RAAV plasmid system of high-yield cytotoxic gene and application of rAAV plasmid system

By introducing an auxiliary plasmid containing the apoptosis inhibitor xIAP into the rAAV plasmid system, the problem of cell death caused by the expression of cytotoxic genes in HEK293 cells was solved, achieving efficient production and cost reduction of rAAV.

CN121674484APending Publication Date: 2026-03-17GUANGZHOU PACKGENE BIOTECH CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

During rAAV production, the promoter on the transgenic plasmid becomes active in HEK293 cells, leading to cell death and affecting viral packaging. In particular, the expression products of cytotoxic genes severely impact rAAV yield.

Method used

By employing an auxiliary plasmid system containing the apoptosis inhibitor xIAP, the production efficiency of rAAV can be improved and the production cost reduced through the overexpression of the auxiliary gene.

Benefits of technology

It effectively improved the production efficiency of rAAV, enhanced its drug-like properties, and reduced production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674484A_ABST
    Figure CN121674484A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of recombinant adeno-associated virus production, and discloses an rAAV plasmid system of a high-yield cytotoxic gene and an application of the rAAV plasmid system. The rAAV plasmid system of the high-yield cytotoxic gene comprises a transgenic plasmid, a packaging plasmid and an auxiliary plasmid, the helper plasmid comprises a gene sequence of an apoptosis inhibition factor xIAP. According to the present invention, the target auxiliary gene can be highly expressed during the production of the rAAV containing the cytotoxic gene, such that the production efficiency of the rAAV is effectively improved, and the technical effects of improving the druggability of the rAAV and reducing the production cost are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of recombinant adeno-associated virus (AAV) production technology, specifically to an rAAV plasmid system that produces high levels of cytotoxic genes and its applications. Background Technology

[0002] Gene therapy involves introducing, modifying, or removing specific genes into patient cells to repair or compensate for defective genes, thereby treating or preventing hereditary diseases. In gene therapy, nucleic acid delivery mediated by viral vectors is currently one of the main methods for introducing genes into cells. Recombinant adeno-associated virus (rAAV) vectors have many advantages, including long-term stable expression of exogenous genes, low probability of integration into the host genome, infection of both dividing and non-dividing cells, broad host cell range, high specificity, and low immunogenicity. Furthermore, with the discovery of serotypes targeting various tissues, AAV is considered one of the most promising gene therapy tools. Currently, rAAV has been applied in clinical trials for various diseases, including ocular, nervous system, metabolic, hematological, neuromuscular, cardiovascular, and oncological diseases. To date, rAAV gene therapy drugs include Glybera for treating lipoprotein lipase deficiency, Luxturna for treating RPE65 mutation-related hereditary retinopathy, Zolgensma for treating spinal muscular atrophy, Upstaza for treating aromatic L-amino acid decarboxylase deficiency, Roctavian for treating hemophilia A, Hemgenix for treating hemophilia B, Elevidys for treating Duchenne muscular dystrophy, and Beqvez / Durveqtix for treating hemophilia B.

[0003] rAAV production systems mainly include plasmid transfection production systems based on HEK293 cells, production systems based on insect cells and baculoviruses, and methods based on packaging cells or induced packaging cells. The HEK293 cell-based plasmid transfection production system is currently the mainstream technology for clinical or research-grade rAAV production. This system employs co-transfection of production cells with multiple plasmids containing all the necessary elements for rAAV packaging. The main steps include: plasmid preparation, production cell amplification, plasmid transfection of production cells, cell lysis to harvest crude virus fluid, and virus purification. However, during rAAV production, because the promoters on the transgenic plasmids can be active in HEK293 cells to drive the transcriptional expression of target genes, some gene expression products can have negative effects on the cells, especially those causing cell death, which can severely affect the rAAV packaging effect. Therefore, developing production technologies to increase rAAV yield, especially the yield of negative effect genes, is of great significance for basic life science research and clinical applications. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide an rAAV plasmid system that produces high levels of cytotoxic genes and its applications.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides an rAAV plasmid system for producing high-yield cytotoxic genes, comprising a transgenic plasmid, a packaging plasmid, and a helper plasmid; wherein the helper plasmid comprises the gene sequence of the apoptosis inhibitor xIAP.

[0006] The rAAV plasmid system of this invention, which produces high-yield cytotoxic genes, includes a helper plasmid containing the gene sequence of the apoptosis inhibitor xIAP. This allows for high expression of the target helper gene during the production of rAAV containing cytotoxic genes. This effectively improves the production efficiency of rAAV, achieving the technical effects of enhancing the drug-likeness of rAAV and reducing production costs.

[0007] In a preferred embodiment of the rAAV plasmid system of the present invention, the cytotoxic genes include apoptosis factors, pyroptosis factors, and necrosis factors; the apoptosis factors include CASP3, CASP6, CASP7, RARP, etc.; the pyroptosis factors include CASP1, CASP4, CASP5, CASP11, GSDMD, etc.; the necrosis factors include RIPK1, RIPK3, MLKL, etc., as well as other death factors.

[0008] In a preferred embodiment of the rAAV plasmid system of the present invention, the transgenic plasmid is a pAAV plasmid; the packaging plasmid is pRep-Cap; and the helper plasmid is pHelper.

[0009] In a second aspect, the present invention provides an rAAV production cell that produces a high level of cytotoxic genes, comprising the plasmid system described in the first aspect.

[0010] As a preferred embodiment of the rAAV production cells of the present invention, the cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

[0011] Thirdly, the present invention provides a method for producing rAAV with high cytotoxicity, which involves transfecting packaging cells with the rAAV plasmid system described in the first aspect; or culturing rAAV producing cells as described in the second aspect.

[0012] In a preferred embodiment of the method described in this invention, the packaging cells are at least one of HEK293, HEK-derived cells, CHO, CHO-derived cells, HeLa cells, Vero cells, and SF-9 cells.

[0013] Fourthly, the present invention applies the rAAV plasmid system described in the first aspect and the rAAV production cells described in the second aspect to the production of rAAV expressing cytotoxic genes.

[0014] In a preferred embodiment of the application described in this invention, the cytotoxic genes include apoptosis factors, pyroptosis factors, and necrosis factors; the apoptosis factors include CASP3, CASP6, CASP7, RARP, etc.; the pyroptosis factors include CASP1, CASP4, CASP5, CASP11, GSDMD, etc.; the necrosis factors include RIPK1, RIPK3, MLKL, etc., as well as other death factors.

[0015] Preferably, the cytotoxic genes include CASP4 and / or RIPK1.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: The rAAV plasmid system of this invention includes a helper plasmid containing the gene sequence of the apoptosis inhibitor xIAP, which can highly express the target helper gene during the production of rAAV containing cytotoxic genes. This effectively improves the production efficiency of rAAV, achieving the technical effects of improving the drug-likeness of rAAV and reducing production costs. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the expression plasmids for apoptosis inhibitors xIAP, BIRC5, and nc886. Figure 2 This is a schematic diagram of the pAAV plasmid structure for the cytotoxic genes CASP4 and RIPK1. Figure 3 To demonstrate the production effect of xIAP during the rAAV~CASP4 packaging process; Figure 4 To demonstrate the production effects of BIRC5 during the rAAV~CASP4 packaging process; Figure 5 To demonstrate the production effect of nc886 during the rAAV~ CASP4 packaging process; Figure 6 To express the production effect of xIAP during the packaging process of rAAV~RIPK1. Detailed Implementation

[0018] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0019] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0020] In the examples, xIAP is X-linked apoptosis inhibitor protein, BIRC5 is protein 5 containing baculovirus IAP repeat sequences, nc886 is non-coding RNA 886, CASP4 is caspase-4, and RIPK1 is receptor-interacting serine / threonine protein kinase 1.

[0021] Example 1: Construction of expression plasmids for apoptosis inhibitors xIAP, BIRC5, and nc886 Using molecular biology techniques such as gene synthesis, PCR, Gibson Assembly, and sequencing analysis, the CAG promoter (Niwa H et al. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991, 15:108(2):193-199), xIAP gene (GenBank accession: NM_001167.4), WPRE3 regulatory element (Choi JH et al. Optimization of AAV expression cassettes to improve packaging capacity and transgene expression in neurons. Mol Brain. 2014, 7:17), and SV40 late polyAsignal (Carswell S, Alwine JC. Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences. Mol Cell Biol. 1989, 9(10):4248-58) was inserted into the pHelper plasmid (GeneBank: AF369965) to obtain the pHelper-xIAP plasmid (see 9(10):4248-58). Figure 1 (Plasmid map of pHelper-xIAP).

[0022] The CAG promoter (Niwa H et.al. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991, 15:108(2):193-199), the BIRC5 gene (GenBank accession: NM_001168.3), the WPRE3 regulatory element (Choi JH et.al. Optimization of AAV expression cassettes to improve packaging capacity and transgene expression in neurons. Mol Brain. 2014, 7:17), and the SV40 latepolyAsignal (Carswell S, Alwine JC. Efficiency of utilization of the simian virus 40 latepolyadenylation site: effects of upstream sequences. Mol Cell Biol. 1989, 9(10):4248-58) were inserted into the pHelper plasmid (GeneBank: AF369965) to obtain the pHelper-BIRC5 plasmid (see Figure 1 (Plasmid map of pHelper-BIRC5).

[0023] The CAG promoter (Niwa H et.al. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991, 15:108(2):193-199), nc886 non-coding RNA (GenBank accession: NR_030583.3), WPRE3 regulatory element (Choi JH et.al. Optimization of AAV expression cassettes to improve packaging capacity and transgene expression in neurons. Mol Brain. 2014, 7:17), and SV40 latepolyAsignal (Carswell S, Alwine JC. Efficiency of utilization of the simian virus 40 latepolyadenylation site: effects of upstream sequences. Mol Cell Biol. 1989, 9(10):4248-58) were inserted into the pHelper plasmid (GeneBank: AF369965) to obtain the pHelper-nc886 plasmid (see Figure 1 (Plasmid map of pHelper-nc886).

[0024] Example 2: Construction of AAV~GOI plasmids for cytotoxic genes CASP4 and RIPK1 In the rAAV packaging process, production is usually achieved by co-transfecting cells with a GOI plasmid containing the target gene and a helper plasmid. However, expression of cytotoxic genes such as CASP4 and RIPK1 during the packaging stage can lead to premature cell death, resulting in extremely low or even zero virus yield. The harvested viral fluid contains a large amount of cell debris, affecting purification, and batch production suffers from poor reproducibility or failure.

[0025] Using molecular biology techniques such as gene synthesis, PCR, Gibson assembly, and sequencing analysis, self-cleaving peptide P2A (Kim JH et al. Highcleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoSOne. 2011, 6(4):e18556.) and CASP4 gene (GenBank accession: NM_001225) were sequentially inserted into the 3' end of the eGFP gene on the pAAV-GFP plasmid (Addgene: 32395) to obtain the pAAV~CASP4 plasmid (see...). Figure 2 (Plasmid map of pAAV~eGFP. P2A.CASP4).

[0026] Similarly, the self-cleaving peptide P2A (Kim JH et al. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoSOne. 2011, 6(4):e18556.) and the RIPK1 gene (GenBank accession: NM_001354930.2) were sequentially inserted into the 3' end of the eGFP gene on the pAAV-GFP plasmid (Addgene: 32395) to obtain the pAAV~RIPK1 plasmid (see...). Figure 2 (Plasmid map of pAAV~eGFP. P2A.RIPK1).

[0027] Example 3: Demonstrating the production effect of xIAP during the rAAV~CASP4 packaging process (1) High concentrations and high purity of pAAV~CASP4, pRep2-Cap9 (Addgene: 112865), pHelper, and pHelper-xIAP plasmids were extracted using a plasmid mini-extraction kit (TIANGEN, Cat#DP106).

[0028] (2) On the day of transfection, take 0.5 mL of Viral Production Cells 2.0 (Gibco, Cat#A49784) suspension cells for cell counting (greater than 3.0E+06 cells / mL) and viability detection (greater than 90%). Dilute the cells to 3.5E+06 cells / mL using OPM-293 CD05 (OPM, Cat #81075-001) medium, dispense 5 mL / well into 6-well cell culture plates, and incubate at 37℃, 5% CO2 incubator with shaking at 125 rpm.

[0029] The Control group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper; the +xIAP group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper-xIAP; the three plasmids were mixed at a ratio of 4.37 μg:6.56 μg:2.19 μg. Each transfection combination was performed in triplicate; two replicate experiments were conducted.

[0030] Add 500 μL of LMEM medium to a centrifuge tube containing the mixed plasmids and vortex for 10 seconds to mix. Add CarpTrans transfection reagent (Opmay, Cat #AC501302) at a ratio of 1.6 μL / μg DNA, vortex for 10 seconds to mix, and incubate at room temperature for 15 minutes. Add the DNA / CarpTrans transfection mixture to a 6-well plate and incubate at 37°C, 5% CO2, with shaking at 125 rpm.

[0031] (3) On the second day after transfection, add 500 μL of cell lysis buffer to a 6-well cell culture plate, shake at 125 rpm for 1 h to lyse the cells, centrifuge at 4000 rpm for 3 min, and collect the supernatant to determine the rAAV genome titer.

[0032] (4) rAAV genome titer determination Harvested rAAV samples were digested using recombinant DNase I (TaKaRa, Cat #2270A). The rAAV samples were diluted 1000-fold, and qRT-PCR was performed using ITR primers (ITR-F: GGAACCCCTAGTGATGGAGTT; ITR-R: CGGCCTCAGTGAGCGA). Serially diluted plasmid standards, negative controls, and rAAV standards were also included. A standard curve was constructed based on the values ​​of the serially diluted plasmid standards, and the genomic titer of the rAAV samples was calculated from the standard curve. Furthermore, the fold change in the genomic titer of the +xIAP group relative to the control group was calculated.

[0033] The results are as follows Figure 3As shown, the CASP4 genome titer in the +xIAP group was 2.95 times that in the Control group.

[0034] Example 4: Demonstrating the production effect of BIRC5 during the rAAV~CASP4 packaging process (1) rAAV packaging test High concentrations and high purity of pAAV~CASP4, pRep2-Cap9 (Addgene: 112865), pHelper, and pHelper-BIRC5 plasmids were extracted using a plasmid mini-extraction kit (TIANGEN, Cat#DP106).

[0035] (2) On the day of transfection, take 0.5 mL of Viral Production Cells 2.0 (Gibco, Cat#A49784) suspension cells for cell counting (greater than 3.0E+06 cells / mL) and viability detection (greater than 90%). Dilute the cells to 3.5E+06 cells / mL using OPM-293 CD05 (OPM, Cat #81075-001) medium, dispense 5 mL / well into 6-well cell culture plates, and incubate at 37℃, 5% CO2 incubator with shaking at 125 rpm.

[0036] The Control group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper; the +BIRC5 group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper-BIRC5; the three plasmids were mixed at a ratio of 4.37 μg:6.56 μg:2.19 μg. Each transfection combination was performed in triplicate; two replicate experiments were conducted.

[0037] Add 500 μL of LMEM medium to a centrifuge tube containing the mixed plasmids and vortex for 10 seconds to mix. Add CarpTrans transfection reagent (Opmay, Cat #AC501302) at a ratio of 1.6 μL / μg DNA, vortex for 10 seconds to mix, and incubate at room temperature for 15 minutes. Add the DNA / CarpTrans transfection mixture to a 6-well plate and incubate at 37°C, 5% CO2, with shaking at 125 rpm.

[0038] (3) On the second day after transfection, 500 μL of cell lysis buffer was added to a 6-well cell culture plate, the cells were lysed by shaking at 125 rpm for 1 h, centrifuged at 4000 rpm for 3 min, and the supernatant was collected for the determination of rAAV genome titer.

[0039] (4) rAAV genome titer determination Harvested rAAV samples were digested using recombinant DNase I (TaKaRa, Cat #2270A). The rAAV samples were diluted 1000-fold, and qRT-PCR was performed using ITR primers (ITR-F: GGAACCCCTAGTGATGGAGTT; ITR-R: CGGCCTCAGTGAGCGA). Serially diluted plasmid standards, negative controls, and rAAV standards were also included. A standard curve was constructed based on the values ​​of the serially diluted plasmid standards, and the genomic titer of the rAAV samples was calculated based on the standard curve. Furthermore, the fold change in the genomic titer of the +BIRC5 group relative to the Control group was calculated.

[0040] The results are as follows Figure 4 As shown, the CASP4 genome titer in the +BIRC5 group was 0.99 times that in the Control group.

[0041] Example 5: Demonstrating the production effect of nc886 during the rAAV~CASP4 packaging process (1) rAAV packaging test High concentrations and high purity of pAAV~CASP4, pRep2-Cap9 (Addgene: 112865), pHelper, and pHelper-nc886 plasmids were extracted using a plasmid mini-extraction kit (TIANGEN, Cat#DP106).

[0042] (2) On the day of transfection, take 0.5 mL of Viral Production Cells 2.0 (Gibco, Cat#A49784) suspension cells for cell counting (greater than 3.0E+06 cells / mL) and viability detection (greater than 90%). Dilute the cells to 3.5E+06 cells / mL using OPM-293 CD05 (OPM, Cat #81075-001) medium, dispense 5 mL / well into 6-well cell culture plates, and incubate at 37℃, 5% CO2 incubator with shaking at 125 rpm.

[0043] The Control group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper; the +nc886 group plasmids consisted of pAAV~CASP4, pRep2-Cap9, and pHelper-nc886; the three plasmids were mixed at a ratio of 4.37 μg:6.56 μg:2.19 μg. Each transfection combination was performed in triplicate; two replicate experiments were conducted.

[0044] Add 500 μL of LMEM medium to a centrifuge tube containing the mixed plasmids and vortex for 10 seconds to mix. Add CarpTrans transfection reagent (Opmay, Cat #AC501302) at a ratio of 1.6 μL / μg DNA, vortex for 10 seconds to mix, and incubate at room temperature for 15 minutes. Add the DNA / CarpTrans transfection mixture to a 6-well plate and incubate at 37°C, 5% CO2, with shaking at 125 rpm.

[0045] (3) On the second day after transfection, 500 μL of cell lysis buffer was added to a 6-well cell culture plate, the cells were lysed by shaking at 125 rpm for 1 h, centrifuged at 4000 rpm for 3 min, and the supernatant was collected for the determination of rAAV genome titer.

[0046] (4) rAAV genome titer determination Harvested rAAV samples were digested using recombinant DNase I (TaKaRa, Cat #2270A). The rAAV samples were diluted 1000-fold, and qRT-PCR was performed using ITR primers (ITR-F: GGAACCCCTAGTGATGGAGTT; ITR-R: CGGCCTCAGTGAGCGA). Serially diluted plasmid standards, negative controls, and rAAV standards were also included. A standard curve was constructed based on the values ​​of the serially diluted plasmid standards, and the genomic titer of the rAAV samples was calculated from the standard curve. Furthermore, the fold change in the genomic titer of the +nc886 group relative to the control group was calculated.

[0047] The results are as follows Figure 5 As shown, the CASP4 genome titer in the +nc886 group was 0.68 times that in the Control group.

[0048] Example 6: Demonstrating the production effect of xIAP during the rAAV~PIPK1 packaging process (1) rAAV packaging test High concentrations and high purity of pAAV~RIPK1, pRep2-Cap9 (Addgene: 112865), pHelper, and pHelper-xIAP plasmids were extracted using a plasmid mini-extraction kit (TIANGEN, Cat#DP106).

[0049] (2) On the day of transfection, take 0.5 mL of Viral Production Cells 2.0 (Gibco, Cat#A49784) suspension cells for cell counting (greater than 3.0E+06 cells / mL) and viability detection (greater than 90%). Dilute the cells to 3.5E+06 cells / mL using OPM-293 CD05 (OPM, Cat #81075-001) medium, dispense 5 mL / well into 6-well cell culture plates, and incubate at 37℃, 5% CO2 incubator with shaking at 125 rpm.

[0050] The Control group plasmids consisted of pAAV~RIPK1, pRep2-Cap9, and pHelper; the +xIAP group plasmids consisted of pAAV~RIPK1, pRep2-Cap9, and pHelper-xIAP; the three plasmids were mixed at a ratio of 4.37 μg:6.56 μg:2.19 μg. Each transfection combination was performed in triplicate; two replicate experiments were conducted.

[0051] Add 500 μL of LMEM medium to a centrifuge tube containing the mixed plasmids and vortex for 10 seconds to mix. Add CarpTrans transfection reagent (Opmay, Cat #AC501302) at a ratio of 1.6 μL / μg DNA, vortex for 10 seconds to mix, and incubate at room temperature for 15 minutes. Add the DNA / CarpTrans transfection mixture to a 6-well plate and incubate at 37°C, 5% CO2, with shaking at 125 rpm.

[0052] (3) On the second day after transfection, 500 μL of cell lysis buffer was added to a 6-well cell culture plate, the cells were lysed by shaking at 125 rpm for 1 h, centrifuged at 4000 rpm for 3 min, and the supernatant was collected for the determination of rAAV genome titer.

[0053] (4) rAAV genome titer determination Harvested rAAV samples were digested using recombinant DNase I (TaKaRa, Cat #2270A). The rAAV samples were diluted 1000-fold, and qRT-PCR was performed using ITR primers (ITR-F: GGAACCCCTAGTGATGGAGTT; ITR-R: CGGCCTCAGTGAGCGA). Serially diluted plasmid standards, negative controls, and rAAV standards were also included. A standard curve was constructed based on the values ​​of the serially diluted plasmid standards, and the genomic titer of the rAAV samples was calculated from the standard curve. Furthermore, the fold change in the genomic titer of the +xIAP group relative to the control group was calculated.

[0054] The results are as follows Figure 6As shown, the PIPK1 genome titer in the +xIAP group was 3.01 times that in the Control group.

[0055] Finally, it should be noted that the Rep2-Cap9 serotype was used in the embodiments of the present invention. Those skilled in the art should understand that the present invention is not limited to this serotype, but includes other serotypes currently known and those that may be discovered in the future. The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A rAAV plasmid system for high production of cytotoxic genes, comprising a transgene plasmid, a packaging plasmid and a helper plasmid; characterized in that, The helper plasmid comprises a gene sequence of an apoptosis inhibitor XIAP.

2. The rAAV plasmid system of claim 1, wherein, The cytotoxic gene comprises an apoptosis factor, a pyroptosis factor and a necrotic factor.

3. The high-yield rAAV plasmid system of claim 1, wherein, The transgene plasmid is a pAAV plasmid; the packaging plasmid is pRep-Cap; and the helper plasmid is pHelper.

4. A rAAV producer cell with high cytotoxic gene production, characterized in that, The plasmid system comprises any one of the plasmids in claims 1-3.

5. The rAAV producer cell of claim 4, wherein, The cell is at least one of HEK293, HEK-derived cell, CHO, CHO-derived cell, Hela cell, Vero cell and SF-9 cell.

6. A method of rAAV production with high yield of cytotoxic gene, characterized by, The rAAV plasmid system in any one of claims 1-3 is used to transfect a packaging cell; or the rAAV production cell in claim 4 or 5 is cultured.

7. The method of claim 6, wherein, The packaging cell is at least one of HEK293, HEK-derived cell, CHO, CHO-derived cell, Hela cell, Vero cell and SF-9 cell.

8. The rAAV plasmid system in any one of claims 1-3 or the rAAV production cell in claim 4 or 5 is used in the production of rAAV expressing a cytotoxic gene.

9. Use according to claim 8, characterized in that, The cytotoxic gene comprises an apoptosis factor, a pyroptosis factor and a necrotic factor.

Citation Information

Patent Citations

  • Recombinant adeno-associated virus vector carrying survivin antigen genes and construction method and application thereof

    CN105087647A

  • Gene therapy constructs and methods for treatment of hearing loss

    CN110709060A

  • AAV cardiac gene therapy for cardiomyopathy

    CN112272705A

  • AAV cardiac gene therapy for cardiomyopathy in humans

    CN114206351A

  • High-yield rAAV plasmid system and application

    CN119662733A