Cas12 protein and application thereof

Abstract

The invention relates to a Cas12 protein and application thereof, the amino acid sequence of the Cas12 protein comprises or is a sequence having at least 50% sequence identity compared with SEQ ID NO: 1, and the amino acid sequence of the Cas12 protein comprises or is a sequence having amino acid difference on one, two or more sites compared with SEQ ID NO: 1. The amino acid sequence of the Cas12 protein comprises or is an amino acid sequence having at least 50% identity compared with SEQ ID NO: 18, and the PAM sequence recognized by the Cas12 protein is A. The gene editing efficiency of the natural Cas12 protein in mammalian cells is improved by carrying out rational and irrational mutation on the amino acid sequence of the natural Cas12 protein. The Cas12 protein is higher in editing efficiency and / or lower in off-target rate, and the PAM sequence of the Cas12 protein is a single A basic group, so that the Cas12 protein can be used for editing a plurality of target sequences which are not easy to edit originally, and the editable range is greatly expanded.

Description

A Cas12 protein and its application

[0001] This application claims priority to Chinese Patent Application No. 2023109221047 filed on July 25, 2023, and Chinese Patent Application No. 202311049437X filed on August 18, 2023. The entire contents of the aforementioned Chinese patent applications are incorporated herein by reference. Technical Field

[0002] The present disclosure relates to the field of CRISPR gene editing, and specifically to a Cas12 protein and its applications. Background Art

[0003] The CRISPR-Cas system is an adaptive immune defense developed over the long evolutionary process by bacteria and archaea, used to combat invading viruses and foreign DNA. SpCas9, derived from the CRISPR / Cas9 system of Streptococcus pyogenes, is widely used in genetic engineering due to its simplicity and high efficiency. Cas9 is not the only type of Cas9; in 2015, Cas12 was discovered in bacteria from the Acidaminococcus and Lachnospiraceae families.

[0004] Currently, more and more Cas12 subtypes have been discovered. However, many researchers in this field are still working to find new Cas12 proteins.

[0005] Summary of the Invention

[0006] The amino acid sequence of the wild-type Cas12 protein selected in the present invention is shown in SEQ ID NO: 1 (1045aa, from CN111757889B), on the basis of which rational and irrational mutations were performed.

[0007] A technical solution provided by the present invention is: a Cas12 protein, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 50% sequence identity compared to SEQ ID NO: 1, and the amino acid sequence of the Cas12 protein includes or is a sequence having amino acid differences at one, two or more sites selected from the following compared to SEQ ID NO: 1:

[0008] N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, D678, E875, D166, N325, N168, N884, N369, N879, P605, K87 2. N456, E601, Q11, N443, D876, E788, G705, V446, S811, E321, E815, A869, V804, N317, N807, H702, V359, K787, P355, K703, V790, L7 78. D782, N409, D704, D356, T354, M863, L332, Q971, A857, Q262, C567, S849, D590, A933, F962, N930, A794, V58, L475, V61, L526, V4 69. Q929, L438, N449, L553, K926, T850, I249, T313, Q450, Y881, R606, Q632, G845, N846, R860, F644, E271, E255, E328, E418, N193, N194, N556, N416, N197, N808, E504, E793, Q186, N812, N570, P121, E658, L662, I549, D551, S664, E681, Q294, E225, N663, Y241, W170, S174, M789, S306, C448, I407, K310, C866, I1031, M618, N571, and L484;

[0009] The amino acid difference is that the amino acid at the site is substituted with any other amino acid, or the amino acid at the site does not exist.

[0010] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising amino acid differences at one, two or more sites selected from the following compared to SEQ ID NO: 1:

[0011] N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, D678, E875, D166, N325, N168, N884, N369, N879, P605, K872, N456, E601, Q 11. N443, D876, E788, G705, V446, S811, E321, E815, A869, V804, N317, N80 7. H702, V359, K787, P355, K703, V790, L778, D782, N409, D704, D356, T354 , M863, L332, Q971, A857, Q262, C567, S849, D590, A933, F962, N930, A794, V58, L475, V61, L526, V469, Q929, L438, N449, L553, K926, T850, I249, T313, Q450, Y881, R606, Q632, G845, N846, R860, F644, E271, E255, E328, E418, N193, N194, N556, N416, N197, N808, E504, E793, Q186, N812, N570, and P121.

[0012] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 80% sequence identity with SEQ ID NO: 1.

[0013] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 85% sequence identity with SEQ ID NO: 1.

[0014] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to SEQ ID NO: 1.

[0015] In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide. In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence to bind specifically to the target nucleic acid. In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide comprises a guide sequence that is engineered to guide the CRISPR complex to bind specifically to the target nucleic acid. In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence to bind specifically to and cut the target nucleic acid. Alternatively, the target nucleic acid is a single-stranded nucleic acid or a double-stranded nucleic acid; Alternatively, the target nucleic acid is a single-stranded DNA or a double-stranded DNA; Alternatively, the cutting of the target nucleic acid is to cut only one single strand in the double-stranded nucleic acid, or the cutting of the target nucleic acid is to cut two single strands in the double-stranded nucleic acid; Alternatively, the cutting of the target nucleic acid is to cut only one single strand in the double-stranded DNA, or the cutting of the target nucleic acid is to cut two single strands in the double-stranded DNA. In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence-specific binding to the target nucleic acid and causes a base conversion of at least one base in the target nucleic acid. In some embodiments of the present invention, the Cas12 protein can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence-specific binding to the target nucleic acid and regulates the expression of at least one gene on the target nucleic acid. Optionally, the at least one base is 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases or 10 bases. Optionally, the at least one gene is 1 gene, 2 genes, 3 genes, 4 genes, 5 genes, 6 genes, 7 genes, 8 genes, 9 genes or 10 genes.

[0016] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 10% higher than that of the Cas12 protein having a sequence of SEQ ID NO: 1.

[0017] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150%, at least 180%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260% or at least 270% higher than the gene editing efficiency of the Cas12 protein having a sequence of SEQ ID NO: 1.

[0018] In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the reporter system targeting Example 1 of the present disclosure. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA shown in any one of SEQ ID NOs: 10-12 in human cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA shown in any one of SEQ ID NOs: 10-12 in 293T cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA comprising the guide sequence shown in any one of SEQ ID NOs: 14-16 in human cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA comprising the guide sequence shown in any one of SEQ ID NOs: 14-16 in 293T cells.

[0019] In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of introducing indel. In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of single base editing of the Cas12 protein or the fusion protein or conjugate. In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of transcriptional activation or transcriptional inhibition caused by the Cas12 protein or the fusion protein or conjugate. The gene editing efficiency can be obtained by testing conventional methods in the art.

[0020] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising an amino acid difference at position N260 compared to SEQ ID NO: 1; in a specific embodiment of the present invention, it further comprises a sequence comprising an amino acid difference at position N295 and / or G705.

[0021] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises amino acid differences at positions N260 and N295 compared to SEQ ID NO: 1, and at positions:

[0022] E875, D166, N325, N884, N369, N879, P605, K872, N456, D678, E601, Q11, N168, D233, N443, Q450, T313, E788, V446, S811, E321, E815, A869, V804, N317, N807, H702, V359, K787, P355, K703, V790, L778, D782, N409, D704, T235, D356, D876, T354, M863, M789, S306, C448, I407, or K310;

[0023] Alternatively, D166 and N168; K872, E875, D876, N879, and N884; or T313, N317, and N325;

[0024] Sequences with amino acid differences.

[0025] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises amino acid differences at positions N260 and N295 compared to SEQ ID NO: 1, and at positions:

[0026] E875, D166, N325, N884, N369, N879, P605, K872, N456, D678, E601, Q11, N168, D233, N443, Q450, T313, E788, V446, S811, E32 1. E815, A869, V804, N317, N807, H702, V359, K787, P355, K703, V790, L778, D782, N409, D704, T235, D356, D876, T354, M863;

[0027] Alternatively, D166 and N168; or K872, E875, D876, N879 and N884;

[0028] Sequences with amino acid differences.

[0029] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises a sequence having amino acid differences at amino acid positions N260 and G705 compared to SEQ ID NO: 1, and amino acid differences at positions: V446, E788 or S811; or, D166 and N168.

[0030] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises amino acid differences at positions N260, N295 and G705 compared to SEQ ID NO: 1, and at positions:

[0031] L332, Q971, A857, P355, Q262, C567, S849, D590, A933, F962, N930, A794, N879, K872, N325, V58, L475, V 61. N884, N409, L526, V469, Q929, Q11, L438, N369, N449, L553, K926, T850, I249, T313, T354, N443, N317 , Q450, Y881, R606, A869, Q632, G845, N846, R860, F644, C866, I1031, M618, E271, E255, E328, E418, N193, N194, N556, Q256, N416, N197, N808, E504, E793, Q186, N812, N570, N571, P605, P121, N456, N168, or L484;

[0032] or, V446, E788, and S811;

[0033] Amino acid sequences with amino acid differences.

[0034] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises amino acid differences at positions N260, N295 and G705 compared to SEQ ID NO: 1, and at positions:

[0035] L332, Q971, A857, P355, Q262, C567, S849, D590, A933, F962, N930, A794, N879, K872, N325, V58, L475, V61, N884, N409, L526, V469, Q929, Q11, L438, N369, N449, L553, K926, T850, I249, T313, T354, N443, N3 17. Q450, Y881, R606, A869, Q632, G845, N846, R860, F644, C866, I1031, M618, E271, E255, E328, E418, N193, N194, N556, Q256, N416, N197, N808, E504, E793, Q186, N812, N570, N571, P605, P121, N456, or N168;

[0036] or, V446, E788, and S811;

[0037] Amino acid sequences with amino acid differences.

[0038] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is compared to SEQ ID NO: 1 at the amino acid position:

[0039] N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, D678, E658, L662, I549, D551, S664, E681, Q294, E225, N663, Y241, W170, or S174;

[0040] Or, at the amino acid position:

[0041] N295 and N260;

[0042] N295, N260 and E875;

[0043] N295, N260, and D166;

[0044] N295, N260 and N325;

[0045] N295, N260, D166, and N168;

[0046] N295, N260 and N884;

[0047] N295, N260 and N369;

[0048] N295, N260 and N879;

[0049] N295, N260 and P605;

[0050] N295, N260 and K872;

[0051] N295, N260 and N456;

[0052] N295, N260, and D678;

[0053] N295, N260 and E601;

[0054] N295, N260 and Q11;

[0055] N295, N260 and N168;

[0056] N295, N260, and D233;

[0057] N295, N260 and N443;

[0058] N295, N260, K872, E875, D876, N879, and N884;

[0059] N295, N260 and Q450;

[0060] N295, N260, T313, N317 and N325;

[0061] N295, N260 and T313;

[0062] N295, N260 and E788;

[0063] N295, N260 and G705;

[0064] N295, N260 and V446;

[0065] N295, N260 and S811;

[0066] N295, N260 and E321;

[0067] N295, N260 and E815;

[0068] N295, N260 and A869;

[0069] N295, N260 and V804;

[0070] N295, N260 and N317;

[0071] N295, N260 and N807;

[0072] N295, N260 and H702;

[0073] N295, N260 and V359;

[0074] N295, N260 and K787;

[0075] N295, N260 and P355;

[0076] N295, N260 and K703;

[0077] N295, N260 and V790;

[0078] N295, N260 and L778;

[0079] N295, N260 and D782;

[0080] N295, N260 and N409;

[0081] N295, N260 and D704;

[0082] N295, N260 and T235;

[0083] N295, N260 and D356;

[0084] N295, N260, and D876;

[0085] N295, N260 and T354;

[0086] N295, N260 and M863;

[0087] N295, N260 and M789;

[0088] N295, N260 and S306;

[0089] N295, N260, and C448;

[0090] N295, N260 and I407;

[0091] N295, N260 and K310;

[0092] N295, N260, G705 and L332;

[0093] N295, N260, G705, and Q971;

[0094] N295, N260, G705 and A857;

[0095] N295, N260, G705 and P355;

[0096] N295, N260, G705 and Q262;

[0097] N295, N260, G705, and C567;

[0098] N295, N260, G705, and S849;

[0099] N295, N260, G705 and D590;

[0100] N295, N260, G705 and A933;

[0101] N295, N260, G705 and F962;

[0102] N295, N260, G705 and N930;

[0103] N295, N260, G705 and A794;

[0104] N295, N260, G705 and N879;

[0105] N295, N260, G705 and K872;

[0106] N295, N260, G705 and N325;

[0107] N295, N260, G705 and V58;

[0108] N295, N260, G705 and L475;

[0109] N295, N260, G705 and V61;

[0110] N295, N260, G705 and N884;

[0111] N295, N260, G705 and N409;

[0112] N295, N260, G705 and L526;

[0113] N295, N260, G705 and V469;

[0114] N295, N260, G705 and Q929;

[0115] N295, N260, G705 and Q11;

[0116] N295, N260, G705 and L438;

[0117] N295, N260, G705 and N369;

[0118] N295, N260, G705 and N449;

[0119] N295, N260, G705 and L553;

[0120] N295, N260, G705 and K926;

[0121] N295, N260, G705 and T850;

[0122] N295, N260, G705 and I249;

[0123] N295, N260, G705 and T313;

[0124] N295, N260, G705 and T354;

[0125] N295, N260, G705 and N443;

[0126] N295, N260, G705 and N317;

[0127] N295, N260, G705 and Q450;

[0128] N295, N260, G705, and Y881;

[0129] N295, N260, G705 and R606;

[0130] N295, N260, G705 and A869;

[0131] N295, N260, G705, and Q632;

[0132] N295, N260, G705 and G845;

[0133] N295, N260, G705 and N846;

[0134] N295, N260, G705 and R860;

[0135] N295, N260, G705, and F644;

[0136] N295, N260, G705, and C866;

[0137] N295, N260, G705 and I1031;

[0138] N295, N260, G705 and M618;

[0139] N260, G705 and E788;

[0140] N260, G705, D166 and N168;

[0141] N260, G705 and V446;

[0142] N260, G705 and S811;

[0143] N295, N260, G705 and E271;

[0144] N295, N260, G705 and E255;

[0145] N295, N260, G705 and E328;

[0146] N295, N260, G705 and E418;

[0147] N295, N260, G705 and N193;

[0148] N295, N260, G705 and N194;

[0149] N295, N260, G705 and N556;

[0150] N295, N260, G705, and Q256;

[0151] N295, N260, G705 and N416;

[0152] N295, N260, G705 and N197;

[0153] N295, N260, G705 and N808;

[0154] N295, N260, G705 and E504;

[0155] N295, N260, G705 and E793;

[0156] N295, N260, G705 and Q186;

[0157] N295, N260, G705 and N812;

[0158] N295, N260, G705 and N570;

[0159] N295, N260, G705 and N571;

[0160] N295, N260, G705, V446, E788, and S811;

[0161] N295, N260, E601 and P605;

[0162] N295, N260, G705 and P121;

[0163] N295, N260, G705 and N456;

[0164] N295, N260, G705 and N168; or

[0165] N295, N260, G705 and L484;

[0166] Sequences with amino acid differences.

[0167] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is compared to SEQ ID NO: 1 at the amino acid position:

[0168] N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, or D678;

[0169] Or, at the amino acid position:

[0170] N295 and N260;

[0171] N295, N260 and E875;

[0172] N295, N260, and D166;

[0173] N295, N260 and N325;

[0174] N295, N260, D166, and N168;

[0175] N295, N260 and N884;

[0176] N295, N260 and N369;

[0177] N295, N260 and N879;

[0178] N295, N260 and P605;

[0179] N295, N260 and K872;

[0180] N295, N260 and N456;

[0181] N295, N260, and D678;

[0182] N295, N260 and E601;

[0183] N295, N260 and Q11;

[0184] N295, N260 and N168;

[0185] N295, N260, and D233;

[0186] N295, N260 and N443;

[0187] N295, N260, K872, E875, D876, N879, and N884;

[0188] N295, N260 and E788;

[0189] N295, N260 and G705;

[0190] N295, N260 and V446;

[0191] N295, N260 and S811;

[0192] N295, N260 and E321;

[0193] N295, N260 and E815;

[0194] N295, N260 and A869;

[0195] N295, N260 and V804;

[0196] N295, N260 and N317;

[0197] N295, N260 and N807;

[0198] N295, N260 and H702;

[0199] N295, N260 and V359;

[0200] N295, N260 and K787;

[0201] N295, N260 and P355;

[0202] N295, N260 and K703;

[0203] N295, N260 and V790;

[0204] N295, N260 and L778;

[0205] N295, N260 and D782;

[0206] N295, N260 and N409;

[0207] N295, N260 and D704;

[0208] N295, N260 and T235;

[0209] N295, N260 and D356;

[0210] N295, N260, and D876;

[0211] N295, N260 and T354;

[0212] N295, N260 and M863;

[0213] N295, N260, G705 and L332;

[0214] N295, N260, G705, and Q971;

[0215] N295, N260, G705 and A857;

[0216] N295, N260, G705 and P355;

[0217] N295, N260, G705 and Q262;

[0218] N295, N260, G705, and C567;

[0219] N295, N260, G705, and S849;

[0220] N295, N260, G705 and D590;

[0221] N295, N260, G705 and A933;

[0222] N295, N260, G705 and F962;

[0223] N295, N260, G705 and N930;

[0224] N295, N260, G705 and A794;

[0225] N295, N260, G705 and N879;

[0226] N295, N260, G705 and K872;

[0227] N295, N260, G705 and N325;

[0228] N295, N260, G705 and V58;

[0229] N295, N260, G705 and L475;

[0230] N295, N260, G705 and V61;

[0231] N295, N260, G705 and N884;

[0232] N295, N260, G705 and N409;

[0233] N295, N260, G705 and L526;

[0234] N295, N260, G705 and V469;

[0235] N295, N260, G705 and Q929;

[0236] N295, N260, G705 and Q11;

[0237] N295, N260, G705 and L438;

[0238] N295, N260, G705 and N369;

[0239] N295, N260, G705 and N449;

[0240] N295, N260, G705 and L553;

[0241] N295, N260, G705 and K926;

[0242] N295, N260, G705 and T850;

[0243] N295, N260, G705 and I249;

[0244] N295, N260, G705 and T313;

[0245] N295, N260, G705 and T354;

[0246] N295, N260, G705 and N443;

[0247] N295, N260, G705 and N317;

[0248] N295, N260, G705 and Q450;

[0249] N295, N260, G705, and Y881;

[0250] N295, N260, G705 and R606;

[0251] N295, N260, G705 and A869;

[0252] N295, N260, G705, and Q632;

[0253] N295, N260, G705 and G845;

[0254] N295, N260, G705 and N846;

[0255] N295, N260, G705 and R860;

[0256] N295, N260, G705, and F644;

[0257] N260, G705 and E788;

[0258] N260, G705, D166 and N168;

[0259] N260, G705 and V446;

[0260] N260, G705 and S811;

[0261] N295, N260, G705 and E271;

[0262] N295, N260, G705 and E255;

[0263] N295, N260, G705 and E328;

[0264] N295, N260, G705 and E418;

[0265] N295, N260, G705 and N193;

[0266] N295, N260, G705 and N194;

[0267] N295, N260, G705 and N556;

[0268] N295, N260, G705, and Q256;

[0269] N295, N260, G705 and N416;

[0270] N295, N260, G705 and N197;

[0271] N295, N260, G705 and N808;

[0272] N295, N260, G705 and E504;

[0273] N295, N260, G705 and E793;

[0274] N295, N260, G705 and Q186;

[0275] N295, N260, G705 and N812;

[0276] N295, N260, G705 and N570;

[0277] N295, N260, G705, V446, E788, and S811;

[0278] N295, N260, E601 and P605;

[0279] N295, N260, G705 and P121;

[0280] N295, N260, G705 and N456; or

[0281] N295, N260, G705 and N168;

[0282] Sequences with amino acid differences.

[0283] In a specific embodiment of the present invention, the amino acid differences are positions N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, E875, D166, P605, E601, D876, E788, G705, V446, S811, E321, E815, A869, V804, N807, H702, V359, K787, K703, V790, L778, D782, D704, D356, M863, C567, D590, N930, A794, V58, L475, V469, and L477. , N571, and L484 are substituted with positively charged amino acids, e.g., R, H, or K; and / or

[0284] The amino acids at positions Q632 and N846 are substituted with negatively charged amino acids, such as D or E; and / or,

[0285] The amino acids at positions D678, P355, Q262, Q971, A933, F962, N879, L332, N325, V61, N884, N409, L526, Q11, S849, A857, Q929, N369, K926, T313, T354, N443, N317, T850, Q450, N456, N168, and N449 are substituted with positively charged amino acids, such as R, H, or K, or are changed to negatively charged amino acids, such as D or E; and / or

[0286] The amino acids at positions I249 and F644 are substituted with positively charged amino acids, such as R, H or K; or with negatively charged amino acids, such as D or E; or with non-polar amino acids, such as G, P, A, I, L, V, M, F, W or Y; and / or,

[0287] The amino acid at position K872 is substituted with a positively charged amino acid, such as R, H or K; or with a negatively charged amino acid, such as D or E; or with a neutral amino acid, such as N, C, Q, S or T; and / or,

[0288] The amino acids at positions A869, C866, and M618 are substituted with non-polar amino acids, such as G, P, A, I, L, V, M, F, W, or Y; and / or,

[0289] The amino acid at position R860 is substituted with a neutral amino acid, such as N, C, Q, S or T; and / or,

[0290] The amino acid at position G845 was substituted with G845Δ.

[0291] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising one, two or more amino acid differences selected from the following compared to SEQ ID NO: 1:

[0292] N260R, N295R, T235R, D233R, S259R, Q256R, M253R, F680R, T550R, Y668R , S246R, N229R, D678R, E875R, D166R, N325R, N168R, N884R, N369R, N879 R, P605R, K872R, N456R, D678E, E601R, Q11R, N443R, D876R, E788R, G705 R, V446R, S811R, E321R, E815R, A869R, V804R, N317R, N807R, H702R, V359 R, K787R, P355R, K703R, V790R, L778R, D782R, N409R, D704R, D356R, T35 4R, M863R, L332R, Q971R, A857R, P355E, Q262E, Q971E, C567R, S849R, D59 0R, A933E, F962E, N930R, A794R, N879E, L332E, F962R, K872E, N325E, V5 8R, L475R, V61E, N884E, N409E, L526E, V469R, L526R, Q929R, Q11E, S849E , L438R, A857E, A933R, Q929E, N369E, N449R, L553R, Q262R, K926E, T850 R, I249F, T313E, I249R, T354E, I249E, N443E, N317E, T850E, Q450E, K87 2N, Y881H, R606K, A869G, Q632E, G845△, N846D, R860S, F644Y, E271K, E2 55K, E328K, E418K, N193K, N194K, N556K, Q262K, Q256K, N416K, N197K, N8 08K, E504K, E793K, Q186K, N812K, L553K, N570K, L475K, V61R, P121R, N456E, N168E, N449E, K926R, E658R, L662R, I549R, D551R, S664R, E681R, Q294R, E225R, N663R, Y241R, W170R, S174R, Q450R, T313R, M789R, S306R, C448R, I407R, K310R, C866L, I1031K, M618Y, N571K, L484R, F644E, and F644R.

[0293] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising one, two or more amino acid differences selected from the following compared to SEQ ID NO: 1:

[0294] N260R, N295R, T235R, D233R, S259R, Q256R, M253R, F680R, T550R, Y668R, S246R, N229R, D678R, E875R, D166R, N325R, N168R, N884R , N369R, N879R, P605R, K872R, N456R, D678E, E601R, Q11R, N443R, D876R, E788R, G705R, V446R, S811R, E321R, E815R, A869R, V804R , N317R, N807R, H702R, V359R, K787R, P355R, K703R, V790R, L778R, D782R, N409R, D704R, D356R, T354R, M863R, L332R, Q971R, A857 R, P355E, Q262E, Q971E, C567R, S849R, D590R, A933E, F962E, N930R, A794R, N879E, L332E, F962R, K872E, N325E, V58R, L475R, V61E, N884E, N409E, L526E, V469R, L526R, Q929R, Q11E, S849E, L438R, A857E, A933R, Q929E, N369E, N449R, L553R, Q2 62R, K926E, T850R, I249F, T313E, I249R, T354E, I249E, N443E, N317E, T850E, Q450E, K872N, Y881H, R606K, A86 9G, Q632E, G845△, N846D, R860S, F644Y, E271K, E255K, E328K, E418K, N193K, N194K, N556K, Q262K, Q256K, N416 K, N197K, N808K, E504K, E793K, Q186K, N812K, L553K, N570K, L475K, V61R, P121R, N456E, N168E, N449E and K926R.

[0295] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising an N260R amino acid difference compared to SEQ ID NO: 1; in a specific embodiment of the present invention, it further comprises a sequence comprising an N295R and / or G705R amino acid difference.

[0296] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R and N295R amino acid differences compared to SEQ ID NO: 1, and

[0297] Also contains the following amino acid differences: E875R, D166R, N325R, N884R, N369R, N879R, P605R, K872R, N456R, D678E, E601R, Q11R, N168R, D233R, N443R, Q450R, T313R, E788R, V446R, S811R, E321R, E815R, A 869R, V804R, N317R, N807R, H702R, V359R, K787R, P355R, K703R, V790R, L778R, D782R, N409R, D704R, T235R, D356R, D876R, T354R, M863R, M789R, S306R, C448R, I407R, or K310R;

[0298] Alternatively, the following amino acid differences are further comprised: D166R and N168R; K872R, E875R, D876R, N879R and N884R; or, T313R, N317R and N325R.

[0299] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R and N295R amino acid differences compared to SEQ ID NO: 1, and

[0300] Also contains the following amino acid differences: E875R, D166R, N325R, N884R, N369R, N879R, P605R, K872R, N456R, D678E, E601R, Q11R, N168R, D233R, N443R, E788R, V446R, S811R, E321R, E815R, A869R, V804R, N317R, N807R, H702R, V359R, K787R, P355R, K703R, V790R, L778R, D782R, N409R, D704R, T235R, D356R, D876R, T354R, or M863R;

[0301] Alternatively, the following amino acid differences are further comprised: D166R and N168R; or, K872R, E875R, D876R, N879R and N884R.

[0302] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R and G705R amino acid differences compared to SEQ ID NO: 1, and

[0303] Also contains the following amino acid differences: V446R, E788R or S811R; or, D166R and N168R.

[0304] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R, N295R and G705R amino acid differences compared to SEQ ID NO: 1, and

[0305] The following amino acid differences are also included: L332R, Q971R, A857R, P355E, Q262E, Q971E, C567R, S849R, D590R, A933E, F962E, N930R, A794R, N879E, L332E, F962R, K872E, N325E, V58R, L475R, V61E, N8 84E, N409E, L526E, V469R, L526R, Q929R, Q11E, S849E, L438R, A857E, A933R, Q929E , N369E, N449R, L553R, Q262R, K926E, T850R, I249F, T313E, I249R, T354E, I249E, N4 43E, N317E, T850E, Q450E, K872N, Y881H, R606K, A869G, Q632E, G845△, N846D, R860 S, F644Y, C866L, I1031K, M618Y, E271K, E255K, E328K, E418K, N193K, N194K, N556K, Q262K, Q256K, N416K, N197K, N808K, E504K, E793K, Q186K, N812K, L553K, N570K, L475K, N571K, V61R, P605R, P121R, N456E, N168E, N449E, K926R, L484R, F644E, or F644R;

[0306] Alternatively, the following amino acid differences are also included: V446R, E788R, and S811R.

[0307] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R, N295R and G705R amino acid differences compared to SEQ ID NO: 1, and

[0308] Also contains the following amino acid differences: L332R, Q971R, A857R, P355E, Q262E, Q971E, C567R, S849R, D590R, A933E, F962E, N930R, A794R, N879E, L332E, F962R, K872E, N325E, V58R, L4 75R, V61E, N884E, N409E, L526E, V469R, L526R, Q929R, Q11E, S849E, L438R, A 857E, A933R, Q929E, N369E, N449R, L553R, Q262R, K926E, T850R, I249F, T313 E, I249R, T354E, I249E, N443E, N317E, T850E, Q450E, K872N, Y881H, R606K, A 869G, Q632E, G845△, N846D, R860S, F644Y, E271K, E255K, E328K, E418K, N193 K, N194K, N556K, Q262K, Q256K, N416K, N197K, N808K, E504K, E793K, Q186K, N812K, L553K, N570K, L475K, V61R, P605R, P121R, N456E, N168E, N449E, or K926R;

[0309] Alternatively, the following amino acid differences are also included: V446R, E788R, and S811R.

[0310] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is compared with SEQ ID NO: 1, and the amino acid difference is: N260R, N295R, T235R, D233R, S259R, Q256R, M253R, F680R, T550R, Y668R, S246R, N229R, D678R, E658R, L662R, I549R, D551R, S664R, E681R, Q294R, E225R, N663R, Y241R, W170R or S174R;

[0311] Alternatively, the amino acid differences are:

[0312] N295R and N260R;

[0313] N295R, N260R and E875R;

[0314] N295R, N260R and D166R;

[0315] N295R, N260R and N325R;

[0316] N295R, N260R, D166R and N168R;

[0317] N295R, N260R and N884R;

[0318] N295R, N260R and N369R;

[0319] N295R, N260R and N879R;

[0320] N295R, N260R and P605R;

[0321] N295R, N260R and K872R;

[0322] N295R, N260R and N456R;

[0323] N295R, N260R, and D678E;

[0324] N295R, N260R and E601R;

[0325] N295R, N260R and Q11R;

[0326] N295R, N260R and N168R;

[0327] N295R, N260R and D233R;

[0328] N295R, N260R and N443R;

[0329] N295R, N260R, K872R, E875R, D876R, N879R, and N884R;

[0330] N295R, N260R and Q450R;

[0331] N295R, N260R, T313R, N317R and N325R;

[0332] N295R, N260R and T313R;

[0333] N295R, N260R and E788R;

[0334] N295R, N260R and G705R;

[0335] N295R, N260R and V446R;

[0336] N295R, N260R and S811R;

[0337] N295R, N260R and E321R;

[0338] N295R, N260R and E815R;

[0339] N295R, N260R and A869R;

[0340] N295R, N260R and V804R;

[0341] N295R, N260R and N317R;

[0342] N295R, N260R and N807R;

[0343] N295R, N260R and H702R;

[0344] N295R, N260R and V359R;

[0345] N295R, N260R and K787R;

[0346] N295R, N260R and P355R;

[0347] N295R, N260R and K703R;

[0348] N295R, N260R and V790R;

[0349] N295R, N260R and L778R;

[0350] N295R, N260R and D782R;

[0351] N295R, N260R and N409R;

[0352] N295R, N260R and D704R;

[0353] N295R, N260R and T235R;

[0354] N295R, N260R and D356R;

[0355] N295R, N260R and D876R;

[0356] N295R, N260R and T354R;

[0357] N295R, N260R and M863R;

[0358] N295R, N260R and M789R;

[0359] N295R, N260R and S306R;

[0360] N295R, N260R and C448R;

[0361] N295R, N260R and I407R;

[0362] N295R, N260R and K310R;

[0363] N295R, N260R, G705R and L332R;

[0364] N295R, N260R, G705R and Q971R;

[0365] N295R, N260R, G705R and A857R;

[0366] N295R, N260R, G705R and P355E;

[0367] N295R, N260R, G705R, and Q262E;

[0368] N295R, N260R, G705R, and Q971E;

[0369] N295R, N260R, G705R and C567R;

[0370] N295R, N260R, G705R and S849R;

[0371] N295R, N260R, G705R and D590R;

[0372] N295R, N260R, G705R and A933E;

[0373] N295R, N260R, G705R and F962E;

[0374] N295R, N260R, G705R and N930R;

[0375] N295R, N260R, G705R and A794R;

[0376] N295R, N260R, G705R and N879E;

[0377] N295R, N260R, G705R and L332E;

[0378] N295R, N260R, G705R and F962R;

[0379] N295R, N260R, G705R and K872E;

[0380] N295R, N260R, G705R and N325E;

[0381] N295R, N260R, G705R and V58R;

[0382] N295R, N260R, G705R and L475R;

[0383] N295R, N260R, G705R and V61E;

[0384] N295R, N260R, G705R and N884E;

[0385] N295R, N260R, G705R and N409E;

[0386] N295R, N260R, G705R and L526E;

[0387] N295R, N260R, G705R and V469R;

[0388] N295R, N260R, G705R and L526R;

[0389] N295R, N260R, G705R and Q929R;

[0390] N295R, N260R, G705R and Q11E;

[0391] N295R, N260R, G705R and S849E;

[0392] N295R, N260R, G705R and L438R;

[0393] N295R, N260R, G705R and A857E;

[0394] N295R, N260R, G705R and A933R;

[0395] N295R, N260R, G705R and Q929E;

[0396] N295R, N260R, G705R and N369E;

[0397] N295R, N260R, G705R and N449R;

[0398] N295R, N260R, G705R and L553R;

[0399] N295R, N260R, G705R and Q262R;

[0400] N295R, N260R, G705R and K926E;

[0401] N295R, N260R, G705R and T850R;

[0402] N295R, N260R, G705R and I249F;

[0403] N295R, N260R, G705R and T313E;

[0404] N295R, N260R, G705R and I249R;

[0405] N295R, N260R, G705R and T354E;

[0406] N295R, N260R, G705R and I249E;

[0407] N295R, N260R, G705R and N443E;

[0408] N295R, N260R, G705R and N317E;

[0409] N295R, N260R, G705R and T850E;

[0410] N295R, N260R, G705R and Q450E;

[0411] N295R, N260R, G705R and K872N;

[0412] N295R, N260R, G705R, and Y881H;

[0413] N295R, N260R, G705R and R606K;

[0414] N295R, N260R, G705R and A869G;

[0415] N295R, N260R, G705R and Q632E;

[0416] N295R, N260R, G705R, and G845△;

[0417] N295R, N260R, G705R and N846D;

[0418] N295R, N260R, G705R and R860S;

[0419] N295R, N260R, G705R, and F644Y;

[0420] N295R, N260R, G705R and C866L;

[0421] N295R, N260R, G705R and I1031K;

[0422] N295R, N260R, G705R and M618Y;

[0423] N260R, G705R and E788R;

[0424] N260R, G705R, D166R and N168R;

[0425] N260R, G705R and V446R;

[0426] N260R, G705R and S811R;

[0427] N295R, N260R, G705R and E271K;

[0428] N295R, N260R, G705R and E255K;

[0429] N295R, N260R, G705R and E328K;

[0430] N295R, N260R, G705R and E418K;

[0431] N295R, N260R, G705R and N193K;

[0432] N295R, N260R, G705R and N194K;

[0433] N295R, N260R, G705R and N556K;

[0434] N295R, N260R, G705R and Q262K;

[0435] N295R, N260R, G705R and Q256K;

[0436] N295R, N260R, G705R and N416K;

[0437] N295R, N260R, G705R and N197K;

[0438] N295R, N260R, G705R and N808K;

[0439] N295R, N260R, G705R and E504K;

[0440] N295R, N260R, G705R and E793K;

[0441] N295R, N260R, G705R and Q186K;

[0442] N295R, N260R, G705R and N812K;

[0443] N295R, N260R, G705R and L553K;

[0444] N295R, N260R, G705R and N570K;

[0445] N295R, N260R, G705R and L475K;

[0446] N295R, N260R, G705R and N571K;

[0447] N295R, N260R, G705R and V61R;

[0448] N295R, N260R, G705R, V446R, E788R, and S811R;

[0449] N295R, N260R, E601R and P605R;

[0450] N295R, N260R, G705R and P121R;

[0451] N295R, N260R, G705R and N456E;

[0452] N295R, N260R, G705R and N168E;

[0453] N295R, N260R, G705R and N449E;

[0454] N295R, N260R, G705R and K926R;

[0455] N295R, N260R, G705R and L484R;

[0456] N295R, N260R, G705R, and F644E; or

[0457] N295R, N260R, G705R and F644R.

[0458] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is compared with SEQ ID NO: 1, and the amino acid difference is: N260R, N295R, T235R, D233R, S259R, Q256R, M253R, F680R, T550R, Y668R, S246R, N229R or D678R;

[0459] Alternatively, the amino acid differences are:

[0460] N295R and N260R;

[0461] N295R, N260R and E875R;

[0462] N295R, N260R and D166R;

[0463] N295R, N260R and N325R;

[0464] N295R, N260R, D166R and N168R;

[0465] N295R, N260R and N884R;

[0466] N295R, N260R and N369R;

[0467] N295R, N260R and N879R;

[0468] N295R, N260R and P605R;

[0469] N295R, N260R and K872R;

[0470] N295R, N260R and N456R;

[0471] N295R, N260R, and D678E;

[0472] N295R, N260R and E601R;

[0473] N295R, N260R and Q11R;

[0474] N295R, N260R and N168R;

[0475] N295R, N260R and D233R;

[0476] N295R, N260R and N443R;

[0477] N295R, N260R, K872R, E875R, D876R, N879R, and N884R;

[0478] N295R, N260R and E788R;

[0479] N295R, N260R and G705R;

[0480] N295R, N260R and V446R;

[0481] N295R, N260R and S811R;

[0482] N295R, N260R and E321R;

[0483] N295R, N260R and E815R;

[0484] N295R, N260R and A869R;

[0485] N295R, N260R and V804R;

[0486] N295R, N260R and N317R;

[0487] N295R, N260R and N807R;

[0488] N295R, N260R and H702R;

[0489] N295R, N260R and V359R;

[0490] N295R, N260R and K787R;

[0491] N295R, N260R and P355R;

[0492] N295R, N260R and K703R;

[0493] N295R, N260R and V790R;

[0494] N295R, N260R and L778R;

[0495] N295R, N260R and D782R;

[0496] N295R, N260R and N409R;

[0497] N295R, N260R and D704R;

[0498] N295R, N260R and T235R;

[0499] N295R, N260R and D356R;

[0500] N295R, N260R and D876R;

[0501] N295R, N260R and T354R;

[0502] N295R, N260R and M863R;

[0503] N295R, N260R, G705R and L332R;

[0504] N295R, N260R, G705R and Q971R;

[0505] N295R, N260R, G705R and A857R;

[0506] N295R, N260R, G705R and P355E;

[0507] N295R, N260R, G705R, and Q262E;

[0508] N295R, N260R, G705R, and Q971E;

[0509] N295R, N260R, G705R and C567R;

[0510] N295R, N260R, G705R and S849R;

[0511] N295R, N260R, G705R and D590R;

[0512] N295R, N260R, G705R and A933E;

[0513] N295R, N260R, G705R and F962E;

[0514] N295R, N260R, G705R and N930R;

[0515] N295R, N260R, G705R and A794R;

[0516] N295R, N260R, G705R and N879E;

[0517] N295R, N260R, G705R and L332E;

[0518] N295R, N260R, G705R and F962R;

[0519] N295R, N260R, G705R and K872E;

[0520] N295R, N260R, G705R and N325E;

[0521] N295R, N260R, G705R and V58R;

[0522] N295R, N260R, G705R and L475R;

[0523] N295R, N260R, G705R and V61E;

[0524] N295R, N260R, G705R and N884E;

[0525] N295R, N260R, G705R and N409E;

[0526] N295R, N260R, G705R and L526E;

[0527] N295R, N260R, G705R and V469R;

[0528] N295R, N260R, G705R and L526R;

[0529] N295R, N260R, G705R and Q929R;

[0530] N295R, N260R, G705R and Q11E;

[0531] N295R, N260R, G705R and S849E;

[0532] N295R, N260R, G705R and L438R;

[0533] N295R, N260R, G705R and A857E;

[0534] N295R, N260R, G705R and A933R;

[0535] N295R, N260R, G705R and Q929E;

[0536] N295R, N260R, G705R and N369E;

[0537] N295R, N260R, G705R and N449R;

[0538] N295R, N260R, G705R and L553R;

[0539] N295R, N260R, G705R and Q262R;

[0540] N295R, N260R, G705R and K926E;

[0541] N295R, N260R, G705R and T850R;

[0542] N295R, N260R, G705R and I249F;

[0543] N295R, N260R, G705R and T313E;

[0544] N295R, N260R, G705R and I249R;

[0545] N295R, N260R, G705R and T354E;

[0546] N295R, N260R, G705R and I249E;

[0547] N295R, N260R, G705R and N443E;

[0548] N295R, N260R, G705R and N317E;

[0549] N295R, N260R, G705R and T850E;

[0550] N295R, N260R, G705R and Q450E;

[0551] N295R, N260R, G705R and K872N;

[0552] N295R, N260R, G705R, and Y881H;

[0553] N295R, N260R, G705R and R606K;

[0554] N295R, N260R, G705R and A869G;

[0555] N295R, N260R, G705R and Q632E;

[0556] N295R, N260R, G705R, and G845△;

[0557] N295R, N260R, G705R and N846D;

[0558] N295R, N260R, G705R and R860S;

[0559] N295R, N260R, G705R, and F644Y;

[0560] N260R, G705R and E788R;

[0561] N260R, G705R, D166R and N168R;

[0562] N260R, G705R and V446R;

[0563] N260R, G705R and S811R;

[0564] N295R, N260R, G705R and E271K;

[0565] N295R, N260R, G705R and E255K;

[0566] N295R, N260R, G705R and E328K;

[0567] N295R, N260R, G705R and E418K;

[0568] N295R, N260R, G705R and N193K;

[0569] N295R, N260R, G705R and N194K;

[0570] N295R, N260R, G705R and N556K;

[0571] N295R, N260R, G705R and Q262K;

[0572] N295R, N260R, G705R and Q256K;

[0573] N295R, N260R, G705R and N416K;

[0574] N295R, N260R, G705R and N197K;

[0575] N295R, N260R, G705R and N808K;

[0576] N295R, N260R, G705R and E504K;

[0577] N295R, N260R, G705R and E793K;

[0578] N295R, N260R, G705R and Q186K;

[0579] N295R, N260R, G705R and N812K;

[0580] N295R, N260R, G705R and L553K;

[0581] N295R, N260R, G705R and N570K;

[0582] N295R, N260R, G705R and L475K;

[0583] N295R, N260R, G705R and V61R;

[0584] N295R, N260R, G705R, V446R, E788R, and S811R;

[0585] N295R, N260R, E601R and P605R;

[0586] N295R, N260R, G705R and P121R;

[0587] N295R, N260R, G705R and N456E;

[0588] N295R, N260R, G705R and N168E;

[0589] N295R, N260R, G705R and N449E; or

[0590] N295R, N260R, G705R and K926R.

[0591] Optionally, the Cas12 protein can recognize a PAM sequence of 5'-TTN, where N is A, T, C or G.

[0592] In some embodiments, the Cas12 protein can recognize a PAM sequence of 5'-TTA. In some embodiments, the Cas12 protein can recognize a PAM sequence of 5'-TTT. In some embodiments, the Cas12 protein can recognize a PAM sequence of 5'-TTC. In some embodiments, the Cas12 protein can recognize a PAM sequence of 5'-TTG.

[0593] A technical solution provided by the present invention is: a fusion protein or conjugate, which comprises the Cas12 protein or its functional fragment as described in the present invention fused to a homologous or heterologous functional domain.

[0594] In some embodiments, the fusion of Cas12 protein does not change the original function of the Cas12 protein, including but not limited to the function of binding and cutting target nucleic acid.

[0595] In a specific embodiment of the present invention, the homologous or heterologous functional domain is selected from one or more of the following: subcellular localization signals, DNA binding domains, protein targeting moieties, transcription activation domains, transcription repression domains, nucleases, base editing domains such as deaminase domains, methylases, demethylases, transcription release factors, histone deacetylases, polypeptides with ssDNA cleavage activity, polypeptides with dsDNA cleavage activity, DNA ligases, epitope tags, reporter proteins and detection labels.

[0596] In a specific embodiment of the present invention, the Cas12 protein is covalently linked to the homologous or heterologous functional domain.

[0597] In a specific embodiment of the present invention, the Cas12 protein is directly linked to the homologous or heterologous functional domain, or is covalently linked through an amino acid linker or a non-amino acid linker.

[0598] In a specific embodiment of the present invention, the homologous or heterologous functional domain is fused or conjugated at the N-terminus, C-terminus or internally relative to the Cas12 protein.

[0599] Alternatively, the fusion protein or conjugate can recognize a PAM sequence of 5'-TTN, wherein N is A, T, C or G.

[0600] A technical solution provided by the present invention is: an isolated nucleic acid, which encodes the Cas12 protein as described in the present invention or the fusion protein or conjugate as described in the present invention.

[0601] In a specific embodiment of the invention, the nucleic acid is codon-optimized for expression in a cell.

[0602] In specific embodiments of the invention, the nucleic acid is codon-optimized for expression in a eukaryote, a mammal such as a human or non-human mammal, a plant, an insect, a bird, a reptile, a rodent (e.g., mouse, rat), a fish, a worm / nematode, or a yeast.

[0603] A technical solution provided by the present invention is: a CRISPR-Cas12 system, wherein the CRISPR-Cas12 system comprises:

[0604] a. The Cas12 protein according to the present invention, the fusion protein or conjugate according to the present invention, or the nucleic acid according to the present invention;

[0605] as well as

[0606] b. a guide polynucleotide, or a polynucleotide sequence encoding the guide polynucleotide;

[0607] The Cas12 protein or the fusion protein or conjugate forms a CRISPR complex with the guide polynucleotide; the guide polynucleotide comprises a guide sequence engineered to guide sequence-specific binding of the CRISPR complex to a target nucleic acid.

[0608] In a specific embodiment of the invention, the guide polynucleotide comprises a direct repeat sequence linked to a guide sequence; the nucleotide sequence of the direct repeat sequence is at least 80% identical to SEQ ID NO: 17.

[0609] In a specific embodiment of the present invention, the nucleotide sequence of the direct repeat sequence is shown as SEQ ID NO: 17.

[0610] In a specific embodiment of the present invention, the target nucleic acid is DNA or RNA, preferably dsDNA or ssDNA.

[0611] In a specific embodiment of the present invention, the DNA is eukaryotic DNA; preferably, the eukaryotic DNA is non-human mammal DNA, non-human primate DNA, human DNA, plant DNA, insect DNA, bird DNA, reptile DNA, rodent DNA, fish DNA, worm / nematode DNA or yeast DNA.

[0612] In a specific embodiment of the present invention, the target nucleic acid is a disease-related gene or a signal transduction biochemical pathway-related gene, or the target nucleic acid is a reporter gene.

[0613] In a specific embodiment of the present invention, the disease-related gene or signal transduction biochemical pathway-related gene is TTR (transthyretin), HBB (hemoglobin β) or HBG (hemoglobin γ-globin) gene; the reporter gene is GFP (green fluorescent protein) gene.

[0614] In a specific embodiment of the present invention, the guide sequence comprises 15-35 nucleotides, and / or the guide sequence hybridizes to the target nucleic acid, and the guide sequence is 90% to 100% complementary to the target nucleic acid, preferably with no more than one nucleotide mismatch. In a specific embodiment of the present invention, the guide sequence is optionally selected from the sequences shown in SEQ ID NOs: 14 to 16.

[0615] In a specific embodiment of the invention, the guide sequence is located at the 3' end of the direct repeat sequence.

[0616] A technical solution provided by the present invention is: a vector system, wherein the vector system comprises one or more vectors, and the vector comprises the isolated nucleic acid as described in the present invention, or the CRISPR-Cas12 system as described in the present invention.

[0617] In a specific embodiment of the present invention, the vector further comprises a regulatory sequence.

[0618] In a specific embodiment of the present invention, the regulatory sequence comprises one or more selected from: a promoter, an enhancer, an internal ribosome entry site and a transcription termination signal; the promoter is, for example, a constitutive promoter, an inducible promoter, a broad-spectrum promoter or a tissue-specific promoter, and / or the transcription termination signal is, for example, a polyadenylation signal or a poly-U sequence.

[0619] In a specific embodiment of the present invention, the regulatory sequence is operably linked to the vector.

[0620] In a specific embodiment of the present invention, the backbone of the vector is pCDNA3.1.

[0621] In a specific embodiment of the present invention, the vector is an adeno-associated virus vector, a lentivirus vector, a ribonucleoprotein complex or a virus-like particle.

[0622] In a specific embodiment of the present invention:

[0623] When the vector is an adeno-associated viral vector, the adeno-associated viral vector is a recombinant adeno-associated viral vector of serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13;

[0624] When the vector is a lentiviral vector, the lentiviral vector is pseudotyped with an envelope protein; optionally, the isolated nucleic acid is linked to an aptamer sequence;

[0625] When the vector is a virus-like particle, the isolated nucleic acid is linked to a gene encoding a gag protein.

[0626] A technical solution provided by the present invention is: a delivery system, the delivery system comprising:

[0627] (1) the means of delivery, and

[0628] (2) The Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0629] In a specific embodiment of the present invention, the delivery vehicle is a lipid nanoparticle, a nanoparticle, a liposome, an exosome, a microbubble or a gene gun.

[0630] In a specific embodiment of the present invention, the delivery vehicle is a lipid nanoparticle comprising the guide polynucleotide and mRNA encoding the Cas12 protein or the fusion protein or conjugate.

[0631] A technical solution provided by the present invention is: a cell, which contains the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0632] In a specific embodiment of the invention, the cell is a eukaryotic cell.

[0633] In a specific embodiment of the invention, the eukaryotic cell is a mammalian cell.

[0634] A technical solution provided by the present invention is: a pharmaceutical composition, comprising the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0635] In a specific embodiment of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

[0636] A technical solution provided by the present invention is: a kit comprising the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0637] A technical solution provided by the present invention is: use of the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention in the preparation of a reagent or drug for diagnosing, treating and / or preventing a disease or condition associated with a target nucleic acid.

[0638] In specific embodiments of the present invention, the agents or drugs are used to: cleave or nick one or more target nucleic acid molecules, activate or upregulate the expression of one or more target nucleic acid molecules, activate or inhibit the transcription of one or more target nucleic acid molecules, inactivate one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules.

[0639] A technical solution provided by the present invention is: a method for detecting, binding or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention or the kit as described in the present invention.

[0640] In a specific embodiment of the invention, the method is a method for non-diagnostic and / or therapeutic purposes; and / or the fusion protein or conjugate comprises a detectable label, such as a label detectable by fluorescence, Southern blotting or FISH.

[0641] A technical solution provided by the present invention is: a method for changing the state of a cell, the method comprising contacting the cell with the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention, thereby changing the cell state.

[0642] In specific embodiments of the invention, the method results in one or more of the following: (i) induction of cellular senescence in vitro or in vivo; (ii) cell cycle arrest in vitro or in vivo; (iii) cell growth inhibition and / or cell growth suppression in vitro or in vivo; (iv) induction of anergy in vitro or in vivo; (v) induction of apoptosis in vitro or in vivo; and (vi) induction of necrosis in vitro or in vivo.

[0643] In a specific embodiment of the invention, the method is a method for non-diagnostic and / or therapeutic purposes.

[0644] A technical solution provided by the present invention is: a method for diagnosing, treating and / or preventing a disease or condition associated with a target nucleic acid, administering the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention to a sample of a subject in need or to a subject in need.

[0645] A technical solution provided by the present invention is: the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention or the kit as described in the present invention, which is used for diagnosing, treating and / or preventing diseases or conditions associated with target nucleic acids.

[0646] The present invention provides Cas12 protein and application thereof.

[0647] In one aspect, the present invention provides a technical solution: a Cas12 protein, the amino acid sequence of the Cas12 protein comprises or is the same as SEQ ID 98%, at least 99.9%, at least 99.0%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to an amino acid sequence of at least 10%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135

[0648] In a specific embodiment of the present invention, the PAM sequence recognized by the Cas12 protein is A.

[0649] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein comprises or is an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identity to SEQ ID NO: 18, and the PAM sequence recognized by the Cas12 protein is A.

[0650] In a preferred embodiment of the present invention, the Cas12 protein does not include a Cas12 protein whose amino acid sequence has at least 70% sequence identity with SEQ ID NO: 40 and whose recognized PAM sequence is not A.

[0651] In a specific embodiment of the present invention, the Cas12 protein does not include: an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99.0%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity compared to SEQ ID NO: 40 and the recognized PAM sequence is not A. Cas12 protein.

[0652] In specific embodiments of the invention, said at least 50% identity is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identity.

[0653] In a specific embodiment of the present invention, the Cas12 protein retains the function of the protein shown in SEQ ID NO: 18.

[0654] In a specific embodiment of the present invention, the Cas12 protein can form a complex with a guide polynucleotide. In a specific embodiment of the present invention, the Cas12 protein can specifically bind to a target nucleic acid with a guide polynucleotide.

[0655] In a specific embodiment of the present invention, the Cas12 protein can form a complex with the guide polynucleotide, and the complex can specifically bind to the target nucleic acid. In a specific embodiment of the present invention, the Cas12 protein can form a complex with the guide polynucleotide, and the complex can specifically bind to the target DNA.

[0656] In a specific embodiment of the present invention, the Cas12 protein can specifically bind to the guide polynucleotide and cut the target nucleic acid. In a specific embodiment of the present invention, the Cas12 protein can specifically bind to the guide polynucleotide and cut the target DNA. In a specific embodiment of the present invention, the Cas12 protein can form a complex with the guide polynucleotide, and the complex can specifically bind to and cut the target nucleic acid. In a specific embodiment of the present invention, the Cas12 protein can form a complex with the guide polynucleotide, and the complex can specifically bind to and cut the target DNA.

[0657] In the present invention, retaining the function of the protein shown in the sequence of SEQ ID NO: 18 refers to retaining the ability to form a complex with the guide polynucleotide, retaining the ability to bind to the target nucleic acid complementary to the guide sequence of the guide polynucleotide, retaining the ability to target and cut the target nucleic acid with the guide polynucleotide, and / or retaining the ability to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[0658] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 18 is retained to form a complex with the guide polynucleotide.

[0659] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 18 is retained to bind to a target nucleic acid complementary to the guide sequence of the guide polynucleotide.

[0660] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 18 is retained to guide the polynucleotide to target and cleave the target nucleic acid.

[0661] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 18 is retained to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[0662] In a preferred embodiment of the present invention, the amino acid sequence of the Cas12 protein comprises or is the amino acid sequence shown in SEQ ID NO: 18.

[0663] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is an amino acid sequence having an amino acid difference at any one of the following sites compared to SEQ ID NO: 18:

[0664] S211, Q216, N217, E218, K219, E220, K351, H352, N353, I355, E359, A362, L3 63. A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, E287, D270 , E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L998, S995, D762, E761, N763, S843, S836, N833, A829, D768, Y988, E24, K76, Q80, Q282, L254, L240, E241, D302, N441, D393, G394, N395, S481, D157, E159, Q491, V490, H485, D903, D953 , N904, V955, Q908, L932, S939, Q930, N870, E851, Q854, V850, N873, V872, D839, Q868, D800, E804 , R19, R28, R32, K512, N527, W531, R553, K581, K589, I590, R605, K611, R612, R615, Y777, E877, R931, H271, I435, T436, F437, S438, D498, D639, D640 and T1006; the amino acid difference is that the amino acid at the position is replaced by any other amino acid.

[0665] In a preferred embodiment of the present invention, the amino acid at the site is substituted with a positively charged amino acid, such as R, H or K; or the amino acid at the site is substituted with a non-polar amino acid, such as G, P, A, I, L, V, M, F, W or Y; or the amino acid at the site is substituted with a negatively charged amino acid, such as D or E; or the amino acid at the site is substituted with a neutral amino acid, such as N, C, Q, S or T.

[0666] In a more preferred embodiment of the present invention, the amino acid at position Q216 or N217 is substituted with a positively charged amino acid or a non-polar amino acid; or

[0667] Sites S211, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, E287, D270, E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L998, the amino acid at S995, D762, E761, N763, S843, S836, N833, A829, D768, Y988, K512, N527, W531, K581, K589, I590, K611, Y777, E877, H271, D393, N395, I435, T436, F437, S438, D498, D639, D640, V850, or T1006 is substituted with a positively charged amino acid; or,

[0668] The amino acid at position R19, R28, R32, R553, R605, R612, R615 or R931 is substituted with a positively charged amino acid, a nonpolar amino acid, a negatively charged amino acid or a neutral amino acid.

[0669] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 10% higher than that of the Cas12 protein having an amino acid sequence of SEQ ID NO: 18.

[0670] In a preferred embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150%, at least 180%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260% or at least 270% higher than the gene editing efficiency of the Cas12 protein having an amino acid sequence of SEQ ID NO: 18.

[0671] In the present invention, “the gene editing efficiency of the Cas12 protein is improved than the gene editing efficiency of the Cas12 protein having an amino acid sequence of SEQ ID NO: 18” may refer to that for a specific guide sequence (not necessarily two, three or more guide sequences, let alone all guide sequences), the editing efficiency of the Cas12 protein after combination with the gRNA containing this guide sequence is higher than the editing efficiency of the Cas12 protein having an amino acid sequence comprising or being SEQ ID NO: 18 and the gRNA containing this guide sequence.

[0672] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is an amino acid sequence comprising any one of the following amino acid differences compared to SEQ ID NO: 18:

[0673] The amino acid at position Q216 or N217 is substituted with R, F, or W;

[0674] Sites S211, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, E287, D270, E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L9 wherein the amino acid sequence of the amino acid sequence of the present invention is substituted with R; and,

[0675] The amino acid at position R19, R28, R32, R553, R605, R612, R615 or R931 is substituted with K, A, Q or E.

[0676] On the other hand, a technical solution provided by the present invention is: a Cas12 protein mutant, the amino acid sequence of the Cas12 protein mutant includes or is an amino acid sequence having at least 70% identity with SEQ ID NO: 40, and:

[0677] The amino acid sequence of the Cas12 protein mutant includes or is the same as SEQ ID NO:40 comprises an amino acid sequence having an amino acid difference at any of the following positions compared to the amino acid sequence selected from: S211, Q216, N217, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, D287, D270, E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L998, S995, D762, E761, N763, S843, S836, N833, A829, D768, 438, D498, D639, D640, and T1006; the amino acid difference is that the amino acid at the position is substituted with any other amino acid.

[0678] In a preferred embodiment of the present invention, the amino acid at the site is substituted with a positively charged amino acid, such as R, H or K; or the amino acid at the site is substituted with a non-polar amino acid, such as G, P, A, I, L, V, M, F, W or Y; or the amino acid at the site is substituted with a negatively charged amino acid, such as D or E; or the amino acid at the site is substituted with a neutral amino acid, such as N, C, Q, S or T.

[0679] In a more preferred embodiment of the present invention, the amino acid at position Q216 or N217 is substituted with a positively charged amino acid or a non-polar amino acid; or, positions S211, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, D287, D270, E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L998, The amino acid at S995, D762, E761, N763, S843, S836, N833, A829, D768, Y988, H271, D393, N395, T435, T436, F437, S438, D498, D639, D640, V850, or T1006 is substituted with a positively charged amino acid.

[0680] Alternatively, the amino acid sequence of the Cas12 protein mutant includes or is compared to SEQ ID NO: 40, wherein the amino acid at position R19, R28, R32, R553, R605, R612, R615 or R931 is substituted with K, A, Q or E.

[0681] Alternatively, the amino acid sequence of the Cas12 protein mutant includes or is compared to SEQ ID NO: 40, wherein the amino acid at position K512, N527, W531, K581, K589, I590, K611, Y777 or E877 is substituted with a positively charged amino acid, such as R, H or K; preferably R.

[0682] In specific embodiments of the invention, the at least 70% identity is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9%.

[0683] In a specific embodiment of the present invention, the Cas12 protein mutant retains the function of the protein shown in SEQ ID NO:40.

[0684] In the present invention, retaining the function of the protein shown in SEQ ID NO: 40 refers to retaining the ability of the protein shown in SEQ ID NO: 40 to bind to the target nucleic acid complementary to the guide sequence of the guide polynucleotide, and / or retaining the ability to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[0685] In the present invention, retaining the function of the protein shown in SEQ ID NO: 40 refers to retaining the ability to form a complex with the guide polynucleotide, retaining the ability to target nucleic acids complementary to the guide sequence of the guide polynucleotide, retaining the ability to target and cut the target nucleic acid with the guide polynucleotide, and / or retaining the ability to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[0686] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 40 is retained, that is, the ability to form a complex with a guide polynucleotide is retained.

[0687] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 40 is retained by retaining the ability to bind to a target nucleic acid complementary to the guide sequence of the guide polynucleotide.

[0688] In a specific embodiment of the present invention, the function of retaining the protein shown in the sequence of SEQ ID NO: 40 is to retain the ability to guide the polynucleotide to target and cleave the target nucleic acid.

[0689] In a specific embodiment of the present invention, the function of the protein represented by SEQ ID NO: 40 is retained to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[0690] In a specific embodiment of the present invention, the Cas12 protein mutant can form a complex with the guide polynucleotide.

[0691] In a specific embodiment of the present invention, the Cas12 protein mutant can specifically bind to the target nucleic acid with the guidance polynucleotide. In a specific embodiment of the present invention, the Cas12 protein mutant can form a complex with the guidance polynucleotide, and the complex can specifically bind to the target nucleic acid.

[0692] In a specific embodiment of the present invention, the Cas12 protein mutant can specifically bind to the guide polynucleotide and cut the target nucleic acid. In a specific embodiment of the present invention, the Cas12 protein mutant can form a complex with the guide polynucleotide, and the complex can specifically bind to and cut the target nucleic acid.

[0693] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein mutant is at least 10% higher than the gene editing efficiency of the Cas12 protein having an amino acid sequence as shown in SEQ ID NO: 40.

[0694] In a specific embodiment of the present invention, the PAM sequence recognized by the Cas12 protein mutant is TTN, such as TTA, TTT, TTC or TTG; and N is A, T, C or G.

[0695] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein mutant is at least 10% higher than that of the Cas12 protein having an amino acid sequence as shown in SEQ ID NO: 40; and / or, the PAM sequence recognized by the Cas12 protein mutant is TTN, and N is A, T, C or G.

[0696] In a preferred embodiment of the present invention, the gene editing efficiency of the Cas12 protein mutant is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150%, at least 180%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260% or at least 270% higher than the gene editing efficiency of the Cas12 protein whose amino acid sequence is shown in SEQ ID NO: 40.

[0697] In the present invention, “the gene editing efficiency of the Cas12 protein is improved than the gene editing efficiency of the Cas12 protein having an amino acid sequence of SEQ ID NO: 40” may refer to that for a specific guide sequence (not necessarily two, three or more guide sequences, let alone all guide sequences), the editing efficiency of the Cas12 protein after combination with the gRNA containing this guide sequence is higher than the editing efficiency of the Cas12 protein having an amino acid sequence comprising or being SEQ ID NO: 40 after combination with the gRNA containing this guide sequence.

[0698] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein mutant includes or is a sequence having any of the following amino acid differences compared to SEQ ID NO: 40:

[0699] The amino acid at position Q216 or N217 is substituted with R, F, or W;

[0700] Sites S211, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, D287, D270, E265, N224, D413, D417, A410, D428, E424, Q1005, N991, E999, L998, S995, The amino acid at D762, E761, N763, S843, S836, N833, A829, D768, Y988, H271, D393, N395, T435, T436, F437, S438, D498, D639, D640, V850, or T1006 is substituted with R.

[0701] On the other hand, a technical solution provided by the present invention is: a guide polynucleotide comprising (i) a direct repeat sequence having a sequence of SEQ ID NO: 26, and (ii) a guide sequence engineered to hybridize with a target nucleic acid; the direct repeat sequence is connected to the guide sequence, and the guide polynucleotide is capable of forming a complex with the Cas12 protein and guiding the complex to bind specifically to the sequence of the target nucleic acid.

[0702] In a preferred embodiment of the present invention, the Cas12 protein is the Cas12 protein described in the present invention or the Cas12 protein mutant described in the present invention.

[0703] In a specific embodiment of the present invention, the guide sequence comprises 15 to 35 nucleotides, and / or the guide sequence hybridizes to the target nucleic acid, and the guide sequence is 90% to 100% complementary to the target nucleic acid, preferably with no more than one nucleotide mismatch; for example, the nucleotide sequence of the guide sequence is as shown in any one of SEQ ID NOs: 27 to 28.

[0704] In a specific embodiment of the present invention, the guide sequence is located at the 3' end of the direct repeat sequence; for example, the nucleotide sequence of the guide polynucleotide is optionally selected from any one of SEQ ID NOs: 24 to 25.

[0705] On the other hand, a technical solution provided by the present invention is: a Cas12 protein, the Cas12 protein comprising a Cas12 active fragment, the Cas12 active fragment comprising one or more selected from: the Helical-I1 domain, the PI domain, the Helical-II domain, the Ruvc-I domain, the Helical-III domain and the Nuc domain of the Cas12 protein according to the present invention;

[0706] Or, the Cas12 active fragment comprises one or more selected from: the WED-I domain, Helical-I1 domain, PI domain, Helical-I2 domain, Helical-II domain, WED-II domain, Helical-III domain, BH domain, Ruvc-II domain and Nuc domain of the Cas12 protein of the present invention; and the Cas12 active fragment comprises amino acid differences as defined in the Cas12 protein of the present invention.

[0707] In a preferred embodiment of the present invention, the Cas12 active fragment comprises the PI domain and comprises one or more selected from the group consisting of: the Helical-I1 domain, the Helical-I2 domain, the Helical-II domain, the Helical-III domain and the BH domain;

[0708] Or, the Cas12 active fragment comprises the WED-I domain, the WED-II domain, the Ruvc-I domain, the Ruvc-II domain and the Nuc domain, and the Ruvc-III domain of the Cas12 protein as described in the present invention.

[0709] In a more preferred embodiment of the present invention, the Cas12 active fragment comprises the PI domain, the Helical-I1 domain, the Helical-I2 domain, the Helical-II domain, the Helical-III domain and the BH domain.

[0710] In a specific embodiment of the present invention, the Cas12 active fragment comprises one or more selected from the group consisting of: a WED-I domain, a Helical-I1 domain, a PI domain, a Helical-I2 domain, a Helical-II domain, a WED-II domain, a Helical-III domain, a BH domain, a Ruvc-II domain and a Nuc domain of a Cas12 protein mutant as described in the present invention; and the Cas12 active fragment comprises an amino acid difference as defined in the Cas12 protein mutant described in the present invention.

[0711] The division of the Cas12 protein domain can be determined by sequence alignment with the protein shown in SEQ ID NO: 18 or 40.

[0712] On the other hand, a technical solution provided by the present invention is: a Cas12 inactivated variant, wherein the Cas12 inactivated variant is a nuclease activity inactivated variant of the Cas12 protein described in the present invention or the Cas12 protein mutant described in the present invention.

[0713] In a specific embodiment of the present invention, the Cas12 inactivated variant is a variant in which the nuclease activity is completely inactivated, i.e., a dead Cas12 inactivated variant (dCas12). The dCas12 can only bind to the target nucleic acid under the mediation of the guide polynucleotide, and has no or almost no function of cutting the target nucleic acid. For example, the target nucleic acid cutting efficiency of the dCas12 is ≤10%, ≤5%, ≤4%, ≤3%, ≤2% or ≤1% of the target nucleic acid cutting efficiency of the Cas12 protein or Cas12 protein mutant before the inactivation mutation.

[0714] In a specific embodiment of the present invention, the Cas12 inactivated variant is a variant with partially inactivated nuclease activity. Further, the variant with partially inactivated nuclease activity is a Cas12 nickase (nCas12), which binds to the target nucleic acid under the mediation of a guide polynucleotide and then cuts one of the single strands in the double-stranded target nucleic acid without cutting the other single strand.

[0715] In a preferred embodiment of the present invention, the Cas12 inactivated variant is an inactivated Ruvc domain of the Cas12 protein or the Cas12 protein mutant.

[0716] In a preferred embodiment of the present invention, the Cas12 inactivated variant is the inactivation of the Ruvc-I, Ruvc-Ⅱ or Ruvc-Ⅲ domain of the Cas12 protein or the Cas12 protein mutant.

[0717] In a preferred embodiment of the present invention, the Cas12 inactivated variant is obtained by introducing an inactivating mutation into the Ruvc-I, Ruvc-II or Ruvc-III domain of the Cas12 protein or the Cas12 protein mutant.

[0718] On the other hand, a technical solution provided by the present invention is: a Cas12 fusion protein or conjugate, wherein the Cas12 fusion protein or conjugate comprises the following elements: (1) a Cas12 functional domain; which includes the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, or the Cas12 inactivated variant as described in the present invention; and (2) a homologous or heterologous functional domain.

[0719] In a specific embodiment of the present invention, the homologous or heterologous functional domains are selected from one or more of the following: subcellular localization signals, DNA binding domains, protease domains, transcription activation domains, transcription repression domains, nuclease domains, deaminase domains, uracil DNA glycosylase domains (UDG), uracil DNA glycosylase inhibitory domains (UGI), methylases, demethylases, transcription release factors, histone acetylase domains, histone deacetylase domains, DNA ligases, epitope tags and reporter domains.

[0720] In a preferred embodiment of the present invention, the nuclease domain comprises a polypeptide having ssDNA cleavage activity and / or a polypeptide having dsDNA cleavage activity.

[0721] In a specific embodiment of the present invention, the Cas12 functional domain is directly or indirectly connected to the homologous or heterologous functional domain.

[0722] In a preferred embodiment of the present invention, the direct connection is covalent connection, and the indirect connection is connection via an amino acid linker or a non-amino acid linker.

[0723] In a more preferred embodiment of the present invention, the homologous or heterologous functional domain is fused or conjugated at the N-terminus, C-terminus or internally relative to the Cas12 functional domain.

[0724] In the present invention, the fusion protein refers to the connection between the element (1) and the element (2) via a peptide segment, or a direct connection; the conjugate refers to the connection between the element (1) and the element (2) via a non-peptide chemical bond.

[0725] On the other hand, a technical solution provided by the present invention is: an isolated nucleic acid, which encodes the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the Cas12 inactivated variant as described in the present invention, or the Cas12 fusion protein or conjugate as described in the present invention.

[0726] In a preferred embodiment of the invention, the nucleic acid is codon-optimized for expression in cells.

[0727] In a more preferred embodiment of the invention, the nucleic acid is codon-optimized for expression in a eukaryote, a mammal such as a human or non-human mammal, a plant, an insect, a bird, a reptile, a rodent (e.g., mouse, rat), a fish, a worm / nematode, or a yeast.

[0728] On the other hand, a technical solution provided by the present invention is: a CRISPR-Cas12 system, the CRISPR-Cas12 system comprising:

[0729] a. a Cas12 functional domain, a Cas12 fusion protein or conjugate as described in the present invention, or a nucleic acid as described in the present invention, wherein the Cas12 functional domain comprises a Cas12 protein as described in the present invention, a Cas12 protein mutant as described in the present invention, or a Cas12 inactivated variant as described in the present invention; and

[0730] b. a guide polynucleotide, or a polynucleotide sequence encoding the guide polynucleotide;

[0731] The Cas12 functional domain or the Cas12 fusion protein or conjugate forms a complex with the guide polynucleotide; the guide polynucleotide comprises a guide sequence, and the guide sequence is engineered to guide the sequence-specific binding of the complex to the target nucleic acid.

[0732] In specific embodiments of the invention, the guide polynucleotide comprises a direct repeat sequence linked to a guide sequence.

[0733] In a specific embodiment of the present invention, the nucleotide sequence of the direct repeat sequence is shown as SEQ ID NO: 26 or SEQ ID NO: 41.

[0734] In specific embodiments of the invention, the guide polynucleotide comprises a direct repeat sequence linked to a guide sequence. Further, in some specific embodiments, the direct repeat sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97% or at least 98% sequence identity to the sequence shown in SEQ ID NO: 9. Still further, in some specific embodiments, the direct repeat sequence comprises or is the sequence shown in SEQ ID NO: 26 or SEQ ID NO: 41.

[0735] In a specific embodiment of the present invention, the guide sequence comprises 15 to 35 nucleotides, and / or the guide sequence hybridizes to the target nucleic acid, and the guide sequence and the target nucleic acid are 90% to 100% complementary, preferably with no more than one nucleotide mismatch.

[0736] In a specific embodiment of the invention, the guide sequence is located at the 5' end or the 3' end of the direct repeat sequence.

[0737] In a specific embodiment of the invention, the guide sequence is located at the 5' end of the direct repeat sequence.

[0738] In a specific embodiment of the invention, the guide sequence is located at the 3' end of the direct repeat sequence.

[0739] In a preferred embodiment of the present invention, the guiding polynucleotide is the guiding polynucleotide described in the present invention.

[0740] In a specific embodiment of the present invention, the target nucleic acid is DNA or RNA, preferably dsDNA or ssDNA.

[0741] In a preferred embodiment of the present invention, the DNA is eukaryotic DNA; preferably, the eukaryotic DNA is non-human mammalian DNA, non-human primate DNA, human DNA, plant DNA, insect DNA, bird DNA, reptile DNA, rodent DNA, fish DNA, worm / nematode DNA or yeast DNA.

[0742] In a specific embodiment of the present invention, the target nucleic acid is a disease or disorder-associated gene or a signal transduction biochemical pathway-associated gene, or the target nucleic acid is a reporter gene; for example, the disease or disorder is a blood system disease or disorder, an ophthalmic disease or disorder, a nervous system disease or disorder, a respiratory system disease or disorder, a liver disease or disorder, a metabolic system disease or disorder, cancer or an infectious disease.

[0743] On the other hand, a technical solution provided by the present invention is: a vector system, wherein the vector system comprises one or more recombinant vectors, and the recombinant vector comprises the isolated nucleic acid as described in the present invention, or the CRISPR-Cas12 system as described in the present invention.

[0744] In a specific embodiment of the present invention, the recombinant vector further comprises a regulatory sequence.

[0745] In a specific embodiment of the present invention, the vector system comprises one or more recombinant vectors, which contain a polynucleotide sequence encoding the Cas12 protein, Cas12 protein mutant, Cas12 inactivated variant or Cas12 fusion protein or conjugate of the present invention, and a polynucleotide sequence encoding the guide polynucleotide.

[0746] In a specific embodiment of the present invention, the polynucleotide sequence encoding the Cas12 protein, Cas12 protein mutant, Cas12 inactivated variant or Cas12 fusion protein or conjugate is operably linked to the regulatory sequence 1.

[0747] In a specific embodiment of the present invention, the polynucleotide sequence encoding the guide polynucleotide is operably linked to regulatory sequence 2.

[0748] Furthermore, in a specific embodiment of the present invention, the regulatory sequence 1 and the regulatory sequence 2 are identical or different sequences.

[0749] In a preferred embodiment of the present invention, the regulatory sequence is optionally selected from: one or more of a promoter, an enhancer, an internal ribosome entry site and a transcription termination signal; the promoter is, for example, a constitutive promoter, an inducible promoter, a broad-spectrum promoter or a tissue-specific promoter, and / or the transcription termination signal is, for example, a polyadenylation signal or a poly-U sequence.

[0750] In a specific embodiment of the present invention, the backbone of the recombinant vector is an adeno-associated virus vector, a lentivirus vector, a ribonucleoprotein complex or a virus-like particle.

[0751] In a preferred embodiment of the present invention:

[0752] When the backbone is an adeno-associated viral vector, the adeno-associated viral vector is a recombinant adeno-associated viral vector of serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13;

[0753] When the backbone is a lentiviral vector, the lentiviral vector is pseudotyped with an envelope protein; in a specific embodiment of the present invention, the isolated nucleic acid is linked to an aptamer sequence;

[0754] When the backbone is a virus-like particle, the isolated nucleic acid is linked to a gene encoding a gag protein.

[0755] On the other hand, a technical solution provided by the present invention is: a delivery system, which comprises: (1) a delivery tool, and (2) the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guide polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0756] In a preferred embodiment of the present invention, the delivery vehicle is a virus, lipid nanoparticle, nanoparticle, liposome, exosome, microbubble or gene gun.

[0757] In a more preferred embodiment of the present invention, the delivery vehicle is a lipid nanoparticle, which comprises the guide polynucleotide and mRNA encoding the Cas12 protein, the Cas12 inactivated variant, the Cas12 protein mutant or the Cas12 fusion protein or conjugate.

[0758] On the other hand, a technical solution provided by the present invention is: a cell, comprising the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guide polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0759] In a preferred embodiment of the present invention, the cell is a eukaryotic cell.

[0760] In a more preferred embodiment of the present invention, the eukaryotic cell is a mammalian cell.

[0761] On the other hand, a technical solution provided by the present invention is: a pharmaceutical composition, comprising the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guide polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0762] In a specific embodiment of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

[0763] On the other hand, a technical solution provided by the present invention is: a kit comprising the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guide polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0764] In a preferred embodiment of the present invention, the kit further comprises a cutting buffer (Cut Buffer). The cutting buffer can be any buffer known in the art suitable for Cas12 protein to cut the target nucleic acid.

[0765] The cleavage buffer preferably comprises Tris-HCl, KCl, MgCl2, DTT, glycerol and ATP.

[0766] In a more preferred embodiment of the present invention, the cleavage buffer satisfies one or more of the following conditions:

[0767] The pH of Tris-HCl is 7.0-8.0; the concentration of Tris-HCl is 180-220 mM; the concentration of KCl is 480-520 mM; the concentration of MgCl2 is 45-55 mM; the concentration of DTT is 4.5-5.5 mM; the volume percentage of glycerol is 8%-12%; and the concentration of ATP is 0.8-1.2 mM.

[0768] The cutting buffer is 10×Cut Buffer, and its concentration in the reaction system is one tenth of that.

[0769] On the other hand, a technical solution provided by the present invention is: the use of the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guiding polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention in the preparation of a reagent or drug for diagnosing, treating and / or preventing a disease or condition associated with a target nucleic acid.

[0770] In specific embodiments of the present invention, the disease or condition is a hematological disease or condition, an ophthalmic disease or condition, a nervous system disease or condition, a respiratory system disease or condition, a liver disease or condition, a metabolic system disease or condition, cancer or an infectious disease; and / or the agent or drug is used to: cut one or more target nucleic acid molecules or cause a nick in one or more target nucleic acid molecules, activate or upregulate the expression of one or more target nucleic acid molecules, activate or inhibit the transcription of one or more target nucleic acid molecules, inactivate one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules.

[0771] On the other hand, a technical solution provided by the present invention is: a method for detecting, binding or cutting a target nucleic acid, the method comprising using a Cas12 protein as described in the present invention, a Cas12 protein mutant as described in the present invention, a guide polynucleotide as described in the present invention, a Cas12 inactivated variant as described in the present invention, a Cas12 fusion protein or conjugate as described in the present invention, or a nucleic acid as described in the present invention, a CRISPR-Cas12 system as described in the present invention, a vector system as described in the present invention, a delivery system as described in the present invention, a cell as described in the present invention, a pharmaceutical composition as described in the present invention, or a kit as described in the present invention to contact the target nucleic acid.

[0772] In a preferred embodiment of the present invention, the method is a method for non-diagnostic and / or therapeutic purposes; and / or the Cas12 fusion protein or conjugate comprises a detectable label, such as a label detectable by fluorescence, Southern blot or FISH.

[0773] In a more preferred embodiment of the present invention, when the method is for cutting the target nucleic acid, the method further comprises using a cutting buffer (Cut Buffer) to carry out a cutting reaction. The cutting buffer can be any buffer suitable for Cas12 protein cutting target nucleic acid known in the art.

[0774] The cleavage buffer preferably comprises Tris-HCl, KCl, MgCl2, DTT, glycerol and ATP.

[0775] In a further preferred embodiment of the present invention, the cleavage buffer satisfies one or more of the following conditions:

[0776] The pH of Tris-HCl is 7.0-8.0; the concentration of Tris-HCl is 180-220 mM; the concentration of KCl is 480-520 mM; the concentration of MgCl2 is 45-55 mM; the concentration of DTT is 4.5-5.5 mM; the volume percentage of glycerol is 8%-12%; and the concentration of ATP is 0.8-1.2 mM.

[0777] The cutting buffer is 10×Cut Buffer, and its concentration in the reaction system is one tenth of that.

[0778] On the other hand, a technical solution provided by the present invention is: a method for changing the state of a cell, the method comprising using the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guide polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention to contact the cell, thereby changing the cell state.

[0779] In preferred embodiments of the invention, the method results in one or more of the following: (i) induction of cellular senescence in vitro or in vivo; (ii) cell cycle arrest in vitro or in vivo; (iii) cell growth promotion and / or cell growth inhibition in vitro or in vivo; (iv) induction of anergy in vitro or in vivo; (v) induction of apoptosis in vitro or in vivo; and (vi) induction of necrosis in vitro or in vivo.

[0780] In a more preferred embodiment of the present invention, the method is a method for non-diagnostic and / or therapeutic purposes.

[0781] On the other hand, a technical solution provided by the present invention is: a method for diagnosing, treating or preventing a disease or condition associated with a target nucleic acid, administering a Cas12 protein as described in the present invention, a Cas12 protein mutant as described in the present invention, a guide polynucleotide as described in the present invention, a Cas12 inactivated variant as described in the present invention, a Cas12 fusion protein or conjugate as described in the present invention, or a nucleic acid as described in the present invention, a CRISPR-Cas12 system as described in the present invention, a vector system as described in the present invention, a delivery system as described in the present invention, a cell as described in the present invention, a pharmaceutical composition as described in the present invention, or a kit as described in the present invention to a sample of a subject in need or to a subject in need.

[0782] In a specific embodiment of the present invention, the disease or disorder is a hematological disease or disorder, an ophthalmic disease or disorder, a nervous system disease or disorder, a respiratory system disease or disorder, a liver disease or disorder, a metabolic system disease or disorder, cancer or an infectious disease.

[0783] On the other hand, a technical solution provided by the present invention is: the Cas12 protein as described in the present invention, the Cas12 protein mutant as described in the present invention, the guiding polynucleotide as described in the present invention, the Cas12 inactivated variant as described in the present invention, the Cas12 fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention, which is used to diagnose, treat or prevent diseases or conditions associated with target nucleic acids.

[0784] In a specific embodiment of the present invention, the disease or disorder is a hematological disease or disorder, an ophthalmic disease or disorder, a nervous system disease or disorder, a respiratory system disease or disorder, a liver disease or disorder, a metabolic system disease or disorder, cancer or an infectious disease.

[0785] A technical solution provided by the present invention is: a Cas12 protein, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 50% sequence identity compared to SEQ ID NO: 1, and the amino acid sequence of the Cas12 protein includes or is compared to SEQ ID NO: 1, comprising amino acid differences at positions N260, N295 and G705 and further comprising a sequence having amino acid differences at one, two or more positions selected from the following:

[0786] D166, V167, N168, G169, W170, S174, E179, K181, K182, E183, E184, Q294, E328, K370, N372, E376, E397, E462, V463, N621, D85 1. S853, A934, W938, N941, K942, K943, N945, N197, E788, K228, K231, E326, L329, K353, P362, G366, N368, N369, Y371, A392, K 395, D396, E399, E400, K401, G402, I403, H405, K408, E434, S433, K441, C448, G455, K502, T505, V842, K580R, T623, K774, S775, T850, K856, K926, Q929, N930, S940, S944, K580, S779, H511, N523, P524, P1032, P579, P984, L767, H995, P557, G232, and L662;

[0787] The amino acid difference is that the amino acid at the site is substituted with any other amino acid.

[0788] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 80% sequence identity with SEQ ID NO: 1.

[0789] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 85% sequence identity with SEQ ID NO: 1.

[0790] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to SEQ ID NO: 1.

[0791] Optionally, the Cas12 protein can recognize the PAM sequence of 5'-TTN.

[0792] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 10% higher than that of the Cas12 protein having a sequence of SEQ ID NO: 1.

[0793] In a specific embodiment of the present invention, the gene editing efficiency of the Cas12 protein is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150%, at least 180%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260% or at least 270% higher than the gene editing efficiency of the Cas12 protein having a sequence of SEQ ID NO: 1.

[0794] In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the reporter system targeting Example 1 of the present disclosure. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA shown in any one of SEQ ID NOs: 10-12 in human cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA shown in any one of SEQ ID NOs: 10-12 in 293T cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA comprising the guide sequence shown in any one of SEQ ID NOs: 14-16 in human cells. In a specific embodiment of the present invention, the gene editing efficiency is the editing efficiency of the Cas12 protein in conjunction with the gRNA comprising the guide sequence shown in any one of SEQ ID NOs: 14-16 in 293T cells.

[0795] In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of introducing indel. In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of single base editing of the Cas12 protein or the fusion protein or conjugate. In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of transcriptional activation or transcriptional inhibition caused by the Cas12 protein or the fusion protein or conjugate. The gene editing efficiency can be obtained by testing conventional methods in the art.

[0796] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or comprises amino acid differences at positions N260, N295 and G705 compared to SEQ ID NO: 1, and at positions:

[0797] D166, V167, N168, G169, W170, S174, E179, K181, K182, E183, E184, Q294, E328, K370, N372, E376, E397, E462, V463, N621, D851, S853, A934, W938, N941, K942, K943, N945, N197, E78 8. K228, K231, E326, L329, K353, P362, G366, N368, N369, Y371, A392, K395, D396, E399, E400, K401, G402, I4 03, H405, K408, E434, S433, K441, C448, G455, K502, T505, V842, K580R, T623, K774, S775, T850, K856, K926, Q929, N930, S940, S944, K580, S779, H511, N523, P524, P1032, P579, P984, L767, H995, P557, G232, or L662; or

[0798] E788 and N197; or

[0799] T505 and V842; or

[0800] H511 and N523; or

[0801] N523 and P524;

[0802] Amino acid sequences with amino acid differences.

[0803] In a specific embodiment of the present invention, the amino acid differences are positions N260, N295, G705, E179, K181, K182, E183, E184, E328, K370, N372, E376, E397, E462, V463, D851, S853, A934, W938, N941, K942, K943, N945, E788, K228, K231, E326, L329, K353, P362, G366, N368, N369, Y371, A392 , K395, D396, E399, E400, K401, G402, I403, H405, K408, E434, S433, K441, G455, K502, T505, K580, T623, K774, S775, S779, T850, K856, K926, Q929, N930, S940, S944, N523, P524, P1032, P579, P984, P557, and N197 are substituted with positively charged amino acids, e.g., R, H, or K; and / or,

[0804] The amino acids at positions G232 and N621 are substituted with negatively charged amino acids, such as D or E; and / or,

[0805] The amino acids at positions H511 and H995 are substituted with neutral amino acids, such as N, C, Q, S or T; and / or,

[0806] The amino acid at positions D166, N168, W170, S174, Q294, C448, V842, L767, and L662 is substituted with a non-polar amino acid, such as G, P, A, I, L, V, M, F, W, or Y; and / or

[0807] The amino acids at positions V167 and G169 are substituted with positively charged amino acids, such as R, H, or K; or with non-polar amino acids, such as G, P, A, I, L, V, M, F, W, or Y.

[0808] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R, N295R and G705R amino acid differences compared to SEQ ID NO: 1, and further comprises a sequence selected from the following one, two or more amino acid differences:

[0809] D166W, D166F, V167W, V167F, V167R, N168W, N168F, G169W, G169F, G169R, W170F, S174W, S174F, E179R, K181R, K182R, E183R, E184R, Q294W, Q294F, E328R, K370R, N372R, E376R, E397R, E462R, V463R, N621D, D851R, S853R, A934R, W938R, N941R, K942R, K943R, N945R, N197K, E788R, K228R, K231R, L329R, K353R, P362R, G366R, N368R, N369R, Y371R, A392R, K395R, D396R, E399R, E400R, K401R, G402R, I403R, H405R, K408R, E434R, S433R, K441R, C448A, G455R, K502R, T505R, V842I, K580R, T623R, K774R, S775R, S779R, T850R, K856R, K926R, Q929R, N930R, S940R, S944R, H511N, N523H, P524H, P1032H, P579H, P984H, L767M, H995N, P557H, G232D, and L662M.

[0810] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is a sequence comprising N260R, N295R and G705R amino acid differences compared to SEQ ID NO: 1, and

[0811] The following amino acid differences are also included: D166W, D166F, V167W, V167F, V167R, N168W, N168F, G169W, G169F, G169R, W170F, S174W, S174F, E179R, K181R, K182R, E183R, E184R, Q294W, Q294F, E 328R, K370R, N372R, E376R, E397R, E462R, V463R, N621D, D851R, S853R, A934R, W 938R, N941R, K942R, K943R, N945R, N197K, E788R, K228R, K231R, E326R, L329R, K3 53R, P362R, G366R, N368R, N369R, Y371R, A392R, K395R, D396R, E399R, E400R, K4 01R, G402R, I403R, H405R, K408R, E434R, S433R, K441R, C448A, G455R, K502R, K58 0R, T623R, K774R, S775R, S779R, T850R, K856R, K926R, Q929R, N930R, S940R, S944R, H511N, P524H, P1032H, P579H, P984H, L767M, H995N, P557H, G232D, or L662M; or

[0812] Also contains the amino acid differences: E788R and N197K; or,

[0813] Also contains the amino acid differences: T505R and V842I; or,

[0814] Also contains the amino acid differences: H511N and N523H; or,

[0815] Also contains amino acid differences: N523H and P524H.

[0816] In a specific embodiment of the present invention, the amino acid sequence of the Cas12 protein includes or is compared with SEQ ID NO: 1, and the amino acid difference is:

[0817] N295R, N260R, G705R and D166W;

[0818] N295R, N260R, G705R and D166F;

[0819] N295R, N260R, G705R and V167W;

[0820] N295R, N260R, G705R and V167F;

[0821] N295R, N260R, G705R and V167R;

[0822] N295R, N260R, G705R and N168W;

[0823] N295R, N260R, G705R and N168F;

[0824] N295R, N260R, G705R and G169W;

[0825] N295R, N260R, G705R and G169F;

[0826] N295R, N260R, G705R and G169R;

[0827] N295R, N260R, G705R and W170F;

[0828] N295R, N260R, G705R and S174W;

[0829] N295R, N260R, G705R, and S174F;

[0830] N295R, N260R, G705R and E179R;

[0831] N295R, N260R, G705R and K181R;

[0832] N295R, N260R, G705R and K182R;

[0833] N295R, N260R, G705R and E183R;

[0834] N295R, N260R, G705R and E184R;

[0835] N295R, N260R, G705R and Q294W;

[0836] N295R, N260R, G705R and Q294F;

[0837] N295R, N260R, G705R and E328R;

[0838] N295R, N260R, G705R and K370R;

[0839] N295R, N260R, G705R and N372R;

[0840] N295R, N260R, G705R and E376R;

[0841] N295R, N260R, G705R and E397R;

[0842] N295R, N260R, G705R and E462R;

[0843] N295R, N260R, G705R and V463R;

[0844] N295R, N260R, G705R and N621D;

[0845] N295R, N260R, G705R and D851R;

[0846] N295R, N260R, G705R and S853R;

[0847] N295R, N260R, G705R and A934R;

[0848] N295R, N260R, G705R and W938R;

[0849] N295R, N260R, G705R and N941R;

[0850] N295R, N260R, G705R and K942R;

[0851] N295R, N260R, G705R and K943R;

[0852] N295R, N260R, G705R and N945R;

[0853] N295R, N260R, G705R and N197K;

[0854] N295R, N260R, G705R and E788R;

[0855] N295R, N260R, G705R, E788R and N197K;

[0856] N295R, N260R, G705R and K181R;

[0857] N295R, N260R, G705R and K228R;

[0858] N295R, N260R, G705R and K231R;

[0859] N295R, N260R, G705R and E326R;

[0860] N295R, N260R, G705R and L329R;

[0861] N295R, N260R, G705R and K353R;

[0862] N295R, N260R, G705R and P362R;

[0863] N295R, N260R, G705R and G366R;

[0864] N295R, N260R, G705R and N368R;

[0865] N295R, N260R, G705R and N369R;

[0866] N295R, N260R, G705R and K370R;

[0867] N295R, N260R, G705R, and Y371R;

[0868] N295R, N260R, G705R and N372R;

[0869] N295R, N260R, G705R and A392R;

[0870] N295R, N260R, G705R and K395R;

[0871] N295R, N260R, G705R and D396R;

[0872] N295R, N260R, G705R and E399R;

[0873] N295R, N260R, G705R, and E400R;

[0874] N295R, N260R, G705R and K401R;

[0875] N295R, N260R, G705R and G402R;

[0876] N295R, N260R, G705R and I403R;

[0877] N295R, N260R, G705R and H405R;

[0878] N295R, N260R, G705R and K408R;

[0879] N295R, N260R, G705R and E434R;

[0880] N295R, N260R, G705R and S433R;

[0881] N295R, N260R, G705R and K441R;

[0882] N295R, N260R, G705R, and C448A;

[0883] N295R, N260R, G705R and G455R;

[0884] N295R, N260R, G705R and K502R;

[0885] N295R, N260R, G705R, T505R, and V842I;

[0886] N295R, N260R, G705R and K580R;

[0887] N295R, N260R, G705R and T623R;

[0888] N295R, N260R, G705R and K774R;

[0889] N295R, N260R, G705R and S775R;

[0890] N295R, N260R, G705R and S779R;

[0891] N295R, N260R, G705R and T850R;

[0892] N295R, N260R, G705R and K856R;

[0893] N295R, N260R, G705R and K926R;

[0894] N295R, N260R, G705R and Q929R;

[0895] N295R, N260R, G705R and N930R;

[0896] N295R, N260R, G705R and S940R;

[0897] N295R, N260R, G705R and S944R;

[0898] N295R, N260R, G705R and E326R;

[0899] N295R, N260R, G705R, and Y371R;

[0900] N295R, N260R, G705R and E434R;

[0901] N295R, N260R, G705R and K580R;

[0902] N295R, N260R, G705R and K774R;

[0903] N295R, N260R, G705R and S779R;

[0904] N295R, N260R, G705R and H511N;

[0905] N295R, N260R, G705R, H511N, and N523H;

[0906] N295R, N260R, G705R, and P524H;

[0907] N295R, N260R, G705R, N523H, and P524H;

[0908] N295R, N260R, G705R, and P1032H;

[0909] N295R, N260R, G705R, and P579H;

[0910] N295R, N260R, G705R, and P984H;

[0911] N295R, N260R, G705R and L767M;

[0912] N295R, N260R, G705R and H995N;

[0913] N295R, N260R, G705R, and P557H;

[0914] N295R, N260R, G705R, and G232D; or,

[0915] N295R, N260R, G705R and L662M.

[0916] Optionally, the Cas12 protein can recognize a PAM sequence of 5'-TTN, where N is A, T, C or G.

[0917] A technical solution provided by the present invention is: a fusion protein or conjugate, which comprises the Cas12 protein or its functional fragment as described in the present invention fused to a homologous or heterologous functional domain.

[0918] In some embodiments, the fusion of Cas12 protein does not change the original function of the Cas12 protein, including but not limited to the function of binding and cutting target nucleic acid.

[0919] In a specific embodiment of the present invention, the homologous or heterologous functional domain is selected from one or more of the following: subcellular localization signals, DNA binding domains, protein targeting moieties, transcription activation domains, transcription repression domains, nucleases, base editing domains such as deaminase domains, methylases, demethylases, transcription release factors, histone deacetylases, polypeptides with ssDNA cleavage activity, polypeptides with dsDNA cleavage activity, DNA ligases, epitope tags, reporter proteins and detection labels.

[0920] In a specific embodiment of the present invention, the Cas12 protein is covalently linked to the homologous or heterologous functional domain.

[0921] In a specific embodiment of the present invention, the Cas12 protein is directly linked to the homologous or heterologous functional domain, or is covalently linked through an amino acid linker or a non-amino acid linker.

[0922] In a specific embodiment of the present invention, the homologous or heterologous functional domain is fused or conjugated at the N-terminus, C-terminus or internally relative to the Cas12 protein.

[0923] Alternatively, the fusion protein or conjugate can recognize a PAM sequence of 5'-TTN, wherein N is A, T, C or G.

[0924] A technical solution provided by the present invention is: an isolated nucleic acid, which encodes the Cas12 protein as described in the present invention or the fusion protein or conjugate as described in the present invention.

[0925] In a specific embodiment of the invention, the nucleic acid is codon-optimized for expression in a cell.

[0926] In specific embodiments of the invention, the nucleic acid is codon-optimized for expression in a eukaryote, a mammal such as a human or non-human mammal, a plant, an insect, a bird, a reptile, a rodent (e.g., mouse, rat), a fish, a worm / nematode, or a yeast.

[0927] A technical solution provided by the present invention is: a CRISPR-Cas12 system, wherein the CRISPR-Cas12 system comprises:

[0928] a. The Cas12 protein according to the present invention, the fusion protein or conjugate according to the present invention, or the nucleic acid according to the present invention;

[0929] as well as

[0930] b. a guide polynucleotide, or a polynucleotide sequence encoding the guide polynucleotide;

[0931] The Cas12 protein or the fusion protein or conjugate forms a CRISPR complex with the guide polynucleotide; the guide polynucleotide comprises a guide sequence engineered to guide sequence-specific binding of the CRISPR complex to a target nucleic acid.

[0932] In a specific embodiment of the invention, the guide polynucleotide comprises a direct repeat sequence linked to a guide sequence; the nucleotide sequence of the direct repeat sequence is at least 80% identical to SEQ ID NO: 17.

[0933] In a specific embodiment of the present invention, the nucleotide sequence of the direct repeat sequence is shown as SEQ ID NO: 17.

[0934] In a specific embodiment of the present invention, the target nucleic acid is DNA or RNA, preferably dsDNA or ssDNA.

[0935] In a specific embodiment of the present invention, the DNA is eukaryotic DNA; preferably, the eukaryotic DNA is non-human mammal DNA, non-human primate DNA, human DNA, plant DNA, insect DNA, bird DNA, reptile DNA, rodent DNA, fish DNA, worm / nematode DNA or yeast DNA.

[0936] In a specific embodiment of the present invention, the target nucleic acid is a disease-related gene or a signal transduction biochemical pathway-related gene, or the target nucleic acid is a reporter gene.

[0937] In a specific embodiment of the present invention, the disease-related gene or signal transduction biochemical pathway-related gene is TTR (transthyretin), HBB (hemoglobin β) or HBG (hemoglobin γ-globin) gene; the reporter gene is GFP (green fluorescent protein) gene.

[0938] In a specific embodiment of the present invention, the guide sequence comprises 15-35 nucleotides, and / or the guide sequence hybridizes to the target nucleic acid, and the guide sequence is 90% to 100% complementary to the target nucleic acid, preferably with no more than one nucleotide mismatch. In a specific embodiment of the present invention, the guide sequence is optionally selected from the sequences shown in SEQ ID NOs: 14 to 16.

[0939] In a specific embodiment of the invention, the guide sequence is located at the 3' end of the direct repeat sequence.

[0940] A technical solution provided by the present invention is: a vector system, wherein the vector system comprises one or more vectors, and the vector comprises the isolated nucleic acid as described in the present invention, or the CRISPR-Cas12 system as described in the present invention.

[0941] In a specific embodiment of the present invention, the vector further comprises a regulatory sequence.

[0942] In a specific embodiment of the present invention, the regulatory sequence comprises one or more selected from: a promoter, an enhancer, an internal ribosome entry site and a transcription termination signal; the promoter is, for example, a constitutive promoter, an inducible promoter, a broad-spectrum promoter or a tissue-specific promoter, and / or the transcription termination signal is, for example, a polyadenylation signal or a poly-U sequence.

[0943] In a specific embodiment of the present invention, the regulatory sequence is operably linked to the vector.

[0944] In a specific embodiment of the present invention, the backbone of the vector is pCDNA3.1.

[0945] In a specific embodiment of the present invention, the vector is an adeno-associated virus vector, a lentivirus vector, a ribonucleoprotein complex or a virus-like particle.

[0946] In a specific embodiment of the present invention:

[0947] When the vector is an adeno-associated viral vector, the adeno-associated viral vector is a recombinant adeno-associated viral vector of serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13;

[0948] When the vector is a lentiviral vector, the lentiviral vector is pseudotyped with an envelope protein; optionally, the isolated nucleic acid is linked to an aptamer sequence;

[0949] When the vector is a virus-like particle, the isolated nucleic acid is linked to a gene encoding a gag protein.

[0950] A technical solution provided by the present invention is: a delivery system, the delivery system comprising:

[0951] (1) the means of delivery, and

[0952] (2) The Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, or the nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0953] In a specific embodiment of the present invention, the delivery vehicle is a lipid nanoparticle, a nanoparticle, a liposome, an exosome, a microbubble or a gene gun.

[0954] In a specific embodiment of the present invention, the delivery vehicle is a lipid nanoparticle comprising the guide polynucleotide and mRNA encoding the Cas12 protein or the fusion protein or conjugate.

[0955] A technical solution provided by the present invention is: a cell, which contains the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, or the vector system as described in the present invention.

[0956] In a specific embodiment of the invention, the cell is a eukaryotic cell.

[0957] In a specific embodiment of the invention, the eukaryotic cell is a mammalian cell.

[0958] A technical solution provided by the present invention is: a pharmaceutical composition, comprising the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0959] In a specific embodiment of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

[0960] A technical solution provided by the present invention is: a kit comprising the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, or the cell as described in the present invention.

[0961] A technical solution provided by the present invention is: use of the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention in the preparation of a reagent or drug for diagnosing, treating and / or preventing a disease or condition associated with a target nucleic acid.

[0962] In specific embodiments of the present invention, the agents or drugs are used to: cleave or nick one or more target nucleic acid molecules, activate or upregulate the expression of one or more target nucleic acid molecules, activate or inhibit the transcription of one or more target nucleic acid molecules, inactivate one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules.

[0963] A technical solution provided by the present invention is: a method for detecting, binding or cutting a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention or the kit as described in the present invention.

[0964] In a specific embodiment of the invention, the method is a method for non-diagnostic and / or therapeutic purposes; and / or the fusion protein or conjugate comprises a detectable label, such as a label detectable by fluorescence, Southern blotting or FISH.

[0965] A technical solution provided by the present invention is: a method for changing the state of a cell, the method comprising contacting the cell with the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention, thereby changing the cell state.

[0966] In specific embodiments of the invention, the method results in one or more of the following: (i) induction of cellular senescence in vitro or in vivo; (ii) cell cycle arrest in vitro or in vivo; (iii) cell growth inhibition and / or cell growth suppression in vitro or in vivo; (iv) induction of anergy in vitro or in vivo; (v) induction of apoptosis in vitro or in vivo; and (vi) induction of necrosis in vitro or in vivo.

[0967] In a specific embodiment of the invention, the method is a method for non-diagnostic and / or therapeutic purposes.

[0968] A technical solution provided by the present invention is: a method for diagnosing, treating and / or preventing a disease or condition associated with a target nucleic acid, administering the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention to a sample of a subject in need or to a subject in need.

[0969] A technical solution provided by the present invention is: the Cas12 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas12 system as described in the present invention, the vector system as described in the present invention, the delivery system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention or the kit as described in the present invention, which is used for diagnosing, treating and / or preventing diseases or conditions associated with target nucleic acids.

[0970] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0971] The reagents and raw materials used in the present invention are commercially available.

[0972] The positive progress effect of the present invention is:

[0973] In some embodiments, the present invention improves the gene editing efficiency in mammalian cells by performing rational and irrational mutations on the amino acid sequence of the natural Cas12 protein as shown in SEQ ID NO: 1.

[0974] Through bioinformatics analysis and experimental verification, the inventors screened and obtained a new Cas protein with DNA cleavage ability, named C12-102. Its amino acid sequence length is 1112aa, which is relatively shorter than the currently commonly used SpCas9 protein (1368aa) and AsCpf1 protein (1307aa), making it easier to be packaged in small-capacity gene therapy vectors (such as AAV).

[0975] The PAM sequences of many Cas12s contain two or more specific bases and are rich in T (for example, TTTN, TTN), while the PAM sequence of C12-102 is a single A base, so it can be used to edit many target sequences that were previously difficult to edit, greatly expanding the editable range.

[0976] In addition, the inventors conducted wet experiment tests on mutants at some sites of the amino acid sequence through bioinformatics analysis and prediction of C12-102 and Cas12-Y2, and obtained a series of mutants. BRIEF DESCRIPTION OF THE DRAWINGS

[0977] Figure 1 is a map of the pCDH-CMV-EGFP-Reporter3-EF1a-Puro plasmid.

[0978] FIG2 is an SDS-PAGE electrophoresis diagram of the C12-102 recombinant protein.

[0979] FIG3 is a schematic diagram of the C12-102 targeting template sequence for PAM recognition.

[0980] FIG4 shows the 7nt random sequence recognized by C12-102-sgRNA.

[0981] FIG5 shows the 7nt random sequence recognized by C12-102-sgRNA-Rev.

[0982] FIG6 is a graph showing the gel electrophoresis detection of dsDNA cut by C12-102.

[0983] FIG7 is a graph showing the fluorescence test results of C12-102 cutting ssDNA.

[0984] Figure 8 shows the bilobal structure of C12-102, including the recognition (REC) lobe and the nuclease (NUC) lobe. DETAILED DESCRIPTION

[0985] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, procedures in molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA used herein are conventional procedures widely used in the relevant fields. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0986] In the present invention, "plurality" refers to greater than or equal to two.

[0987] In the present invention, the letters in the amino acid sequence represent the single-letter abbreviations of amino acids known in the art, such as those described in J.Biol.Chem, 243, p3558 (1968): alanine: Ala-A, arginine: Arg-R, aspartic acid: Asp-D, cysteine: Cys-C, glutamine: Gln-Q, glutamic acid: Glu-E, histidine: His-H, glycine: Gly-G, asparagine: Asn-N, tyrosine: Tyr-Y, proline: Pro-P, serine: Ser-S, methionine: Met-M, lysine: Lys-K, valine: Val-V, isoleucine: Ile-I, phenylalanine: Phe-F, leucine: Leu-L, tryptophan: Trp-W, threonine: Thr-T.

[0988] In the present invention, "comprising or being" or "including or being" means that the technical solution has both open-ended expressions and closed-ended expressions. For example, "the amino acid sequence of the Cas12 protein includes or is an amino acid sequence having an amino acid difference at the S211 site compared to SEQ ID NO: 18", and its solution includes an open-ended expression of "the Cas12 protein includes an amino acid sequence having a difference at the S211 site compared to SEQ ID NO: 18", and a closed-ended expression of "the amino acid sequence of the Cas12 protein is compared to the amino acid sequence shown in SEQ ID NO: 18, and there is only an amino acid difference at the S211 site".

[0989] In the present invention, "amino acid difference" refers to the difference in amino acid residues at specific sites in the amino acid sequence of a protein, including substitution, addition or reduction.

[0990] It is well known to those skilled in the art that in a protein or peptide, two adjacent amino acids each remove an OH or H and undergo dehydration condensation to form a peptide bond, and each amino acid actually exists in the form of an amino acid residue. Therefore, in this disclosure, the terms "amino acid" and "amino acid residue" generally represent the same meaning. In addition, in order to simplify the expression, the amino acid residue before substitution is retained before the site where the amino acid residue is located in this disclosure, the letter before the site represents the original amino acid residue, and the letter after the site represents the amino acid residue after substitution, and "△" indicates that the original amino acid residue does not exist. For example, S211 represents that the original amino acid residue at site 211 is S. When it is replaced by R, it can be expressed as S211R.

[0991] In the present invention, the numbers represented by the sites refer to the positions of the amino acid residues corresponding to the amino acid sequences of Cas12 protein or Cas12 protein mutants SEQ ID NO: 1, SEQ ID NO: 18 or SEQ ID NO: 40.

[0992] In the present invention, when an amino acid is substituted, it means that it is replaced by another amino acid residue that is different from the original amino acid residue. If the original amino acid residue is a positively charged amino acid and it is replaced by a positively charged amino acid, it means that it is replaced by another positively charged amino acid residue that is different from the original amino acid residue. For example, if the original amino acid residue is R and it is replaced by a positively charged amino acid, it means that it is replaced by H or K.

[0993] In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide. In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the sequence-specific binding of the CRISPR complex to the target nucleic acid. In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide includes a guide sequence that is engineered to guide the sequence-specific binding of the CRISPR complex to the target nucleic acid. In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence-specific binding and cleavage of the target nucleic acid. Optionally, the target nucleic acid is a single-stranded nucleic acid or a double-stranded nucleic acid; alternatively, the target nucleic acid is a single-stranded DNA or a double-stranded DNA; alternatively, the cutting of the target nucleic acid is to cut only one single strand in the double-stranded nucleic acid, or the cutting of the target nucleic acid is to cut two single strands in the double-stranded nucleic acid; alternatively, the cutting of the target nucleic acid is to cut only one single strand in the double-stranded DNA, or the cutting of the target nucleic acid is to cut two single strands in the double-stranded DNA. In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence-specific binding to the target nucleic acid and causes a base conversion of at least one base in the target nucleic acid. In some embodiments of the present invention, the Cas12 protein, Cas12 mutant, Cas12 inactivated variant, Cas12 fusion protein or Cas12 conjugate can form a CRISPR complex with a guide polynucleotide, and the guide polynucleotide guides the CRISPR complex sequence to bind specifically to the target nucleic acid and regulate the expression of at least one gene on the target nucleic acid. Alternatively, the at least one base is 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases or 10 bases. Alternatively, the at least one gene is 1 gene, 2 genes, 3 genes, 4 genes, 5 genes, 6 genes, 7 genes, 8 genes, 9 genes or 10 genes.

[0994] Sequence identity

[0995] As used herein, the term "sequence identity" (identity or percent identity) is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a certain position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (for example, a certain position in each of the two DNA molecules is occupied by adenine, or a certain position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent sequence identity" (percent identity) between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100%. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% sequence identity. Typically, comparisons are made when two sequences are aligned to produce maximum sequence identity. Such comparisons can be performed using published and commercially available alignment algorithms and programs, such as, but not limited to, ClustalΩ, MAFFT, Probcons, T-Coffee, Probalign, BLAST, which can be reasonably selected by one of ordinary skill in the art. Those skilled in the art can determine appropriate parameters for aligning sequences, including, for example, any algorithms needed to achieve better alignment or optimal comparison over the entire length of the sequences being compared, as well as any algorithms needed to achieve better alignment or optimal comparison over a portion of the sequences being compared.

[0996] CRISPR-Cas12 system

[0997] As used herein, the terms "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-Associated (Cas) (CRISPR-Cas) System" or "CRISPR System" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally include transcripts or other elements related to the expression of CRISPR-associated ("Cas") genes, or transcripts or other elements capable of directing the activity of the Cas genes. Such transcripts or other elements may include sequences encoding Cas effector proteins and guide polynucleotides.

[0998] Zhang Feng's group discovered Cas12a in 2015, classifying it as type V within the Class I CRISPR-Cas system. Following detailed studies of subtype V (Cas12a), Zhang Feng's group also reported Cas12b (C2C1) in 2015. In 2017, Burstein et al. reported the Cas12e (CasX) nuclease. In 2019, Winston X. Yan et al. detailed the newly discovered type V Cas effector proteins, Cas12c, Cas12h, Cas12i, and Cas12g, through bioinformatics analysis.

[0999] In some embodiments, the Cas12 protein described herein refers to a protein having an amino acid sequence comprising or having at least 50%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to SEQ ID NO: 1. When the CRISPR-Cas12 system includes a fusion protein or conjugate comprising the Cas12 protein and a protein domain, the percentage of sequence identity between the Cas12 portion of the fusion protein or conjugate and the reference sequence is calculated.

[1000] In the present invention, the CRISPR-Cas12 system comprises a Cas12 protein having at least 50% sequence identity with SEQ ID NO: 1, or a nucleic acid encoding the Cas12 protein, and a guide polynucleotide or a nucleic acid encoding the guide polynucleotide, wherein the guide polynucleotide comprises a direct repeat sequence connected to a guide sequence, and the guide sequence is engineered to hybridize with the target DNA, and the guide polynucleotide is capable of forming a CRISPR complex with the Cas12 protein and guiding the CRISPR complex to sequence-specific binding to the target DNA.

[1001] In some embodiments, the Cas12 protein described herein refers to a protein having an amino acid sequence comprising or having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID NO: 18. The Cas12 protein mutant described herein refers to a protein having an amino acid sequence comprising or having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to SEQ ID NO: 40. When the CRISPR-Cas12 system includes a Cas12 fusion protein or conjugate comprising the Cas12 protein or Cas12 protein mutant and a protein domain, the percentage of sequence identity between the Cas12 portion of the Cas12 fusion protein or conjugate and the reference sequence is calculated.

[1002] In the present invention, the CRISPR-Cas12 system comprises a Cas12 protein having at least 50% sequence identity compared to SEQ ID NO: 18 or a Cas12 protein mutant having at least 70% sequence identity compared to SEQ ID NO: 40, or nucleic acids encoding them, and a guide polynucleotide or a nucleic acid encoding the guide polynucleotide, the guide polynucleotide comprising a direct repeat sequence connected to a guide sequence, the guide sequence being engineered to hybridize with a target nucleic acid, and the guide polynucleotide being capable of forming a complex with the Cas12 protein or Cas12 protein mutant and guiding the complex to sequence-specific binding to the target nucleic acid.

[1003] Guide polynucleotide

[1004] As used herein, the term "guide polynucleotide" is used to refer to a molecule in the CRISPR-Cas system that forms a CRISPR complex with the Cas protein and guides the CRISPR complex to the target sequence. Typically, the guide polynucleotide comprises a backbone sequence connected to a guide sequence that can hybridize with the target sequence. The backbone sequence typically comprises a direct repeat sequence and sometimes may further comprise a tracrRNA sequence. In the Cas12-based CRISPR system of the present invention, a tracrRNA sequence is not required.

[1005] In some embodiments, the guidance polynucleotide of the CRISPR-Cas12 system is a guidance DNA. In some embodiments, the guidance polynucleotide is a chemically modified guidance polynucleotide. In some embodiments, the guidance polynucleotide comprises at least one chemically modified nucleotide.

[1006] In some embodiments, the guide polynucleotide comprises at least one guide sequence (also known as a spacer sequence) linked to at least one direct repeat (DR). In some embodiments, the guide sequence is located at the 3' end of the direct repeat. In some embodiments, the guide sequence is located at the 5' end of the direct repeat.

[1007] In some embodiments, the guide sequence comprises at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, or at least 30 nucleotides. In some embodiments, the guide sequence comprises no more than 60 nucleotides, no more than 55 nucleotides, no more than 50 nucleotides, no more than 45 nucleotides, no more than 40 nucleotides, no more than 35 nucleotides, or no more than 30 nucleotides. In some embodiments, the guide sequence comprises 15-20 nucleotides, 20-25 nucleotides, 25-30 nucleotides, 30-35 nucleotides, or 35-40 nucleotides.

[1008] In some embodiments, the guide sequence has sufficient complementarity to the target DNA sequence to hybridize with the target DNA and guide sequence-specific binding of the CRISPR-Cas12 complex to the target DNA. In some embodiments, the guide sequence has 100% complementarity to the target DNA (or region of the DNA to be targeted), but the guide sequence can have less than 100% complementarity to the target DNA, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% complementarity.

[1009] In some embodiments, the guide sequence is engineered to hybridize to the target DNA with no more than two nucleotide mismatches. In some embodiments, the guide sequence is engineered to hybridize to the target DNA with no more than one nucleotide mismatches. In some embodiments, the guide sequence is engineered to hybridize to the target DNA with or without mismatches.

[1010] In some embodiments, the same direction repeat sequence comprises at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 25 nucleotides, at least 26 nucleotides, at least 27 nucleotides, at least 28 nucleotides, at least 29 nucleotides, at least 30 nucleotides, at least 31 nucleotides, at least 32 nucleotides, at least 33 nucleotides, at least 34 nucleotides, at least 35 nucleotides or at least 36 nucleotides. In some embodiments, the same direction repeat sequence comprises no more than 60 nucleotides, no more than 55 nucleotides, no more than 50 nucleotides, no more than 45 nucleotides, no more than 40 nucleotides or no more than 35 nucleotides. In some embodiments, the same direction repeat sequence comprises 20-25 nucleotides, 25-30 nucleotides, 30-35 nucleotides or 35-40 nucleotides.

[1011] In some embodiments, the direct repeat sequence has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity compared to SEQ ID NO: 17 or SEQ ID NO: 26.

[1012] In some embodiments, the CRISPR-Cas12 system comprises at least 2, at least 3, at least 4, at least 5, at least 10, or at least 20 different guide polynucleotides. In some embodiments, the guide polynucleotides target at least 2, at least 3, at least 4, at least 5, at least 10, or at least 20 different target DNA molecules, or target at least 2, at least 3, at least 4, at least 5, at least 10, or at least 20 different regions of one or more target DNA molecules.

[1013] In some embodiments, the guidance polynucleotide includes a constant directional repeat sequence located upstream of the variable guide sequence. In some embodiments, a plurality of guidance polynucleotides are a part for an array (which can be a part of a vector, such as a viral vector or a plasmid). For example, the guidance array including the sequence DR-spacer-DR-spacer-DR-spacer can include three unique unprocessed guidance polynucleotides (one for each DR-spacer sequence). Once introduced into a cell or a cell-free system, the array is processed into three separate mature guidance polynucleotides by the Cas12 protein. This allows multiplexing, such as by delivering a plurality of guidance polynucleotides to a cell or system to target multiple target DNAs or multiple regions within a single target DNA.

[1014] The ability of a guide polynucleotide to direct sequence-specific binding of a CRISPR complex to a target DNA can be assessed by any suitable assay. For example, components of a CRISPR system sufficient to form a CRISPR complex, including the guide polynucleotide to be tested, can be provided to a host cell with a corresponding target DNA molecule, such as by transfection of a vector encoding the components of the CRISPR complex, and preferential cleavage within the target sequence can be assessed. Similarly, cleavage of a target DNA sequence can be assessed in a test tube by providing the target DNA, components of a CRISPR complex, including the guide polynucleotide to be tested and a control guide polynucleotide that is different from the test guide polynucleotide, and comparing the ability to bind to the target DNA or the rate at which the target DNA is cut between the test and control guide polynucleotides. The ability of a CRISPR complex to cut a target nucleic acid or target DNA can also be assessed by the assays described above.

[1015] Cas12 mutants

[1016] In some embodiments, the Cas12 proteins provided herein comprise one or more mutations, such as a single amino acid insertion, a single amino acid deletion, a single amino acid substitution, or a combination thereof, compared to the wild-type Cas12 protein (SEQ ID NO: 1, SEQ ID NO: 18, or SEQ ID NO: 40). In some examples, the Cas12 proteins provided herein comprise one or more mutations, such as a single amino acid insertion, a single amino acid deletion, a single amino acid substitution, or a combination thereof, compared to the wild-type Cas12 protein (SEQ ID NO: 1, SEQ ID NO: 18, or SEQ ID NO: 40). NO:40) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 7, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90 amino acid changes (e.g., insertions, deletions or substitutions), but retain the ability to bind to a target DNA molecule that is complementary to the guide sequence of the guide polynucleotide, and / or retain the ability to process the guide array RNA transcript into a guide polynucleotide molecule. In some examples, the Cas12 protein is the same as the wild-type Cas12 protein (SEQ ID NO: 1, SEQ ID NO: 18 or SEQ ID NO:40) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90 amino acid changes (e.g., insertions, deletions or substitutions) but retain the ability to bind to a target DNA molecule that is complementary to the guide sequence of the guide polynucleotide.In some examples, the Cas12 protein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid changes (e.g., insertions, deletions or substitutions) compared to the wild-type Cas12 protein (SEQ ID NO: 1, SEQ ID NO: 18 or SEQ ID NO: 40), but retains the ability to bind to a target DNA molecule that is complementary to the guide sequence of the guide polynucleotide, and / or retains the ability to process guide array RNA transcripts into guide polynucleotide molecules.

[1017] A type of modification or mutation includes replacing an amino acid residue with a similar biochemical property, i.e., a conservative substitution (e.g., a conservative substitution of 1-4, 1-8, 1-10, or 1-20 amino acids). Typically, conservative substitutions have little or no effect on the activity of the resulting protein or peptide. For example, conservative substitutions are amino acid substitutions in Cas12 protein that substantially do not affect the binding of Cas12 protein to a target DNA molecule complementary to the gRNA molecule guide sequence, and / or the process of processing guidance array RNA transcripts into gRNA molecules.

[1018] More substantial changes can be made by using less conservative substitutions, for example, by selecting residues that differ more in maintaining: (a) the structure of the polypeptide backbone in the region where the substitution occurs, for example, as a helical or sheet conformation; (b) the charge or hydrophobicity of the region that interacts with the target site; or (c) the bulk of the side chain. Substitutions that would generally be expected to produce the greatest changes in polypeptide function are (a) substitutions between a hydrophilic residue (e.g., serine or threonine) and a hydrophobic residue (e.g., leucine, isoleucine, phenylalanine, valine, or alanine); (b) substitutions between cysteine ​​or proline and any other residue; (c) substitutions between a residue with a positively charged side chain (e.g., lysine, arginine, or histidine) and a negatively charged residue (e.g., glutamic acid or aspartic acid); or (d) substitutions between a residue with a bulky side chain (e.g., phenylalanine) and a residue without a side chain (e.g., glycine).

[1019] Cas12 active fragment

[1020] In the present invention, the biloba structure of the Cas12 protein C12-102 is as shown in Figure 8 (the structure of the C12-102 protein mutant of the present invention is also applicable to Figure 8), and the numbers in Figure 8 refer to the WED-I domain of the present invention, Helical-I1 domain, PI domain, Helical-I2 domain, Helical-II domain, WED-II domain, Ruvc-I domain, Helical-III domain, BH domain, Ruvc-II domain, Nuc domain and Ruvc-III domain correspond to the amino acid on SEQ ID NO:18. The domain boundaries of SEQ ID NO:40 and its mutants can be determined by comparing the corresponding positions of the boundaries with the sequences of C12-102 protein in Figure 8.

[1021] The Cas12 protein of the present invention, in addition to comprising the corresponding domain of the Cas12 active fragment, may also comprise the domain of the Cas12 protein in other prior art, which are combined into the complete structure of the Cas12 protein as shown in Figure 8 to achieve the function of the Cas12 protein of the present invention, including but not limited to retaining the ability of the Cas12 protein to bind to the target nucleic acid molecule complementary to the guide sequence of the guide polynucleotide, and / or retaining the ability to process the guide sequence RNA transcript into a guide polynucleotide molecule.

[1022] Cas12 inactivated variants

[1023] By making the RuvC domain of Cas12 inactive through point mutation, the Cas12 protein will lose its endonuclease activity. The resulting dCas12 can only bind to the target gene under the mediation of the guide polynucleotide, but does not have the function of cutting DNA.

[1024] The RuvC domain of Cas12 can also be partially inactivated by point mutation to form a Cas12 nickase (nCas12), which binds to the target gene under the guidance of a guide polynucleotide and cuts one of the single strands in the double-stranded nucleic acid without cutting the other single strand.

[1025] Therefore, dCas12 or nCas12 can be fused with other domains (including but not limited to deaminase domains, transcription activation domains, transcription repression domains, methylation domains, demethylation domains, histone acetylation domains, histone deacetylation domains), guided by the guide polynucleotide to the target sequence of the target nucleic acid, and then the corresponding functions are performed with the help of the other domains; for example, the conversion of base C→T is achieved by deaminating cytosine bases, the conversion of base A→G is achieved by deaminating adenine bases, transcription repression is achieved by the transcription repression domain KRAB, and transcription is promoted by the transcription activation domain VP64.

[1026] Subcellular localization signals

[1027] In some embodiments, the Cas12 protein is fused to at least one homologous or heterologous subcellular localization signal. Exemplary subcellular localization signals include organelle localization signals, such as nuclear localization signals (NLS), nuclear export signals (NES), or mitochondrial localization signals.

[1028] Protein domain

[1029] In some embodiments, the Cas12 protein or Cas12 protein mutant is covalently linked or fused to a homologous or heterologous protein domain.

[1030] In some embodiments, the protein domain is selected from one or more of the following: a DNA binding domain, a protease domain, a transcription activation domain, a transcription repression domain, a nuclease domain (including a polypeptide having ssDNA cleavage activity and / or a polypeptide having dsDNA cleavage activity), a deaminase domain, a uracil DNA glycosylase domain (UDG), a uracil DNA glycosylase inhibitory domain (UGI), a methylase, a demethylase, a transcription release factor, a histone acetylase domain, a histone deacetylase domain, a DNA ligase, an epitope tag, and a reporter domain.

[1031] In some embodiments, the Cas12 protein or Cas12 protein mutant may arbitrarily include 0, 1, 2, 3 or more protein domains at the N-terminus and / or C-terminus.

[1032] Vector system

[1033] Another aspect of the present disclosure relates to a vector system comprising the CRISPR-Cas12 system described herein, comprising one or more vectors comprising a polynucleotide sequence encoding the Cas12 protein and a polynucleotide sequence encoding the guide polynucleotide.

[1034] In some embodiments, the vector system comprises at least one plasmid or viral vector (e.g., retrovirus, lentivirus, adenovirus, adeno-associated virus, or herpes simplex virus). In some embodiments, the polynucleotide sequence encoding the Cas12 protein and the polynucleotide sequence encoding the guide polynucleotide are located on the same vector. In some embodiments, the polynucleotide sequence encoding the Cas12 protein and the polynucleotide sequence encoding the guide polynucleotide are located on multiple vectors.

[1035] In some embodiments, the polynucleotide sequence of the coding Cas12 protein and / or the polynucleotide sequence of the coding guidance polynucleotide are operably connected to a regulatory element. Regulatory elements include promoters, enhancers, internal ribosome entry sites (IRES) and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Regulatory elements include regulatory elements that make the nucleotide sequence constitutively expressed in many types of host cells, and regulatory elements (e.g., tissue-specific regulatory sequences) that make the nucleotide sequence expressed only in certain host cells. Tissue-specific promoters can be directly expressed mainly in desired tissues of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas) or specific cell types (e.g., lymphocytes). Regulatory elements can also guide expression in a time-dependent manner, such as in a cell cycle-dependent or developmental stage-dependent manner, which may or may not be tissue or cell type-specific. In some embodiments, the regulatory element is an enhancer element, such as WPRE, the CMV enhancer, the R-U5 segment in the LTR of HTLV-1, the SV40 enhancer, or the intronic sequence between exons 2 and 3 of rabbit β-globin.

[1036] In some embodiments, the vector comprises a pol III promoter (e.g., U6 and H1 promoters), a pol II promoter (e.g., the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), a cytomegalovirus (CMV) promoter (optionally with a CMV enhancer), an SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, a phosphoglycerol kinase (PGK) promoter, or an EF1α promoter), or a pol III promoter and a pol II promoter.

[1037] In some embodiments, the promoter is a constitutive promoter, which is continuously active and not regulated by external signals or molecules. Suitable constitutive promoters include, but are not limited to, CMV, RSV, SV40, EF1α, CAG, and β-actin promoters. In some embodiments, the promoter is an inducible promoter regulated by external signals or molecules (e.g., transcription factors).

[1038] In some embodiments, the promoter is a tissue-specific promoter, which can be used to drive the tissue-specific expression of Cas12 protein. Suitable muscle-specific promoters include but are not limited to CK8, MHCK7, myoglobin promoter (Mb), desmin (Desmin) promoter, muscle creatine kinase promoter (MCK) and variants thereof, and SPc5-12 synthetic promoters. Suitable immune cell-specific promoters include but are not limited to B29 promoter (B cells), CD14 promoter (monocytes), CD43 promoter (leukocytes and platelets), CD68 (macrophages) and SV40 / CD43 promoter (leukocytes and platelets). Suitable blood cell-specific promoters include but are not limited to CD43 promoter (leukocytes and platelets), CD45 promoter (hematopoietic cells), INF-β (hematopoietic cells), WASP promoter (hematopoietic cells), SV40 / CD43 promoter (leukocytes and platelets), and SV40 / CD45 promoter (hematopoietic cells). Suitable pancreas-specific promoters include but are not limited to elastase-1 promoter. Suitable endothelial cell-specific promoters include, but are not limited to, the Fit-1 promoter and the ICAM-2 promoter. Suitable neuronal tissue / cell-specific promoters include, but are not limited to, the GFAP promoter (astroglial cells), the SYN1 promoter (neurons), and the NSE / RU5' (mature neurons). Suitable kidney-specific promoters include, but are not limited to, the NphsI promoter (podocytes). Suitable bone-specific promoters include, but are not limited to, the OG-2 promoter (osteoblasts, odontoblasts). Suitable lung-specific promoters include, but are not limited to, the SP-B promoter (lung). Suitable liver-specific promoters include, but are not limited to, the SV40 / Alb promoter. Suitable heart-specific promoters include, but are not limited to, α-MHC.

[1039] AAV vectors

[1040] Another aspect of the present disclosure relates to an adeno-associated viral (AAV) vector comprising the CRISPR-Cas12 system described herein, wherein the adeno-associated viral (AAV) vector comprises DNA encoding the Cas12 protein and guide polynucleotide described herein.

[1041] Delivery of the CRISPR-Cas system by AAV vector is described in Maeder et al., Nature Medicine 25:229-233 (2019), which has been clinically demonstrated to be safe and effective for subretinal delivery of AAV. Local delivery by subretinal injection, the natural tropism of AAV5 for photoreceptor cells, and the use of the photoreceptor-specific GRK1 promoter are all used to limit the expression of the CRISPR / Cas system to therapeutic target tissues and cell types, which is incorporated herein by reference in its entirety. In some embodiments, the AAV vector comprises an ssDNA genome comprising a coding sequence for a Cas12 protein and a guide polynucleotide flanked by ITRs.

[1042] In some embodiments, the CRISPR-Cas12 system described herein is packaged in an AAV vector, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh74. In some embodiments, the CRISPR-Cas12 system described herein is packaged in an AAV vector comprising an engineered capsid with tissue tropism, such as an engineered muscle tropism capsid. Tabebordbar et al., Cell 184: 4919-4938 (2021) describes engineering of AAV capsids with tissue tropism by directed evolution, identifies a class of capsids containing RGD motifs, and systemic injection of MyoAAV can efficiently transduce primate muscles, which is incorporated herein by reference in its entirety.

[1043] lipid nanoparticles

[1044] Another aspect of the present disclosure relates to lipid nanoparticles (LNPs) comprising a CRISPR-Cas12 system described herein, wherein the LNP comprises a guide polynucleotide described herein and an mRNA encoding a Cas12 protein described herein.

[1045] Gillmore et al., N.Engl.J.Med., 385:493-502 (2021) describes the LNP delivery of the CRISPR-Cas system, lipid nanoparticles (LNPs) are composed of 4 lipids, including a proprietary ionizable lipid LP000001; DSPC; cholesterol and DMG-PEG2k, and the LNP suspension is formulated in an aqueous buffer of Tris, NaCl and sucrose, pH 7.4, which is incorporated herein by reference in its entirety. In some embodiments, in addition to RNA payload (Cas12 mRNA and guide polynucleotides), lipid nanoparticles (LNPs) also include four components: cationic or ionizable lipids, cholesterol, helper lipids, and PEG-lipids. In some embodiments, the cation or ionizable lipids include cKK-E12, C12-200, ALC-0315, DLin-MC3-DMA, DLin-KC2-DMA, FTT5, Moderna SM-102, and Intellia LP01. In some embodiments, the PEG-lipids include PEG-2000-C-DMG, PEG-2000-DMG, or ALC-0159. In some embodiments, the helper lipids include DSPC. The components of LNPs are described in Paunovska et al., Nature Reviews Genetics 23: 265-280 (2022), and FDA-approved LNPs contain variants of four basic ingredients: cation or ionizable lipids, cholesterol, helper lipids, and polyethylene glycol (PEG) lipids, which are incorporated herein by reference in their entirety.

[1046] Lentiviral vectors

[1047] Another aspect of the present disclosure relates to a lentiviral vector comprising a CRISPR-Cas12 system as described herein, wherein the lentiviral vector comprises a guide polynucleotide as described herein and an mRNA encoding a Cas12 protein as described herein. In some embodiments, the lentiviral vector is pseudotyped with a homologous or heterologous envelope protein such as VSV-G. In some embodiments, the mRNA encoding the Cas12 protein is connected to an aptamer sequence.

[1048] RNP complex

[1049] Another aspect of the present disclosure relates to a ribonucleoprotein complex comprising a CRISPR-Cas12 system as described herein, wherein the ribonucleoprotein complex is formed by a guidance polynucleotide and a Cas12 protein as described herein. In some embodiments, the ribonucleoprotein complex can be delivered to eukaryotic cells, mammalian cells, or human cells by microinjection or electroporation. In some embodiments, the ribonucleoprotein complex can be packaged in virus-like particles and delivered to a mammal or human subject in vivo.

[1050] virus-like particles

[1051] Another aspect of the present disclosure relates to a virus-like particle (VLP) comprising the CRISPR-Cas12 system described herein, wherein the virus-like particle comprises a guide polynucleotide and a Cas12 protein described herein, or a ribonucleoprotein complex consisting of the guide polynucleotide and the Cas12 protein.

[1052] Banskota et al. Cell 185(2):250-265(2022) reported the development and application of DNA-free virus-like particles (eVLPs) for efficient packaging and delivery of base editors or Cas9 ribonucleoprotein; Mangeot et al., Nature Communications 10(1):1-15(2019) used engineered mouse leukemia virus-like particles (Nanoblades) loaded with Cas9-sgRNA ribonucleoprotein to induce efficient genome editing in cell lines and primary cells (including human induced pluripotent stem cells, human hematopoietic stem cells and mouse bone marrow cells); Campbell, et al., Molecular Therapy 27:151-163 (2019) utilizes a kind of specialized extracellular vesicle called " gesicle ", effectively but transiently delivers Cas9 targeting HIV long terminal repeat sequence (LTR) in the form of ribonucleoprotein, Gesicles is produced by expressing vesicular stomatitis virus glycoprotein and packaging protein (as its cargo), so there is no need for transgenic delivery, so that Cas9 expression and Mangeot et al.Molecular Therapy, 19 (9): 1656-1666 (2011) reported that the overexpression of the spike glycoprotein of vesicular stomatitis virus (VSV-G) in human cells induced the release of fusogenic vesicles called gesicles, biochemical and functional studies have shown that glial cells bind proteins from production cells and can transport them to receptor cells, and this protein transduction method allows direct transport of cytoplasmic, nuclear or surface proteins in target cells. These documents all describe engineered VLPs, which are incorporated herein by reference in their entirety.

[1053] In some embodiments, engineered virus-like particles (VLPs) are pseudotyped with homologous or heterologous envelope proteins such as VSV-G. In some embodiments, the Cas12 protein is fused to a gag protein (e.g., MLVgag) via a cleavable linker, wherein the cleavage of the linker in the target cell exposes an NLS between the linker and the Cas12 protein. In some embodiments, the fusion protein or conjugate comprises (e.g., from 5' to 3') a gag protein (e.g., MLVgag), one or more NES, a cleavable linker, one or more NLS, and Cas12, as described in Banskota et al. Cell 185 (2): 250-265 (2022).

[1054] In some embodiments, the Cas12 protein is fused to a first dimerization domain that is capable of dimerizing or heterodimerizing with a second dimerization domain fused to a membrane protein, wherein the presence of a ligand promotes the dimerization and enriches the Cas12 protein or fusion protein or conjugate into VLPs as described in Campbell, et al., Molecular Therapy 27: 151-163 (2019).

[1055] cell

[1056] Another aspect of the present disclosure relates to cells comprising CRISPR-Cas12 systems as described herein.Cells (for example, which can be used to produce cell-free systems) can be eukaryotic or prokaryotic.The examples of such cells include, but are not limited to, bacteria, archaebacteria, plants, fungi, yeasts, insects, and mammalian cells, such as lactobacilli, lactococci, bacillus (for example, bacillus subtilis), Escherichia (for example, Escherichia coli), Clostridium, Saccharomyces or Pichia (such as saccharomyces cerevisiae or Pichia pastoris), Kluyveromyces lactis, Salmonella typhimurium, Drosophila cells, Caenorhabditis elegans cells, African clawed frog cells, SF9 cells, C129 cells, 293 cells, Neurospora and immortalized mammalian cell lines (for example, Hela cells, myeloid cell lines, and lymphoid cell lines).

[1057] In some embodiments, the cell is a prokaryotic cell, such as a bacterial cell, such as escherichia coli. In some embodiments, the cell is a eukaryotic cell, such as a mammalian cell or a human cell. In some embodiments, the cell is a primary eukaryotic cell, a stem cell, a tumor / cancer cell, a circulating tumor cell (CTC), a blood cell (for example, T cell, B cell, NK cell, Tregs etc.), a hematopoietic stem cell, a specialized immune cell (such as tumor infiltrating lymphocytes or tumor suppressor lymphocytes), a stromal cell (such as cancer associated fibroblasts etc.) in a tumor microenvironment. In some embodiments, the cell is the brain or neuronal cell (for example, neuron, astrocyte, microglia, retinal ganglion cell, rod / cone cell etc.) of a central or peripheral nervous system.

[1058] Target nucleic acid or target DNA

[1059] In some embodiments of the present invention, the target nucleic acid is target DNA.

[1060] The CRISPR-Cas12 system described herein can be used to target one or more target DNA molecules, such as target DNA molecules present in a biological sample, an environmental sample (e.g., a soil, air, or water sample), and the like.

[1061] In some embodiments, the target nucleic acid is a disease-related gene or a signaling biochemical pathway-related gene, or the target nucleic acid is a reporter gene. Non-limiting examples of such target nucleic acids include those listed in U.S. Provisional Patent Applications 61 / 736,527 and 61 / 748,427, filed on December 12, 2012 and January 2, 2013, respectively, and International Application No. PCT / US2013 / 074667, filed on December 12, 2013, all of which are incorporated herein by reference.

[1062] In the present invention, non-limiting examples of the target nucleic acid or target DNA include but are not limited to:

[1063] IL1B (interleukin 1, beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGIS (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin), IL4 (interleukin 4), ANGPT1 (angiopoietin 1), ABCG8 (ATP-binding cassette, subfamily G (white), member 8), CTSK (cathepsin K), PTGIR (prostaglandin 12 (prostacyclin) receptor (IP)), KCNJ11 (inwardly rectifier potassium channel, subfamily J, member 11), INS (insulin), CRP (C-reactive protein, pentraxin-related), PDG FRB (platelet-derived growth factor receptor, beta polypeptide), CCNA2 (cyclin A2), PDGFB (platelet-derived growth factor beta polypeptide (simian sarcoma virus (v-sis) oncogene homolog)), KCNJ5 (inwardly rectifier potassium channel, subfamily J, member 5), KCNN3 (potassium intermediate small conductance calcium-activated channel, subfamily N, member 3), CAPN10 (calpain 10), PTGES (prostaglandin E synthase), ADRA2B (adrenergic, α-2B-, receptor), ABCG5 (ATP-binding cassette, subfamily G (WHITE), member 5), PRDX2 (peroxide redox receptor). 2), CAPN5 (cardiac 5), PARP14 (poly (ADP-ribose) polymerase family, member 14), MEX3C (mex-3 homolog C (Caenorhabditis elegans)), ACE angiotensin I converting enzyme (peptidyl dipeptidase A) 1), TNF (tumor necrosis factor (TNF superfamily, member 2)), IL6 (interleukin 6 (interferon, beta 2)), STN (inhibin), SERPINE1 (serpin peptidase inhibitor, clade E (microtubule-linked protein, plasminogen activator inhibitor type 1), member 1), ALB (albumin), ADIPOQ (adiponectin, containing C1Q and collagen domains), APOB (apolipoprotein B (including Ag(x) antigen)), APOE (apolipoprotein E), LEP (leptin), MTHFR (5,10-methylenetetrahydrofolate reductase (NADPH)), APOA1 (apolipoprotein AI), EDN1 (endothelin 1), NPPB (natriuretic peptide pro-B), NOS3 (nitric oxide synthase 3 (endothelial cells)), PPARG (peroxisome proliferator-activated receptor gamma), PLAT (plasminogen activator, tissue), PTGS2 (prostaglandin endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), CETP (cholesterol ester transfer protein, plasma), AGTR1 (angiotensin II receptor,1), HMGCR (3-hydroxy-3-methylglutaryl-CoA reductase), IGF1 (insulin-like growth factor 1 (somatomedin C)), SELE (selectin E), REN (renin), PPARA (peroxisome proliferator-activated receptor alpha), PON1 (paraoxonase 1), KNG1 (kininogen 1), CCL2 (chemokine (CC motif) ligand 2), LPL (lipoprotein lipase), VWF (von Willebrand factor), F2 (coagulation factor II (thrombin)), ICAM1 (intercellular adhesion molecule 1), TGFB1 (transforming growth factor beta 1), NPPA (natriuretic peptide precursor A), IL10 (interleukin 10), EPO (erythropoietin-stimulating factor 1). cytokines), SOD1 (superoxide dismutase 1, soluble), VCAM1 (vascular cell adhesion molecule 1), IFNG (interferon gamma), LPA (lipoprotein, Lp(a)), MPO (myeloperoxidase), ESR1 (estrogen receptor 1), MAPK1 (mitogen-activated protein kinase 1), HP (haptoglobin), F3 (coagulation factor III (thromboplastin, tissue factor)), CST3 (cystatin C), COG2 (oligomeric Golgi complex component 2), MMP9 (matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type V collagenase)), SERPIN C1 (serine protease inhibitor peptidase inhibitor , evolutionary branch C (antithrombin), member 1), F8 (coagulation factor VIII, procoagulant component), HMOX1 (heme oxygenase (decycling) 1), APOC3 (apolipoprotein C-III), IL8 (interleukin 8), PROK1 (prokineticin 1), CBS (cystathionine-β-synthase), NOS2 (nitric oxide synthase 2, inducible), TLR4 (toll-like receptor 4), SELP (selectin P (granule membrane protein 140 kDa, antigen CD62)), ABCA1 (ATP binding cassette, subfamily A (ABC1), member 1), AGT (angiotensinogen (serine protease inhibitor peptidase inhibitor, evolutionary branch A, member 8)), LDLR (low Density lipoprotein receptor), GPT (alanine aminotransferase (alanine aminotransferase)), VEGFA (vascular endothelial growth factor A), NR3C2 (nuclear receptor subfamily 3, type C, member 2), IL18 (interleukin 18 (interferon-gamma-inducing factor)), NOS1 (nitric oxide synthase 1 (neuronal)), NR3C1 (nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)), FGB (fibrinogen beta chain), HGF (hepatocyte growth factor (hepatocyte growth factor A; scatter factor)), IL1A (interleukin 1, alpha), RETN (resistin), AKT1 (v-akt murine thymoma viral oncogene homolog 1), LIPC (lipase,hepatic), HSPD1 (heat shock 60 kDa protein 1 (chaperone)), MAPK14 (mitogen-activated protein kinase 14), SPP1 (secreted phosphoprotein 1), ITGB3 (integrin, β3 (platelet glycoprotein 111a, antigen CD61)), CAT (catalase), UTS2 (urotensin 2), THBD (thrombomodulin), F10 (coagulation factor X), CP (ceruloplasmin (ferroxidase)), TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b), EDNRA (endothelin type A receptor), EGFR (epidermal growth factor receptor (erythroleukemia virus (v-erb-b) oncogene homolog, avian)), MMP2 (matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type V collagenase)), PLG (plasminogen lysogen), NPY (neuropeptide Y), RHOD (ras homolog gene family, member D), MAPK8 (mitogen-activated protein kinase 8), MYC (V-Myc myelocytoma viral oncogene homolog (avian)), FN1 (fibronectin 1), CMA1 (chymase 1, mast cells), PLAU (plasminogen activator, urokinase), GNB3 (guanine nucleotide binding protein (G protein), beta polypeptide 3), ADRB2 (adrenergic, beta-2-, receptor, surface), APOA5 (apolipoprotein AV), SOD2 (superoxide dismutase), 2 (mitochondrial), F5 (coagulation factor V (prothrombin, labile factor)), VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor), ALOX5 (arachidonic acid 5-lipoxygenase), HLA-DRB1 (major histocompatibility complex, class I, DRβ1), PARP1 (poly (ADP-ribose) polymerase 1), CD40LG (CD40 ligand), PON2 (paraoxonase 2), AGER (receptor specific for advanced glycation end products), IRS1 (insulin receptor substrate 1), PTGS1 (prostaglandin endoperoxide synthase 1 (prostaglandin G / H synthase and cyclooxygenase)), ECE1 (endothelin-converting enzyme 1) , F7 (coagulation factor VII (serum prothrombin conversion accelerating factor)), URN (interleukin 1 receptor antagonist), EPHX2 (epoxide hydrolase 2, cytoplasmic), IGFBP1 (insulin-like growth factor binding protein 1), MAPK10 (mitogen-activated protein kinase 10), FAS (Fas (TNF receptor superfamily, member 6)), ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), JUN (jun oncogene), IGFBP3 (insulin-like growth factor binding protein 3), CD14 (CD14 molecule), PDE5A (phosphodiesterase 5A, cGMP-specific), AGTR2 (angiotensin II receptor,2), CD40 (CD40 molecule, TNF receptor superfamily member 5), LCAT (phosphatidylcholine cholesterol acyltransferase), CCR5 (chemokine (CC motif) receptor 5), MMP1 (matrix metallopeptidase 1 (interstitial collagenase)), TIMP1 (TIMP metallopeptidase inhibitor 1), ADM (adrenomedullin), DYT10 (dystonia 10), STAT3 (signal transducer and activator of transcription 3 (acute phase response factor)), MMP3 (matrix metallopeptidase 3 (matrilysin 1, pro-inflammatory cytokine)). gelatinase), ELN (elastin), USF1 (upstream transcription factor 1), CFH (complement factor H), HSPA4 (heat shock 70 kDa protein 4), MMP12 (matrix metallopeptidase 12 (macrophage elastase)), MME (membrane metalloendopeptidase), F2R (coagulation factor II (thrombin) receptor), SELL (selectin L), CTSB (cathepsin B), ANXA5 (annexin A5), ADRB1 (adrenergic, beta-1-, receptor), CYBA (cytokine receptor). Pigment b-245, alpha polypeptide), FGA (fibrinogen alpha chain), GGT1 (gamma-glutamyl transpeptidase 1), LIPG (lipase, endothelial), HIF1A (hypoxia-inducible factor 1, alpha subunit (basic-helix-loop-helix transcription factor)), CXCR4 (chemokine (CXC motif) receptor 4), PROC (protein C (coagulation factor Va and VIIIa inhibitor), SCARB1 (scavenger receptor class B, member 1), CD79A (CD79a molecule, immunoglobulin-related alpha), PL TP (phospholipid transfer protein), ADD1 (adductin 1 (alpha)), FGG (fibrinogen gamma chain), SAA1 (serum amyloid protein A1), KCNH2 (voltage-gated potassium channel, subfamily H (potential antennal-related), member 2), DPP4 (dipeptidyl peptidase 4), G6PD (glucose-6-phosphate dehydrogenase), NPR1 (natriuretic peptide receptor A / guanylate cyclase A (atrial natriuretic peptide receptor A)), VTN (vitronectin), KIAA0101 (KIAA0101), FOS (FBJ Murine osteosarcoma viral oncogene homolog), TLR2 (toll-like receptor 2), PPIG (peptidylprolyl isomerase G (cyclophilin G)), IL1R1 (interleukin 1 receptor, type I), AR (androgen receptor), CYP1A1 (cytochrome P450, family 1, subfamily A, polypeptide 1), SERPINA1 (serine protease inhibitor, clade A (alpha-1 antiprotease, antitrypsin), member 1), MTR (5-methyltetrahydrofolate homocysteine ​​methyltransferase), RBP4 (retinol binding protein 4, plasma), APOA4 (apolipoprotein A-IV), CDKN2A (cyclin-dependent kinase inhibitor 2A (melanoma p16,Inhibits CDK4), FGF2 (fibroblast growth factor 2 (basic)), EDNRB (endothelin receptor type B), ITGA2 (integrin, α2 (CD49B, VLA-2 receptor α2 subunit)), CABIN1 (calcineurin binding protein 1), SHBG (sex hormone binding globulin), HMGB1 (high mobility group box 1), HSP90B2P (heat shock protein 90 kDa beta (Grp94), member 2 (pseudogene)), CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4), GJA1 (gap junction protein, α1, 43 kDa), CAV1 (caveolin 1, plasma membrane microcystin, 22 kDa) a), ESR2 (estrogen receptor 2 (ERβ)), LTA (lymphotoxin alpha (TNF superfamily, member 1)), GDF15 (growth differentiation factor 15), BDNF (brain-derived neurotrophic factor), CYP2D6 (cytochrome P450, family 2, subfamily D, polypeptide 6), NGF (nerve growth factor (beta polypeptide)), SP1 (Sp1 transcription factor), TGIF1 (TGFB-inducible factor homeobox 1), SRC (v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)), EGF (epidermal growth factor (beta-gastrin)), PIK3CG (phosphoinositide-3- Kinase, catalytic, gamma polypeptide), HLA-A (major histocompatibility complex, class I, A), KCNQ1 (voltage-gated potassium channel, KQT-like subfamily, member 1), CNR1 (cannabinoid receptor 1 (brain)), FBN1 (fibrillary protein 1), CHKA (choline kinase alpha), BEST1 (yolk-like maculopathy protein 1), APP (amyloid beta (A4) precursor protein), CTNNB1 (catenin (cadherin-associated protein), beta 1, 88 kDa), IL2 (interleukin 2), CD36 (CD36 molecule (thrombospondin receptor)), PRKAB1 (protein kinase, AMP-activated, beta 1 non-catalytic subunit), TPO (thyroxine kinase). Adenoperoxidase (ALDH7A1), ALDH7A1 (aldehyde dehydrogenase family 7, member A1), CX3CR1 (chemokine (C-X3-C motif) receptor 1), TH (tyrosine hydroxylase), F9 (coagulation factor IX), GH1 (growth hormone 1), TF (transferrin), HFE (hemochromatosis), IL17A (interleukin 17A), PTEN (phosphatase and tensin homolog), GSTM1 (glutathione S-transferase μ1), DMD (dystrophin), GATA4 (GATA binding protein 4), F13A1 (coagulation factor XIII, A1 polypeptide), TTR (transthyretin), FABP4 (fatty acid binding protein 4,adipocytes), PON3 (paraoxonase 3), APOC1 (apolipoprotein C1), INSR (insulin receptor), TNFRSF1B (tumor necrosis factor receptor superfamily, member 1B), HTR2A (5-hydroxytryptamine (serotonin) receptor 2A), CSF3 (colony stimulating factor 3 (granulocytes)), CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9), TXN (thioredoxin), CYP11B2 (cytochrome P450, family 11, subfamily B, polypeptide 2), PTH (parathyroid hormone), CSF2 (colony stimulating factor 2 (granulocyte-macrophage)), KDR (kinase insert domain receptor (type II receptor tyrosine kinase) kinase), PLA2G2A (phospholipase A2, type IIA (platelets, synovial fluid)), B2M (beta-2-microglobulin), THBS1 (thrombospondin 1), GCG (glucagon), RHOA (ras homolog gene family, member A), ALDH2 (aldehyde dehydrogenase 2 family (mitochondrial)), TCF7L2 (transcription factor 7-like 2 (T cell-specific HMG box)), BDKRB2 (bradykinin receptor B2), NFE2L2 (erythroid-derived nuclear factor 2-like protein), NOTCH1 (Notch homolog 1, translocation-related (Drosophila)), UGT1A1 (UDP glucuronosyltransferase 1 family, polypeptide A1), IFNA1 (interferon, alpha 1), PPARD (peroxisome proliferator-activated receptor delta), SIRT1 (longevity protein (silent mating type I information regulation 2 homolog) 1 (Saccharomyces cerevisiae)), GNRH1 (gonadotropin-releasing hormone 1 (luteinizing hormone-releasing hormone)), PAPPA (pregnancy-associated plasma protein A, pappus 1), ARR3 (arrestin 3, retinal (X-arrestin)), NPPC (natriuretic peptide precursor C), AHSP (alpha hemoglobin stabilizing protein), PTK2 (PTK2 protein tyrosine kinase 2), IL13 (interleukin 13), MTOR (mechanical target of rapamycin (serine / threonine kinase)), ITGB2 (integrin, beta 2 (complement building block) 3 receptor subunits 3 and 4)), GSTT1 (glutathione S-transferase theta 1), IL6ST (interleukin 6 signaling factor (gp130, oncostatin M receptor)), CPB2 (carboxypeptidase B2 (plasma)), CYP1A2 (cytochrome P450, family 1, subfamily A, polypeptide 2), HNF4A (hepatocyte nuclear factor 4, alpha), SLC6A4 (solute carrier family 6 (neurotransmitter transporter, serotonin), member 4), PLA2G6 (phospholipase A2, type VI (cytosolic, calcium-dependent)), TNFSF11 (tumor necrosis factor (ligand) superfamily, member 11), SLC8A1 (solute carrier family 8 (sodium / calcium exchanger),member 1), F2RL1 (coagulation factor II (thrombin) receptor-like 1), AKR1A1 (aldo-keto reductase family 1, member A1 (aldehyde reductase)), ALDH9A1 (aldehyde dehydrogenase family 9, member A1), BGLAP (bone gamma-carboxyglutamate (gla) protein), MTTP (microsomal triglyceride transfer protein), MTRR (5-methyltetrahydrofolate-homocysteine ​​methyltransferase reductase), SULT1A3 (sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3), RAGE (renal tumor antigen), C4B (complement component 4B (Qidu blood group), P2RY12 (purinergic receptor P2Y, G-protein coupled, 12), RNLS (renal enzyme, FAD-dependent amine oxidase), CREB1 (cAMP response element binding protein 1), POMC (proopiomelanocortin), RAC1 (ras-related C Botulinum toxin substrate 1 (rho family, small GTP-binding protein Rac1), LMNA (lamin NC), CD59 (CD59 molecule, complement regulatory protein), SCN5A (sodium channel, voltage-gated, V-type, alpha subunit), CYP1B1 (cytochrome P450, family 1, subfamily B, polypeptide 1), MIF (macrophage migration inhibitory factor (glycosylation inhibitor)), MMP13 (matrix metallopeptidase 13 (collagenase 3)), TIMP2 (TIMP metallopeptidase inhibitor 2), CYP19A1 (cytochrome P450, family 19, subfamily A, polypeptide 1), CYP21A2 (cytochrome P450, family 21, subfamily A, polypeptide 2), PTPN22 (protein tyrosine phosphatase, non-receptor type 22 (lymphoid)), MYH14 (myosin, heavy chain 14, non-muscle), MBL2 (mannose-binding lectin (protein C) 2, soluble (opsonin deficiency)), SELPLG (selectin P ligand), AOC3 (amine oxidase, copper-containing 3 (vascular adhesion protein 1)), CTSL1 (cathepsin L1), PCNA (proliferating cell nuclear antigen), IGF2 (insulin-like growth factor 2 (somatomedin A)), ITGB1 (integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 including MDF2, MSK12)), CAST (calpain inhibitor), CXCL12 (chemotaxis). chemokine (CXC motif) ligand 12 (stromal cell-derived factor 1), IGHE (immunoglobulin constant region epsilon), KCNE1 (voltage-gated potassium channel, Isk-related family, member 1), TFRC (transferrin receptor (p90, CD71)), COL1A1 (collagen, type I, α1), COL1A2 (collagen, type I, α2), IL2RB (interleukin 2 receptor, β), PLA2G10 (phospholipase A2, type X), ANGPT2 (angiopoietin 2), PROCR (protein C receptor,Endothelial (EPCR)), NOX4 (NADPH oxidase 4), HAMP (hepcidin antimicrobial peptide), PTPN11 (protein tyrosine phosphatase, non-receptor type 1), SLC2A1 (solute carrier family 2 (facilitated glucose transporter), member 1), IL2RA (interleukin 2 receptor, alpha), CCL5 (chemokine (C-C motif) ligand 5), IRF1 (interferon regulatory factor 1), CFLAR (CASP8 and FADD-like regulator of apoptosis), CALCA (calcitonin-related polypeptide alpha), EIF4E (eukaryotic translation initiation factor 4E), GSTP1 (glutathione S-transferase pi1), JAK2 (Janus kinase 2), C YP3A5 (cytochrome P450, family 3, subfamily A, polypeptide 5), HSPG2 (heparan sulfate proteoglycan 2), CCL3 (chemokine (CC motif) ligand 3), MYD88 (myeloid differentiation primary response gene (88)), VIP (vasoactive intestinal peptide), SOAT1 (sterol O-acyltransferase 1), ADRBK1 (adrenergic, beta, receptor kinase 1), NR4A2 (nuclear receptor subfamily 4, type A, member 2), MMP8 (matrix metallopeptidase 8 (neutrophil collagenase)), NPR2 (natriuretic peptide receptor B / guanylate cyclase B (atrial natriuretic peptide receptor B)), GCH1 (GTP cyclohydrolase 1), EPRS (glutamyl-proline kinase 1), acyl-tRNA synthetase), PPARGC1A (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha), F12 (coagulation factor XII (Hagemann factor)), PECAM1 (platelet / endothelial cell adhesion molecule), CCL4 (chemokine (CC motif) ligand 4), SERPINA3 (serpin peptidase inhibitor, clade A (alpha-1 antiprotease, antitrypsin), member 3), CASR (calcium sensing receptor), GJA5 (gap junction protein, alpha 5, 40 kDa), FABP2 (fatty acid binding protein 2, intestinal), TTF2 (transcription termination factor, RNA polymerase II), PROS1 (protein S (alpha)), CTF1 ( Cardiotrophin 1), SGCB (sarcoglycan, beta (43 kDa dystrophin-related glycoprotein)), YME1L1 (YME1-like 1 (Saccharomyces cerevisiae)), CAMP (casericidal antimicrobial peptide), ZC3H12A (zinc finger CCCH type 12A), AKR1B1 (aldoketoreductase family 1, member B1 (aldose reductase)), DES (desmin), MMP7 (matrix metallopeptidase 7 (matrimolytic factor, uterine)), AHR (aryl hydrocarbon receptor), CSF1 (colony stimulating factor 1 (macrophage)), HDAC9 (histone deacetylase 9), CTGF (connective tissue growth factor), KCNMA1 (large conductance calcium-activated potassium channel, subfamily M,α member 1), UGT1A (UDP glucuronosyltransferase 1 family, polypeptide A complex locus), PRKCA (protein kinase C, α), COMT (catechol-β-methyltransferase), S100B (S100calcium binding protein B), EGR1 (early growth response protein 1), PRL (prolactin), IL15 (interleukin 15), DRD4 (dopamine receptor D4), CAMK2G (calcium-calmodulin-dependent protein kinase IIγ), SLC22A2 (solute carrier family 22 (organic cation transporter), member 2), CCL11 (chemokine (CC motif) ligand 11), PGF (B32 1 placental growth factor), THPO (thrombopoietin), GP6 (glycoprotein VI (platelets)), TACR1 (tachykinin receptor 1), NTS (neurotensin), HNF1A (HNF1 homeobox A), SST (somatostatin), KCND1 (voltage-gated potassium channel, Shal-related subfamily, member 1), LOC646627 (phospholipase inhibitor), TBXAS1 (thromboxane A synthase 1 (platelets)), CYP2J2 (cytochrome P450, family 2, subfamily J, polypeptide 2), TBXA2R (thromboxane A2 receptor), ADH1C (alcohol dehydrogenase 1C (class I, gamma polypeptide), ALOX12 (arachidonic acid tetramer), enoate 12-lipoxygenase), AHSG (alpha-2-HS-glycoprotein), BHMT (betaine homocysteine ​​methyltransferase), GJA4 (gap junction protein, alpha 4, 37 kDa), SLC25A4 (solute carrier family 25 (mitochondrial carrier; adenine nucleotide transporter), member 4), ACLY (ATP citrate lyase), ALOX5AP (arachidonate 5-lipoxygenase-activating protein), NUMA1 (nuclear mitotic apparatus protein 1), CYP27B1 (cytochrome P450, family 27, subfamily B, polypeptide 1), CYSLTR2 (cysteinyl leukotriene receptor 2), SOD3 (superoxide dismutase). 3, extracellular), LTC4S (leukotriene C4 synthase), UCN (urocortin), GHRL (ghrelin / obesityn precursor peptide), APOC2 (apolipoprotein C-II), CLEC4A (C-type lectin domain family 4, member A), KBTBD10 (Kelch repeat and BTB (POZ) domain-containing protein), TNC (tenascin C), TYMS (thymidylate synthase), SHCl (SHC (Src homology 2 domain-containing) converting protein 1), LRP1 (low-density lipoprotein receptor-related protein 1), SOCS3 (suppressor of cytokine signaling 3), ADH1B (alcohol dehydrogenase 1B (class I),beta polypeptide), KLK3 (kallikrein-related peptidase 3), HSD11B1 (hydroxysterol (11-beta) dehydrogenase 1), VKORC1 (vitamin K epoxide reductase complex, subunit 1), SERPINB2 (serpin peptidase inhibitor, evolutionary branch B (ovalbumin), member 2), TNS1 (tensin 1), RNF19A (RING finger protein 9A), EPOR (erythropoietin receptor), ITGAM (integrin, αM (complement component 3 receptor 3 subunit)), PITX2 (paired-like homeodomain 2), MAPK7 (mitogen-activated protein kinase 7), FCGR3A (Fc fragment of IgG, low affinity 111a, receptor (CD1 6a)), LEPR (leptin receptor), ENG (endoglin), GPX1 (glutathione peroxidase 1), GOT2 (glutamic oxaloacetate aminotransferase 2, mitochondrial (aspartate aminotransferase 2)), HRH1 (histamine receptor H1), NR112 (nuclear receptor subfamily 1, type I, member 2), CRH (corticotropin-releasing hormone), HTR1A (5-hydroxytryptamine (serotonin) receptor 1A), VDAC1 (voltage-dependent anion channel 1), HPSE (heparanase), SFTPD (surfactant protein D), TAP2 (transporter 2, ATP-binding cassette, subfamily B (MDR / TAP)), RNF123 (RING finger protein 123), PTK2B (PTK2B protein tyrosine kinase 2 beta), NTRK2 (neurotrophic tyrosine kinase, receptor, type 2), IL6R (interleukin 6 receptor), ACHE (acetylcholinesterase (Yt blood type)), GLP1R (glucagon-like peptide 1 receptor), GHR (growth hormone receptor), GSR (glutathione reductase), NQO1 (NAD(P)H dehydrogenase, quinone 1), NR5A1 (nuclear receptor subfamily 5, type A, member 1), GJB2 (gap junction protein, beta 2, 26 kDa), SLC9A1 (solute carrier family 9 (sodium / hydrogen exchanger), member 1), MAOA (monoamine oxidase A), PCSK9 (proprotein convertase subtilisin / kexin type 9) , FCGR2A (Fc fragment of IgG, low affinity IIa, receptor (CD32)), SERPINF1 (serpin peptidase inhibitor, evolutionary branch F (alpha-2 antiplasmin, pigment epithelium-derived factor), member 1), EDN3 (endothelin 3), DHFR (dihydrofolate reductase), GAS6 (growth arrest-specific protein 6), SMPD1 (sphingomyelin phosphodiesterase 1, acid lysosomal), UCP2 (uncoupling protein 2 (mitochondrial, proton carrier)), TFAP2A (transcription factor AP-2α (activating enhancer binding protein 2α)), C4BPA (complement component 4 binding protein, α), SERPINF2 (serpin peptidase inhibitor,Clade F (alpha-2 antiplasmin, pigment epithelium-derived factor), member 2), TYMP (thymidine phosphorylase), ALPP (alkaline phosphatase, placental (Regan isozyme), CXCR2 (chemokine (CXC motif) receptor 2), SLC39A3 (solute carrier family 39 (zinc transporter), member 3), ABCG2 (ATP-binding cassette, subfamily G (WHITE), member 2), ADA (adenosine deaminase), JAK3 (Janus kinase 3), HSPA1A (heat shock 70 kDa protein 1A), FASN (fatty acid synthase), FGF1 (fibroblast growth factor 1 (acidic)), F11 (coagulation factor XI) , ATP7A (ATPase, Cu++ transporting, alpha polypeptide), CR1 (complement component (3b / 4b) receptor 1 (Knops blood type)), GFAP (glial fibrillary acidic protein), ROCK1 (Rho-associated, coiled-coil containing protein kinase 1), MECP2 (methyl CpG binding protein 2 (Rett syndrome)), MYLK (myosin light chain kinase), BCHE (butyrylcholinesterase), LIPE (lipase, hormone-sensitive), PRDX5 (peroxide redox enzyme 5), ADORA1 (adenosine A1 receptor), WRN (Werner syndrome, RecQ helicase-like), CXCR3 (chemokine (CXC motif) receptor 3), CD 81 (CD81 molecule), SMAD7 (SMAD family member 7), LAMC2 (laminin, gamma 2), MAP3K5 (mitogen-activated protein kinase kinase kinase 5), CHGA (chromogranin A (parathyroid secretory protein 1)), IAPP (islet amyloid polypeptide), RHO (rhodopsin), ENPP1 (ectonucleotide pyrophosphatase / phosphodiesterase 1), PTHLH (parathyroid hormone-like hormone), NRG1 (neuregulin 1), VEGFC (vascular endothelial growth factor C), ENPEP (glutamyl aminopeptidase (aminopeptidase A)), CEBPB (CCAAT / enhancer binding protein (C / EBP, beta), NAG LU (N-acetylglucosaminidase, α-), F2RL3 (coagulation factor II (thrombin) receptor-like 3), CX3CL1 (chemokine (C-X3-C motif) ligand 1), BDKRB1 (bradykinin receptor B1), ADAMTS13 (ADAM metallopeptidase with thrombospondin type 1 motif, 13), ELANE (elastase, neutrophil-expressed), ENPP2 (ectonucleotide pyrophosphatase / phosphodiesterase 2), CISH (cytokine-induced SH2-containing protein), GAST (gastrin), MYOC (myosin, trabecular meshwork-induced glucocorticoid response), ATP1A2 (ATPase, Na+ / K+ transporter,α2 polypeptide), NF1 (neurofibromin 1), GJB1 (gap junction protein, β1, 32 kDa), MEF2A (myocyte enhancer factor 2A), VCL (vinculin), BMPR2 (bone morphogenetic protein receptor, type II (serine / threonine kinase)), TUBB (tubulin, β), CDC42 (cell division cycle 42 (GTP-binding protein, 25 kDa)), KRT18 (keratin 18), HSF1 (heat shock transcription factor 1), MYB (v-myb myeloblastosis viral oncogene homolog (avian)), PRKAA2 (protein kinase, AMP-activated, catalytic subunit α2), ROCK2 (Rho-associated coiled-containing The kinases involved in the mitochondrial cleavage of the mitochondria are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 lipoxygenase A (cyclophilin A), APOH (apolipoprotein H (beta-2-glycoprotein I)), S100A8 (S100 calcium-binding protein A8), IL11 (interleukin 11), ALOX15 (arachidonic acid 15-lipoxygenase), FBLN1 (fibulin 1), NR1H3 (nuclear receptor subfamily 1, type H, member 3), SCD (stearoyl-CoA desaturase (delta-9-desaturase)), GIP (gastric inhibitory polypeptide), CHGB (chromogranin B (secretory granin 1)), PRKCB (protein kinase C, beta), SRD5A1 (steroid-5-alpha reductase alpha polypeptide 1 (3-oxo-5alpha-steroid delta4-dehydrogenase alpha 1) )), HSD11B2 (hydroxysterol (11-beta) dehydrogenase 2), CALCRL (calcitonin receptor-like), GALNT (UDP-N-acetyl-α-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)), ANGPTL4 (angiopoietin-like 4), KCNN4 (potassium intermediate / small conductance calcium-activated channel, subfamily N, member 4), PIK3C2A (phosphoinositide 3-kinase, class 2, alpha polypeptide), HBEGF (heparin-binding EGF-like growth factor), CYP7A1 (cytochrome P450, family 7, subfamily A, polypeptide 1), HLA-DRB5 (major histocompatibility complex, class I,DRβ5), BNIP3 (BCL2 / adenovirus E1B 19 kDa interacting protein 3), GCKR (glucokinase (hexokinase 4) regulatory protein), S100A12 (S100 calcium binding protein A12), PADI4 (peptidyl arginine deiminase, type I V), HSPA14 (heat shock 70 kDa protein 14), CXCR1 (chemokine (CXC motif) receptor 1), H19 (H19, maternally imprinted expressed transcript (non-protein coding)), KRTAP19-3 (keratin kinase inhibitor), catenin 19-3), IDDM2 (insulin-dependent diabetes mellitus 2), RAC2 (ras-related C3 botulinum toxin substrate 2 (rho family, small GTP-binding protein Rac2)), RYR1 (ryanodine receptor 1 (skeletal)), CLOCK (clock homolog (mouse)), NGFR (nerve growth factor receptor (TNFR superfamily, member 16)), DBH (dopamine beta-hydroxylase (dopamine beta-monooxygenase)), CHRNA4 (cholinergic receptor, nicotinic, alpha 4), CACNA1C (calcium channel, voltage-dependent, L-type, α1C subunit), PRKAG2 (protein kinase, AMP-activated, gamma 2 non-catalytic subunit), CHAT (choline acetyltransferase), PTGDS (prostaglandin D2 synthase 21 kDa (brain)), NR1H2 (nuclear receptor subfamily 1, type H, member 2), TEK (TEK tyrosine kinase, endothelial), VEGFB (vascular endothelial growth factor B), MEF2C (myocyte enhancer factor 2C), MAPKAPK2 (mitogen-activated protein kinase-activated protein kinase 2), TNFRSF11A (tumor necrosis factor receptor superfamily, member 11a, NFKB activator), HSPA9 (heat shock 70 kDa protein 9 (lethal protein)), CYSLTR1 (cysteinyl leukotriene receptor 1), MAT1A (methionine adenosyltransferase I, α), OPRL1 (opioid receptor-like 1), I MPA1 (inositol (muscle)-1 (or 4)-monophosphatase 1), CLCN2 (chloride channel 2), DLD (dihydrolipoamide dehydrogenase), PSMA6 (proteasome (precursor, megalin factor) subunit, alpha type, 6), PSMB8 (proteasome (precursor, megalin factor) subunit, beta type, 8 (large multifunctional peptidase 7)), CHI3L1 (chitinase 3-like 1 (cartilage glycoprotein-39)), ALDH1B1 (aldehyde dehydrogenase 1 family, member B1), PARP2 (poly (ADP-ribose) polymerase 2), STAR (steroidogenic acute phase regulatory protein), LBP (lipopolysaccharide binding protein), ABCC6 (ATP binding cassette, subfamily C (CFTR / MRP), member 6), RGS2 (G protein signaling regulator 2, 24 kDa), EFNB2 (ephrin-B2), GJB6 (gap junction protein, beta 6,30 kDa), APOA2 (apolipoprotein A-II), AMPD1 (adenosine monophosphate deaminase 1), DYSF (dysferlin, limb-girdle muscular dystrophy 2B (autosomal recessive)), FDFT1 (farnesyl diphosphate farnesyltransferase 1), EDN2 (endothelin 2), CCR6 (chemokine (CC motif) receptor 6), GJB3 (gap junction protein, beta 3, 31 kDa), IL1RL1 (interleukin 1 receptor-like 1), ENTPD1 (ectonucleoside triphosphate diphosphohydrolase 1), BBS4 (Bardet-Biedl syndrome 4), CELSR2 (cadherin 1), The proteins involved include EGFLAG, G-type receptor 2 (Flamingo homolog, Drosophila), F11R (F11 receptor), RAPGEF3 (Rap guanylate exchange factor (GEF) 3), HYAL1 (hyaluronan glucosaminidase 1), ZNF259 (zinc finger protein 259), ATOX1 (ATX1 antioxidant protein 1 homolog (yeast)), ATF6 (activating transcription factor 6), KHK (ketokinase (fructokinase)), SAT1 (spermidine / spermine N1-acetyltransferase 1), GGH (γ-glutamyl hydrolase (conjugating enzyme, folic acid poly-γ-glutamyl hydrolase)), TIMP4 (TIMP metallopeptidase inhibitor 4), SLC4A4 (solute carrier family 4), Sodium bicarbonate cotransporter, member 4), PDE2A (phosphodiesterase 2A, cGMP-stimulated), PDE3B (phosphodiesterase 3B, cGMP-inhibited), FADS1 (fatty acid desaturase 1), FADS2 (fatty acid desaturase 2), TMSB4X (thymosin beta 4, X-linked), TXNIP (thioredoxin-interacting protein), LIMS1 (LIM and senescent cell antigen-like domain 1), RHOB (ras homolog gene family, member B), LY96 (lymphocyte antigen 96), FOXO1 (forkhead box O1), PNPLA2 (Patatin-like phospholipase domain-containing 2), TRH (thyrotropin-releasing hormone), GJC1 (gap junction protein, gamma 1, 45 kDa), SLC17A5 (solute carrier family 17 (anion / sugar transporter), member 5), FTO (fat mass and obesity-related), GJD2 (gap junction protein, delta 2, 36 kDa), PSRC1 (proline / serine rich coiled-coil protein 1), CASP12 (caspase 12 (gene / pseudogene)), GPBAR1 (G protein-coupled bile acid receptor 1), PXK (PX domain-containing serine / threonine kinase), IL33 (interleukin 33), TRIB1 (tribbles homolog 1 (Drosophila)), PBX4 (pre-B cell leukemia homeobox 4), NUPR1 (nuclear protein, transcriptional regulator,1), 15-Sep (15 kDa selenoprotein), CILP2 (cartilage intermediate layer protein 2), TERC (telomerase RNA component), GGT2 (γ-glutamyl transpeptidase 2), MT-CO1 (mitochondrial encoded cytochrome c oxidase I) or UOX (urate oxidase, pseudogene).

[1064] Trinucleotide repeat expansion disorder-associated genes, non-limiting examples of which include AR (androgen receptor), FMR1 (fragile x mental retardation 1), HTT (huntingtin), DMPK (myotonic dystrophy protein kinase), FXN (mitochondrial ataxia), ATXN2 (spinocerebellar ataxia 2), ATN1 (atrophin 1), FEN1 (fragment structure-specific endonuclease 1), TNRC6A (trinucleotide repeat containing 6A), PABPN1 (poly(A) binding protein, nuclear 1), JPH3 (affine protein 3), MED15 (mediator complex subunit 15), ATXN1 (spinocerebellar ataxia 1), AT XN3 (spinocerebellar ataxia protein 3), TBP (TATA box binding protein), CACNA1A (calcium channel, voltage-dependent, P / Q type, α1A subunit), ATXN80S (ATXN8 opposite chain (non-protein coding)), PPP2R2B (protein phosphatase 2, regulatory subunit B, β), ATXN7 (spinocerebellar ataxia protein 7), TNRC6B (6B-containing trinucleotide repeat), TNRC6C (6C-containing trinucleotide repeat), CELF3 (CUGBP, Elav-like family member 3), MAB21L1 (mab-21-like 1 (Caenorhabditis elegans)), MSH2 (MutS homolog 2, Colon cancer, non-polyposis type 1 (Escherichia coli), TMEM185A (transmembrane protein 185A), SIX5 (SIX homeobox 5), CNPY3 (canopy 3 homolog (zebrafish)), FRAXE (fragile site, folate type, rare type, fra(X)(q28)E), GNB2 (guanine nucleotide binding protein (G protein), beta polypeptide 2), RPL14 (ribosomal protein L14), ATXN8 (spinocerebellar ataxia protein 8), INSR (insulin receptor), TTR (transthyretin), EP400 (E1A binding protein p400), GIGYF2 (GRB10 interacting GYF protein 2), OGG 1 (8-oxoguanine DNA glycosylase), STC1 (stanniocalcin 1), CNDP1 (carnosine dipeptidase 1 (metallopeptidase M20 family)), C10orf2 (chromosome 10 open reading frame 2), MAML3 wise gene-like 3 (Drosophila), DKC1 (dyskeratosis congenita 1, dyskeratin), PAXIP1 (PAX-interacting (with transcriptional activation domain) protein 1), CASK (calcium / calmodulin-dependent serine protein kinase (MAGUK family), MAPT (microtubule-associated protein tau), SP1 (Sp1 transcription factor), POLG (polymerase (DNA-directed), gamma), AFF2 (AF4 / FMR2 family,member 2), THBS1 (thrombospondin 1), TP53 (tumor protein p53), ESR1 (estrogen receptor 1), CGGBP1 (CGG triplet repeat binding protein 1), ABT1 (basic transcription activator 1), KLK3 (kallikrein-related peptidase 3), PRNP (prion protein), JUN (jun oncogene), KCNN3 (potassium intermediate / small conductance calcium-activated channel, subfamily N, member 3), BAX (BCL2-associated X protein), FRAXA (fragile site, folate type, rare type, fra(X)(q27.3)A (macrotestis, mental retardation)), KBTBD10 (Kelch repeat and BTB (PO Z domain-containing protein 10), MBNL1 (blind muscle-like (Drosophila)), RAD51 (RAD51 homolog (RecA homolog, Escherichia coli) (Saccharomyces cerevisiae)), NCOA3 (nuclear receptor coactivator 3), ERDA1 (expanded repeat domain, CAG / CTG1), TSC1 (tuberous sclerosis complex 1), COMP (cartilage oligomeric matrix protein), GCLC (glutamylcysteine ​​ligase, catalytic subunit), RRAD (Ras-related diabetes mellitus), MSH3 (mutS homolog 3 (Escherichia coli)), DRD2 (dopamine receptor D2), CD44 (CD44 molecule (Indian blood group)), CTCF (CCCTC binding factor (zinc finger protein), CCND1 (cyclin D1), CLSPN (claspin homolog (Xenopus laevis)), MEF2A (myocyte enhancer factor 2A), PTPRU (protein tyrosine phosphatase, receptor type U), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), TRIM22 (tri-motif protein 22), WT1 (Wilms tumor 1), AHR (aryl hydrocarbon receptor), GPX1 (glutathione peroxidase 1), TPMT (thiopurine methyltransferase), NDP (Norrie disease (pseudoglioma)), ARX (awnless-related homeobox), MUS81 (MUS81 endonuclease homolog (Saccharomyces cerevisiae)), TYR (tyrosinase (oculocutaneous albinism) IA), EGR1 (early growth response protein 1), UNG (uracil DNA glycosylase), NUMBL (numb homolog (Drosophila)-like), FABP2 (fatty acid binding protein 2, intestine), EN2 (serrated homeobox 2), CRYGC (crystallin, gamma C), SRP14 (signal recognition particle 14 kDa (homologous Alu RNA binding protein)), CRYGB (crystallin, gamma B), PDCD1 (programmed cell death 1), HOXA1 (homeobox A1), ATXN2L (spinocerebellar ataxia 2-like), PMS2 (PMS2 postmeiotic segregation increase 2-like protein (Saccharomyces cerevisiae)), GLA (galactosidase,α), CBL (Cas-Br-M (murine) tropic retroviral transforming sequence), FTH1 (ferritin, heavy polypeptide 1), IL12RB2 (interleukin 12 receptor, beta 2), OTX2 (orthodenticle homeobox 2), HOXA5 (homeobox A5), POLG2 (polymerase (DNA-directed), gamma 2, auxiliary subunit), DLX2 (terminal reduction homeobox 2), SIRPA (signal regulatory protein α), OTX1 (orthodenticle homeobox 1), AHRR (aryl hydrocarbon receptor repressor), MANF (mesencephalic astrocyte-derived neurotrophic factor), TMEM158 (transmembrane protein 158 (gene / pseudogene)), or ENSG00000078687.

[1065] MD-related genes include but are not limited to: (ABCA4) ATP-binding cassette, subfamily A (ABC1), member 4, ACHM1 achromatopsia (rod monochromacy) 1, ApoE, apolipoprotein E (ApoE), C1QTNF5 (CTRP5), C1q and tumor necrosis factor-related protein 5 (C1QTNF5), C2 complement, complement 2 (C2), C3 complement, complement (C3), CCL2, chemokine (CC motif) ligand 2 (CCL2), CCR2, chemokine (CC motif) receptor 2 (CCR2 ), CD36 cluster of differentiation 36, CFB, complement receptor B, CFH, complement factor CFHH, CFHR1, complement factor H-related 1, CFHR3, complement factor H-related 3, CNGB3, cyclic nucleotide-gated channel beta 3, CP ceruloplasmin (CP), CRP, C-reactive protein (CRP), CST3 cystatin C or cystatin 3 (CST3), CTSD, cathepsin D (CTSD), CX3CR1, chemokine (C-X3-C motif) receptor 1, ELO VL4, elongation of very long chain fatty acids 4, ERCC6, excision repair cross-complementing rodent repair deficiency, complementation group 6, FBLN5, senescence protein-5, FBLN5, senescence protein 5, FBLN6, senescence protein 6 FSCN2 fasciclin (FSCN2), HMCN1, hemicenterin 1, HMCN1, hemicenterin 1, HTRA1, HtrA serine peptidase 1 (HTRA1), HTRA1, HtrA serine peptidase 1, IL-6, interleukin 6, IL-8, interleukin 8, LOC3 87715, hypothetical protein, LEKHA1, platelet leukocyte C-kinase substrate homology domain-containing family A member 1 (PLEKHA1), PROM1, pleurominin 1 (PROM1 or CD133), PRPH2, peripherin-2RPGR retinitis pigmentosa GTPase regulator, SERPING1, serine protease inhibitor peptidase inhibitor, clade G, member 1 (C1-inhibitor), TCOF1, treacle TIMP3 inhibitor of metalloproteinase 3 (TIMP3) or TLR3Toll-like receptor 3.

[1066] Examples of reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).

[1067] In some embodiments, the target nucleic acid is the TTR (transthyretin) gene, and transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare autosomal dominant multi-system disease caused by pathogenic variants in the TTR gene encoding transthyretin, characterized by peripheral nerve damage. Editing the TTR gene using the CRISPR-Cas12 system of the present invention can be used to treat transthyretin-related familial amyloid polyneuropathy. In some embodiments, the guide sequence of the guide polynucleotide is SEQ ID NO: 14.

[1068] In some embodiments, the target nucleic acid is the HBB (hemoglobin β) gene. Sickle cell anemia and β-thalassemia are both hereditary anemias caused by mutations in the HBB gene encoding the β subunit of adult hemoglobin. Editing the HBB gene using the CRISPR-Cas12 system of the present invention can be used to treat diseases such as sickle cell anemia and β-thalassemia. In some embodiments, the guide sequence of the guide polynucleotide is SEQ ID NO: 15.

[1069] In some embodiments, the target nucleic acid is the HBG (hemoglobin gamma-globin) gene. Clinical studies have found that activating fetal HBG expression and obtaining higher levels of HbF in patients with thalassemia can alleviate symptoms or even completely cure thalassemia. Using the CRISPR-Cas12 system described herein to edit the HBG gene can be used to treat diseases such as thalassemia. In some embodiments, the guide sequence of the guide polynucleotide is SEQ ID NO: 16.

[1070] In some embodiments of the present invention, the target nucleic acid is a disease or condition-associated gene. In some embodiments of the present invention, the target nucleic acid is a disease-associated gene. In some embodiments of the present invention, the disease-associated gene is a pathogenic gene that directly causes the disease. In some embodiments of the present invention, the disease-associated gene is an abnormal gene that directly causes the disease or a gene whose expression is abnormal. For example, an adverse mutation occurs in the gene, leading to the occurrence of the disease. For another example, excessive or low expression of the gene leads to the occurrence of the disease.

[1071] In some embodiments of the present invention, the disease or disorder is a hematological disease or disorder, an ophthalmic disease or disorder, a nervous system disease or disorder, a respiratory system disease or disorder, a liver disease or disorder, a metabolic system disease or disorder, cancer, or an infectious disease.

[1072] In some embodiments of the present invention, the disease or condition is selected from the group consisting of hemophilia A, Best vitelliform macular dystrophy, B-cell acute lymphoblastic leukemia, hemophilia B, CDKL5 deficiency, CLN2 disease, Niemann-Pick disease type C, Dravet syndrome, FOXG1 syndrome, GM1 gangliosidosis, GM2 gangliosidosis, HIV infection, HSV infection, Usher syndrome type IB, Usher syndrome type IIA, mucopolysaccharidosis type IIIA, mucopolysaccharidosis type IIIB, Gaucher disease type III, mucopolysaccharidosis type II, type II diabetes mellitus, type IV mucopolysaccharidosis, type I Gaucher disease, type I mucopolysaccharidosis, type I diabetes mellitus, type I Usher syndrome, KCNQ2 epileptic encephalopathy, Leber hereditary optic neuropathy, Leighsyndrome, Prader-Willi syndrome, SLC13A5 deficiency, X-linked myotubular myopathy, X-linked retinoschisis, X-linked retinitis pigmentosa, alpha-1 antitrypsin deficiency, alpha-mannosidosis, alpha-thalassemia, beta-thalassemia, Alzheimer's disease, Budd-Bieder syndrome, albicans punctata retinopathy, leukocyte adhesion deficiency type I, galactosemia, bladder cancer, overactive bladder, phenylketonuria, nasopharyngeal carcinoma, Bietti's lens dystrophy, pyruvate kinase deficiency, erectile dysfunction, autosomal recessive congenital ichthyosis, adult glucan disorder, traumatic arthritis, homozygous familial hypercholesterolemia, fragile X syndrome, thalassemia, hypophosphatasia, epilepsy, multiple myeloma, multiple system atrophy, frontotemporal dementia, catecholamine-sensitive polymorphic ventricular tachycardia, Fabry disease, Fanconi anemia, aromatic amino acid decarboxylase deficiency, radiation-induced xerostomia, non-Hodgkin lymphoma, non-muscle invasive bladder cancer, non-alcoholic fatty liver disease, non-small cell lung cancer Lung cancer, hypertrophic cardiomyopathy, hypertrophic scarring, obesity, Charcot-Marie-Tooth disease type 1A, Charcot-Marie-Tooth disease type 2A, pulmonary hypertension, Friedreich's ataxia, peritoneal cancer, liver cancer, hepatocellular carcinoma, dry-type age-related macular degeneration, Sjögren's syndrome, hyperuricemia, hyperlipidemia, Gaucher disease, autism spectrum disorder, osteoarthritis, bone marrow failure syndrome, citrullinemia type 1, coronary artery disease, cystinosis, melanoma, Huntington's disease, amyotrophic lateral sclerosis, urge urinary incontinence, acute intermittent porphyria, acute lymphoblastic leukemia , spinocerebellar ataxia, spinal muscular atrophy with respiratory distress type 1, spinal muscular atrophy, familial Tay-Sachs disease, methylmalonic acidemia, thyroid cancer, pseudohypertrophic muscular dystrophy, anaplastic astrocytoma, intermittent claudication, junctional epidermolysis bullosa, glioma, glioblastoma, corneal transplant rejection, colorectal cancer, progressive multifocal leukoencephalopathy, progressive familial intrahepatic cholestasis, giant axonal neuropathy, Canavan disease, cocaine addiction, Krabbe disease, Crigler-Najjar syndrome, oral cancer, Happy Puppetsyndrome, diffuse intrinsic pontine glioma, Lafora disease, rheumatoid arthritis, sickle cell disease, lymphedema, ovarian cancer, chronic lymphocytic leukemia, chronic granulomatous disease, anemia of chronic kidney disease, chronic pain, chronic hepatitis B, Menkes disease, cystic fibrosis, Netherton syndrome, ornithine transcarbamylase deficiency, Parkinson's disease, Pompe disease, uveitis, prostate cancer, vestibular schwannoma, myotonic dystrophy, ankylosing spondylitis, castration-resistant prostate cancer, glaucoma, achromatopsia, ischemic heart failure, lysosomal storage disease, sarcoma, breast cancer, Rett syndrome, triple-negative breast cancer, Sandhoff disease, colorectal cancer Blindness, heart failure with reduced ejection fraction, neuronal ceroid lipofuscinosis, adrenoleukodystrophy, renal cell carcinoma, wet age-related macular degeneration, eczema, thrombocytopenia with immunodeficiency syndrome, esophageal cancer, optic neuropathy, optic atrophy, retinal vein occlusion, retinitis pigmentosa, rhodopsin-mediated autosomal dominant retinitis pigmentosa, ependymoma, fallopian tube cancer, bilateral vestibulopathy, Stargardt's disease, diabetic macular edema, diabetic neuropathy, diabetic retinopathy, diabetic peripheral neuropathy, diabetic foot, glycogen storage disease, glycogen storage disease type Ia, glycogen storage disease type IIb, atopy Dermatitis, hearing loss, hearing impairment, head and neck cancer, head and neck squamous cell carcinoma, Wilson's disease, stable angina, Usher syndrome, choroideremia, congenital amaurosis, congenital adrenal hyperplasia, cardiomyopathy, angina, heart failure, new coronavirus infection, pleural mesothelioma, acne vulgaris, severe combined immunodeficiency disease, severe limb ischemia, oculopharyngeal muscular dystrophy, pancreatic cancer, graft-versus-host disease, hereditary retinal dystrophy, hereditary angioedema, hepatitis B, metachromatic leukodystrophy, psoriatic arthritis, recessive hereditary dystrophic epidermolysis bullosa, infantile malignant osteosclerosis, nutrition Dystrophic epidermolysis bullosa, morphea, primary immunodeficiency, heterozygous familial hypercholesterolemia, limb-girdle muscular dystrophy type 2B, limb-girdle muscular dystrophy type 2C, limb-girdle muscular dystrophy type 2D, limb-girdle muscular dystrophy type 2E, limb-girdle muscular dystrophy type 2I, limb-girdle muscular dystrophy type 2L, limb ischemic disease, lipoprotein lipase deficiency, severe congenital neutropenia, wrinkles, stroke, sciatica, schizophrenia, depression, drug addiction, autism, idiopathic pulmonary fibrosis, transthyretin (ATTR) amyloidosis, AATD liver disease, and AATD lung disease.

[1073] The genes related to transthyretin (ATTR) amyloidosis include but are not limited to ATTR;

[1074] The genes related to Leber hereditary optic neuropathy include but are not limited to MT-ND4;

[1075] The AATD liver disease related genes include but are not limited to AATD;

[1076] The AATD lung disease related genes include but are not limited to AATD;

[1077] The graft-versus-host disease related genes include but are not limited to thymidine kinase gene;

[1078] The genes related to hereditary retinal dystrophy include but are not limited to RPE65;

[1079] The spinal muscular atrophy-related genes include but are not limited to SMN1;

[1080] The osteoarthritis related genes include but are not limited to TGF-β1;

[1081] The related genes of hemophilia A include but are not limited to factor VIII;

[1082] The related genes of hemophilia B include but are not limited to factor IX;

[1083] The cystic fibrosis related genes include but are not limited to CFTR;

[1084] The Parkinson's disease-related genes include but are not limited to Gad1, Gad2, PTBP1 and REST;

[1085] The Usher syndrome related genes include but are not limited to USH2A;

[1086] The genes related to α-thalassemia, β-thalassemia, and sickle cell disease include but are not limited to BCL11A, HBG, HBA, and HBB;

[1087] The pulmonary hypertension related genes include but are not limited to eNOS;

[1088] The Stargardt disease-related genes include but are not limited to ABCA4;

[1089] The genes related to age-related macular degeneration include but are not limited to VEGFA and VEGFR;

[1090] The glaucoma-related genes include but are not limited to AQP1;

[1091] The idiopathic pulmonary fibrosis related genes include but are not limited to CTGF;

[1092] The Alzheimer's disease related genes include but are not limited to NGF;

[1093] The coronary heart disease related genes include but are not limited to VEGFA and bFGF;

[1094] The related genes of chronic kidney disease anemia include but are not limited to EPO;

[1095] The related genes of congenital amaurosis include but are not limited to RPE65;

[1096] The retinitis pigmentosa related genes include but are not limited to PDE6B;

[1097] The phenylketonuria related genes include but are not limited to PAH;

[1098] The epilepsy-related genes include but are not limited to GAT1.

[1099] Therapeutic applications

[1100] Another aspect of the present disclosure relates to a pharmaceutical composition comprising a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guiding polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, or a cell as described herein. The pharmaceutical composition may comprise, for example, an AAV vector encoding a Cas12 protein or a Cas12 protein mutant and a guiding polynucleotide as described herein. The pharmaceutical composition may comprise, for example, lipid nanoparticles comprising a guiding polynucleotide as described herein and an mRNA encoding a Cas12 protein. The pharmaceutical composition may comprise, for example, a lentiviral vector comprising a guiding polynucleotide as described herein and an mRNA encoding a Cas12 protein. The pharmaceutical composition may comprise, for example, a virus-like particle comprising a guiding polynucleotide and a Cas12 protein as described herein, or a ribonucleoprotein complex formed by the guiding polynucleotide and the Cas12 protein.

[1101] Another aspect of the present disclosure relates to the use of a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guide polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, a cell as described herein, a pharmaceutical composition as described herein, or a kit as described herein for cutting or editing a target nucleic acid in a mammalian cell.

[1102] Another aspect of the present disclosure relates to the use of a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guide polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, a cell as described herein, a pharmaceutical composition as described herein, or a kit as described herein for any of the following: cleaving or nicking one or more target nucleic acid molecules, activating or upregulating expression of one or more target nucleic acid molecules, activating or inhibiting transcription of one or more target nucleic acid molecules, inactivating one or more target nucleic acid molecules, visualizing, labeling, or detecting one or more target nucleic acid molecules, binding one or more target nucleic acid molecules, transporting one or more target nucleic acid molecules, and masking one or more target nucleic acid molecules.

[1103] Another aspect of the present disclosure relates to the use of a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guide polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, a cell as described herein, a pharmaceutical composition as described herein, or a kit as described herein to modify one or more target nucleic acid molecules, wherein the modification of one or more target nucleic acid molecules comprises one or more of the following: nucleic acid base substitution, nucleic acid base deletion, nucleic acid base insertion, fragmentation of the target nucleic acid, nucleic acid methylation, and nucleic acid demethylation.

[1104] Another aspect of the present disclosure relates to the use of a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guide polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, a cell as described herein, a pharmaceutical composition as described herein, or a kit as described herein in the diagnosis, treatment, or prevention of a disease or condition associated with a target nucleic acid.

[1105] Another aspect of the present disclosure relates to the use of a Cas12 protein as described herein, a Cas12 protein mutant as described herein, a guide polynucleotide as described herein, a Cas12 inactivated variant as described herein, a Cas12 fusion protein or conjugate as described herein, or a nucleic acid as described herein, a CRISPR-Cas12 system as described herein, a vector system as described herein, a delivery system as described herein, a cell as described herein, a pharmaceutical composition as described herein, or a kit as described herein in the preparation of a medicament for diagnosing, treating or preventing a disease or condition associated with a target nucleic acid.

[1106] In some embodiments, the pharmaceutical composition is delivered to a human subject in vivo. The pharmaceutical composition can be delivered by any effective route. Exemplary routes of administration include, but are not limited to, intravenous infusion, intravenous injection, intraperitoneal injection, intramuscular injection, intratumoral injection, subcutaneous injection, intradermal injection, intraventricular injection, intravascular injection, intracerebellar injection, intraocular injection, subretinal injection, intravitreal injection, intracameral injection, intratympanic injection, intranasal administration, and inhalation.

[1107] Diagnostic applications

[1108] Another aspect of the present disclosure relates to an in vitro composition comprising a CRISPR-Cas12 system described herein and a labeled detector DNA that is incapable of hybridizing to a guide polynucleotide described herein.

[1109] Another aspect of the present disclosure relates to the use of the CRISPR-Cas12 system described herein for detecting a target nucleic acid in a nucleic acid sample suspected of containing the target nucleic acid.

[1110] In some embodiments, the method for detecting target DNA includes a Cas12 protein fused to a fluorescent protein or other detectable marker and a guide polynucleotide comprising a guide sequence specific for the target DNA. The binding of Cas12 to the target DNA can be visualized by microscopy or other imaging methods.

[1111] In some embodiments, the method for detecting a target nucleic acid in a cell-free system results in the production of a detectable label or enzyme activity. For example, by using a Cas12 protein, a guide polynucleotide comprising a guide sequence specific for the target nucleic acid, and a detectable label, the target nucleic acid will be recognized by Cas12. The binding of Cas12 to the target nucleic acid triggers its DNase activity, which results in the cleavage of the target nucleic acid and the detectable label.

[1112] In some embodiments, the detectable label is a DNA connected to a fluorescent probe and a quencher. The complete detectable DNA is connected to the fluorescent probe and the quencher to suppress fluorescence. After the detectable DNA is cut by Cas12, the fluorescent probe is released from the quencher and shows fluorescent activity. This method can be used to determine whether the target DNA is present in a cracked cell sample, a cracked tissue sample, a blood sample, a saliva sample, an environmental sample (such as water, soil or air sample), or other cracked cells or cell-free samples. This method can also be used to detect pathogens, such as viruses or bacteria, or to diagnose disease states, such as cancer.

[1113] In some embodiments, detection of a target nucleic acid aids in diagnosing a disease and / or pathological condition, or the presence of a viral or bacterial infection.

[1114] Example

[1115] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[1116] Example 1. Construction of pCDH-CMV-EGFP-Reporter3-EF1a-Puro cell line

[1117] 1. Construction of GFP reporter system lentiviral expression plasmid pCDH-CMV-EGFP-Reporter3-EF1a-Puro

[1118] Synthesize the GFP fragment containing the detection system (SEQ ID NO: 2):

[1119] The GFP fragment was digested with XbaI+NotI to obtain a digestion product, which was then ligated with the XbaI+NotI digestion product of the pCDH-CMV-MCS-EF1-Puro plasmid (Ubao Bio) using T4 DNA ligase (Thermo Scientific). The product was transformed into Stbl3 and cultured overnight at 37°C on an ampicillin-resistant plate. Clones were picked and sequenced to obtain the pCDH-CMV-EGFP-Reporter3-EF1a-Puro plasmid (SEQ ID NO: 3), the map of which is shown in Figure 1.

[1120] The specific principle of the reporter system is as follows: the unedited reporter system has a 32bp base insertion between the start codon (black bold) and the normal reading frame of GFP, which causes the normal reading frame of GFP (underlined part) to be interrupted and GFP is not expressed; using CRISPR-Cas technology, the gRNA target site is set inside GFP (the framed part is the target sequence corresponding to the sgRNA), and indels are generated by editing, which has a chance to restore the normal reading frame of GFP, allowing GFP to be expressed normally. The higher the Cas editing efficiency, the higher the rate of indel generation to restore the correct reading frame of GFP. The number of cells that can normally express GFP is detected by flow cytometry to characterize the editing efficiency of the Cas protein.

[1121] 2. Lentiviral Packaging

[1122] The sequence-identified pCDH-CMV-EGFP-Reporter3-EF1a-Puro plasmid was mixed with the viral packaging helper plasmids pMD2.G (Miaoling Biotechnology) and psPAX2 (Miaoling Biotechnology) at a molar ratio of 1:1:1 and then transfected into 293T cells using polyethylene glycol (PEI). After 48 hours, the culture supernatant was collected and filtered through a 0.45 μm filter to obtain the crude pCDH-CMV-EGFP-Reporter3-EF1a-Puro virus.

[1123] 3. Virus-infected 293T cells to construct a test cell line

[1124] 293T cells were infected with the crude pCDH-CMV-EGFP-Reporter3-EF1a-Puro virus. 48 hours after infection, the medium was changed and 2 μg / ml of puromycin was added for selection. The selected cells were screened for monoclonal clones using limiting dilution. The resulting monoclonal clones were designated as the cell line for testing (referred to as the Reporter3 cell line).

[1125] Example 2, Cas12i mutant design and vector construction, reporter system editing efficiency detection

[1126] 1. Determination of mutation sites

[1127] The wild-type Cas12i protein (i.e., SEQ ID NO: 1 in CN111757889B) was selected for mutation, and the amino acid sequence of the wild-type protein is shown below (1045aa in length).

[1128] SEQ ID NO: 1:

[1129] The three-dimensional structure of Cas12i protein (SEQ ID NO: 1) was predicted and simulated by bioinformatics analysis and AI methods. The possible DNA binding, recognition and cleavage sites of Cas12i were analyzed in combination with the three-dimensional structure. Mutant clones were constructed for these sites using molecular cloning point mutation methods.

[1130] Table 1. Designed Cas12i mutants (first round of design)

[1131] 2. Construction of mutant clones

[1132] After determining the specific mutation site, primers are used to introduce the mutated bases and construct expression clones containing different mutation sites. The following uses the construction of the N260R mutant clone as an example to illustrate.

[1133] First, primers were designed based on the mutation site N260R to construct the mutant cloning plasmid Cas12i-pCDNA3.1-16, which can be used to express the mutant Cas12i-16 and gRNA. The specific primer sequences are shown in Table 2.

[1134] Table 2. Primer sequences used to construct Cas12i mutant clone Cas12i-pCDNA3.1-16

[1135] Targeting the mutation site N260R, primers were designed and introduced using primers Cas12I-16-PF1 and Cas12I-16-PR1. Using the synthesized plasmid pXC12-68-GFPgRNA encoding the wild-type protein (SEQ ID NO: 8) as a template, Cas12i-16-PF1+Cas12-PR1 were used for PCR amplification (Yijin Bio, UltraHiPF TM DNA Polymerase Kit was used to obtain the fragment Cas12i-16-F1, Cas12i-16-PR1 and Cas12-PF1 were PCR amplified to obtain the fragment Cas12i-16-F2, the wild-type plasmid pXC12-68-GFPgRNA was digested with HindIII+KpnI, and the 5646bp fragment was recovered by gel recovery and in vitro recombined with the fragments Cas12i-16-F1 and Cas12i-16-F2 (NEB, E2611L, Gibson Mix), and heat-shock transformed into Escherichia coli to obtain the mutant clone plasmid Cas12i-pCDNA3.1-16 (SEQ ID NO: 9).

[1136] The same method was used to construct mutant clone plasmids expressing other mutants and the same gRNA. The difference from the above-mentioned Cas12i-pCDNA3.1-16 plasmid was only that the mutation site of the expressed mutant was different.

[1137] 3. Detecting the Editing Efficiency of Mutants in a Reporter System

[1138] Plating: When the confluency of the pCDH-CMV-EGFP-Reporter3-EF1a-Puro cell line (Reporter3 cell line) reaches 70-80%, plating is performed, and the number of cells seeded in a 24-well plate is 5×10^5 cells / well.

[1139] Transfection: Transfection was performed 12-14 hours after plating. 100 μl Opti-MEM, 1.5 ul PEI (Yisheng Biology, Polyethylenimine Linear (PEI) MW25000) and 500 ng mutant clone plasmid were added to each well of a 24-well plate, mixed, and added to the Reporter3 cell line after standing at room temperature for 20 minutes for cell transfection. Fresh culture medium was replaced overnight and cultured for 72 hours. Flow cytometry was used to detect the editing efficiency of different mutant clones according to the GFP-positive cell ratio. The ratio of the GFP-positive cell ratio after editing with different mutants was calculated compared to the GFP-positive cell ratio after editing with wild-type Cas12i. The results are shown in Table 3.

[1140] Table 3. Results of the first round of editing efficiency test

[1141] In Table 3, the NC blank control is a Reporter3 cell line that was not transfected with the mutant clone plasmid, and the NC-PEI blank control is a Reporter3 cell line that was not transfected with the mutant clone plasmid but with PEI added. Cas12i-16 and Cas12i-18 were screened in the first round and used for subsequent combined mutagenesis.

[1142] According to the results of the first round of mutations, the entire three-dimensional structure is corrected and marked, and the data from the first round are placed in a new model for predictive analysis. Finally, the possible second-round mutation sites are analyzed and predicted, and mutations and detection are performed. By analogy, the optimal mutation combination of Cas12i is determined through multiple rounds of mutation, selection, and accumulation.

[1143] A total of 8 rounds of mutagenesis were performed, and the mutants from rounds 2 to 8 are shown in Tables 4 to 9. Mutant clone plasmids were constructed using the same method as above, and the editing efficiency was tested in a reporter system. The ratio of the proportion of GFP-positive cells after editing with different mutants was calculated compared to the proportion of GFP-positive cells after editing with wild-type Cas12i or specific mutants, and the results are shown in Tables 4 to 9. The NC blank control is a Reporter3 cell line that was not transfected with a mutant clone plasmid, and the NC-PEI blank control is a Reporter3 cell line that was not transfected with a mutant clone plasmid but with PEI added.

[1144] Table 4. Results of the second round of editing efficiency test

[1145] Table 5. Results of the third round of editing efficiency test

[1146] Cas12i-69 was screened in the third round and used for subsequent combined mutagenesis.

[1147] Table 6. Results of the fourth and fifth rounds of editing efficiency testing

[1148] Table 7. Results of the sixth round of editing efficiency test

[1149] Table 8. Results of the seventh round of editing efficiency test

[1150] Table 9. Results of the eighth round of editing efficiency test

[1151] Example 3, Cas12i mutant editing efficiency of endogenous genes

[1152] To verify the gene editing activity of Cas12i mutants combined with gRNA in 293T cells, the gRNA molecules were designed for the TTR, HBB, and HBG target genes in 293T cells as follows (SEQ ID NOs: 10 to 12), where the underlined parts are guide sequences (SEQ ID NOs: 14 to 16) and the others are direct repeat sequences (DR, SEQ ID NO: 17).

[1153] gRNA-TTR: (SEQ ID NO: 10)

[1154] AGAGAATGTGTGCATAGTCACACCAGTAAGATTTGGTGTCTAT

[1155] gRNA-HBB: (SEQ ID NO: 11)

[1156] AGAGAATGTGTGCATAGTCACACTATGCAGAAATATTGCTATTGCCT

[1157] gRNA-HBG: (SEQ ID NO: 12)

[1158] AGAGAATGTGTGCATAGTCACACACAAGGCAAACTTGACCAAT

[1159] TTR guide sequence: CAGTAAGATTTGGTGTCTAT (SEQ ID NO: 14)

[1160] HBB guide sequence: TATGCAGAAATATTGCTATTGCCT (SEQ ID NO: 15)

[1161] HBG guide sequence: ACAAGGCAAACTTGACCAAT (SEQ ID NO: 16)

[1162] Direct repeat sequence (DR): AGAGAATGTGTGCATAGTCACAC (SEQ ID NO: 17)

[1163] A gRNA expression vector was constructed (U6 promoter drives gRNA expression). The sequence of the gRNA-HBG expression vector is shown in SEQ ID NO: 13, and the gRNA-TTR and gRNA-HBB vectors are replaced with the corresponding gRNA coding sequences.

[1164] Plating: 293T cell lines were plated when the confluency reached 70-80%, and the number of cells seeded in a 24-well plate was 5*10^5 cells / well.

[1165] Transfection: Transfection was performed 12-14 h after plating. 100 μl of Opti-MEM, 1.5 μl of PEI (Yisheng Bio, Polyethylenimine Linear (PEI) MW25000), 250 ng of the mutant clone plasmid of Example 2, and 250 ng of the gRNA plasmid for targeting the endogenous gene were added to each well of a 24-well plate. The mixture was allowed to stand at room temperature for 20 minutes and then added to 293T cells for cell transfection. After overnight transfection, fresh culture medium was replaced and cultured.

[1166] DNA extraction, PCR amplification, and Sanger sequencing: After 72 h of culture, cells were washed with PBS and then 100 μl of cell lysis buffer (Viagen, Lysis Reagent (Cell) was used to lyse the cells to obtain a lysis solution containing genomic DNA. The region near the target sequence of the genomic DNA was amplified, and the PCR product was sent to a sequencing company for Sanger sequencing.

[1167] Sequencing data analysis: The sequencing peak graph and gRNA guide sequence related information were submitted to the editing efficiency analysis website (http: / / shinyapps.datacurators.nl / tide / ) for TIDE analysis to obtain the editing efficiency of the mutant protein on the target nucleic acid, as shown in Tables 10 to 13. Among them, the editing efficiency of Cas12i-30 for TTR and HBB genes was higher than 10%, the editing efficiency of Cas12i-69 for TTR and HBB genes was higher than 15%, and the editing efficiency of Cas12i-69 for HBG gene was higher than 3%.

[1168] Table 10. Endogenous gene editing in the second round of mutants

[1169] Table 11. Endogenous gene editing in the third round of mutants

[1170] Table 12. Endogenous gene editing in the fourth and fifth rounds of mutants

[1171] Among them, the mutations of Cas12i-92 are N295R, N260R, G705R and P605E mutations based on SEQ ID NO: 1.

[1172] Table 13. Endogenous gene editing in the fourth and fifth rounds of mutants

[1173] Example 4, Cas12i mutant design and vector construction, reporter system editing efficiency detection

[1174] The mutant expression vector plasmid was constructed in the same manner as in Example 2, and the editing efficiency of the mutant was tested in the reporter system. The results are shown in Table 14.

[1175] Table 14. Editing efficiency test results

[1176] Note: The symbol & indicates that there is one mutation immediately before and one mutation immediately after the symbol (a total of two mutations).

[1177] Example 5: Screening of C12-102 protein

[1178] 1. CRISPR and gene annotation

[1179] Use software to predict the proteins expressed by microbial genomes in the NCBI Gebank database, and then use software to predict the CRISPR array on the genome.

[1180] 2. Preliminary screening of proteins

[1181] Clustering was used to remove redundant proteins, and proteins with amino acid sequence lengths less than 800 aa (amino acids) or greater than 1400 aa were filtered out.

[1182] 3. Acquisition of CRISPR-related proteins

[1183] Protein sequences within 10 kb upstream and downstream of the CRISPR Array were compared with known Cas12 proteins, and proteins with an evalue greater than 1*e-2 were filtered out. Proteins with high similarity were then compared with the NCBI NR library and the EBI patent library, and candidate proteins were selected. Experimental verification ultimately yielded the C12-102 protein, whose amino acid sequence is shown in SEQ ID NO: 18. The C12-102 protein is also known as the CasRfg.8 protein.

[1184] Example 6. Preparation and purification of C12-102 protein

[1185] 1. Vector Construction

[1186] The pET28a vector plasmid was double-digested with BamHI and XhoI, and the linearized vector was recovered by agarose gel electrophoresis. The prepared pXC12-102-GFPPAM plasmid (SEQ ID NO: 19) was used as a template, and primers C12-102-pET28a-PF1 and C12-102-pET28a-PR1 were used to amplify the DNA fragment containing the coding sequence of the C12-102 protein by PCR. The DNA fragment was amplified by homologous recombination (NEB, Gibson The recombinant vector C12-102-pET28a (SEQ ID NO: 20) was constructed by inserting the master mix into the cloning region of the pET28a vector. The reaction mixture was transformed into Stbl3 competent cells, plated on kanamycin sulfate-resistant LB plates, and cultured overnight at 37°C. Colonies were then identified by sequencing. The sequences of primers C12-102-pET28a-PF1 and C12-102-pET28a-PR1 are as follows:

[1187] Primer C12-102-pET28a-PF1 (SEQ ID NO:21): ACAGCAAATGGGTCGCGGATCCATGCCGGCAGCTAAGAAAAAGAAACTGGATGGCAGCG

[1188] Primer C12-102-pET28a-PR1 (SEQ ID NO:22): TCTCAGTGGTGGTGGTGGTGGTGCTCGAGTCAAGCGTAATCTGGAACATCGTATG

[1189] Positive clones with correct sequences were selected and cultured overnight. The plasmids were extracted and transformed into expression strain Rosetta (DE3). The clones were spread on LB plates containing kanamycin sulfate and cultured at 37°C overnight.

[1190] 2. Protein Expression

[1191] A single clone was picked and inoculated into 5 ml of LB culture medium containing kanamycin sulfate and cultured at 37°C overnight.

[1192] The cells were inoculated into 500 ml of LB culture medium containing kanamycin sulfate at a ratio of 1:100, cultured at 220 rpm and 37°C to an OD of 0.6, and IPTG was added to a final concentration of 0.2 mM, and induced at 16°C for 24 h.

[1193] Rinse with 15 ml PBS, collect the cells by centrifugation, add lysis buffer and ultrasonically disrupt them. Centrifuge at 10,000 g for 30 min to obtain the supernatant containing the recombinant protein. Filter the supernatant through a 0.45 μm filter membrane and then apply it to the column for purification.

[1194] 3. Protein purification

[1195] The C12-102 recombinant protein has an amino acid sequence of 1213 amino acids and a structure of His tag-NLS-C12-102-SV40 NLS-nucleoplasmin NLS. The six His residues at the N-terminus served as purification tags. The C12-102 recombinant protein was purified by IMAC (Ni Sepharose 6 Fast Flow, Cytiva) and then by hydrophobic chromatography (HiTrap phenly HP, Cytiva). The purified recombinant protein was analyzed by SDS-PAGE electrophoresis, as shown in Figure 2.

[1196] Example 7: Determination of the PAM sequence of the C12-102 protein

[1197] In this example, sgRNA (single guide RNA) containing a specific guide sequence and the C12-102 recombinant protein purified in Example 6 were mixed to cleave the in vitro cleavage substrate (containing a spacer sequence and a 7nt random sequence). After incubation at 37°C, purification was performed, and a library was constructed. NGS sequencing and analysis were performed to determine the PAM sequence of C12-102. The specific steps are as follows:

[1198] A. In vitro cleavage of substrates

[1199] The designed in vitro cleavage substrate sequence (SEQ ID NO: 23) is as follows:

[1200] In the sequence, N represents any of A, T, C, and G.

[1201] The double-stranded DNA containing the above sequence was prepared by PCR amplification method and used as an in vitro cleavage substrate.

[1202] The cleavage substrate was taken to a sequencing company for PCR-free library construction and NGS sequencing. The complexity and abundance of the PAM library composed of 7nt random sequences were analyzed. The results are as follows:

[1203] The composition of the four bases, A, T, G, and C, was essentially uniform. Furthermore, the PAM library, comprised of 7-nt random sequences, contained 4^7 = 16,384 different combinations, all of which were detected. The PAM library demonstrated acceptable complexity and abundance.

[1204] B. Preparation of sgRNA

[1205] sgRNA containing a specific guide sequence was synthesized by in vitro transcription at 37°C in a system containing T7 RNA transcriptase, four ribonucleotide triphosphates, and a DNA template with a T7 promoter. The transcript was precipitated with LiCl and purified. The sgRNA sequence is as follows:

[1206] >C12-102-sgRNA(SEQ ID NO:24)5'-ccucgacuagauuuagaaugcccacgaugauugggcaGUGAGCAAGGGCGAGGAGCUGUUC-3'

[1207] >C12-102-sgRNA-Rev(SEQ ID NO:25)5'-ccucgacuagauuuagaaugcccacgaugauugggcaCGCAAUGAUGAUCUCCGAGCCGUUCC-3'

[1208] Direct repeat sequence (SEQ ID NO: 26): ccucgacuagauuuagaaugcccacgaugauugggca

[1209] The capitalized bases are the specific guide sequences of sgRNA:

[1210] C12-102-sgRNA guide sequence (SEQ ID NO: 27): GUGAGCAAGGGCGAGGAGCUGUUC

[1211] C12-102-sgRNA-Rev guide sequence (SEQ ID NO: 28): CGCAAUGAUGAUCUCCGAGCCGUUCC.

[1212] C. NGS library construction and PAM analysis

[1213] PAM library cleavage and T4 DNA Polymerase treatment

[1214] 1. Prepare reaction systems containing C12-102 protein, two different sgRNAs, in vitro cleavage substrate, and buffer, and incubate at 37°C for 3 hours and 75°C for 15 minutes, as shown in Table 15 and Figure 3.

[1215] Table 15. Reaction system for in vitro cleavage reaction

[1216] 2. Treat with T4 DNA Polymerase and fill in the cleavage product

[1217] T4 DNA Polymerase (Thermo Scientific) was added to the cleaved product. The specific reaction system is shown in Table 16. After addition, the reaction was incubated at 37°C for 20 minutes and then at 85°C for 10 minutes.

[1218] Table 16. Reaction system for filling in the C12-102 cleavage product

[1219] 3. Add A to the 3' end and add biotin-labeled adapter

[1220] a. Add 78 μl of SPRISelect Beads (Beckman COULTER) to the T4 DNA Polymerase reaction product, mix well, incubate at room temperature for 5 minutes, transfer the product to a magnetic rack for adsorption for 5 minutes, and transfer the supernatant to a new 1.5 ml tube. Then add 39 μl of SPRISelect Beads (Beckman COULTER), mix well, incubate at room temperature for 5 minutes, transfer the product to a magnetic rack for adsorption for 5 minutes, discard the supernatant, wash twice with 85% ethanol, incubate at room temperature for 10 minutes, and air-dry. Elute with 50 μl of ddH2O.

[1221] b. Use the SynplSeq DNA Library Prep Kit for Illumina to construct a library. Perform 3' A addition to the product in step a according to the system in Table 17 at 37°C for 10 min, 65°C for 20 min, and 4°C for ∞.

[1222] Table 17. C12-102 cleavage products 3' plus A

[1223] c. Adapter 1 was obtained by annealing the upstream primer 5'Biosg / gttgacatgctggattgagacttcctacactctttccctacacgacgctcttccgatc*t (SEQ ID NO: 29, * indicates phosphorothioate modification on the t base) with the downstream primer gatcggaagagcgtcgtgtagggaaagagtgtaggaagtctcaatccagcatgtcaac (SEQ ID NO: 30). Adapter 1 and other components were added according to the system in Table 18, and the reaction was incubated at 20°C for 30 minutes and then at 16°C overnight. The reaction product was purified using SPRI Select Beads.

[1224] Table 18. Reaction system with Adapter 1

[1225] d. Using streptavidin-labeled magnetic beads The reaction products were purified by M-280 Streptavidin (Invitrogen).

[1226] e.Recover PCR

[1227] Design the primers in Table 19 and use them according to the system in Table 20 and the reaction procedure in Table 21. Recover PCR reaction was performed using Hot Start High-Fidelty 2x Master Mix (NEB).

[1228] Table 19. Recover PCR primers

[1229] Table 20. Recover PCR reaction system

[1230] Table 21. Recover PCR reaction program

[1231] f. Move the Recover PCR product to a magnetic rack and adsorb for 5 minutes. Transfer the supernatant to a new 1.5ml centrifuge tube, take 3μl of the Recovery PCR product, and dilute it with 148.5μl of ddH2O.

[1232] g.Index PCR

[1233] Select the primers in Table 22 and perform Index PCR according to the system in Table 23 and the reaction program in Table 24.

[1234] Table 22. Index PCR primers

[1235] Table 23. Index PCR reaction system

[1236] Table 24. Index PCR reaction program

[1237] The h.Index PCR product was purified by adding 0.7x SPRISelect Beads and eluted with 38 μl of ddH2O. The concentration was determined using Qubit. The concentration of the C12-102-sgRNA library was 35.4 ng / μl, and the concentration of the C12-102-sgRNA-Rev library was 35.6 ng / μl, meeting the requirements for NGS sequencing.

[1238] i. Analysis of NGS results: NGS sequencing was performed and the reference (A compact Cas9 ortholog from Staphylococcus Auricularis (SauriCas9) expands the DNA targeting scope. PLoS biology, 2020, 18 (3), e3000686.) method was used to analyze the captured 7nt random sequences as shown in Figures 4 and 5.

[1239] The PAM sequence recognized by the C12-102-sgRNA system is A (Figure 4). Since the target strand during targeted editing by the C12-102-sgRNA-Rev system is the plus strand and the non-target strand is the minus strand, the PAM sequence recognized by the C12-102-sgRNA-Rev system is also A (Figure 5), which is consistent with the PAM sequence recognized by the C12-102-sgRNA system.

[1240] Example 8: Testing the in vitro cleavage activity of C12-102 protein

[1241] In this example, the sgRNA in Example 7 and the C12-102 recombinant protein in Example 6 were mixed and the target DNA (dsDNA or ssDNA) was cleaved in vitro. The specific steps were as follows:

[1242] a. In vitro cleavage of dsDNA

[1243] After binding to sgRNA, CRISPR-Cas protein can specifically cut dsDNA containing a specific PAM, and the cutting product can show the cutting effect of Cas protein through gel electrophoresis.

[1244] The target DNA (dsDNA) was prepared and the sequence was as follows (SEQ ID NO: 35):

[1245] The underlined sequence is the corresponding sequence of the sgRNA guide sequence.

[1246] Select two different sets of Cut Buffer for cutting reaction, as follows:

[1247] 10×Cut Buffer 1:200mM HEPES, 1M NaCl, 50mM MgCl2, 1mM EDTA

[1248] 10×Cut Buffer 2: 200 mM Tris-HCl (pH 7.5), 500 mM KCl, 50 mM MgCl2, 5 mM DTT, 10% glycerol, 1 mM ATP.

[1249] Prepare the reaction system according to Table 25:

[1250] Table 25. C12-102 in vitro cleavage reaction system

[1251] The reaction was carried out at 37°C for 2 hours and at 75°C for 10 minutes. 20 μl of the cleavage product was taken for gel electrophoresis detection. The electrophoresis detection results are shown in FIG6 .

[1252] b. In vitro cleavage of ssDNA

[1253] Based on the sgRNA (C12-102 and C12-102-Rev) guide sequences in Example 6, the inventors designed ssDNA containing a 5'-end FAM fluorescent group and a 3'-end quencher group (3'BHQ1 / 3'Super Quencher 1) as a cleavage substrate. Once the C12-102 protein specifically cleaves the ssDNA (called cis cleavage), a fluorescent signal can be detected by qPCR, and the cis cleavage activity of the C12-102 protein is determined based on the change in the fluorescent signal.

[1254] The target DNA (ssDNA) sequence cleaved by C12-102 protein in vitro is as follows:

[1255] C12Template01(SEQ ID NO:36):

[1256] 5'FAM-AACATAAtCgaacagctcctcgcccttgctcacTAGACAAtc-3'BHQ1

[1257] C12Template02(SEQ ID NO:37):

[1258] 5'FAM-AACATAAtCgaacagctcctcgcccttgctcacTAGACAAtc-3'Super Quencher 1

[1259] C12Template-Rev01(SEQ ID NO:38):

[1260] 5'FAM-tgcTaccATGGAACGGCTCGGAGATCATCATTGCGtaaAGgAtc-3'BHQ1

[1261] C12Template-Rev02(SEQ ID NO:39):

[1262] 5'FAM-tgcTaccATGGAACGGCTCGGAGATCATCATTGCGtaaAGgAtc-3'Super Quenc her 1

[1263] The underlined sequence is the target sequence of C12-102 or C12-102-Rev sgRNA.

[1264] Prepare the reaction system according to Table 26:

[1265] Table 26. Reaction system of C12-102 in vitro cleavage of ssDNA

[1266] In the ssDNA cutting experiment, the other components except ssDNA were first mixed evenly, incubated at 25°C for 20 minutes, and then ssDNA was added and placed in a qPCR instrument at 37°C for reaction. The fluorescence signal intensity was detected once per cycle (per minute), and a group without sgRNA was set as a control. The specific fluorescence intensity was plotted against the reaction time to determine the cutting activity of the Cas protein. The results are shown in Figure 7, where Ct represents the respective negative control groups (adding C12-102 recombinant protein and ssDNA, without adding sgRNA). The fluorescence test results show that C12-102 can specifically cut ssDNA, and the cutting behavior does not require the assistance of PAM (sequence A).

[1267] Example 9, C12-102 protein mutant and Cas12i-Y2 mutant

[1268] The inventors designed mutants as shown in Table 27 for C12-102 and Cas12-Y2 proteins (SEQ ID NO: 40), respectively, and tested their editing efficiency and off-target effects.

[1269] Direct repeat sequence of sgRNA of Cas12-Y2 (SEQ ID NO: 41):

[1270] Table 27. Designed mutants

[1271] Although the above describes specific embodiments of the present invention, it should be understood by those skilled in the art that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. A Cas12 protein, characterized in that The amino acid sequence of the Cas12 protein includes or is a sequence having at least 50% sequence identity compared to SEQ ID NO: 1, and the amino acid sequence of the Cas12 protein includes or is a sequence having amino acid differences at one, two or more sites selected from the following compared to SEQ ID NO: 1: N260, N295, T235, D233, S259, Q256, M253, F680, T550, Y668, S246, N229, D678, E875, D166 , N325, N168, N884, N369, N879, P605, K872, N456, E601, Q11, N443, D876, E788, G705, V446, S811, E321, E815, A869, V804, N317, N807, H702, V359, K787, P355, K703, V790, L778, D782, N409, D704, D356, T354, M863, L332, Q971, A857, Q262, C567, S849, D590, A933, F962, N930, A794, V58, L475, V61, L526, V469, Q929, L438, N449, L553, K926, T850, I249, T313, Q450, Y 881, R606, Q632, G845, N846, R860, F644, E271, E255, E328, E418, N193, N194, N556, N416, N 197, N808, E504, E793, Q186, N812, N570, P121, E658, L662, I549, D551, S664, E681, Q294, E225, N663, Y241, W170, S174, M789, S306, C448, I407, K310, C866, I1031, M618, N571, and L484; The amino acid difference is that the amino acid at the position is substituted with any other amino acid, or the amino acid at the position does not exist.

2. A Cas12 protein, characterized in that The amino acid sequence of the Cas12 protein includes or is a sequence having at least 50% sequence identity compared to SEQ ID NO: 1, and the amino acid sequence of the Cas12 protein includes or is a sequence having amino acid differences at positions N260, N295 and G705 compared to SEQ ID NO: 1 and further comprising amino acid differences at one, two or more positions selected from the following: D166, V167, N168, G169, W170, S174, E179, K181, K182, E183, E184, Q294, E328, K370, N372, E376, E397, E462, V463, N621, D85 1. S853, A934, W938, N941, K942, K943, N945, N197, E788, K228, K231, E326, L329, K353, P362, G366, N368, N369, Y371, A392, K 395, D396, E399, E400, K401, G402, I403, H405, K408, E434, S433, K441, C448, G455, K502, T505, V842, K580R, T623, K774, S775, T850, K856, K926, Q929, N930, S940, S944, K580, S779, H511, N523, P524, P1032, P579, P984, L767, H995, P557, G232, and L662; The amino acid difference is that the amino acid at the position is substituted with any other amino acid.

3. A Cas12 protein, characterized in that The amino acid sequence of the Cas12 protein comprises or is an amino acid sequence having at least 50% identity with SEQ ID NO: 18, Moreover, the PAM sequence recognized by the Cas12 protein is A; Preferably, the Cas12 protein is not Including: a Cas12 protein whose amino acid sequence has at least 70% sequence identity with SEQ ID NO: 40 and whose recognized PAM sequence is not A.

4. A Cas12 protein mutant, characterized in that The amino acid sequence of the Cas12 protein mutant includes or is an amino acid sequence having at least 70% identity with SEQ ID NO: 40, and: The amino acid sequence of the Cas12 protein mutant includes or is an amino acid sequence selected from any of the following positions with amino acid differences compared to SEQ ID NO: 40: S211, Q216, N217, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, D287, D270, E265, N224, D413 , D417, A410, D428, E424, Q1005, N991, E999, L998, S995, D762, E761, N763, S843, S836, N833, A829, D768 , Y988, E24, K76, Q80, Q282, L254, L240, E241, D302, N441, D393, G394, N395, S481, D157, E159, Q491, V49 0, H485, D903, D953, N904, V955, Q908, L932, S939, Q930, N870, E851, Q854, V850, N873, V872, D839, Q868, D800, E804, H271, T435, T436, F437, S438, D498, D639, D640 and T1006; the amino acid difference is that the amino acid at the position is replaced by any other amino acid Acid; preferably, the amino acid at the position is substituted with a positively charged amino acid, such as R, H or K; or the amino acid at the position is substituted with a non-polar amino acid, such as G, P, A, I, L, V, M, F, W or Y; or the amino acid at the position is substituted with a negatively charged amino acid, such as D or E; or the amino acid at the position is substituted with a neutral amino acid, such as N, C, Q, S or T; more preferably, the amino acid at position Q216 or N217 is substituted with a positively charged amino acid or a non-polar amino acid;or, sites S211, E218, K219, E220, K351, H352, N353, I355, E359, A362, L363, A366, N365, L370, K401, V402, A403, E439, E463, D468, D276, D287, D270, E265, N224, D413, D417, A410, D428, E the amino acid at 424, Q1005, N991, E999, L998, S995, D762, E761, N763, S843, S836, N833, A829, D768, Y988, H271, D393, N395, T435, T436, F437, S438, D498, D639, D640, V850, or T1006 is substituted with a positively charged amino acid; Alternatively, the amino acid sequence of the Cas12 protein mutant includes or is compared to SEQ ID NO: 40, wherein the amino acid at position R19, R28, R32, R553, R605, R612, R615 or R931 is substituted with K, A, Q or E; Alternatively, the amino acid sequence of the Cas12 protein mutant includes or is compared to SEQ ID NO: 40, wherein the amino acid at position K512, N527, W531, K581, K589, I590, K611, Y777 or E877 is replaced with a positively charged amino acid, such as R, H or K; preferably R; Furthermore, the Cas12 protein mutant retains the function of the protein shown in the sequence of SEQ ID NO:40; Preferably, the Cas12 protein mutant can form a complex with the guide polynucleotide, or the Cas12 protein mutant can specifically bind to the target nucleic acid with the guide polynucleotide.

5. A fusion protein or conjugate, characterized in that The fusion protein or conjugate comprises the Cas12 protein or a functional fragment thereof as described in claim 1 or 2 fused to a homologous or heterologous functional domain; Optionally, the fusion protein or conjugate may recognize the PAM sequence of 5'-TTN.

6. A Cas12 fusion protein or conjugate, characterized in that The Cas12 fusion protein or conjugate comprises the following elements: (1) a Cas12 functional domain; comprising the Cas12 protein as described in claim 3 or the Cas12 protein mutant as described in claim 4; and (2) Homologous or heterologous functional domains.

7. An isolated nucleic acid, characterized in that The nucleic acid encodes the Cas12 protein according to claim 1 or 2, the fusion protein or conjugate according to claim 5, the Cas12 protein according to claim 3, the Cas12 protein mutant according to claim 4, or the Cas12 fusion protein or conjugate according to claim 6; Preferably, the nucleic acid is codon optimized for expression in a cell; More preferably, the nucleic acid is codon-optimized for expression in a eukaryote, a mammal such as a human or non-human mammal, a plant, an insect, a bird, a reptile, a rodent (e.g., a mouse, a rat), a fish, a worm / nematode, or a yeast.

8. A CRISPR-Cas12 system, characterized in that The CRISPR-Cas12 system comprises: a. The Cas12 protein according to claim 1 or 2, the fusion protein or conjugate according to claim 5, or the nucleic acid according to claim 7; as well as b. a guide polynucleotide, or a polynucleotide sequence encoding the guide polynucleotide; The Cas12 protein or the fusion protein or conjugate forms a CRISPR complex with the guide polynucleotide; the guide polynucleotide comprises a guide sequence, which is engineered to guide the sequence-specific binding of the CRISPR complex to the target nucleic acid.

9. A CRISPR-Cas12 system, characterized in that The CRISPR-Cas12 system comprises: a. Cas12 functional domain, a Cas12 fusion protein or conjugate as claimed in claim 6, or a nucleic acid as claimed in claim 7, wherein the Cas12 functional domain comprises a Cas12 protein as claimed in claim 3 or a Cas12 protein mutant as claimed in claim 4; as well as b. a guide polynucleotide, or a polynucleotide sequence encoding the guide polynucleotide; The Cas12 functional domain or the Cas12 fusion protein or conjugate forms a complex with the guide polynucleotide; the guide polynucleotide comprises a guide sequence, and the guide sequence is engineered to guide the complex to the target nucleic acid. Sequence-specific binding.

10. Use of the Cas12 protein according to claim 1 or 2, the fusion protein or conjugate according to claim 5, the isolated nucleic acid according to claim 7, or the CRISPR-Cas12 system according to claim 8 in the preparation of an agent or medicament for diagnosing, treating and / or preventing a disease or disorder associated with a target nucleic acid; Preferably, the agent or drug is used to: cut one or more target nucleic acid molecules or create a nick in one or more target nucleic acid molecules, activate or upregulate the expression of one or more target nucleic acid molecules, activate or inhibit the transcription of one or more target nucleic acid molecules, inactivate one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules.

11. Use of the Cas12 protein as claimed in claim 3, the Cas12 protein mutant as claimed in claim 4, the Cas12 fusion protein or conjugate as claimed in claim 6, the nucleic acid as claimed in claim 7, and the CRISPR-Cas12 system as claimed in claim 9 in the preparation of an agent or drug for diagnosing, treating and / or preventing a disease or disorder associated with a target nucleic acid; Preferably, the disease or condition is a blood disease or condition, an ophthalmic disease or condition, a nervous system disease or condition, a respiratory system disease or condition, a liver disease or condition, a metabolic system disease or condition, cancer or an infectious disease; and / or, the agent or drug is used to: cleave or nick one or more target nucleic acid molecules, activate or upregulate the expression of one or more target nucleic acid molecules, activate or inhibit the transcription of one or more target nucleic acid molecules, inactivate one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules; More preferably, the disease or disorder is selected from the group consisting of hemophilia A, Best vitelliform macular dystrophy, B-cell acute lymphoblastic leukemia, hemophilia B, CDKL5 deficiency, CLN2 disease, Niemann-Pick disease type C, Dravet syndrome, FOXG1 syndrome, GM1 gangliosidosis, GM2 gangliosidosis, HIV infection, HSV infection, Usher syndrome type IB, Usher syndrome type IIA, mucopolysaccharidosis type IIIA, mucopolysaccharidosis type IIIB, Gaucher disease type III, mucopolysaccharidosis type II, type II diabetes, mucopolysaccharidosis type IV, Gaucher disease type I, mucopolysaccharidosis type I, type I diabetes, Usher syndrome type I, KCNQ2 epileptic encephalopathy, Leber hereditary optic neuropathy, Leigh syndrome, Prader-Willi syndrome, SLC13A5 deficiency, X-linked myotubular myopathy, X-linked retinoschisis, X-linked retinitis pigmentosa, alpha-1-antitrypsin deficiency, alpha-mannosidosis, alpha-thalassemia, beta-thalassemia, Alzheimer's disease, Budd-Bieder syndrome, white punctate retinal degeneration, leukocyte adhesion deficiency type I, galactosemia, bladder cancer, overactive bladder, phenylketonuria, nasopharyngeal carcinoma, Bietti crystal dystrophy, pyruvate kinase deficiency, erectile dysfunction, autosomal recessive Congenital ichthyosis, adult glucan body disease, traumatic arthritis, homozygous familial hypercholesterolemia, fragile X syndrome, thalassemia, hypophosphatasia, epilepsy, multiple myeloma, multiple system atrophy, frontotemporal dementia, catecholamine-sensitive polymorphic ventricular tachycardia, Fabry disease, Fanconi anemia, aromatic amino acid decarboxylase deficiency, radiation-induced xerostomia, non-Hodgkin lymphoma, non-muscle-invasive bladder cancer, non-alcoholic fatty liver disease, non-small cell lung cancer, hypertrophic cardiomyopathy, hypertrophic scars, obesity, Charcot-Marie-Tooth Disease Type 1A, Charcot-Marie-Tooth Disease Type 2A, pulmonary hypertension, Friedrich's ataxia, peritoneal cancer, liver cancer, hepatocellular carcinoma, dry age-related macular degeneration, Sjögren's syndrome syndrome, hyperuricemia, hyperlipidemia, Gaucher disease, autism spectrum disorder, osteoarthritis, bone marrow failure syndrome, citrullinemia type I, coronary heart disease, cystinosis, melanoma, Huntington's disease, amyotrophic lateral sclerosis, urge incontinence, acute intermittent porphyria, acute lymphoblastic leukemia, spinocerebellar ataxia, spinal muscular atrophy with respiratory distress type 1, spinal muscular atrophy, familial Tay-Sachs disease, methylmalonic acidemia, thyroid cancer, pseudohypertrophic muscular dystrophy, anaplastic astrocytoma, intermittent claudication, junctional epidermolysis bullosa, glioma, glioblastoma, corneal transplant rejection, colorectal cancer, progressive multifocal leukoencephalopathy, progressive familial intrahepatic cholestasis, giant axonal neuropathy, Canavan disease, cocaine addiction, Krabbe disease, Crigler-Najjar syndrome, oral cancer, happy puppet syndrome, diffuse intrinsic pontine glioma, Lafora disease, rheumatoid arthritis, sickle cell disease, lymphedema, ovarian cancer, chronic lymphocytic leukemia, chronic granulomatous disease, anemia of chronic kidney disease, chronic pain, chronic hepatitis B, Menkes disease, cystic fibrosis, Netherton syndrome, ornithine carbamoyltransferase deficiency, Parkinson's disease, Pompe disease, uveitis, prostate cancer, vestibular schwannoma, myotonic dystrophy, ankylosing spondylitis, castration-resistant prostate cancer, glaucoma, achromatopsia, ischemic heart failure, lysosomal storage disease, sarcoma, breast cancer, Rett syndrome, triple-negative breast cancer, Sandhoff disease, color blindness, radiography Heart failure with reduced blood fraction, neuronal ceroid lipofuscinosis, adrenoleukodystrophy, renal cell carcinoma, wet age-related macular degeneration, eczema, thrombocytopenia with immunodeficiency syndrome, esophageal cancer, optic neuropathy, optic atrophy, retinal vein occlusion, retinitis pigmentosa, rhodopsin-mediated autosomal dominant retinitis pigmentosa, ependymoma, fallopian tube cancer, bilateral vestibulopathy, Stargardt's disease, diabetic macular edema, diabetic neuropathy, diabetic retinopathy, diabetic peripheral neuropathy, diabetic foot, glycogen storage disease, glycogen storage disease type Ia, glycogen storage disease type IIb, atopic dermatitis, hearing loss, hearing impairment, head and neck cancer, head and neck squamous cell carcinoma, Wilson's disease, stable angina,Usher syndrome, choroideremia, congenital amaurosis, congenital adrenal hyperplasia, cardiomyopathy, angina pectoris, heart failure, novel coronavirus infection, pleural mesothelioma, acne vulgaris, severe combined immunodeficiency, severe limb ischemia, oculopharyngeal muscular dystrophy, pancreatic cancer, graft-versus-host disease, hereditary retinal dystrophy, hereditary angioedema, hepatitis B, metachromatic leukodystrophy, psoriatic arthritis, recessive dystrophic epidermolysis bullosa, infantile malignant osteosclerosis, dystrophic epidermolysis bullosa, morphea, primary immunodeficiency, heterozygous familial hypercholesterolemia, limb-girdle muscular dystrophy type 2B, limb-girdle muscular dystrophy type 2C, limb-girdle muscular dystrophy type 2D, limb-girdle muscular dystrophy type 2E, limb-girdle muscular dystrophy type 2I, limb-girdle muscular dystrophy type 2L, limb ischemic disease, lipoprotein lipase deficiency, severe congenital neutropenia, wrinkles, stroke, sciatica, schizophrenia, depression, drug addiction, autism, idiopathic pulmonary fibrosis, transthyretin (ATTR) amyloidosis, AATD liver disease, and AATD lung disease.

Images