Saccharomyces cerevisiae engineering bacterium with high squalene yield as well as construction method and application thereof

Abstract

The invention relates to the technical field of synthetic biology, in particular to a squalene high-yield saccharomyces cerevisiae engineering bacterium and a construction method and application thereof.Saccharomyces cerevisiae CEN.PK.2-1D is used as an original strain, pentose phosphate pathway genes ZWF1, GND1, TAL1 and TKL1 and IDP1 genes of TCA circulation are integrated in a genome of the original strain through homologous recombination, and the squalene high-yield saccharomyces cerevisiae engineering bacterium is obtained. Constructing a dual-channel cofactor supply system to improve the intracellular NADPH level and the NADPH / NADP + ratio; according to the saccharomyces cerevisiae genetic engineering strain Sc-Sq04 constructed by the method disclosed by the invention, the yield of squalene obtained by shake flask fermentation reaches 741.08 + / -28.9 mg / L by further integrating all genes of an MVA way, ERG20 and ERG9 genes, and a new thought is provided for transforming saccharomyces cerevisiae to synthesize terpene compounds and promoting industrial application.

Description

Technical Field

[0001] This invention relates to the field of synthetic biology, specifically to a squalene-producing engineered Saccharomyces cerevisiae strain, its construction method, and its applications. Background Technology

[0002] Squalene, with the chemical formula C30H50, is a linear triterpenoid compound widely found in nature. It is a colorless or slightly yellow oily liquid at room temperature, insoluble in water but readily soluble in organic solvents such as petroleum ether, acetone, and carbon tetrachloride. It possesses high bioactivity, strong antioxidant properties, and good stability, and is widely used in cosmetics, food, and pharmaceuticals. Traditionally, squalene has been extracted primarily from the livers of deep-sea sharks, but this method is unsustainable due to limited resources and ethical concerns regarding animal welfare. Although many plant oils contain some squalene, the content is low and insufficient to meet industrial demands. In contrast, microbial synthesis has become a more economical and sustainable alternative, making large-scale industrialization of squalene possible. Saccharomyces cerevisiae, with its clear genetic information, readily available gene-editing tools, and excellent robustness, has become a host for the production of various natural chemicals, including terpenes. Reportedly, research strategies for synthesizing squalene using Saccharomyces cerevisiae mainly focus on regulating central carbon metabolism to direct metabolic flux to the squalene synthesis pathway, thereby increasing squalene yield.

[0003] The synthesis of one molecule of squalene requires the participation of thirteen molecules of NADPH. Squalene synthesis may cause an imbalance of intracellular cofactors, leading to excessive cellular metabolic load and thus affecting cell activity and productivity. The non-oxidative pentose phosphate pathway and the TCA cycle are important sources of intracellular reducing power and energy regeneration. However, current technologies for synthesizing squalene using Saccharomyces cerevisiae do not construct a dual-channel cofactor supply system by regulating the expression levels of related genes in the non-oxidative pentose phosphate pathway and the TCA cycle. This makes it difficult to effectively alleviate the reducing power imbalance caused by squalene synthesis and further increase squalene yield. Therefore, in view of the above situation, it is urgent to develop a high-yield engineered Saccharomyces cerevisiae strain and its construction method and application to overcome the shortcomings in current practical applications. Summary of the Invention

[0004] The purpose of this invention is to provide a squalene-producing engineered Saccharomyces cerevisiae strain, its construction method, and its application, in order to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: A squalene-producing engineered Saccharomyces cerevisiae strain, using Saccharomyces cerevisiae CEN.PK.2-1D as the starting strain, integrates genes related to the pentose phosphate pathway and genes encoding NADP in the TCA cycle into the genome of the starting strain through synthetic biology modification.+ The modification of genes related to isocitrate dehydrogenase and squalene synthesis pathways can increase intracellular NADPH levels and the NADPH / NADP ratio. + The ratio of the engineered bacteria is used for high-yield squalene production.

[0006] As a further aspect of the present invention: the pentose phosphate pathway-related genes include the gene ZWF1 encoding glucose-6-phosphate dehydrogenase, the gene GND1 encoding 6-phosphate decarboxylase, the gene TAL1 encoding transaldolase, and the gene TKL1 encoding transketolase. The gene encoding NADP+-dependent isocitrate dehydrogenase in the TCA cycle is IDP1; The genes related to the squalene synthesis pathway include all genes of the MVA pathway, the gene ERG20 encoding farnesyl pyrophosphate synthase, and the gene ERG9 encoding squalene synthase.

[0007] As a further aspect of the present invention: the genes of the MVA pathway include ERG10 encoding acetyl-CoA acyltransferase, ERG13 encoding hydroxymethylglutaryl-CoA synthase, tHMG encoding hydroxymethylglutaryl-CoA reductase, ERG12 encoding mevalonate kinase, ERG8 encoding mevalonate phosphate kinase, ERG19 encoding mevalonate pyrophosphate decarboxylase, and IDI1 encoding isopentenyl pyrophosphate isomerase.

[0008] As a further aspect of the present invention: the genes ZWF1, GND1, TAL1, and TKL1 are integrated into the GAL80 site of the genome of the originating strain; The gene IDP1 is integrated into the H1 site of the originating strain genome; In the MVA pathway, ERG10, ERG13, tHMG, and ERG12 are integrated into the ypl062w site of the originating strain genome; In the MVA pathway, ERG8, ERG19, and IDI1 are integrated into the ROX1 site of the originating strain genome; The genes ERG20 and ERG9 are integrated into the GRE3 site of the originating strain genome.

[0009] As a further embodiment of the present invention: the nucleotide sequence of the gene ZWF1 is shown in SEQ ID NO.1, the nucleotide sequence of the gene GND1 is shown in SEQ ID NO.2, the nucleotide sequence of the gene TAL1 is shown in SEQ ID NO.3, the nucleotide sequence of the gene TKL1 is shown in SEQ ID NO.4, the nucleotide sequence of the gene IDP1 is shown in SEQ ID NO.5, the nucleotide sequence of the gene ERG10 is shown in SEQ ID NO.6, the nucleotide sequence of the gene ERG13 is shown in SEQ ID NO.7, the nucleotide sequence of the gene tHMG is shown in SEQ ID NO.8, the nucleotide sequence of the gene ERG12 is shown in SEQ ID NO.9, the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO.10, the nucleotide sequence of the gene ERG19 is shown in SEQ ID NO.11, the nucleotide sequence of the gene IDI1 is shown in SEQ ID NO.12, the nucleotide sequence of the gene ERG20 is shown in SEQ ID NO.13, and the nucleotide sequence of the gene ERG9 is shown in SEQ ID NO.14.

[0010] As a further embodiment of the present invention: the nucleotide sequence of the genomic site GAL80 is shown in SEQ ID NO.15, the nucleotide sequence of the genomic site ypl062w is shown in SEQ ID NO.16, the nucleotide sequence of the genomic site ROX1 is shown in SEQ ID NO.17, and the nucleotide sequence of the genomic site GRE3 is shown in SEQ ID NO.18.

[0011] As a further aspect of the present invention: the pentose phosphate pathway-related genes and the genes encoding NADP in the TCA cycle + The genes for the dependent isocitrate dehydrogenase and the genes related to the squalene synthesis pathway are all expressed by promoters including PGAL1 and PGAL10, wherein the nucleotide sequence of PGAL1 is shown in SEQ ID NO.19 and the nucleotide sequence of PGAL10 is shown in SEQ ID NO.20.

[0012] A method for constructing the above-mentioned squalene-producing engineered Saccharomyces cerevisiae includes the following steps: Using the genome of Saccharomyces cerevisiae CEN.PK.2-1D as a template, the target gene and promoter region were amplified by PCR, and then spliced ​​into a complete recombinant fragment by overlapping extension PCR. The recombinant fragment was integrated into the genome of the starting strain using a lithium acetate conversion method; The successfully constructed engineered strain was validated using the Ura auxotrophic screening marker, the nucleotide sequence of which is shown in SEQ ID NO.21.

[0013] A method for producing squalene using the above-described high-yield squalene-producing Saccharomyces cerevisiae engineered strain includes the following steps: Single colonies of the engineered bacteria were picked and inoculated into YPD medium and cultured at 30℃ and 220 rpm / min for 18-20 h to obtain primary seed culture; The primary seed culture was transferred to YPD medium, and the initial OD600 was controlled at 0.1-0.2. The culture was carried out at 30℃ and 220 rpm / min for 14-16 h to obtain the secondary seed culture. The secondary seed culture was inoculated into fresh YPD medium, and the initial OD600 was controlled to be 0.2. It was cultured at 30℃ and 220 rpm / min for 4-5 days.

[0014] The application of the above-described high-yield squalene-producing Saccharomyces cerevisiae engineered strain, the above-described construction method, or the above-described production method in squalene synthesis.

[0015] Compared with the prior art, the beneficial effects of the present invention are: This invention achieves its goals by overexpressing genes related to the non-oxidative pentose phosphate pathway, namely ZWF1, GND1, TAL1, and TKL1, while simultaneously overexpressing NADP encoded by the TCA cycle. + A system was constructed using the isocitrate dehydrogenase gene IDP1, which is dependent on NADPH, to enhance the total intracellular NADPH level and simultaneously increase the NADPH / NADP ratio. + The ratio of [specific components] mitigated the reduction power shortage caused by intracellular squalene synthesis; This invention systematically enhances the gene expression level of the complete acetyl-CoA to squalene synthesis pathway by overexpressing all genes of the MVA pathway and its downstream squalene synthesis pathway, thereby redirecting carbon metabolism flux to the squalene synthesis pathway. The Saccharomyces cerevisiae genetically engineered strain Sc-Sq04 constructed in this invention achieved a yield of 741.08±28.9 mg / L in shake-flask fermentation, demonstrating greater advantages in squalene production and showing promising application prospects. This invention utilizes synthetic biology to modify Saccharomyces cerevisiae, systematically increasing squalene production from the perspectives of cofactors and metabolic engineering, providing new ideas and directions for the synthesis of terpenoids by Saccharomyces cerevisiae. Attached Figure Description

[0016] Figure 1 The NADPH / NADP ratio of the starting strain and the genetically engineered Saccharomyces cerevisiae strain in shake-flask fermentation in this embodiment of the invention. + Ratio diagram.

[0017] Figure 2 This is a schematic diagram showing the squalene production of the starting strain and the genetically engineered Saccharomyces cerevisiae strain under shake-flask fermentation conditions in an embodiment of the present invention. Detailed Implementation

[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0020] Please see Figure 1 and Figure 2 The present invention provides a high-yield squalene-producing Saccharomyces cerevisiae engineered strain, its construction method and application. The Saccharomyces cerevisiae CEN.PK.2-1D (abbreviated as S.cerevisiae2-1D) is used as the starting strain and is modified by synthetic biology to produce squalene.

[0021] In this embodiment of the invention, all nucleotide sequences involved have been clearly numbered, and the specific correspondence is as follows: the nucleotide sequence of the gene ZWF1 encoding glucose-6-phosphate dehydrogenase is shown in SEQ ID NO.1; the nucleotide sequence of the gene GND1 encoding 6-phosphate decarboxylase is shown in SEQ ID NO.2; the nucleotide sequence of the gene TAL1 encoding transaldolase is shown in SEQ ID NO.3; the nucleotide sequence of the gene TKL1 encoding transketolase is shown in SEQ ID NO.4; and the nucleotide sequence of the gene TKL1 encoding NADP... +The nucleotide sequences of the genes encoding the dependent isocitrate dehydrogenase IDP1 are shown in SEQ ID NO. 5; the nucleotide sequences of the genes encoding acetyl-CoA acyltransferase ERG10 are shown in SEQ ID NO. 6; the nucleotide sequences of the genes encoding hydroxymethylglutaryl-CoA synthase ERG13 are shown in SEQ ID NO. 7; the nucleotide sequences of the genes encoding hydroxymethylglutaryl-CoA reductase tHMG are shown in SEQ ID NO. 8; the nucleotide sequences of the genes encoding mevalonate kinase ERG12 are shown in SEQ ID NO. 9; the nucleotide sequences of the genes encoding phosphate mevalonate kinase ERG8 are shown in SEQ ID NO. 10; the nucleotide sequences of the genes encoding pyrophosphate mevalonate decarboxylase ERG19 are shown in SEQ ID NO. 11; the nucleotide sequences of the genes encoding isopentenyl pyrophosphate isomerase IDI1 are shown in SEQ ID NO. 12; and the nucleotide sequences of the genes encoding farnesyl pyrophosphate synthase ERG20 are shown in SEQ ID NO. 5. The nucleotide sequence of the gene encoding squalene synthase, ERG9, is shown in SEQ ID NO. 13; the nucleotide sequence of the genome integration site GAL80 is shown in SEQ ID NO. 15; the nucleotide sequence of the genome integration site ypl062w is shown in SEQ ID NO. 16; the nucleotide sequence of the genome integration site ROX1 is shown in SEQ ID NO. 17; the nucleotide sequence of the genome integration site GRE3 is shown in SEQ ID NO. 18; the nucleotide sequence of the promoter PGAL1 is shown in SEQ ID NO. 19; the nucleotide sequence of the promoter PGAL10 is shown in SEQ ID NO. 20; and the nucleotide sequence of the Ura auxotroph selection marker is shown in SEQ ID NO. 21. All of the above genes were obtained by PCR amplification using the *Saccharomyces cerevisiae* CEN.PK.2-1D genome as a template, and all genome integration sites were located in the genome of the originating strain.

[0022] The PCR amplification reaction system for obtaining endogenous genes and promoters in this embodiment of the invention is as follows: Table 1. PCR reaction system for endogenous genes and promoters Phanta Flash Master Mix (2×) Template-genome Upstream primers and downstream primers <![CDATA[ddH2O]]> Total volume 50μL 1μL 4 μL each 41μL 100μL The conditions for fragment PCR and overlap extension PCR in the embodiments of the present invention are as follows: (1) Fragment PCR: Pre-denaturation temperature is 95 ℃, time is 3 min; denaturation temperature is 95 ℃, time is 15 s; annealing temperature is 56 ± 2 ℃, time is 15 s; extension temperature is 72 ℃, time is determined according to fragment length and requires 45 s / kb; denaturation-annealing-extension is one cycle, a total of 35 cycles are required; then enter 5 min extension, after which the PCR product is stored at 4 ℃; (2) Overlap extension PCR: The pre-denaturation temperature is 95 ℃ and the time is 3 min; the denaturation temperature is 95 ℃ and the time is 15 s; the annealing temperature is 68 ℃, which is decreased by 0.4 ℃ per cycle and the time is 15 s; the extension temperature is 72 ℃ and the time is determined according to the fragment length, which is 45 s / kb; denaturation-annealing-extension is one cycle, and a total of 35 cycles are required; then the extension is performed for 5 min, and the overlap extension PCR product is stored at 4 ℃ after completion.

[0023] The culture medium in this embodiment of the invention is as follows: (1) YPD culture medium described in the examples: glucose 20 g / L, tryptone 20 g / L, yeast extract 10 g / L; (2) The Dropout mixture described in the example: Take 2g each of glycine, alanine, valine, isoleucine, methionine (methionine), proline, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and adenine and shake thoroughly to mix. (3) The SC-ura medium described in the examples: glucose 20 g / L, amino-free yeast nitrogen source 6.7 g / L, Dropout 2 g / L, tryptophan 0.02 g / L, leucine 0.1 g / L, histidine 0.02 g / L; (4) The SC+5-FOA culture medium described in the examples: glucose 20 g / L, amino-free yeast nitrogen source 6.7 g / L, Dropout 2 g / L, tryptophan 0.02 g / L, leucine 0.1 g / L, histidine 0.02 g / L, uracil 0.02 g / L, 5-FOA 0.1 g / L; All culture media were sterilized by high-pressure steam at 115℃ for 15 minutes before use. After sterilization, they need to be cooled to room temperature before inoculation or storage.

[0024] The lithium acetate yeast conversion method in this embodiment of the invention is as follows: Take a single activated colony and transfer it to a Roche tube containing 5 mL of YPD medium. Activate at 30 °C and 250 rpm for 18 h. Transfer 5% (v / v) to a 50 mL centrifuge tube containing 5 mL of YPD medium. Incubate for 6 h, then remove the tube and place it on ice for 20 min. Take 1 mL of the bacterial suspension and centrifuge at 5000 rpm for 2 min. Discard the supernatant and wash the cells once with physiological saline. Resuspend the cells in 1 mL of 0.1 M lithium acetate solution and place on ice for 15 min. Centrifuge at 5000 rpm for 2 min and discard 900 μL of the supernatant. Add 600 μL of PEG 4000 solution, 100 μL of sterile water, 50 μL of 1 M lithium acetate solution, 50 μL of salmon extract solution, and 20 μL of linearization product sequentially. Mix well by pipetting and aspiration, incubate at 30 °C for 30 min, and then heat shock in a water bath at 42 °C for 15 min. After heat shock, immediately transfer to ice and place for 10 min. Centrifuge at 5000 rpm for 2 min, discard the supernatant, resuspend in 1 mL YPD medium, and incubate at 30 ℃ and 250 rpm for 1 h. After incubation, centrifuge at 5000 rpm for 2 min, discard the supernatant, add 100 μL of sterile water, and spread onto a selection plate.

[0025] Intracellular NADPH content and NADPH / NADP ratio in the embodiments of the present invention + The ratio detection method is as follows: This method uses NADPH / NADP produced by Beyotime Biotechnology Co., Ltd. + Use the WST-8 assay kit (product number S0179) for testing. Ensure NADPH / NADP levels are within acceptable limits before testing. + The extraction buffer, G6PDH working solution, and chromogenic solution were all within their expiration dates and stored under conditions that met the kit requirements. 300 μL of the fermentation broth was pipetted and centrifuged at 4°C and 8000 rpm for 2 min. After collecting the cells, NADPH / NADP was added. + Add 1 mL of the extraction solution (product number S0179-4) and gently pipette to promote full cell lysis; then centrifuge at 4℃ and 12000 rpm for 2 min, and take the supernatant as the sample to be tested.

[0026] (1) NADP in the sample + Determination of total NADPH: Pipette 50 μL of the sample to be tested into a 96-well plate, add 100 μL of LG6PDH working solution (product number S0179-1) and mix thoroughly; incubate at 37°C in the dark for 10 minutes to allow the NADP in the sample to rise. +All NADP+ and NADPH are converted to NADPH. Mix the chromogenic solution (product number S0179-2) appropriately, then add 10 μL of the solution to each well, mix well, and incubate at 37°C in the dark for 10-20 minutes. Measure the absorbance of the sample at 450 nm. This absorbance value is the sum of the NADP+ and NADPH content in the sample.

[0027] (2) NADPH / NADP in the sample + Determination of the ratio: Pipette 100-200 μL of the sample to be tested into a centrifuge tube and heat in a 60°C water bath for 30 minutes to decompose NADP. + ; Pipette 50 μL of the heated sample into a 96-well plate, add 100 μL of LG6PDH working solution (product number S0179-1) and mix thoroughly; incubate at 37°C in the dark for 10 minutes to allow the NADP in the sample to rise. + All NADPH is converted to NADPH; mix the chromogenic solution (product number S0179-2) appropriately, then add 10 μL of the chromogenic solution to each well, mix well, and incubate at 37°C in the dark for 10-20 minutes. Measure the absorbance of the sample at 450 nm. This absorbance value is the NADPH content in the sample. Subtracting this from the total amount used gives the NADP+ content, thus obtaining the NADPH / NADP+ ratio. + ratio.

[0028] The squalene extraction method in this embodiment of the invention is as follows: Collect 1 mL of the fermentation cell suspension by centrifugation at 8000 rpm for 2 min at 4 °C. Wash the cells with 1 mL of physiological saline and centrifuge at 8000 rpm for 2 min at 4 °C. Add 3 M NaOH to the cells and boil at 100 °C for 3 min, then centrifuge at 8000 rpm for 2 min at 4 °C to collect the cells. Wash the cells thoroughly with 1 mL of physiological saline and centrifuge at 8000 rpm for 2 min at 4 °C. Add 1 mL of acetone to the cells and vortex to ensure the centrifuge tube is well sealed to prevent acetone evaporation from affecting the extraction efficiency. Vortex for 30-40 min and centrifuge at 12000 rpm for 5 min at 4 °C. Collect the supernatant acetone extract, dilute appropriately, and transfer to a brown liquid chromatography bottle for analysis.

[0029] The method for detecting squalene content in this embodiment of the invention is as follows: The detection was performed using a Waters 2695 liquid chromatograph, a 2998 UV detector, and a Waters (250×4.6mm, 5μm) C18 column. Prior to detection, the liquid chromatograph underwent system suitability validation to ensure that the column performance, mobile phase purity, and detector sensitivity met the detection requirements. The liquid chromatographic conditions were: isocratic elution, mobile phase of 60% methanol and 40% acetonitrile, flow rate of 1.2 mL / min, detection wavelength of 205 nm, column temperature of 40℃, and detection time of 20 min.

[0030] Example 1: Method for constructing engineered brewing yeast for producing squalene; (1) Constructing the Saccharomyces cerevisiae genetically engineered strain Sc-Sq01 that regulates the pentose phosphate pathway, including the following steps: Using the Saccharomyces cerevisiae genome as a template, and GAL80 R -U is an uplink, GAL80 R -D is used as a downscript to amplify the homologous arm approximately 700 bp upstream of gene locus GAL80 (nucleotide sequence shown in SEQ ID NO.15); using GAL80 F -U is an uplink, GAL80 F Using -D as a downlink, amplification yielded a homologous arm approximately 700 bp downstream of gene locus GAL80 (nucleotide sequence shown in SEQ ID NO. 15); using ZWF1-U as an uplink and ZWF1-D as a downlink, amplification yielded gene fragment ZWF1 (nucleotide sequence shown in SEQ ID NO. 1); using GND1-U as an uplink and GND1-D as a downlink, amplification yielded gene fragment GND1 (nucleotide sequence shown in SEQ ID NO. 2); using TAL1-U as an uplink and TAL1-D as a downlink, amplification yielded gene fragment TAL1 (nucleotide sequence shown in SEQ ID NO. 3); using TKL1-U as an uplink and TKL1-D as a downlink, amplification yielded gene fragment TKL1 (nucleotide sequence shown in SEQ ID NO. 4); using P... GAL1 / 10 -U is an upstroke, P GAL1 / 10 -D is a downscript, which amplifies to obtain the promoter fragment P. GAL1 / 10 (including P) GAL1 and P GAL10 The nucleotide sequences are shown in SEQ ID NO.19 and SEQ ID NO.20, respectively; the auxotrophic gene Ura (nucleotide sequence shown in SEQ ID NO.21) was obtained through artificial synthesis. Subsequently, homologous arms, promoters, and gene fragments were assembled using overlap extension PCR to obtain the recombinant gene fragment GAL80. F -ZWF1-P GAL1 / 10 -GND1-TAL1-P GAL1 / 10-TKL1-GAL80 R -Ura-GAL80 R ; The recombinant gene fragment was knocked into the genome of the originating strain using the lithium acetate yeast transformation method. Single colonies of the obtained positive transformants were inoculated into SC-ura liquid medium and cultured at 30°C for 16-18 hours. The colonies were then spread onto 5-FOA solid medium until correct single colonies grew, yielding the Saccharomyces cerevisiae genetically engineered strain Sc-Sq01.

[0031] (2) Constructing the Saccharomyces cerevisiae genetically engineered strain Sc-Sq02 that regulates the TCA cycle, including the following steps: Using the Saccharomyces cerevisiae genome as a template, with H1 R -U is an uplink, H1 R -D is used as a downlink to amplify the approximately 700 bp homologous arm upstream of gene locus H1 (Chromosome I); using H1 F -U is an uplink, H1 F Using -D as a downlink, amplification yields a homologous arm approximately 700 bp downstream of gene locus H1 (Chromosome I); using IDP1-U as an uplink and IDP1-D as a downlink, amplification yields gene fragment IDP1 (nucleotide sequence shown in SEQ ID NO. 5); using P... GAL1 -U is an upstroke, P GAL1 -D is a downscript, which amplifies to obtain the promoter fragment P. GAL1 (The nucleotide sequence is shown in SEQ ID NO.19); the auxotrophic gene Ura (nucleotide sequence is shown in SEQ ID NO.21) was obtained through artificial synthesis; Subsequently, homologous arms, promoters, and gene fragments were assembled using overlap extension PCR to obtain the recombinant gene fragment H1. F -P GAL1 -IDP1-H1 R -Ura-H1 R ; The recombinant gene fragment was knocked into the genome of the Saccharomyces cerevisiae genetically engineered strain Sc-Sq01 using the lithium acetate yeast transformation method. Single colonies of the obtained positive transformants were inoculated into SC-ura liquid medium and cultured at 30°C for 16-18 h. The colonies were then plated onto 5-FOA solid medium until correct single colonies grew, thus obtaining the Saccharomyces cerevisiae genetically engineered strain Sc-Sq02.

[0032] (3) Constructing a Saccharomyces cerevisiae genetically engineered strain Sc-Sq03 overexpressing the MVA pathway, including the following steps: Using the Saccharomyces cerevisiae genome as a template, with ypl062w R -U is an uplink, ypl062wR -D is used as a downscript to amplify the homologous arm approximately 700 bp upstream of the gene locus ypl062w (nucleotide sequence shown in SEQ ID NO.16); using ypl062w F -U is an uplink, ypl062w F Using -D as a downlink, amplification yielded a homologous arm approximately 700 bp downstream of the gene locus ypl062w (nucleotide sequence shown in SEQ ID NO. 16); using ERG10-U as an uplink and ERG10-D as a downlink, amplification yielded the gene fragment ERG10 (nucleotide sequence shown in SEQ ID NO. 6); using ERG13-U as an uplink and ERG13-D as a downlink, amplification yielded the gene fragment ERG13 (nucleotide sequence shown in SEQ ID NO. 7); using tHMG-U as an uplink and tHMG-D as a downlink, amplification yielded the gene fragment tHMG (nucleotide sequence shown in SEQ ID NO. 8); using ERG12-U as an uplink and ERG12-D as a downlink, amplification yielded the gene fragment ERG12 (nucleotide sequence shown in SEQ ID NO. 9); the auxotrophic gene Ura (nucleotide sequence shown in SEQ ID NO. 21) was obtained through artificial synthesis. Subsequently, the second module genes ERG8, ERG19, and IDI1 of the MVA pathway were introduced into the aforementioned Saccharomyces cerevisiae genetically engineered strain. Using the Saccharomyces cerevisiae genome as a template, and employing ROX1... R -U is an uplink, ROX1 R -D is a downscript, amplifying approximately 700 bp upstream of the gene locus ROX1 (nucleotide sequence shown in SEQ ID NO.17); using ROX1 F -U is an uplink, ROX1 F Using -D as a downlink, the amplification yielded a homologous arm approximately 700 bp downstream of gene locus ROX1 (nucleotide sequence shown in SEQ ID NO. 17); using ERG8-U as an uplink and ERG8-D as a downlink, the amplification yielded gene fragment ERG8 (nucleotide sequence shown in SEQ ID NO. 10); using ERG19-U as an uplink and ERG19-D as a downlink, the amplification yielded gene fragment ERG19 (nucleotide sequence shown in SEQ ID NO. 11); using IDI1-U as an uplink and IDI1-D as a downlink, the amplification yielded gene fragment IDI1 (nucleotide sequence shown in SEQ ID NO. 12); the auxotrophic gene Ura (nucleotide sequence shown in SEQ ID NO. 21) was obtained through artificial synthesis. Subsequently, homologous arms, promoters, and gene fragments were assembled using overlap extension PCR to obtain the recombinant gene fragment ypl062w. F -ERG10-PGAL1 / 10 -ERG13-tHMG-P GAL1 / 10 -IDI1-ypl062w R -Ura-ypl062w R ; The recombinant gene fragment was knocked into the genome of the Saccharomyces cerevisiae genetically engineered strain Sc-Sq02 using the lithium acetate yeast transformation method. Single colonies of the obtained positive transformants were inoculated into SC-ura liquid medium and cultured at 30°C for 16-18 hours. The colonies were then plated onto 5-FOA solid medium until correct single colonies grew, and intermediate strains of the Saccharomyces cerevisiae genetically engineered strain were obtained through screening.

[0033] Subsequently, homologous arms, promoters, and gene fragments were assembled using overlap extension PCR to obtain the recombinant gene fragment ROX1. F -ERG8-P GAL1 / 10 -ERG19-P GAL1 -IDI1-ROX1 R -Ura-ROX1 R ; The recombinant gene fragment was knocked into the genome of an intermediate strain using a lithium acetate yeast transformation method. Single colonies of the obtained positive transformants were inoculated into SC-ura liquid medium and cultured at 30°C for 16-18 hours. The colonies were then plated onto 5-FOA solid medium until correct single colonies grew, and the resulting Saccharomyces cerevisiae genetically engineered strain Sc-Sq03 was obtained through screening.

[0034] (4) Constructing a Saccharomyces cerevisiae genetically engineered strain Sc-Sq04 that overexpresses the squalene synthesis pathway, including the following steps: Using the Saccharomyces cerevisiae genome as a template, with GRE3 R -U is an upquote, GRE3 R -D is a downscript, amplifying approximately 700 bp upstream of the gene locus GRE3 (nucleotide sequence shown in SEQ ID NO.18); using GRE3 F -U is an upquote, GRE3 F Using -D as a downlink, the homologous arm approximately 700 bp downstream of gene locus GRE3 (nucleotide sequence shown in SEQ ID NO. 18) was amplified; using ERG20-U as an uplink and ERG20-D as a downlink, gene fragment ERG20 (nucleotide sequence shown in SEQ ID NO. 13) was amplified; using ERG9-U as an uplink and ERG9-D as a downlink, gene fragment ERG9 (nucleotide sequence shown in SEQ ID NO. 14) was amplified; the auxotrophic gene Ura (nucleotide sequence shown in SEQ ID NO. 21) was obtained through artificial synthesis. Subsequently, homologous arms, promoters, and gene fragments were assembled using overlap extension PCR to obtain the recombinant gene fragment GRE3. F -ERG20-P GAL1 / 10 -ERG9-GRE3 R -Ura-GRE3 R ; The recombinant gene fragment was knocked into the genome of the Saccharomyces cerevisiae genetically engineered strain Sc-Sq03 using the lithium acetate yeast transformation method. Single colonies of the obtained positive transformants were inoculated into SC-ura liquid medium and cultured at 30°C for 16-18 h. The colonies were then plated onto 5-FOA solid medium until correct single colonies grew, and the Saccharomyces cerevisiae genetically engineered strain Sc-Sq04 was obtained through screening.

[0035] The primer sequences used in this embodiment are shown in Table 2: Table 2 Primer sequences Primer name Primer sequence (5'-3') <![CDATA[GAL80 R -U]]> Ctctgccatggcaaagaatgctttc (SEQ ID NO.22) <![CDATA[GAL80 R -D]]> gagtggaaagaacgggaaaccaactatc (SEQ ID NO.23) <![CDATA[GAL80 F -U]]> ccagtgcagcgaacgttataaaaacg (SEQ ID NO. 24) <![CDATA[GAL80 F -D]]> cctggaaggatagctttggtgcttg (SEQ ID NO.25) ZWF1-U atgagtgaaggccccgtcaaattc (SEQ ID NO.26) ZWF1-D ctaattatccttcgtatcttctggcttagtcac (SEQ ID NO.27) GND1-U atgtctgctgatttcggtttgattgg (SEQ ID NO.28) GND1-D ttaagcttggtatgtagaggaagaaacattacc (SEQ ID NO.29) TAL1-U atgtctgaaccagctcaaaagaaacaaaag (SEQ ID NO.30) TAL1-D cgacttgattgaaaagaaagttaccgcttaa (SEQ ID NO.31) TKL1-U atgactcaattcactgacattgataagctagc (SEQ ID NO.32) TKL1-D caagctaatttctcctttgaaaaaagctttctaa (SEQ ID NO.33) <![CDATA[H1 R -U]]> ccagtaattgggttccaaacaag (SEQ ID NO.34) <![CDATA[H1 R -D]]> gaagacatttcattcgcttctcagatc (SEQ ID NO.35) <![CDATA[H1 F -U]]> acacctcggacatggatttgtacatg (SEQ ID NO.36) <![CDATA[H1 F -D]]> gtgagtcgtaatcaggtgaatcatgtggg (SEQ ID NO.37) IDP1-U atgagtatgttatctgaagattattttccacctctcg (SEQ ID NO.38) IDP1-D gactacaaaaagaaatcaagtcgatcgagtaa (SEQ ID NO.39) <![CDATA[ypl062w R -U]]> gctgaaagactatgttgaaggtaacttgcc (SEQ ID NO.40) <![CDATA[ypl062w R -D]]> cgctaacagacaatagacacactatcagg(SEQ ID NO.41) <![CDATA[ypl062w F -U]]> caagacaagcaaccttgttagtcagctc(SEQ ID NO.42) <![CDATA[ypl062w F -D]]> cggtgtctgtggtcaaattattccatgg(SEQ ID NO.43) ERG10-U atgtctcagaacgtttacattgtatcgac(SEQ ID NO.44) ERG10-D gtgcttcctctattgtcattgaaaagatatga(SEQ ID NO.45) ERG13-U atgaaactctcaactaaactttgttggtg(SEQ ID NO.46) ERG13-D agaagatcttacgatgttaaaaataa (SEQ ID NO.47) tHMG-U atggaccaattggttaagactgaagttac(SEQ ID NO.48) tHMG-D gacggttctgttacttgtatcaagtcttaa(SEQ ID NO.49) ERG12-U atgtcattaccgttcttaacttctgca(SEQ ID NO.50) ERG12-D ggaaacacgaatttaccatggacttcataa(SEQ ID NO.51) <![CDATA[ROX1 R -U]]> ggtatcggaaccggctcttgttc(SEQ ID NO.52) <![CDATA[ROX1 R -D]]> cacaaaagaacgcagttagacaatcaac(SEQ ID NO.53) <![CDATA[ROX1 F -U]]> gcatttggctcctgtttaataaaagtttaaatcg(SEQ ID NO.54) <![CDATA[ROX1 F -D]]> cttttacaaagacttccagttcataatctcgg(SEQ ID NO.55) ERG8-U atgtcagagttgagagccttcagtg(SEQ ID NO.56) ERG8-D agatccggaaacttatcttgataaataact(SEQ ID NO.57) ERG19-U atgaccgtttacacagcatccg(SEQ ID NO.58) ERG19-D gcaaagactggtctaccaaaggaataa (SEQ ID NO.59) IDI1-U atgactgccgacaaatagtatgc(SEQ ID NO.60) IDI1-D atgacaggcaaattcatagaatgctataa (SEQ ID NO.61) <![CDATA[GRE3 R -U]]> ctaccacctggtggaacatcctagaac (SEQ ID NO.62) <![CDATA[GRE3 R -D]]> gttgtcagtgcaatccttcaagacg (SEQ ID NO.63) <![CDATA[GRE3 F -U]]> ccagccagtaaaatccatactcaacg (SEQ ID NO.64) <![CDATA[GRE3 F -D]]> gacagcgaaacctgagaaacttaactg (SEQ ID NO.65) ERG20-U atggcttcagaaaaagaaattaggagaga (SEQ ID NO.66) ERG20-D ttgaacaaagtttacaagagaagcaaatag (SEQ ID NO.67) ERG9-U atgggaaagctattacaattggcattg (SEQ ID NO.68) ERG9-D attatatatacactttacacagagcgtga (SEQ ID NO.6�) <![CDATA[P GAL1 / 10 -U]]> ttatattgaattttcaaaaattcttactttttttttgg (SEQ ID NO.70) <![CDATA[P GAL1 / 10 -D]]> ctatactttaacgtcaaggagaaaaaactata (SEQ ID NO.71) <![CDATA[P GAL1 -U]]> ggaaatgtaaagagccccattatcttagc (SEQ ID NO.72) <![CDATA[P GAL1 -D]]> ctatactttaacgtcaaggagaaaaaactataG (SEQ ID NO.73) Example 2: Production of squalene using the genetically engineered Saccharomyces cerevisiae strain Sc-Sq04 under shake-flask fermentation conditions, including the following steps: Single colonies of the genetically engineered Saccharomyces cerevisiae strain Sc-Sq04 were picked and placed into 5m LYPD liquid medium. Before inoculation, it was ensured that the single colonies on the plate had normal morphology and no signs of contamination by other microorganisms. The culture was carried out at 30℃ and 220rpm / min for 20h to prepare the primary seed liquid. The prepared primary seed culture was inoculated into 50 ml LYPD liquid medium at an inoculation ratio of 1% and cultured at 30℃ and 220 rpm / min for 16 h to prepare the secondary seed culture. The prepared secondary seed culture was inoculated into an Erlenmeyer flask containing 50 ml of LYPD liquid medium. After inoculation, the Erlenmeyer flask was shaken quickly to ensure that the seed culture was evenly dispersed in the medium. The initial OD600 of the fermentation suspension was controlled to be 0.2. The culture was then carried out at 30°C and 220 rpm / min for 120 h to obtain the fermentation broth.

[0036] The intracellular reducing power level of the genetically engineered strain Sc-Sq04 was evaluated based on the intracellular NADPH content and NADPH / NADP+ ratio detection method described above (the sequences of each integrated gene in this strain are shown in SEQ ID NO. 1-14, the integration site sequences are shown in SEQ ID NO. 15-18, and the promoter sequences are shown in SEQ ID NO. 19-20).

[0037] like Figure 1 As shown, after 120 h of shake-flask fermentation, the intracellular NADPH / NADP+ ratio of the Saccharomyces cerevisiae genetically engineered strain Sc-Sq04 was 0.61, which is similar to that of the original strain.

[0038] The squalene production capacity of the Saccharin-producing yeast strain Sc-Sq04 was evaluated based on the squalene extraction and detection methods described above (the sequences of each integrated gene in this strain are shown in SEQ ID NO. 1-14, the integration site sequences are shown in SEQ ID NO. 15-18, and the promoter sequences are shown in SEQ ID NO. 19-20).

[0039] like Figure 2 As shown, the squalene yield of the Saccharomyces cerevisiae genetically engineered strain Sc-Sq04 reached 741.08±28.9 mg / L after 120 h of shake-flask fermentation.

[0040] In summary, the results of this embodiment show that the intracellular NADPH / NADP+ ratio of the recombinant Saccharomyces cerevisiae intermediate strain after overexpression of the pentose phosphate pathway was 0.79, which was 14.5% higher than that of the starting strain. On this basis, after overexpression of the gene regulating the TCA cycle, the intracellular NADPH / NADP+ ratio was 0.84. This indicates that the simultaneous regulation of the pentose phosphate pathway in the cytoplasm and the TCA cycle in the mitochondria has a synergistic effect on increasing the intracellular NADPH / NADP+ ratio.

[0041] This invention promotes the conversion of NADP+ to NADPH by overexpressing the genes ZWF1 (encoding glucose-6-phosphate dehydrogenase) and GND1 (encoding 6-phosphate decarboxylase). Further enhancement of the pentose phosphate pathway is achieved by overexpressing the genes TAL1 (encoding transaldolase) and TKL1 (encoding transketolase). Subsequently, overexpression of isocitrate dehydrogenase enhances the catalytic conversion of isocitrate to α-ketoglutarate, a process that is simultaneously dependent on NADP+ and promotes NADPH regeneration. Experimental results in this invention show that overexpression of the pentose phosphate pathway and further overexpression of the NADP+-dependent isocitrate oxidation pathway in the TCA cycle gradually increases the intracellular total NADPH level and the NADPH / NADP ratio. + The ratio of squalene was increased, which effectively improved the yield of squalene and provided a new approach for modifying Saccharomyces cerevisiae to synthesize terpenoids.

[0042] Appendix: Nucleotide Sequence List; All nucleotide sequences (SEQ ID NO. 1-21) involved in the embodiments of this invention are as follows. The sequence information can be used for PCR primer design, recombinant fragment sequencing verification, and sequence alignment during the construction of engineered bacteria: SEQ ID NO.1 (Gene ZWF1 encoding glucose-6-phosphate dehydrogenase): SEQ ID NO.2 (GND1, encoding 6-phosphate decarboxylase): SEQ ID NO.3 (the gene TAL1 encoding transaldolase): SEQ ID NO.4 (Gene TKL1 encoding transketolase): SEQ ID NO.5 (encoding NADP) + The gene IDP1 of isocitrate dehydrogenase (dependent on this enzyme) SEQ ID NO.6 (Gene ERG10 encoding acetyl-CoA acyltransferase): SEQ ID NO.7 (Gene ERG13 encoding hydroxymethylglutaryl-CoA synthase): SEQ ID NO.8 (the gene tHMG encoding hydroxymethylglutaryl-CoA reductase): SEQ ID NO.9 (Gene ERG12 encoding mevalonate kinase): SEQ ID NO.10 (Gene ERG8 encoding mevalonate kinase): SEQ ID NO.11 (Gene ERG19 encoding mevalonate pyrophosphate decarboxylase): SEQ ID NO.12 (gene IDI1 encoding isopentenyl pyrophosphate isomerase): ATGACTGCCGACAACAATAGTATGCCCCATGGTGCAGTATCTAGTTACGCCAAATTAGTGCAAAACCAAACACCTGAAGACATTTTGGAAGAGTTTCCTGAAATTATTCCATTACAACAAAGACCTAATACCCGATCTAGTGAGACGTCAAATGACGAAAGCGGAGAAACATGTTTTTCTGGTCATGATGAGGAGCAAATTAAGTTAATGAATGAAAATTGTATTGTTTTGGATTGGGACGATAATGCTATTGGTGCCGGTACCAAGAAAGTTTGTCATTTAATGGAAAATATTGAAAAGGGTTTACTACATCGTGCATTCTCCGTCTTTATTTTCAATGAACAAGGTGAATTACTTTTACAACAAAGAGCCACTGAAAAAATAACTTTCCCTGATCTTTGGACTAACACATGCTGCTCTCATCCACTATGTATTGATGACGAATTAGGTTTGAAGGGTAAGCTAGACGATAAGATTAAGGGCGCTATTACTGCGGCGGTGAGAAAACTAGATCATGAATTAGGTATTCCAGAAGATGAAACTAAGACAAGGGGTAAGTTTCACTTTTTAAACAGAATCCATTACATGGCACCAAGCAATGAACCATGGGGTGAACATGAAATTGATTACATCCTATTTTATAAGATCAACGCTAAAGAAAACTTGACTGTCAACCCAAACGTCAATGAAGTTAGAGACTTCAAATGGGTTTCACCAAATGATTTGAAAACTATGTTTGCTGACCCAAGTTACAAGTTTACGCCTTGGTTTAAGATTATTTGCGAGAATTACTTATTCAACTGGTGGGAGCAATTAGATGACCTTTCTGAAGTGGAAAATGACAGGCAAATTCATAGAATGCTATAA; SEQ ID NO.13 (gene ERG20 encoding farnesyl pyrophosphate synthase): SEQ ID NO.14 (Gene ERG9 encoding squalene synthase): SEQ ID NO.15 (Saccharomyces cerevisiae CEN.PK.2-1D genome integration site GAL80): SEQ ID NO.16 (Saccharomyces cerevisiae CEN.PK.2-1D genome integration site ypl062w): ATGATAGAATTGGATTATGTAAAAGGTGAAGATACCATTGTAGAAGCAACCAGCACGTCGCCGTGGCTGATGAGGTCTCCTCTTGCCCGGGCCGCAGAAAAGAGGGGCAGTGGCCTGTTTTTCGACATAAATGAGGGGCATGGCCAGCACCGAGACGTCATTGTTGCATATGGCGTATCCAAGCCGAAACGGCGCTCGCCTCA TCCCCACGGGAATAAGGCAGCCGACAAAAGAAAAACGACCGAAAAGGAACCAGAAAGAAAAAAGAGGGTGGGCGCCGCGGACGTGTAAAAAGATATGCATCCAGCTTCTATATCGCTTTAACTTTACCGTTTTGGGCATCGGGAACGTATGTAACATTGATCTCCTTCTGGGAACGGTGAGTGCAACGAATGCGATATAG; SEQ ID NO.17 (Saccharomyces cerevisiae CEN.PK.2-1D genome integration site ROX1): SEQ ID NO.18 (Saccharomyces cerevisiae CEN.PK.2-1D genome integration site GRE3): ATGTCTTCACTGGTTACTCTTAATAACGGTCTGAAAATGCCCCTAGTCGGCTTAGGGTGCTGGAAAATTGACAAAAAAGTCTGTGCGAATCAAATTTATGAAGCTATCAAATTAGGCTACCGTTTATTCGATGGTGCTTGCGACTACGGCAACGAAAAGGAAGTTGGTGAAGGTATCAGGAAAGCCATCTCCGAAGGTCTTGTTTCTAGAAAGGATATATTTGTTGTTTCAAAGTTATGGAACAATTTTCACCATCCTGATCATGTAAAATTAGCTTTAAAGAAGACCTTAAGCGATATGGGACTTGATTATTTAGACCTGTATTATATTCACTTCCCAATCGCCTTCAAATATGTTCCATTTGAAGAGAAATACCCTCCAGGATTCTATACGGGCGCAGATGACGAGAAGAAAGGTCACATCACCGAAGCACATGTACCAATCATAGATACGTACCGGGCTCTGGAAGAATGTGTTGATGAAGGCTTGATTAAGTCTATTGGTGTTTCCAACTTTCAGGGAAGCTTGATTCAAGATTTATTACGTGGTTGTAGAATCAAGCCCGTGGCTTTGCAAATTGAACACCATCCTTATTTGACTCAAGAACACCTAGTTGAGTTTTGTAAATTACACGATATCCAAGTAGTTGCTTACTCCTCCTTCGGTCCTCAATCATTCATTGAGATGGACTTACAGTTGGCAAAAACCACGCCAACTCTGTTCGAGAATGATGTAATCAAGAAGGTCTCACAAAACCATCCAGGCAGTACCACTTCCCAAGTATTGCTTAGATGGGCAACTCAGAGAGGCATTGCCGTCATTCCAAAATCTTCCAAGAAGGAAAGGTTACTTGGCAACCTAGAAATCGAAAAAAAGTTCACTTTAACGGAGCAAGAATTGAAGGATATTTCTGCACTAAATGCCAACATCAGATTTAATGATCCATGGACCTGGTTGGATGGTAAATTCCCCACTTTTGCCTGA; SEQ ID NO.19 (Promoter PGAL1): TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATT; SEQ ID NO.20 (Promoter PGAL10): GTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATA; SEQ ID NO.21 (Ura auxotrophic selection marker): .

[0043] It should be noted that, in this invention, although the specification describes the embodiments, not every embodiment contains only one independent technical solution. This way of describing the specification is only for clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A squalene-producing engineered Saccharin yeast strain, characterized in that, Using *Saccharomyces cerevisiae* CEN.PK.2-1D as the starting strain, pentose phosphate pathway-related genes and NADP-encoding genes in the TCA cycle were integrated into the genome of the starting strain through synthetic biology modifications. + The modification of genes related to isocitrate dehydrogenase and squalene synthesis pathways can increase intracellular NADPH levels and the NADPH / NADP ratio. + The ratio of the engineered bacteria is used for high-yield squalene production.

2. The squalene-producing high-yield Saccharin-producing engineered Saccharin yeast strain according to claim 1, characterized in that, The pentose phosphate pathway-related genes include ZWF1, which encodes glucose-6-phosphate dehydrogenase; GND1, which encodes 6-phosphate decarboxylase; TAL1, which encodes transaldolase; and TKL1, which encodes transketolase. The gene encoding NADP+-dependent isocitrate dehydrogenase in the TCA cycle is IDP1; The genes related to the squalene synthesis pathway include all genes of the MVA pathway, the gene ERG20 encoding farnesyl pyrophosphate synthase, and the gene ERG9 encoding squalene synthase.

3. The squalene-producing high-yield Saccharin-producing engineered Saccharin yeast strain according to claim 2, characterized in that, The MVA pathway includes all genes encoding acetyl-CoA acyltransferase (ERG10), hydroxymethylglutaryl-CoA synthase (ERG13), hydroxymethylglutaryl-CoA reductase (tHMG), mevalonate kinase (ERG12), mevalonate phosphate kinase (ERG8), mevalonate pyrophosphate decarboxylase (ERG19), and isopentenyl pyrophosphate isomerase (IDI1).

4. The squalene-producing high-yield Saccharin-producing engineered Saccharin yeast strain according to claim 2, characterized in that, The genes ZWF1, GND1, TAL1, and TKL1 are integrated into the GAL80 site of the genome of the starting strain; The gene IDP1 is integrated into the H1 site of the originating strain genome; In the MVA pathway, ERG10, ERG13, tHMG, and ERG12 are integrated into the ypl062w site of the originating strain genome; In the MVA pathway, ERG8, ERG19, and IDI1 are integrated into the ROX1 site of the originating strain genome; The genes ERG20 and ERG9 are integrated into the GRE3 site of the originating strain genome.

5. The squalene-producing high-yield Saccharomyces cerevisiae engineered strain according to claim 2, characterized in that, The nucleotide sequences of the following genes are shown in SEQ ID NO.1: ZWF1, GND1, TAL1, TKL1, IDP1, ERG10, 1HMG, ERG12, ERG13, 1HMG, ERG19, IRG11, IRG12, ERG20, and ERG9.

6. The squalene-producing high-yield Saccharin-producing engineered Saccharin yeast strain according to claim 4, characterized in that, The nucleotide sequence of the genomic site GAL80 is shown in SEQ ID NO.15, the nucleotide sequence of the genomic site ypl062w is shown in SEQ ID NO.16, the nucleotide sequence of the genomic site ROX1 is shown in SEQ ID NO.17, and the nucleotide sequence of the genomic site GRE3 is shown in SEQ ID NO.

18.

7. The squalene-producing high-yield Saccharin-producing engineered Saccharin yeast strain according to claim 1, characterized in that, The pentose phosphate pathway-related genes and NADP encoded in the TCA cycle + The genes for the dependent isocitrate dehydrogenase and the genes related to the squalene synthesis pathway are all expressed by promoters including PGAL1 and PGAL10, wherein the nucleotide sequence of PGAL1 is shown in SEQ ID NO.19 and the nucleotide sequence of PGAL10 is shown in SEQ ID NO.

20.

8. A method for constructing a high-yield squalene-producing Saccharomyces cerevisiae engineered strain according to any one of claims 1-7, characterized in that, Includes the following steps: Using the genome of Saccharomyces cerevisiae CEN.PK.2-1D as a template, the target gene and promoter region were amplified by PCR, and then spliced ​​into a complete recombinant fragment by overlapping extension PCR. The recombinant fragment was integrated into the genome of the starting strain using a lithium acetate conversion method; The successfully constructed engineered strain was validated using the Ura auxotrophic screening marker, the nucleotide sequence of which is shown in SEQ ID NO.

21.

9. A method for producing squalene using the engineered strain of *Saccharomyces cerevisiae* according to any one of claims 1-7, characterized in that, Includes the following steps: Single colonies of the engineered bacteria were picked and inoculated into YPD medium and cultured at 30℃ and 220 rpm / min for 18-20 h to obtain primary seed culture; The primary seed culture was transferred to YPD medium, and the initial OD600 was controlled at 0.1-0.

2. The culture was carried out at 30℃ and 220 rpm / min for 14-16 h to obtain the secondary seed culture. The secondary seed culture was inoculated into fresh YPD medium, and the initial OD600 was controlled at 0.

2. It was cultured at 30℃ and 220 rpm / min for 120 h.

10. The application of the squalene-producing high-yield Saccharomyces cerevisiae engineered strain according to any one of claims 1-7, or the construction method according to claim 8, or the production method according to claim 9 in the synthesis of squalene.

Images