Novel heterocyclic compound

Abstract

The invention provides a p53 mutant reactivator as well as a preparation method and application thereof. The present invention provides compounds of formula (I) and pharmaceutically acceptable salts, solvates, deuterated compounds, polymorphs or isomers thereof, pharmaceutical compositions comprising these compounds, and uses of such compounds and compositions in the treatment of related diseases.

Description

Technical Field

[0001] This invention relates to compounds targeting p53 mutants, pharmaceutical compositions comprising said compounds, methods for preparing said compounds, and the use of said compounds in treating diseases associated with p53 mutants. Background Technology

[0002] p53 gene mutations are the most common mutations in human tumors, occurring in over 50% of cancer patients. The p53 gene, named for its encoding of a 53 kDa protein, is a tumor suppressor gene. Studies have shown that p53, as an important tumor suppressor transcription factor, can be activated under stress stimuli such as hypoxia and DNA damage. It regulates multiple downstream target genes, including ATM, ATR, E2F, and KAT5, to induce cell cycle arrest, apoptosis and senescence, participate in DNA damage repair, immune responses, and regulate cellular metabolism, thereby inhibiting tumor development and progression. However, mutations in p53 can alter the DNA-binding specificity of wild-type p53, disrupt its spatial conformation and thermodynamic stability, leading to loss of activity. Mutations can also negatively regulate p53 function and inactivate its family of tumor suppressor factors, p63 and p73. Misfolded p53 can also bind to other transcription factors in the cytoplasm, thereby activating or inactivating various signaling pathways such as NF-κB and NRF2. These changes can enhance the invasive and migratory abilities of tumor cells and promote angiogenesis, thereby leading to tumor development, spread, and increased resistance to anticancer drugs.

[0003] p53 mutations include various forms such as missense mutations, frameshift mutations, and nonsense mutations. In human cancers with p53 gene mutations, 75% are missense mutations, which frequently occur in the DBD region of p53. Among them, hotspot mutations with high mutation rates include R175H, R248Q / W, R273H / C, and Y220C, etc.

[0004] p53 Y220C is one of the most common p53 mutations, accounting for 1.0-1.5% of all cancer patients, including those with gastric cancer, ovarian cancer, breast cancer, colorectal cancer, pancreatic cancer, and lung cancer. It is estimated that more than 100,000 new cancer patients carrying p53 Y220C are diagnosed globally each year, and there are currently no approved drugs for it. p53 Y220C is a unique mutation; high-resolution crystal structure analysis shows a targetable gap near the Y220C mutation site, a characteristic that provides favorable conditions for small molecule targeted research. PC14586 has been reported as a small molecule reactivator targeting the p53 Y220C mutant, developed by PMV Pharmaceuticals. However, there is still an urgent need in the field to develop novel small molecule reactivators targeting p53 mutants (such as the Y220C mutant) with high activity and low toxicity. Summary of the Invention

[0005] This invention provides a p53 mutant reactivator, which is a compound of general formula (I) or a pharmaceutically acceptable salt, solvate, deuterated compound, polymorph, or isomer thereof. This invention also provides a series of compounds represented by general formula (I) and their pharmaceutically acceptable salts, solvates, deuterated compounds, polymorphs, or isomers, pharmaceutical compositions comprising these compounds, and the use of such compounds to treat diseases associated with p53 mutants.

[0006] In one aspect, the present invention provides compounds of formula (I) or pharmaceutically acceptable salts, solvates, deuterated derivatives, polymorphs or isomers thereof.

[0007]

[0008] in,

[0009] Rings B and C are aromatic rings;

[0010] The D ring is a benzene ring, a naphthalene ring, a 5-12 membered heteroaromatic ring, or a bicyclic ring fused with a 5-6 membered aromatic ring and a 5-7 membered nonaromatic ring;

[0011] X3 can be either N or CR5 independently.

[0012] R5 can be halogen, -CN, -NH2, -OH, or C independently. 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, wherein the alkyl group may optionally be substituted with a halogen, -CN, -NH2, or -OH;

[0013] R2 is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized to... or Furthermore, the cycloalkyl and heterocyclic groups may optionally be replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), -(CO)-NR7R8, -(CO)-OR7, or R 12 replace,

[0014] R 12It is a 3-8 membered cycloalkyl, a 3-8 membered heterocyclic group, a 6-10 membered aryl, or a 5-12 membered heteroaryl, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized to Furthermore, the cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be replaced by (=O), halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution;

[0015] R6 can be halogen, -CN, -NH2, -OH, or C independently. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl, 3-8 membered cycloalkyl, 3-8 membered heterocyclic, -O-(3-8 membered cycloalkyl), -O-(3-8 membered heterocyclic), 6-10 membered aryl, 5-12 membered heteroaryl, -CHO, -(CO)-NR7R8, or -(CO)-OR7, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized, and the alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be oxidized by halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution;

[0016] R1 is -(CO)-NR7R8, -(CO)-(CO)-NR7R8, -NR8-(CO)-(CO)-NR7R8, -(CO)-OR7, -(CO)-R9, -O-(CO)-NR7R8, -O-(CO)-OR7, -O-(C O)-R9, -NR8-(CO)-NR7R8, -NR8-(CO)-OR7, -NR8-(CO)-R9, -(SO2)-R9, -(SO2)-NR7R8, -NR8-(SO2)-R9, -NR8-(SO2)-NR7R8, Or -P(O)R 10 R 11 ;

[0017] L stands for bond.

[0018] X1 is N, X2 is CSR 20 One of X4 and X5 is N, and the other is C.

[0019] R1 is or

[0020] L represents -(CO)- or -(CR3R4) p -,

[0021] X1 is CH, X2 is N-CH2-R 20 X4 is C, X5 is C, or

[0022] X1 is N, X2 is CSR 20 One of X4 and X5 is N, and the other is C;

[0023] R 20 Each independently is C 1-6 Alkyl, Halogenated C 1-6 Alkyl, C 3-6 cycloalkyl or halogenated C 3-6 cycloalkyl;

[0024] R3 and R4 are each independently H or C. 1-6 Alkyl group, wherein the alkyl group may optionally be substituted with halogen, -OH, -NH2, -CN, -NR7R8, or -OR7;

[0025] R8 is independently either H or C. 1-6 alkyl,

[0026] R7 is independently H and C. 1-6 Alkyl, C 2-6 alkenyl, C 2-6 The heterocyclic group may contain alkynyl, 3-8-membered cycloalkyl, 3-8-membered heterocyclic, 6-10-membered aryl, or 5-12-membered heteroaryl, wherein the S atom of the heterocyclic group may optionally be oxidized, and the alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be oxidized by halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, or

[0027] In -NR7R8, R7 and R8 can be linked together to form a 3-8 membered heterocycle. When the heterocycle contains S, its S atom can be optionally oxidized, and the heterocycle can be optionally replaced by (=O), halogen, -CN, -NH2, -OH, C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution;

[0028] R9 is independently C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 The heterocyclic group may contain alkynyl, 3-8-membered cycloalkyl, 3-8-membered heterocyclic, 6-10-membered aryl, or 5-12-membered heteroaryl, wherein the S atom of the heterocyclic group may optionally be oxidized, and the alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be oxidized by halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, or

[0029] The two R9 atoms in the ring can connect together to form a 3-8 membered heterocycle. When the heterocycle contains S, the S atom can be optionally oxidized, and the heterocycle can be optionally replaced by (=O), halogen, -CN, -NH2, -OH, C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution;

[0030] R 10 and R 11 Each independently is C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 The heterocyclic group may contain alkynyl, 3-8-membered cycloalkyl, 3-8-membered heterocyclic, 6-10-membered aryl, or 5-12-membered heteroaryl, wherein the S atom of the heterocyclic group may optionally be oxidized, and the alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups may optionally be oxidized by halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, or

[0031] R 10 With R 11 They can be linked together to form 3-8 membered heterocycles, wherein when S is present, the S atom may be optionally oxidized, and the heterocycle may be optionally coupled with (=O), halogens, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution;

[0032] n is 0, 1, or 2;

[0033] p can be 1, 2, or 3.

[0034] In some embodiments, R2 is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized to... or Furthermore, the cycloalkyl and heterocyclic groups may optionally be replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 alkyl), or R 12 replace,

[0035] R 12 It is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized to Furthermore, the cycloalkyl and heterocyclic groups may optionally be replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution.

[0036] In some implementations, L is -(CO)- or -(CR3R4). p -,

[0037] X1 is CH, X2 is N-CH2-R 20 X4 is C, X5 is C, or X1 is N, X2 is CSR. 20 One of X4 and X5 is N, and the other is C.

[0038] R3, R4 and R 20 As defined above.

[0039] In some embodiments, the D ring is a benzene ring or a pyridine ring.

[0040] In some implementations... for or R1 and R6 are as defined above.

[0041] In some implementations, X3 is CH, R 20 It is CF3.

[0042] In some embodiments, R2 is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom may optionally be oxidized to... or Furthermore, the cycloalkyl and heterocyclic groups may optionally be replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution,

[0043] In some embodiments, R6 is independently a halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, wherein the alkyl group may optionally be substituted with a halogen.

[0044] In some implementations, R6 is independently -OC 1-6 Alkyl group, wherein the alkyl group may optionally be substituted with a halogen.

[0045] In some embodiments, the present invention provides the following compounds

[0046]

[0047]

[0048]

[0049]

[0050] Or a pharmaceutically acceptable salt, solvate, deuterated, polymorph or isomer thereof.

[0051] In another aspect, the present invention provides a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, and a pharmaceutically acceptable carrier.

[0052] In another aspect, the present invention provides a method for treating diseases associated with p53 mutants, the method comprising administering to a subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph or isomer thereof, or a pharmaceutical composition thereof.

[0053] In another aspect, the present invention provides the use of the compounds of the present invention or pharmaceutically acceptable salts, solvates, deuterated derivatives, polymorphs, or tautomers thereof, or pharmaceutical compositions thereof, in the preparation of medicaments for treating diseases associated with p53 mutants.

[0054] In some embodiments, the p53 mutant has mutations at amino acids Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282 and / or combinations thereof.

[0055] In some embodiments, the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W and / or a combination thereof, preferably Y220C.

[0056] In some embodiments, the disease associated with the p53 mutant is cancer; preferably, the cancer is lymphoma, leukemia, carcinoma, and sarcoma; for example, non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, follicular lymphoma, mucosa-associated lymphoid tissue lymphoma, marginal zone lymphoma, T-cell lymphoma, Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, chronic lymphocytic leukemia, small lymphocytic lymphoma, Waldenström macroglobulinemia, lymphocytic T-cell leukemia, chronic myeloid leukemia, hairy cell leukemia, acute lymphoblastic T-cell leukemia, plasma cell leukemia, etc. Cell tumors, immunoblastic large cell leukemia, megakaryocytic leukemia, acute megakaryocytic leukemia, promyelocytic leukemia, erythroleukemia, glioma, glioblastoma, breast cancer, colorectal cancer, prostate cancer, lung cancer, gastric cancer, endometrial cancer, melanoma, pancreatic cancer, liver cancer, kidney cancer, squamous cell carcinoma, ovarian cancer, sarcoma, osteosarcoma, thyroid cancer, bladder cancer, head and neck cancer, testicular cancer, Ewing's sarcoma, rhabdomyosarcoma, medulloblastoma, neuroblastoma, cervical cancer, kidney cancer, urothelial carcinoma, vulvar cancer, esophageal cancer, salivary gland cancer, nasopharyngeal carcinoma, buccal cancer, oral cancer, or gastrointestinal stromal tumors. Invention Details

[0057] Exemplary embodiments utilizing the principles of the invention are set forth in the following detailed description of the invention. The features and advantages of the invention can be better understood by referring to the following summary of the invention.

[0058] It should be understood that the scope of protection of each aspect of the present invention is determined by the claims, and the methods and structures within the scope of these claims, as well as their equivalents, are all within the scope of these claims.

[0059] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent applications, and publications cited in this document are incorporated herein in their entirety through reference.

[0060] It should be understood that the above summary and the following detailed description are exemplary and explanatory, and not intended to limit any subject matter of the invention. Unless otherwise specified, the singular form includes the plural form. Unless otherwise specified, the use of "or" or "or" means "and / or". Furthermore, the use of the term "comprising" and other forms such as "including," "containing," and "containing" are not limiting.

[0061] Some chemical terms

[0062] The terms “optional,” “optional,” or “optionally” mean that the event or condition described below may or may not occur, including both the occurrence and non-occurrence of the event or condition. For example, “optionally substituted alkyl” means “unsubstituted alkyl” or “substituted alkyl.” Furthermore, the optionally substituted group can be unsubstituted (e.g., -CH2CH3), fully substituted (e.g., -CF2CF3), monosubstituted (e.g., -CH2CH2F), or any level between monosubstituted and fully substituted (e.g., -CH2CHF2, -CF2CH3, -CFHCHF2, etc.). Those skilled in the art will understand that for any group containing one or more substituents, no substitution or substitution mode that is spatially impossible and / or cannot be synthesized is introduced.

[0063] Unless otherwise stated, conventional methods within the scope of the art, such as mass spectrometry, nuclear magnetic resonance, high-performance liquid chromatography, infrared and ultraviolet / visible spectroscopy, and pharmacological methods, are employed. Unless specifically defined herein, the terminology, experimental procedures, and techniques used herein in analytical chemistry, organic synthetic chemistry, and pharmaceutical and medicinal chemistry are known in the art. Standard techniques can be used in chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and patient treatment. For example, reactions and purifications can be carried out using the manufacturer's instructions for use of reagent kits, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein are generally carried out according to conventional methods well known in the art, based on descriptions in several summary and more specific documents cited and discussed herein. In this specification, groups and their substituents can be selected by those skilled in the art to provide stable structural moieties and compounds.

[0064] When a substituent is described using a conventional chemical formula written from left to right, it also includes chemically equivalent substituents obtained when the structural formula is written from right to left. For example, -CH2O- is equivalent to -OCH2-.

[0065] As used in this article, the terms "group" and "chemical group" refer to a specific part or functional group of a molecule. Chemical groups are often considered as chemical entities that are embedded in or attached to a molecule.

[0066] Some chemical groups named herein may be indicated by abbreviations to represent the total number of carbon atoms. For example, C1-C6 alkyl describes an alkyl group having a total of 1 to 6 carbon atoms, as defined below. The total number of carbon atoms indicated by the abbreviations does not include carbon atoms on possible substituents.

[0067] The terms “halogen,” “halogenated,” or “halogenated” refer to bromine, chlorine, fluorine, or iodine.

[0068] The compounds of the present invention may contain one or more (e.g., one, two, three, or four) isotopic substitutions. For example, in said compounds, H may be any isotopic form, including 1 H, 2 H (D or deuterium) and 3 H (T or tritium); C can be any isotopic form, including 12 C 13 C and 14 C and O can be any isotopic form, including 16 O and 18 O etc.

[0069] As used herein, the terms "aromatic," "aromatic ring," "aromatic," "aromatic," and "aromatic ring" refer to a planar ring or ring portion of one or more rings having a delocalized electronic conjugated system containing 4n+2 electrons, where n is an integer. An aromatic ring can be formed from 5, 6, 7, 8, 9, or more atoms. Aromatic compounds can be optionally substituted and can be monocyclic or polycyclic with fused rings. The term aromatic compound includes all carbocyclic rings (such as benzene rings) and rings containing one or more heteroatoms (such as pyridine).

[0070] The term "heteroatom" or "heteroatom" as used herein, alone or as part of other components, refers to an atom other than carbon and hydrogen. Heteroatoms are independently selected from, but not limited to, oxygen, nitrogen, sulfur, phosphorus, silicon, selenium, and tin. In embodiments where two or more heteroatoms are present, the two or more heteroatoms may be identical to each other, or some or all of the two or more heteroatoms may be different from each other.

[0071] The term “dense” or “dense ring” as used alone or in combination in this article refers to a ring structure in which two or more rings share one or more bonds.

[0072] The term “spiral” or “spiral ring” as used alone or in combination in this article refers to a ring structure in which two or more rings share one or more atoms.

[0073] The term "alkyl" as used alone or in combination herein refers to a monovalent saturated hydrocarbon with optional substituted straight or optional substituted branched chains having 1-12 carbon atoms, preferably 1-8 carbon atoms, more preferably 1-6 carbon atoms, and connected to other parts of the molecule by single bonds, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, n-octyl, n-nonyl, n-decyl, etc.

[0074] The term "alkenyl" as used alone or in combination herein refers to a monovalent hydrocarbon group of optional substituted straight or optional substituted branched form, having one or more C=C double bonds and having 2 to about 10 carbon atoms, more preferably 2 to about 6 carbon atoms. The double bonds in these groups may be in cis or trans conformations and should be understood to include both isomers. Examples include, but are not limited to, vinyl (CH=CH2), 1-propenyl (CH2CH=CH2), isopropenyl (C(CH3)=CH2), butenyl, and 1,3-butadienyl. When alkenyl as defined herein appears in numerical ranges, for example, "C2-C6 alkenyl" or "C 2-6 "Alkenyl" refers to an alkenyl group that can be composed of 2, 3, 4, 5, or 6 carbon atoms. In this article, alkenyl also includes cases where no numerical range is specified.

[0075] The term "alkynyl" as used alone or in combination herein refers to an optionally substituted straight-chain or branched monovalent hydrocarbon group having one or more C-3C triple bonds and having 2 to about 10 carbon atoms, more preferably 2 to about 6 carbon atoms. Examples include, but are not limited to, ethynyl, 2-propynyl, 2-butynyl, and 1,3-butadiynyl. When alkynyl as defined herein appears in a numerical range, such as "C2-C6 alkynyl" or "C 2-6 "Alynyl" refers to an alkynyl group that can be composed of 2, 3, 4, 5, or 6 carbon atoms. In this article, alkynyl also includes cases where no numerical range is specified.

[0076] The term "aryl" refers to a fully carbon monocyclic or fused ring having a fully conjugated π-electron system, having 6-14 carbon atoms, preferably 6-12 carbon atoms, and most preferably 6 carbon atoms. The aryl group can be unsubstituted or substituted with one or more substituents, examples of which include, but are not limited to, alkyl, alkyloxy, aryl, aralkyl, amino, halogen, hydroxyl, sulfonyl, sulfinyl, phosphoryl, and heterocyclic groups. Non-limiting examples of unsubstituted aryl groups include, but are not limited to, phenyl, naphthyl, and anthraceneyl.

[0077] The term "heteroaryl" refers to a monocyclic or fused ring with 5-12 ring atoms, having 5, 6, 7, 8, 9, 10, 11, or 12 ring atoms, of which 1, 2, 3, or 4 are selected from N, O, and S, and the remaining ring atoms are C, and possessing a fully conjugated π-electron system. Heteroaryl groups can be unsubstituted or substituted, and the substituents include, but are not limited to, alkyl, alkyloxy, aryl, aralkyl, amino, halogen, hydroxyl, cyano, nitro, carbonyl, and heterocyclic groups. Non-limiting examples of unsubstituted heteroaryl groups include, but are not limited to, pyrrole, furanyl, thiophene, imidazolyl, oxazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, quinolinyl, isoquinolinyl, tetrazolyl, and triazineyl.

[0078] The term "cycloalkyl" as used herein, alone or as part of other components, refers to a stable, monovalent, non-aromatic monocyclic or polycyclic hydrocarbon group containing only carbon and hydrogen atoms. It may include fused ring, spirocyclic, or bridged ring systems, containing 3-15 cyclic carbon atoms, preferably 3-10 cyclic carbon atoms, more preferably 3-8 cyclic carbon atoms, and may be saturated or unsaturated, linked to other parts of the molecule by single bonds. Non-limiting examples of "cycloalkyl" include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0079] The term "carbocyclic" as used alone or as part of other components herein refers to a stable, non-aromatic monocyclic or polycyclic hydrocarbon group containing only carbon and hydrogen atoms. It may include fused ring, spirocyclic, or bridged ring systems, containing 3-15 cyclic carbon atoms, preferably 3-10 cyclic carbon atoms, more preferably 3-8 cyclic carbon atoms, and may be saturated or unsaturated.

[0080] As used alone or as part of other components herein, the terms "heterocyclic alkyl," "heterocyclic group," and "heterocycle" refer to a stable 3-18 member monovalent non-aromatic ring comprising 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise stated, the heterocyclic group can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, which may contain fused rings, spirocyclic, or bridged ring systems. The nitrogen, carbon, or sulfur on the heterocyclic group may be selectively oxidized, the nitrogen atom may be selectively quaternized, and the heterocyclic group may be partially or completely saturated. A heterocyclic group can be connected to the rest of the molecule via a single bond through a carbon atom or heteroatom on the ring. Heterocyclic groups containing fused rings may contain one or more aromatic or heteroaromatic rings, provided that the atoms connected to the rest of the molecule are atoms from non-aromatic rings. For the purposes of this application, the heterocyclic group is preferably a stable 4-11 valent monovalent non-aromatic monocyclic or bicyclic ring containing 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur; more preferably, it is a stable 4-8 valent monovalent non-aromatic monocyclic ring containing 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur. Non-limiting examples of heterocyclic groups include azirheptanyl, azirheptanyl, decahydroisoquinolinyl, dihydrofuranyl, dihydroindolyl, dioxopentyl, 1,1-dioxo-thiomorpholinyl, imidazoalkyl, imidazolinyl, isothiazolyl, isoxazolyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, oxazinyl, piperazinyl, piperidinyl, 4-piperidinoneyl, pyranyl, pyrazolyl, pyrrolidinyl, quinazinyl, quininecycloyl, tetrahydrofuranyl, tetrahydropyranyl, etc.

[0081] The term "heterocycle" as used herein, either alone or as part of other components, refers to a stable 3-18 membered non-aromatic ring comprising 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise stated, the heterocycle can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, which may contain fused rings, spirocyclic, or bridged ring systems. The nitrogen, carbon, or sulfur on the heterocyclic group may be selectively oxidized, the nitrogen atom may be selectively quaternized, and the heterocycle may be partially or completely saturated. Heterocycles containing fused rings may contain one or more aromatic or heteroaromatic rings, provided that the atoms attached to the remainder of the molecule are atoms from non-aromatic rings. For the purposes of this application, the heterocycle is preferably a stable 4-11 membered non-aromatic monocyclic or bicyclic ring comprising 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur, and more preferably a stable 4-8 membered non-aromatic monocyclic ring comprising 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur.

[0082] The term "polymorph" or "polymorphism" as used in this invention refers to the fact that the compounds of this invention have multiple crystal lattice forms. Some compounds of this invention may have more than one crystal form, and this invention covers all polymorphs or mixtures thereof.

[0083] Intermediate compounds and polymorphs of the compounds of this invention are also within the scope of this invention.

[0084] Unless otherwise specified, the olefin double bonds contained in the compounds of this invention include E and Z isomers.

[0085] It should be understood that the compounds of the present invention may contain asymmetric centers. These asymmetric centers may independently be R or S configurations. Some compounds of the present invention may also exhibit cis-trans isomerism, which will be apparent to those skilled in the art. It should be understood that the compounds of the present invention include their individual geometric isomers and stereoisomers, as well as mixtures thereof, including racemic mixtures. These isomers can be isolated from mixtures thereof by implementing or modifying known methods, such as chromatography and recrystallization techniques, or they can be prepared separately from suitable isomers of their intermediates.

[0086] The term “pharmaceutically acceptable salt” as used in this article includes both salts with added acid salts and salts with added alkali salts.

[0087] "Pharmaceutically acceptable salts" refer to salts that retain the biological potency and properties of the free base of a compound, are not biologically or otherwise undesirable, and are formed with inorganic acids, such as, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., or organic acids, such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, decanoic acid, hexanoic acid, carbonic acid, cinnamic acid, citric acid, etc. "Pharmaceutically acceptable base salts" refer to salts that retain the biological potency and properties of the free acid of a compound, and are not biologically or otherwise undesirable. These salts are prepared by reacting a free acid with an inorganic or organic base. Salts formed by reacting with inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, etc. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts, and manganese salts.

[0088] Organic bases that form salts include, but are not limited to, primary amines, secondary amines, tertiary amines, and cyclic amines, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, ethanolamine, dicyclohexylamine, ethylenediamine, purines, piperazine, piperidine, choline, and caffeine. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0089] Crystallization often produces solvates of the compounds of this invention. As used herein, the term "solvate" refers to a combination of one or more molecules of the compounds of this invention and one or more solvent molecules.

[0090] The solvent can be water, in which case the solvate is a hydrate. Alternatively, it can be an organic solvent. Therefore, the compounds of this invention can exist as hydrates, including monohydrates, dihydrates, hemihydrates, trihydrates, tetrahydrates, etc., and the corresponding solvated forms. The compounds of this invention can be true solvates, but in other cases, they may simply retain water or a mixture of water and some other solvents by chance. The compounds of this invention can react in a solvent or precipitate or crystallize in a solvent. The solvates of the compounds of this invention are also included within the scope of this invention.

[0091] As used herein, the term "pharmaceutical composition" refers to a formulation containing the compounds of the present invention and a medium generally accepted in the art for delivering biologically active compounds to mammals, such as humans. This medium includes all pharmaceutically acceptable carriers.

[0092] As used in this article, the term "acceptable" in relation to formulations, compositions, or ingredients means that it does not have a lasting harmful effect on the overall health of the treated subject.

[0093] As used herein, the term "pharmaceutically acceptable" means a substance (such as a carrier or diluent) that does not affect the biological activity or properties of the compounds of the present invention and is relatively non-toxic, i.e., that the substance can be administered to an individual without causing an adverse biological reaction or interacting adversely with any component contained in the composition.

[0094] "Pharmaceutically acceptable carriers" include, but are not limited to, adjuvants, carriers, excipients, auxiliaries, deodorants, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants and wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers that have been approved by the relevant government administrative departments for use in humans and domesticated animals.

[0095] As used herein, the terms “subject,” “patient,” “object,” or “individual” refer to an individual suffering from a disease, disorder, or symptom, including both mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the class Mammalia: humans; non-human primates (e.g., chimpanzees and other apes and monkeys); livestock such as cattle, horses, sheep, goats, and pigs; domesticated animals such as rabbits, dogs, and cats; and laboratory animals, including rodents such as rats, mice, and guinea pigs. Examples of non-human mammals include, but are not limited to, birds and fish. In one embodiment of the methods and compositions provided herein, the mammal is a human.

[0096] The term "treatment" as used in this article refers to the treatment of relevant diseases or conditions in mammals, particularly humans, including...

[0097] (i) To prevent mammals, especially those previously exposed to a disease or condition but not yet diagnosed with it, from developing the corresponding disease or condition.

[0098] (ii) To suppress a disease or symptom, that is, to control its development;

[0099] (iii) To alleviate the disease or symptom, that is, to make the disease or symptom subside;

[0100] (iv) Relieve symptoms caused by disease or illness.

[0101] The terms “disease” and “symptom” used in this article may be used interchangeably or have different meanings, because some specific diseases or symptoms do not yet have known causative factors (so the cause of the disease is still unclear), so they cannot be recognized as diseases but can only be regarded as unwanted conditions or syndromes. These syndromes have more or less some specific symptoms that have been confirmed by clinical researchers.

[0102] As used herein, the terms "effective amount," "therapeutic effective amount," or "pharmaceutical effective amount" refer to an amount of at least one drug or compound that, when taken, is sufficient to alleviate, to some extent, one or more symptoms of the disease or condition being treated. The result may be a reduction and / or relief of signs, symptoms, or causes, or any other desired change in a biological system. For example, an "effective amount" for treatment is the amount of a composition containing the compounds disclosed herein that is clinically necessary to provide significant symptom relief. Effective amounts suitable for any individual case can be determined using techniques such as dose escalation testing.

[0103] As used herein, the terms “administration,” “application,” “dosage,” etc., refer to methods that deliver a compound or composition to the desired site for biological action. These methods include, but are not limited to, oral administration, duodenal administration, parenteral administration (including intravenous, subcutaneous, intraperitoneal, intramuscular, intra-arterial injection or infusion), local administration, and rectal administration. In preferred embodiments, the compounds and compositions discussed herein are administered orally.

[0104] Preparation of the compounds of the present invention

[0105] The following reaction route illustrates a method for preparing the compounds of the present invention.

[0106] It should be understood that, in the following description, the combination of substituents and / or variables of the molecular formula is permitted only in the case of forming a stable compound.

[0107] Those skilled in the art will also understand that, in the processes described below, the functional groups of the intermediate compounds may need to be protected by suitable protecting groups. These functional groups include hydroxyl, amino, mercapto, and carboxyl groups. Suitable hydroxyl protecting groups include trialkylsilyl or diarylalkylsilyl (e.g., tert-butylmethylsilyl, tert-butyldiphenylsilyl, or trimethylsilyl), tetrahydropyranyl, benzyl, etc. Suitable amino, amidine, and guanidine protecting groups include tert-butyloxycarbonyl, benzyloxycarbonyl, etc. Suitable mercapto protecting groups include -C(O)-R″ (R″ represents alkyl, aryl, or arylalkyl), p-methoxybenzyl, triphenylmethyl, etc. Suitable carboxyl protecting groups include alkyl, aryl, or arylalkyl esters. Protecting groups can be added or removed using standard techniques known to those skilled in the art. Example

[0108] The following non-limiting embodiments are merely illustrative and do not limit the invention in any way.

[0109] Unless otherwise specified, temperatures are in Celsius. Reagents were purchased from commercial suppliers such as Sinopharm Chemical Reagents Beijing Co., Ltd., Alfa Aesar, or Beijing Bailingwei Technology Co., Ltd., and these reagents are ready for use without further purification, unless otherwise specified.

[0110] Unless otherwise specified, the following reactions are carried out at room temperature, in anhydrous solvents, under positive pressure of nitrogen or argon, or using a drying tube; the reaction flask is fitted with a rubber diaphragm to allow for the addition of substrates and reagents via syringe; glassware is dried by drying and / or heating.

[0111] Unless otherwise specified, column chromatography purification used 200-300 mesh silica gel from Qingdao Ocean Chemical Plant; preparative thin-layer chromatography used thin-layer chromatography silica gel pre-plates (HSGF254) produced by Yantai Chemical Industry Research Institute; MS determination was performed using a ThermoLCQ Fleet (ESI) liquid chromatography-mass spectrometry system; optical rotation determination was performed using an SGW-3 automatic polarimeter from Shanghai Shenguang Instrument Co., Ltd.

[0112] NMR data ( 1 H NMR was performed using a Varian instrument at 400 MHz. Solvents used for NMR data included CDCl3, CD3OD, D2O, and DMSO-d6, with tetramethylsilane (0.00 ppm) or residual solvents as the reference (CDCl3: 7.26 ppm; CD3OD: 3.31 ppm; D2O: 4.79 ppm; d6-DMSO: 2.50 ppm). When indicating peak shape diversity, the following abbreviations are used to represent different peak shapes: s (singleton), d (doublet), t (triplet), q (quartet), m (multiplex), br (broad peak), dd (double doublet), dt (double triplet). If coupling constants are given, they are expressed in Hertz (Hz).

[0113] Synthesis method

[0114] Synthesis of intermediates:

[0115] Intermediate 1

[0116] 3-Methoxy-N-methyl-4-(prop-2-yn-1-ylamino)benzamide

[0117]

[0118] Step 1: 3-Methoxy-N-methyl-4-nitrobenzamide

[0119]

[0120] Under nitrogen protection, methyl 3-methoxy-4-nitrobenzoate (5.0 g) was dissolved in toluene (40 mL), and methylamine hydrochloride (3.2 g) was added. The mixture was stirred at room temperature for 5 minutes, and then a 1 mol / L solution of bis(trimethylsilylamino)lithium in tetrahydrofuran (70 mL) was slowly added. The mixture was stirred at room temperature for 1 hour. The reaction was quenched with saturated ammonium chloride aqueous solution (200 mL), and the mixture was extracted with ethyl acetate (200 mL × 3). The extract was washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (difluoromethane / methanol = 20:1) to obtain the target product (3.0 g).

[0121] Step 2: 3-Methoxy-N-methyl-4-aminobenzamide

[0122]

[0123] 3-Methoxy-N-methyl-4-nitrobenzamide (3.0 g) and tetrahydroxydiboron (5.55 g) were dissolved in N,N-dimethylformamide (50 mL), and 0.1 mol / L of 4,4-bipyridine in N,N-dimethylformamide solution (1.5 mL) was slowly added. The mixture was stirred at room temperature for 5 minutes. The reaction was quenched with water (100 mL), and the mixture was extracted with dichloromethane (100 mL × 5). The extract was concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to obtain the target product (3.9 g).

[0124] Step 3: 3-Methoxy-N-methyl-4-(prop-2-yn-1-ylamino)benzamide

[0125]

[0126] 3-Methoxy-N-methyl-4-aminobenzamide (3.56 g), propargyl bromide (2.4 g), and potassium carbonate (2.76 g) were dissolved in N,N-dimethylformamide (40 mL), and the mixture was heated to 50 °C and stirred for 16 hours. After cooling to room temperature, the reaction was quenched with water (100 mL), and the mixture was extracted with ethyl acetate (100 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 1:2) to give the target product (2.7 g).

[0127] Intermediate 2

[0128] 2-Methoxy-4-(Methylsulfonyl)-N-(Prop-2-yn-1-yl)aniline

[0129]

[0130] Step 1: 2-Methoxy-4-(Methylsulfonyl)aniline

[0131]

[0132] Using 2-methoxy-4-(methanesulfonyl)nitrobenzene as a starting material, the target product was obtained by referring to step 2 of the synthesis of intermediate 1.

[0133] Step 2: 2-Methoxy-4-(Methylsulfonyl)-N-(Prop-2-yn-1-yl)aniline

[0134]

[0135] Using 2-methoxy-4-(methylsulfonyl)aniline as a starting material, the target product was obtained by referring to step 3 of the synthesis of intermediate 1.

[0136] Intermediate 3

[0137] (3-Methoxy-4-(prop-2-yn-1-ylamino)phenyl)(methyl)(methylimino)-λ 6 -sulfone

[0138]

[0139] Step 1: imino(3-methoxy-4-nitrophenyl)(methyl)-λ 6 - Sulfone

[0140]

[0141] (3-Methoxy-4-nitrophenyl)(methyl) sulfone (500 mg), ammonium carbamate (780 mg), and iodobenzene acetate (2.45 g) were dissolved in ethanol (50 mL) and stirred at room temperature for 2 hours. The reaction was quenched with water (100 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to give the target product (445 mg).

[0142] Step 2: (3-Methoxy-4-nitrophenyl)(methyl)(methylimine)-λ 6 -sulfone

[0143]

[0144] imino(3-methoxy-4-nitrophenyl)(methyl)-λ 6Sulfone (445 mg) and 37% (w / w) formaldehyde aqueous solution (6 mL) were added to formic acid (50 mL), and the mixture was heated to 100 °C and stirred for 48 hours. After cooling to room temperature, the reaction was quenched with water (100 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to give the target product (340 mg).

[0145] Step 3: (3-Methoxy-4-aminophenyl)(methyl)(methylimine)-λ 6 -sulfone

[0146]

[0147] (3-methoxy-4-nitrophenyl)(methyl)(methylimine)-λ 6 Using sulfone (335 mg) as a starting material, the target product (276 mg) was obtained by referring to step 2 of the synthesis of intermediate 1.

[0148] Step 4: (3-methoxy-4-(prop-2-yn-1-ylamino)phenyl)(methyl)(methylimino)-λ 6 -sulfone

[0149]

[0150] (3-methoxy-4-aminophenyl)(methyl)(methylimine)-λ 6 Using sulfone (260 mg) as a starting material, the target product (200 mg) was obtained by referring to step 3 of the synthesis of intermediate 1.

[0151] Intermediate 4

[0152] imino(3-methoxy-4-(prop-2-yn-1-ylimino)phenyl)(methyl)-λ 6 -sulfone

[0153]

[0154] imino(3-methoxy-4-nitrophenyl)(methyl)-λ 6 Using sulfone (500 mg) as a starting material, the target product (200 mg) was obtained by referring to steps 3 and 4 of the synthesis of intermediate 3.

[0155] Intermediate 5

[0156] ((3-methoxy-4-(prop-2-yn-1-ylamino)phenyl)imino)dimethyl-λ 6 -sulfone

[0157]

[0158] Step 1: Under argon protection, 4-bromo-2-methoxynitrobenzene (2.32 g), dimethyl sulfinyl imide (1.4 g), bis(triphenylphosphine)-naphthyl (1.5 g), palladium acetate (225 mg), and cesium carbonate (6.52 g) were added to toluene (100 mL), and the mixture was heated to 110 °C and stirred for 36 hours. After cooling to room temperature, the reaction was quenched with water (100 mL), extracted with ethyl acetate (200 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 25:1) to obtain the target product (1.2 g).

[0159] Steps 2 and 3: Following steps 2 and 3 of the synthesis of intermediate 1, the target product (421 mg) was obtained.

[0160] Intermediate 6

[0161] Dimethyl(4-(propyl-2-yn-1-ylamino)phenyl)phosphine oxide

[0162]

[0163] Using (4-amino-3-methoxyphenyl)dimethylphosphine oxide (500 mg) as a starting material, the target product (206 mg) was obtained by referring to step 3 of the synthesis of intermediate 1.

[0164] Intermediate 7

[0165] 4-Methoxy-6-(Methylsulfonyl)-N-(Prop-2-yn-1-yl)pyridine-3-amine

[0166]

[0167] Step 1: 4-Methoxy-6-(Methylsulfonyl)pyridine-3-amine

[0168]

[0169] Using 4-methoxy-2-(methanesulfonyl)-5-nitropyridine (464 mg) as the starting material, the target product (380 mg) was obtained by following step 2 of the synthesis of intermediate 1.

[0170] Step 2: 4-Methoxy-6-(Methylsulfonyl)-N-(Prop-2-yn-1-yl)pyridine-3-amine

[0171]

[0172] Using 4-methoxy-6-(methanesulfonyl)pyridine-3-amine (350 mg) as the starting material, the target product (140 mg) was obtained by referring to step 3 of the synthesis of intermediate 1.

[0173] Intermediate 8

[0174] 8-Bromo-2-iodo-3-((trifluoromethyl)thio)imidazo[1,2-a]pyridine

[0175]

[0176] Step 1: 2-Amino-3-bromo-1-(2-ethoxy-2-oxoethyl)pyridine bromide

[0177]

[0178] Under nitrogen protection, ethyl 2-bromoacetic acid (10 mL) was added to 2.5 g of 3-bromo-2-aminopyridine, and the mixture was heated to 50 °C and reacted for 12 hours. The reaction mixture was cooled to room temperature, and 50 mL of isopropyl ether was added. The mixture was filtered, the filter cake was washed with isopropyl ether, and dried to obtain the target product (4.3 g).

[0179] Step 2: 8-Bromo-2-chloroimidozolo[1,2-a]pyridine

[0180]

[0181] Under nitrogen protection, phosphorus oxychloride (10 mL) was added to 1.0 g of 2-amino-3-bromo-1-(2-ethoxy-2-oxoethyl)pyridine bromide, and the mixture was heated to 105 °C for 5 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the pH was adjusted to 10 by adding saturated sodium bicarbonate aqueous solution to the residue. The residue was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target product (0.53 g).

[0182] Step 3: 8-Bromo-2-iodoimidazole[1,2-a]pyridine

[0183]

[0184] Under nitrogen protection, anhydrous acetonitrile (10 mL) and hydroiodic acid (1.2 mL) were added to 0.53 g of 8-bromo-2-chloroimidazolo[1,2-a]pyridine and 1.7 g of sodium iodide, and the mixture was heated to 85 °C and reacted for 12 hours. The reaction solution was cooled to room temperature and concentrated under reduced pressure. The residue was adjusted to pH 10 with an aqueous sodium hydroxide solution (4 mol / L), and residual iodine was removed by adding saturated sodium thiosulfate solution. The mixture was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to obtain the target product (0.63 g).

[0185] Step 4: 8-Bromo-2-iodo-3-((trifluoromethyl)thio)imidazo[1,2-a]pyridine

[0186]

[0187] Under nitrogen protection, anhydrous acetonitrile (15 mL) was added to 0.63 g of 8-bromo-2-iodoimidazole[1,2-a]pyridine and 0.72 g of N-thiotrifluoromethyl-o-sulfonylbenzoimide, followed by the slow addition of trimethylchlorosilane (0.32 g). The reaction was carried out at room temperature for 12 hours. The mixture was concentrated under reduced pressure, and water (100 mL) was added to the residue. The residue was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to obtain the target product (0.60 g).

[0188] Intermediate 9

[0189] 7-Chloro-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine

[0190]

[0191] Step 1: 2-Iodopyrazolo[1,5-a]pyridine

[0192]

[0193] Under argon protection, pyrazolo[1,5-a]pyridine (5 g) was added to anhydrous tetrahydrofuran (50 mL), and boron trifluoride diethyl ether (5.8 mL) was slowly added dropwise to the reaction solution at 0 °C, while stirring at 0 °C for 1 hour. The reaction solution was cooled to -78 °C, and a tetrahydrofuran solution of lithium diisopropylmagnesium chloride (2,2,6,6-tetramethylpiperidine) (1 mol / L, 51 mL) was slowly added dropwise to the reaction solution, while stirring at -78 °C for 2 hours. At -78 °C, an anhydrous tetrahydrofuran solution of iodine (16.2 g) (30 mL) was slowly added dropwise to the reaction solution, and then stirred at room temperature overnight. At 0 °C, a saturated sodium carbonate aqueous solution (100 mL) and water (200 mL) were added to the reaction solution, and stirring at room temperature for 1 hour. Extracted with ethyl acetate (300 mL × 3), the extract was rinsed with saturated sodium thiosulfate aqueous solution (300 mL × 3) to remove residual iodine, washed with saturated brine (300 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 20:1) to obtain the target product (6.4 g).

[0194] Step 2: 7-Chloro-2-iodopyrazolo[1,5-a]pyridine

[0195]

[0196] Under argon protection, 6.3 g of 2-iodopyrazolo[1,5-a]pyridine was added to 50 mL of anhydrous tetrahydrofuran. The mixture was cooled to -78 °C, and a tetrahydrofuran solution (1 mol / L, 35.5 mL) of lithium diisopropyl magnesium chloride (2,2,6,6-tetramethylpiperidine) was slowly added dropwise to the reaction solution. The mixture was stirred at -78 °C for 1 hour. Then, a tetrahydrofuran solution (20 mL) of 9 g of hexachloroethane was slowly added dropwise to the reaction solution. The mixture was stirred at -78 °C for 40 minutes, and then stirred at room temperature for 2 hours. Add water (200 mL) and saturated sodium thiosulfate aqueous solution (200 mL) to the reaction solution, extract with ethyl acetate (300 mL × 3), wash the extract with saturated brine (400 mL × 3), dry with anhydrous sodium sulfate, concentrate under reduced pressure, and purify the residue by column chromatography (petroleum ether / ethyl acetate = 20:1) to obtain the target product (5.7 g).

[0197] Step 3: 7-Chloro-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine

[0198]

[0199] Under argon protection, 7-chloro-2-iodopyrazolo[1,5-a]pyridine (5.0 g) and N-thiotrifluoromethyl-o-sulfonylbenzoimide (7.6 g) were added to anhydrous acetonitrile (100 mL), followed by slow addition of trimethylchlorosilane (2.93 g). The mixture was stirred at room temperature for 1 hour, then heated to 60 °C and stirred for another 1 hour. The reaction mixture was cooled to room temperature and concentrated under reduced pressure. The residue was dissolved in ethyl acetate (100 mL), and an aqueous sodium hydroxide solution (1 mol / L, 50 mL) was added and stirred for 5 minutes. The mixture was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to obtain the target product (5.1 g).

[0200] Some embodiments of this application can be prepared according to the route described in the following process.

[0201]

[0202] Step 1: 4-Bromoindolone compound SM-1 reacts with 2,2,2-trifluoroethyltrifluoromethanesulfonate in the presence of an alkali (such as sodium hydride) to yield SM2;

[0203] Step 2: SM-2 reacts with trifluoromethanesulfonic anhydride under the action of alkali to obtain SM-3;

[0204] Step 3: SM-3 reacts with alkyne in the presence of palladium catalyst, copper catalyst and base to obtain SM-4;

[0205] Step 4: SM-4 reacts with an amine in the presence of a palladium catalyst, a base, and a solvent to obtain the target compound.

[0206] Taking intermediate SM-4-1 as an example, the specific synthesis process is as follows:

[0207] SM-4-1: 4-((3-(4-bromo-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0208]

[0209] SM-2-1: 4-Bromo-1-(2,2,2-trifluoroethyl)indol-2-one

[0210]

[0211] 4-Bromoindolone (10.6 g) was dissolved in N,N-dimethylformamide (100 mL). Sodium hydride (2 g) was added in portions to the solution at 0 °C, and the mixture was stirred for 1 hour. Then, 2,2,2-trifluoroethyltrifluoromethanesulfonate (11.6 g) was added, and the mixture was stirred at 0 °C for 2 hours. Saturated ammonium chloride aqueous solution (100 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (200 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (ethyl acetate / petroleum ether = 1:5) to obtain the target product (11.3 g).

[0212] SM-3-1: 4-Bromo-1-(2,2,2-trifluoroethyl)-1H-indole-2-yl-trifluoromethanesulfonate

[0213]

[0214] 10 g of 4-bromo-1-(2,2,2-trifluoroethyl)indol-2-one was dissolved in 100 mL of dichloromethane. Sodium hydride (1.65 g) was added in portions at 0 °C, and the mixture was stirred at 0 °C for 30 minutes. Trifluoromethanesulfonic anhydride (9.6 g) was added dropwise, and the mixture was stirred at room temperature for 2 hours. A saturated ammonium chloride aqueous solution (100 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (100 mL × 3). The extract was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (ethyl acetate / petroleum ether = 1:5) to obtain the target product (13 g).

[0215] SM-4-1: 4-((3-(4-bromo-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0216]

[0217] Under nitrogen protection, 4-bromo-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl-trifluoromethanesulfonate (4.26 g) was dissolved in dimethyl sulfoxide (30 mL), and 3-methoxy-N-methyl-4-(prop-2-yn-1-ylamino)benzamide (2.3 g), cuprous iodide (2.3 g), tetrakis(triphenylphosphine)palladium (2.3 g), and diisopropylamine (10 g) were added. The mixture was stirred at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (4.0 g).

[0218] Example 1

[0219] 4-((3-(4-((cyclohexylmethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0220]

[0221] Under nitrogen protection, SM-4-1 4-((3-(4-bromo-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide (49 mg), cyclohexylmethylamine (23 mg), methanesulfonic acid (2-dicyclohexylphosphino-2′,6′-diisopropoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II) (25 mg), and cesium carbonate (100 mg) were added to dioxane (10 mL), and the mixture was heated to 100 °C and stirred for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane / methanol = 8:1) to give the target product (40 mg), LCMS m / z = 527.35 [M+H]. + .

[0222] 1 H NMR (400MHz, DMSO-d6) δ8.16-8.05 (m, 1H), 7.41 (d, J=8.3Hz, 1H), 7.38-7.32 (m, 1H), 7.04 (s, 1H), 6.98 (t, J= 8.0Hz, 1H), 6.75 (d, J=8.3Hz, 1H), 6.65 (d, J=8.2Hz, 1H), 6.07 (d, J=7.7Hz, 1H), 5.98 (t, J=6.4Hz, 1H), 5.82 ( t, J=5.9Hz, 1H), 4.90 (q, J=9.0Hz, 2H), 4.31 (d, J=6.3Hz, 2H), 3.84 (s, 3H), 2.96 (t, J=6.3Hz, 2H), 2.75 (d, J= 4.4Hz, 3H), 1.79 (d, J=12.7Hz, 2H), 1.64 (m, 4H), 1.16 (d, J=9.1Hz, 2H), 0.92 (d, J=11.5Hz, 2H), 0.84 (m, 1H).

[0223] Example 2

[0224] 3-Methoxy-N-methyl-4-((3-(4-(((1-methylpiperidin-4-yl)methyl)amino)-1-(2,2,2-trifluoromethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)benzamide

[0225]

[0226] Following the synthesis method of Example 1, using (1-methyl-4-piperidin-)methylamine (26 mg) as a starting material, the target product (40 mg) was obtained, with LCMS m / z = 542.41 [M+H]. + .

[0227] 1 H NMR (400MHz, CDCl3+CD3OD) δ7.37 (dd, J=8.4Hz, 2.0Hz, 1H), 7.31 (d, J=2.0Hz, 1H), 7.14-7.17 (m, 2H), 6.85-6.92 (m, 2H), 6.75 (d, J=8.4Hz, 1H), 4.63 (q, J=8.4Hz, 2H), 4.30 (s, 2H), 3.88 (s, 3H), 3.44-3.50 (m, 2H), 3.24 (d, J=6.8Hz , 2H), 2.87-2.96(m, 5H), 2.77(s, 3H), 2.00-2.20(m, 3H), 1.66-1.78(m, 2H).

[0228] Example 3

[0229] 3-Methoxy-N-methyl-4-((3-(4-((2-(1-methylpiperidin-4-yl)ethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)propyl-2-yn-1-yl)amino)benzamide

[0230]

[0231] Following the synthesis method described in Example 1, using 2-(1-methylpiperidin-4-yl)ethane-1-amine as the starting material, the target product (45 mg) was obtained, with LCMS m / z = 556.40 [M+H]. + .

[0232] 1H NMR (400MHz, DMSO-d6) δ9.23-9.46 (brs, 1H), 8.10 (q, J=4.0Hz, 1H), 7.39 (dd, J=8.0Hz, 2.0Hz, 1H), 7.33 (d, J=2.0Hz , 1H), 6.98 (t, J=8.0Hz, 1H), 6.96 (s, 1H), 6.73 (d, J=8.0Hz, 1H), 6.67 (d, J=8.4Hz, 1H), 6.09 (d, J=8.0Hz, 1H), 5.96 ( t, J=6.0Hz, 1H), 5.72 (t, J=5.6Hz, 1H), 4.90 (q, J=8.8Hz, 2H), 4.29 (d, J=6.0Hz, 2H), 3.81 (s, 3H), 3.14 (q, J=5.6Hz, 2H), 2.76-2.90 (m, 2H), 2.73 (d, J=4.0Hz, 3H), 2.68 (s, 3H), 1.81-1.92 (m, 2H), 1.49-1.64 (m, 3H), 1.20-1.40 (m, 4H).

[0233] Example 4

[0234] 3-Methoxy-N-methyl-4-((3-(4-(((1-methylpyrrolidin-3-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)propyn-1-yl)amino)benzamide

[0235]

[0236] Following the synthesis method described in Example 1, using (1-methylpyrrolidine-3-alkyl)methylamine as a starting material, the target product (20 mg) was obtained, with LCMS m / z = 528.38 [M+H]. + .

[0237] 1H NMR (400MHz, DMSO-d6) δ9.87-10.27 (brs, 1H), 8.09 (d, J=4.8Hz, 1H), 7.40 (dd, J=8.0Hz, 2.0H z, 1H), 7.33 (d, J=2.0Hz, 1H), 7.00 (t, J=8.0Hz, 1H), 6.98 (s, 1H), 6.70-6.74 (m, 2H), 6.16 (d, J=8.0Hz, 1H), 5.92-5.98 (m, 2H), 4.90 (q, J=9.2Hz, 2H), 4.29 (d, J=6.4Hz, 2H), 3.81 (s, 3H), 3 .06-3.44(m, 5H), 2.66-2.82(m, 7H), 2.04-2.22(m, 1H), 1.61-1.84(m, 1H), 1.19-1.30(m, 1H).

[0238] Example 5

[0239] N-(2-(3-((2-methoxy-4-(formyl)phenyl)amino)prop-1-yn-1-yl)-1-(2,2,2-trifluoroethyl)-1H-indol-4-yl)-1-methylpyrrole-3-carboxamide

[0240]

[0241] Step 1: 4-((3-(4-bromo-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide (90 mg) was added to dimethyl sulfoxide (5 mL), followed by cuprous oxide (6 mg), N,N′-dimethylethylenediamine (4 mg), and ammonia in methanol (7 mol / L, 2 mL). The mixture was stirred at 100 °C for 12 hours, cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to obtain the target product (40 mg).

[0242] Step 2: Add 4-((3-(4-amino-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide (40 mg) to N,N-dimethylformamide (10 mL), then add 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazol[4,5-b]pyridine-3-oxide hexafluorophosphate (53 mg), N,N-diisopropylethylamine (367 mg) and 1-methylpyrrolidine-3-carboxylic acid (180 mg), and stir at room temperature for 3 hours. Water (20 mL) was added to the reaction solution, and the mixture was extracted with ethyl acetate (50 mL × 3). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to obtain the target product (18 mg). LCMS m / z = 542.41 [M+H] + .

[0243] 1 H NMR (400MHz, CDCl3+CD3OD) δ7.60 (d, J=8.0Hz, 1H), 7.39 (d, J=8.0Hz, 1H), 7.32 (s, 1H ), 7.21 (t, J = 8.0Hz, 1H), 7.12 (d, J = 8.0Hz, 1H), 6.88 (s, 1H), 6.76 (d, J = 8.0Hz, 1H), 4 .67(q, J=8.4Hz, 2H), 4.31(s, 2H), 4.08-4.22(m, 1H), 3.89(s, 3H), 3.42-3.57(m, 2H) ,3.16-3.38(m,2H),2.89(s,3H),2.82(s,3H),2.42-2.52(m,1H),2.22-2.32(m,1H).

[0244] Example 6

[0245] 3-Methoxy-N-methyl-4-((3-(4-(((1-methylpiperidin-3-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)benzamide

[0246]

[0247] Following the synthesis method of Example 1, using (1-methylpiperidin-3-yl)methylamine (30 mg) as a starting material, the target product (18 mg) was obtained, with LCMS m / z = 542.40 [M+H]. + .

[0248] 1H NMR (400MHz, CD3OD) δ7.43 (dd, J=8.0Hz, 2.0Hz, 1H), 7.35 (d, J=2.0Hz, 1H), 7.06 (t, J=8.0 Hz, 1H), 6.85 (s, 1H), 6.82 (d, J=8.4Hz, 1H), 6.67 (d, J=8.4Hz, 1H), 6.24 (d, J=8.0Hz, 1H), 4 .73(q, J=8.8Hz, 2H), 4.34(s, 2H), 3.91(s, 3H), 3.49-3.58(m, 1H), 3.38-3.48(m, 1H), 3.16 -3.38(m, 3H), 2.67-2.98(m, 8H), 2.22-2.36(m, 1H), 1.92-2.05(m, 2H), 1.66-1.86(m, 1H).

[0249] Example 7

[0250] 3-Methoxy-N-methyl-4-((3-(4-(((1-methylazacyclobut-3-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)propyl-2-yn-1-yl)amino)benzamide

[0251]

[0252] Following the synthesis method described in Example 1, using (1-methylazacyclobutane-3-yl)methylamine as a starting material, the target product (35 mg) was obtained, with LCMS m / z = 514.08 [M+H]. + .

[0253] 1 H NMR (400MHz, DMSO-d6) δ9.99-10.38 (brs, 1H), 8.11 (d, J=4.8Hz, 1H), 7.40 (dd, J=8.0Hz, 1 .6Hz, 1H), 7.33 (d, J=1.6Hz, 1H), 7.00 (t, J=8.0Hz, 1H), 6.96 (s, 1H), 6.71-6.74 (m, 2H), 6 .14 ​​(d, J=7.6Hz, 1H), 5.92-6.04 (m, 2H), 4.91 (q, J=9.2Hz, 2H), 4.29 (d, J=6.0Hz, 2H), 3.6 1-4.22 (m, 7H), 3.26-3.42 (m, 2H), 2.97-3.05 (m, 1H), 2.75 (s, 3H), 2.72 (d, J=4.0Hz, 3H).

[0254] Example 8

[0255] (R)-4-((3-(4-(((1-ethylpyrrolo-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0256]

[0257] Following the synthesis method of Example 1, using (R)-2-(aminomethyl)-1-ethylpyrrolidine (26 mg) as the starting material, the target product (34 mg) was obtained, with LCMS m / z = 542.42 [M+H]. + .

[0258] 1 H NMR (400MHz, DMSO-d6) δ8.09 (q, J=4.4Hz, 1H), 7.39 (dd, J=8.0Hz, 1.6Hz, 1H), 7.32 (d, J=1.6Hz, 1H), 7.06- 7.27 (brs, 1H), 7.01 (t, J=8.0Hz, 1H), 6.98 (s, 1H), 6.73 (d, J=8.0Hz, 1H), 6.72 (d, J=8.0Hz, 1H), 6.19 (d, J= 7.6Hz, 1H), 5.98-6.14 (brs, 1H), 5.95 (t, J=6.0Hz, 1H), 4.90 (q, J=9.2Hz, 2H), 4.29 (d, J=6.4Hz, 2H), 3.84 (s, 3H), 3.02-3.58 (m, 5H), 2.60-2.82 (m, 5H), 1.92-2.08 (m, 1H), 1.64-1.88 (m, 3H), 1.11 (t, J=7.2Hz, 3H).

[0259] Example 9

[0260] (R)-3-methoxy-N-methyl-4-((3-(4-(((1-methylpyrrolidin-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)benzamide

[0261]

[0262] Following the synthesis method of Example 1, using (R)-(1-methylpyrrolidone-2-yl)methylamine (20 mg) as the starting material, the target product (12 mg) was obtained, with LCMS m / z = 528.36 [M+H]. + .

[0263] 1H NMR (400MHz, CD3OD) δ7.43 (dd, J=8.0Hz, 2.0Hz, 1H), 7.35 (d, J=2.0Hz, 1H), 7.11 (t, J=8 .0Hz, 1H), 6.89 (s, 1H), 6.82 (d, J=8.4Hz, 1H), 6.77 (d, J=8.4Hz, 1H), 6.35 (d, J=7.6Hz, 1H), 4.75(q, J=8.8Hz, 2H), 4.34(s, 2H), 3.91(s, 3H), 3.60-3.82(m, 4H), 3.11-3.21(m, 1H), 2.92(s, 3H), 2.89(s, 3H), 2.31-2.40(m, 1H), 1.99-2.18(m, 2H), 1.87-1.96(m, 1H).

[0264] Example 10

[0265] (S)-3-methoxy-N-methyl-4-((3-(4-(((1-methylpyrrolo-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)benzamide

[0266]

[0267] Following the synthesis method of Example 1, using (S)-(1-methylpyrrolidone-2-yl)methylamine (35 mg) as the starting material, the target product (35 mg) was obtained, with LCMS m / z = 528.39 [M+H]. + .

[0268] 1 H NMR (400MHz, CDCl3+CD3OD) δ7.37 (dd, J=8.4Hz, 2.0Hz, 1H), 7.31 (d, J=2.0Hz, 1H), 7.09 ( d, J=8.0Hz, 1H), 6.96 (s, 1H), 6.75 (d, J=8.4Hz, 1H), 6.67 (d, J=8.4Hz, 1H), 6.22 (d, J=8.0 Hz, 1H), 4.58 (q, J=8.8Hz, 2H), 4.28 (s, 2H), 3.87 (s, 3H), 3.61-3.74 (m, 4H), 2.92-2.99 (m , 1H), 2.89 (s, 3H), 2.78 (s, 3H), 2.24-2.33 (m, 1H), 2.05-2.12 (m, 2H), 1.83-1.92 (m, 1H).

[0269] Example 11

[0270] (S)-3-methoxy-N-methyl-4-((3-(4-(((1-ethylpyrrolidin-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)benzamide

[0271]

[0272] Following the synthesis method of Example 1, using (S)-(1-ethylpyrrolidone-2-yl)methylamine (35 mg) as the starting material, the target product (20 mg) was obtained, with LCMS m / z = 542.40 [M+H]. + .

[0273] 1 H NMR (400MHz, CDCl3+CD3OD) δ7.39 (dd, J=8.4Hz, 2.0Hz, 1H), 7.32 (d, J=2.0Hz, 1H), 7.07-7.14 (m , 1H), 6.95 (s, 1H), 6.78 (d, J=8.4Hz, 1H), 6.68 (d, J=8.4Hz, 1H), 6.23 (d, J=7.6Hz, 1H), 4.60 (q, J=8.8Hz, 2H), 4.30 (s, 2H), 3.89 (s, 3H), 3.59-3.84 (m, 4H), 3.21-3.30 (m, 1H), 2.91-3.05 (m, 2H ), 2.89 (s, 3H), 2.22-2.31 (m, 1H), 2.05-2.13 (m, 2H), 1.85-1.93 (m, 1H), 1.23 (t, J=7.2Hz, 3H).

[0274] Example 12

[0275] (S)-4-((3-(4-((1-cyclopropyl-2-hydroxyethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0276]

[0277] Step 1: (S)-2-((tert-butyldimethylsilyl)oxy)-1-cyclopropylethyl-1-amine

[0278]

[0279] (S)-2-amino-2-cyclopropylethanol hydrochloride (150 mg) was dissolved in dichloromethane (10 mL), and triethylamine (0.45 mL), 4-dimethylaminopyridine (26 mg), and tert-butyldimethylchlorosilane (197 mg) were added. The mixture was stirred at room temperature for 16 hours. The reaction was quenched with water (15 mL), and the mixture was extracted with ethyl acetate (10 mL * 3). The extract was washed with saturated brine (10 mL * 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 1:1) to give the target product (160 mg).

[0280] Step 2: (S)-4-((3-(4-((2-((tert-butyldimethylsilyl)oxy)-1-cyclopropylethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0281]

[0282] Following the synthesis method of Example 1, (S)-2-((tert-butyldimethylsilyl)oxy)-1-cyclopropylethyl-1-amine (38 mg) was used as the starting material to obtain the target product (35 mg).

[0283] Step 3: (S)-4-((3-(4-((1-cyclopropyl-2-hydroxyethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0284]

[0285] (S)-4-((3-(4-((2-((tert-butyldimethylsilyl)oxy)-1-cyclopropylethyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide (35 mg) was dissolved in tetrahydrofuran (5 mL), and tetrabutylammonium fluoride trihydrate (35 mg) was added. The mixture was stirred at room temperature for 1 hour. The reaction was quenched with water (15 mL), and the mixture was extracted with ethyl acetate (10 mL * 3). The extract was washed with saturated brine (10 mL * 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to give the target product (20 mg). LCMS m / z = 515.38 [M+H] + .

[0286] 1H NMR (400MHz, CDCl3+CD3OD) δ7.38 (d, J=8.4Hz, 2.0Hz, 1H), 7.31 (d, J=2.0Hz, 1H), 7.05 (t, J=8.0H z, 1H), 6.81 (s, 1H), 6.75 (d, J=8.4Hz, 1H), 6.64 (d, J=8.4Hz, 1H), 6.32 (d, J=8.0Hz, 1H), 4.59 (q, J=8.8Hz, 2H), 4.29 (s, 2H), 3.88 (s, 3H), 3.76 (dd, J=11.2Hz, 4.4Hz, 1H), 3.66 (dd, J=11.2Hz, 5.2 Hz, 1H), 3.00-3.04 (m, 1H), 2.89 (s, 3H), 0.97-1.06 (m, 1H), 0.42-0.53 (m, 2H), 0.24-0.32 (m, 2H).

[0287] Example 13

[0288] (4-((3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)imidazol[1,2-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-3-methoxyphenyl)(methyl)(methylimino)-λ 6 -sulfone

[0289]

[0290] Step 1: Under nitrogen protection, 8-bromo-2-iodo-3-((trifluoromethyl)thio)imidazolium[1,2-a]pyridine (422 mg) was dissolved in dimethyl sulfoxide (10 mL), and (3-methoxy-4-(prop-2-yn-1-ylamino)phenyl)(methyl)(methylimino)-λ was added. 6 Sulfone (252 mg), cuprous iodide (190 mg), tetra(triphenylphosphine)palladium (230 mg), and diisopropylamine (1 g) were stirred at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (difluoromethane / methanol = 20:1) to give the target product (400 mg).

[0291] Step 2: Under nitrogen protection, the product obtained in Step 1 (54.7 mg), (3S,4R)-3-fluoro-1-methylpiperidine-4-amine dihydrochloride (41 mg), methanesulfonic acid (2-dicyclohexylphosphino-2′,6′-diisopropoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II) (25 mg), and cesium carbonate (100 mg) were added to dioxane (10 mL), and the mixture was heated to 100 °C and stirred for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane / methanol = 10:1) to obtain the target product (24 mg), LCMS m / z = 599.42 [M+H]. + .

[0292] Example 14

[0293] (4-((3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)imidazol[1,2-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-3-methoxyphenyl)imino)dimethyl-λ 6 -sulfone

[0294]

[0295] Step 1: Under nitrogen protection, 8-bromo-2-iodo-3-((trifluoromethyl)thio)imidazolium[1,2-a]pyridine (422 mg) was dissolved in dimethyl sulfoxide (10 mL), and ((3-methoxy-4-(prop-2-yn-1-ylamino)phenyl)imino)dimethyl-λ 6 Sulfone (252 mg), cuprous iodide (190 mg), tetra(triphenylphosphine)palladium (230 mg), and diisopropylamine (1 g) were stirred at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (378 mg).

[0296] Step 2: Under nitrogen protection, the product obtained in Step 1 (54.7 mg), (3S,4R)-3-fluoro-1-methylpiperidine-4-amine dihydrochloride (41 mg), methanesulfonic acid (2-dicyclohexylphosphino-2′,6′-diisopropoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II) (25 mg), and cesium carbonate (100 mg) were added to dioxane (10 mL), and the mixture was heated to 100 °C and stirred for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane / methanol = 10:1) to obtain the target product (22 mg), LCMS m / z = 599.41 [M+H]. + .

[0297] Example 15

[0298] (4-((3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)imidazol[1,2-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-3-methoxyphenyl)(imino)(methyl)-λ 6 -sulfone

[0299]

[0300] Step 1: Under nitrogen protection, 8-bromo-2-iodo-3-((trifluoromethyl)thio)imidazolium[1,2-a]pyridine (422 mg) was dissolved in dimethyl sulfoxide (10 mL), and imino(3-methoxy-4-(prop-2-yn-1-ylimino)phenyl)(methyl)-λ was added. 6 Sulfone (238 mg), cuprous iodide (190 mg), tetraphenylphosphine palladium (230 mg), and diisopropylamine (1 g) were stirred at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (317 mg).

[0301] Step 2: Under nitrogen protection, the product obtained in Step 1 (53 mg), (3S,4R)-3-fluoro-1-methylpiperidine-4-amine dihydrochloride (41 mg), methanesulfonic acid (2-dicyclohexylphosphino-2′,6′-diisopropoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II) (25 mg), and cesium carbonate (100 mg) were added to dioxane (10 mL), and the mixture was heated to 100 °C and stirred for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane / methanol = 10:1) to obtain the target product (17 mg), LCMS m / z = 585.42 [M+H]. + .

[0302] Example 16

[0303] (4-((3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)imidazol[1,2-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-3-methoxyphenyl)(imino)(methyl)-λ 6 -sulfone

[0304]

[0305] Step 1: 7-Chloro-2-iodo-3-((trifluoromethyl)thio)pyrazole[1,5-a]pyridine (378 mg), (3S,4R)-3-fluoro-1-methylpiperidin-4-amine dihydrochloride (410 mg), and N,N-diisopropylethylamine (774 mg) were added to N,N-dimethylformamide (20 mL), and the mixture was heated to 130 °C and stirred for 24 hours. After cooling to room temperature, water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (200 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to obtain the target product (124 mg).

[0306] Step 2: Under nitrogen protection, the product obtained in Step 1 (47 mg) and ((3-methoxy-4-(prop-2-yn-1-ylamino)phenyl)imino)dimethyl-λ 625 mg of sulfone was dissolved in 10 mL of dimethyl sulfoxide, and cuprous iodide (19 mg), tetraphenylphosphine palladium (23 mg), and diisopropylamine (100 mg) were added. The mixture was stirred at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 10:1) to give the target product (21 mg). LCMS m / z = 599.41 [M + H] + .

[0307] Example 26

[0308] (S)-3-methoxy-N-methyl-4-((3-(8-((((1-methylpyrrolidin-2-yl)methyl)amino)-5-(2,2,2-trifluoroethyl)-5H-[1,3]dioxane[4,5-f]indol-6-yl)prop-2-yn-1-yl)amino)benzamide

[0309]

[0310] Step 1: 4-Bromo-6-nitropiperaldehyde

[0311]

[0312] 6-Nitropiperaldehyde (4.878 g) was dissolved in concentrated sulfuric acid (50 mL), and N-bromosuccinimide (8.899 g) was added in portions at 0 °C. The mixture was stirred at room temperature for 3 hours. The reaction solution was poured into ice water (500 mL), extracted with ethyl acetate (300 mL × 3), and the extract was washed with saturated brine (200 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / petroleum ether = 9:1) to give the target product (5.121 g).

[0313] Step 2: 1-(4-bromo-6-nitrobenzo[d][1,3]dioxane-5-yl)-2-nitroethane-1-ol

[0314]

[0315] 4-Bromo-6-nitropiperanal (3.97 g) was dissolved in nitromethane (30 mL), and neutral alumina (30 g) was added. The mixture was stirred at room temperature for 9 hours. The solution was filtered through diatomaceous earth and washed with ethyl acetate (100 mL × 3). The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / ethyl acetate = 50:1) to give the target product (2.153 g).

[0316] Step 3: (E)-4-bromo-6-nitro-5-(2-nitrovinyl)benzo[d][1,3]dioxin

[0317]

[0318] 4-Bromo-6-nitropiperanal (2.143 g) was dissolved in dichloromethane (50 mL), and 4-dimethylaminopyridine (78 mg) and acetic anhydride (784 mg) were added. The mixture was stirred at room temperature for 16 hours. The reaction was quenched with water (200 mL), and the mixture was extracted with ethyl acetate (200 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane) to give the target product (1.406 g).

[0319] Step 4: 8-Bromo-5H-[1,3]dioxane[4,5-f]indole

[0320]

[0321] Under nitrogen protection, (E)-4-bromo-6-nitro-5-(2-nitrovinyl)benzo[d][1,3]dioxin (1.268 g) was dissolved in toluene (30 mL), and iron powder (2.912 g), cyclohexane (10 mL), acetic acid (20 mL), and silica gel (3 g) were added. The mixture was heated to 100 °C and reacted for 1 hour. After cooling to room temperature, the mixture was filtered through diatomaceous earth, washed with dichloromethane (100 mL × 3), and the filtrate was washed with saturated brine (100 mL × 3). The filtrate was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 3:1) to give the target product (528 mg).

[0322] Step 5: 8-Bromo-5-(benzenesulfonyl)-5H-[1,3]dioxane[4,5-f]indole

[0323]

[0324] At 0°C, 528 mg of 8-bromo-5H-[1,3]dioxane[4,5-f]indole was dissolved in 25 mL of tetrahydrofuran, and sodium hydride (264 mg) was added in portions. The reaction was allowed to proceed for 1 hour. 583 mg of benzenesulfonyl chloride was added at 0°C, and the reaction was allowed to proceed for 1 hour at room temperature. The reaction was quenched with 50 mL of saturated ammonium chloride solution, and the mixture was extracted with 3 ethyl acetate solutions (50 mL each). The extract was washed with 3 saturated brine solutions, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 4:1) to give the target product (769 mg).

[0325] Step 6: 8-Bromo-6-iodo-5-(benzenesulfonyl)-5H-[1,3]dioxane[4,5-f]indole

[0326]

[0327] Under nitrogen protection, 760 mg of 8-bromo-5-(benzenesulfonyl)-5H-[1,3]dioxane[4,5-f]indole was dissolved in tetrahydrofuran (20 mL). A solution of diisopropylaminolithium tetrahydrofuran (2 mol / L, 3 mL) was added at -78 °C, and the reaction was carried out at -78 °C for 1 hour. A solution of 1.54 g of iodine in tetrahydrofuran (20 mL) was added, and the reaction was carried out at -78 °C for 1 hour. The reaction was quenched with saturated ammonium chloride aqueous solution (20 mL), extracted with ethyl acetate (80 mL × 3), washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain the target product (754 mg).

[0328] Step 7: 8-Bromo-6-iodo-5H-[1,3]dioxane[4,5-f]indole

[0329]

[0330] A mixture of 750 mg 8-bromo-6-iodo-5-(benzenesulfonyl)-5H-[1,3]dioxane[4,5-f]indole, 952 mg potassium tert-butoxide, and 30 mL acetonitrile was stirred at room temperature for 2 hours. Water (30 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (50 mL × 3). The extract was washed with saturated brine (30 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 4:1) to obtain the target product (530 mg).

[0331] Step 8: 8-Bromo-6-iodo-5-(2,2,2-trifluoroethyl)-5H-[1,3]-dioxane[4,5-f]indole

[0332]

[0333] 530 mg of 8-bromo-6-iodo-5H-[1,3]-dioxane[4,5-f]indole was dissolved in 20 mL of tetrahydrofuran, and 180 mg of sodium hydride was added. The reaction was carried out at room temperature for 30 minutes. 1.05 g of 2,2,2-trifluoroethyltrifluoromethanesulfonate was added, and the reaction was carried out at room temperature for 12 hours. The reaction was quenched with 30 mL of saturated ammonium chloride solution, extracted with 30 mL of ethyl acetate, washed with 30 mL of saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 5:1) to give the target product (550 mg).

[0334] Step 9: 4-((3-(8-bromo-5-(2,2,2-trifluoroethyl)-5H-[1,3]dioxane[4,5-f]indol-6-yl)prop-2-yn-1-yl)amino)3-methoxy-N-methylbenzamide

[0335]

[0336] Under nitrogen protection, 8-bromo-6-iodo-5-(2,2,2-trifluoroethyl)-5H-[1,3]-dioxane[4,5-f]indole (50 mg) was dissolved in dimethyl sulfoxide (5 mL), and 3-methoxy-N-methyl-4-(prop-2-yn-1-ylamino)benzamide (50 mg), cuprous iodide (50 mg), tetrakis(triphenylphosphine)palladium (50 mg), and diisopropylamine (200 mg) were added. The reaction was carried out at room temperature for 2 hours. The reaction was quenched with water (30 mL), extracted with ethyl acetate (50 mL × 3), washed with saturated brine (30 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to obtain the target product (40 mg).

[0337] Step 10: (S)-3-methoxy-N-methyl-4-((3-(8-(((1-methylpyrrolidin-2-yl)methyl)amino)-5-(2,2,2-trifluoroethyl)-5H-[1,3]dioxane[4,5-f]indol-6-yl)prop-2-yn-1-yl)amino)benzamide

[0338]

[0339] Under nitrogen protection, 4-((3-(8-bromo-5-(2,2,2-trifluoroethyl)-5H-[1,3]dioxane[4,5-f]indol-6-yl)prop-2-yn-1-yl)amino)3-methoxy-N-methylbenzamide (40 mg), (S)-(1-methylpyrrolidone-2-yl)methylamine (20 mg), methanesulfonic acid (2-dicyclohexylphosphino-2′,6′-diisopropoxy-1,1′-biphenyl)(2-amino-1,1′-biphenyl-2-yl)palladium(II) (17 mg) and cesium carbonate (73 mg) were added to dioxane (10 mL), and the mixture was heated to 100 °C and reacted for 12 hours. Cool to room temperature, filter with diatomaceous earth, wash the filter cake with ethyl acetate (50 mL × 3), wash the filtrate with saturated brine (50 mL × 3), dry with anhydrous sodium sulfate, concentrate under reduced pressure, and purify the residue by column chromatography (dichloromethane / methanol = 8:1) to obtain the target product (7 mg).

[0340] Example 32

[0341] 4-((3-(4-((((2R,4R)-4-fluoro-1-methylpyrrolidone-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0342] Step 1: (2S,4R)-4-fluoro-1-methylpyrrolidine-2-carboxylic acid

[0343]

[0344] At room temperature, a mixture of (2S,4R)-4-fluoropyrrolidine-2-carboxylic acid (1.33 g), palladium on carbon (133 mg), 30% formaldehyde aqueous solution (3 mL), concentrated hydrochloric acid (0.5 mL), and methanol (15 mL) was reacted overnight under a hydrogen atmosphere. The mixture was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure to obtain the target product (1.3 g).

[0345] Step 2: (2R,4R)-4-fluoro-N-methoxy-N,1-dimethylpyrrolidine-2-amide

[0346]

[0347] The product obtained in step 1 (1.3 g), N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)hexafluorophosphate urea (5.05 g), N,N-diisopropylethylamine (3.5 g), dimethylhydroxylamine hydrochloride (1.03 g), and tetrahydrofuran (50 mL) were reacted at room temperature for 5 hours, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to obtain the target product (1.5 g).

[0348] Step 3: (2R,4R)-4-fluoro-1-methylpyrrolidine-2-carboxaldehyde

[0349]

[0350] Under argon protection, (2R,4R)-4-fluoro-N-methoxy-N,1-dimethylpyrrolidine-2-amide (1.5 g) was added to anhydrous tetrahydrofuran (30 mL), and diisobutylaluminum hydride toluene solution (1 mol / L, 24 mL) was slowly added at 0 °C, followed by reaction at 0 °C for 3 hours. Sodium hydroxide (960 mg) and water (0.5 mL) were added to the reaction solution, and the mixture was stirred vigorously overnight at room temperature. The reaction solution was dried and filtered through a double filter layer of anhydrous sodium sulfate and diatomaceous earth, and the filtrate was concentrated under reduced pressure to obtain the crude target product.

[0351] Step 4: N-(((2R,4R)-4-fluoro-1-methylpyrrolidone-2-yl)methyl)-2-iodo-1-(2,2,2-trifluoroethyl)-1H-indole-4-amine

[0352]

[0353] Under argon protection, crude (2R,4R)-4-fluoro-1-methylpyrrolidine-2-carboxaldehyde obtained in step 3 and 2-iodo-1-(2,2,2-trifluoroethyl)-1H-indole-4-amine (850 mg) were added to anhydrous N,N-dimethylformamide (15 mL). Trimethylchlorosilane (2.16 g) was slowly added at 0 °C, and the reaction was carried out at 0 °C for 5 minutes. Boranetetrahydrofuran complex (1 mol / L, 24 mL) was slowly added, and the reaction was carried out at 0 °C for 1 hour. The reaction was quenched by adding water (50 mL), extracted with ethyl acetate (80 mL × 3), washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 15:1) to obtain the target product (110 mg).

[0354] Step 5: 4-((3-(4-((((2R,4R)-4-fluoro-1-methylpyrrolidone-2-yl)methyl)amino)-1-(2,2,2-trifluoroethyl)-1H-indol-2-yl)prop-2-yn-1-yl)amino)-3-methoxy-N-methylbenzamide

[0355]

[0356] Under nitrogen protection, N-(((2R,4R)-4-fluoro-1-methylpyrrolidone-2-yl)methyl)-2-iodo-1-(2,2,2-trifluoroethyl)-1H-indole-4-amine (110 mg) was dissolved in dimethyl sulfoxide (5 mL), and 3-methoxy-N-methyl-4-(prop-2-yn-1-ylamino)benzamide (55 mg), cuprous iodide (57 mg), tetrakis(triphenylphosphine)palladium (58 mg), and diisopropylamine (252 mg) were added. The reaction was carried out at room temperature for 2 hours. The reaction was quenched with water (30 mL), extracted with ethyl acetate (50 mL × 3), washed with saturated brine (30 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 10:1) to give the target product (20 mg).

[0357] The following compounds were synthesized according to the above examples:

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377] Biological testing

[0378] 1. In vitro DNA binding assay of the compound:

[0379] We established an in vitro DNA binding assay for the compound using homogeneous time-resolved fluorescence (HTRF) to determine its activation activity for p53 Y220C DNA binding. The assay system included the compound, His-p53 Y220C, Anti-His-Tb, biotinylated p53 homogeneous DNA, and SA-d2. His-p53 Y220C (94aa-294aa) protein was expressed in *E. coli* DH5α and purified using affinity chromatography with an AKTA Purifier (GE). Anti-His-Tb was purchased from CisBio, catalog number 61HI2TLB. The biotinylated p53 homogeneous DNA was synthesized by Sangon Biotech, with the sequence F: 5'(biotin)ATTAGGCATGTCTAGGCATGTCTAGG, R: CCTAGACATGCCTAGACATGCCTAAT. SA-d2 was purchased from CisBio, catalog number 610SADLF. Specific experimental procedure: The compound was serially diluted 5-fold with 100% DMSO, starting from 2 mM, to obtain 8 concentrations. 4 μL of each concentration was added to 96 μL of reaction buffer (20 mM Hepes (pH 7.5), 75 mM KCl, 1 mM MgCl2, 0.1% BSA, 1 mM DTT) and mixed thoroughly to prepare 8× compounds for later use (final concentrations: 10000, 2000, 400, 80, 16, 3.2, 0.64, 0 nM). 8× His-p53 Y220C (final concentration 10 nM) and 4× Anti-His-Tb (final concentration 1×) were prepared using reaction buffer. Add 2.5 μL of the 8× compound to a 384-well microplate (OptiPlate-384 white plate, PerkinElmer, catalog number 6007290), add 2.5 μL of 8×His-p53Y220C to the 384-well microplate, then add 5 μL of 4×Anti-His-Tb, centrifuge, incubate at 23°C in the dark for 15 minutes, then transfer to 27°C and incubate in the dark for 60 minutes. Add 5 μL of 4×p53 homogeneous DNA (final concentration 50 nM) and 5 μL of 4×SA-d2 (final concentration 1×), centrifuge, and incubate at 23°C for 60 minutes. Read the fluorescence values ​​on an Envision (purchased from PerkinElmer, catalog number 2103-0010) (excitation at 320 nm, detection of emission light at 665 nm and 620 nm, the ratio of the two values ​​represents enzyme activity). The activity of each compound was measured at eight concentrations. Data were processed using GraphPad Prism software to calculate the half-activation concentration (EC50) of each compound for binding to p53 Y220C protein and DNA. 50Value. Testing showed that the compound had a certain activating effect on the DNA binding ability of p53 Y220C.

[0380] 2. Assay for the cell proliferation inhibitory activity of the compound:

[0381] A method for detecting the proliferation-inhibiting activity of compounds in HUH-7 (p53 Y220C / -) cells was established using Promega's CellTiter-Glo assay kit.

[0382] Human hepatocellular carcinoma cells HUH-7 were purchased from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. They were cultured in DMEM (Vivacell) medium supplemented with 10% fetal bovine serum (Biological Industries) and 1% penicillin-streptomycin (Gibco) at 37°C, with 95% air and 5% CO2. The cells were cultured in 25cm² or 75cm² plastic tissue culture flasks (Corning) and passaged 2-3 times per week.

[0383] Cells were seeded at 500 cells / well in 96-well Corning cell culture plates (195 μL / well) and cultured at 37°C under 95% aerosol and 5% CO2 conditions. After 24 hours, the test compound was added: the compound was serially diluted 3-fold with DMSO, starting at 100 mM (dissolved in DMSO), to obtain 10 concentrations. 2 μL of each concentration was added to 48 μL of serum-free medium, vortexed, and finally 5 μL of the diluted compound was added to the cell-seeded culture plate. The final concentration of DMSO in the cell culture medium was 0.1%, and the final concentration of the test compound ranged from 0 nM to 100 μM. The cells were cultured at 37°C for 6 days. After 6 days, cell viability was measured using the CellTiter-Glo (Promega) kit. The IC50 value (half-maximal inhibitory concentration) of the compound against cell proliferation was obtained by processing the data using GraphPadPrism software. The results showed that the compound exhibited certain inhibitory activity against cell proliferation.

[0384] 3. Animal pharmacokinetic studies of the examples:

[0385] The study used three healthy adult male rats obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0386] The experimental administration method was a single oral gavage administration to SD rats at a dose of 5 mg / kg, a volume of 5 mL / kg, and a concentration of 1 mg / mL.

[0387] The test sample of P53 was suspended in a 2% hydroxypropyl methylcellulose and 0.5% Tween 80 (W / V / V) aqueous solution, with a suspension concentration of 1 mg / mL.

[0388] Animals administered the drug via gavage were fasted overnight before the experiment, from 10 hours before administration to 4 hours after administration. Blood samples were collected sequentially at 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours after administration. Animals were lightly anesthetized with isoflurane, and approximately 0.3 mL of whole blood was collected from the orbital venous plexus using a glass blood collection tube. The blood was placed in a heparin sodium anticoagulant tube, centrifuged at 4200 rpm for 5 min at 4°C, and the plasma was transferred to a centrifuge tube and stored at -80°C until analysis.

[0389] Plasma sample analysis used acetonitrile protein precipitation to extract the analyte and internal standard (warfarin or propranolol) from rat plasma. The extracts were analyzed by LC / MS / MS. Individual animal plasma concentration-time data were analyzed using a non-compartmental model in WinNonlin (version 5.2.1; Phasight) software to obtain the following pharmacokinetic parameters (e.g., SY-12652 data): maximum (peak) plasma drug concentration Cmax; time to peak concentration Tmax; half-life T1 / 2; and area under the plasma concentration-time curve extrapolated to infinity AUC0-inf.

Claims

1. A compound of Formula (I) or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, Formula (I) wherein, wherein, B ring and C ring are aromatic rings; D ring is a benzene ring, a naphthalene ring, a 5-12 membered heteroaromatic ring, or a bicyclic ring fused by a 5-6 membered aromatic ring and a 5-7 membered non-aromatic ring; X3are each independently N or CR5, R5is each independently halogen, -CN, -NH2, -OH, C 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl), which alkyl groups can be optionally substituted with halogen, -CN, -NH2, or -OH; R2is 3-8 membered cycloalkyl or 3-8 membered heterocyclyl, which S atom can be optionally oxidized to or and said cycloalkyl and heterocyclyl can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, -N(C 1-6 alkyl)(C 1-6 alkyl), -(CO)-NR7R8, -(CO)-OR7, or R 12 substituted, R 12 is 3-8 membered cycloalkyl, 3-8 membered heterocyclyl, 6-10 membered aryl, or 5-12 membered heteroaryl, which heterocyclyl, when containing S, can optionally have the S atom oxidized to and said cycloalkyl, heterocyclyl, aryl and heteroaryl can optionally be substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, halogenated C 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl); R6is each independently halogen, -CN, -NH2, -OH, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, -N(C 1-6 alkyl)(C 1-6 alkyl), 3-8 membered cycloalkyl, 3-8 membered heterocyclyl, -O-(3-8 membered cycloalkyl), -O-(3-8 membered heterocyclyl), 6-10 membered aryl, 5-12 membered heteroaryl, -CHO, -(CO)-NR7R8, or -(CO)-OR7, said heterocyclyl when containing S atom can be optionally oxidized, and said alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl and heteroaryl can be optionally substituted with halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl); R1is -(CO)-NR7R8, -(CO)-(CO)-NR7R8, -NR8-(CO)-(CO)-NR7R8, -(CO)-OR7, -(CO)-R9, -O-(CO)-NR7R8, -O-(CO)-OR7, -O-(CO)-R9, -NR8-(CO)-NR7R8, -NR8-(CO)-OR7, -NR8-(CO)-R9, -(SO2)-R9, -(SO2)-NR7R8, -NR8-(SO2)-R9, -NR8-(SO2)-NR7R8, or -P(O)R 10 R 11 ; L is a bond, X1is N, X2is C-S-R 20 one of X4and X5is N and the other is C, R1is or or L is -(CO)- or -(CR3R4) p - and X1is CH, X2is N-CH2-R 20 X4is C, X5is C, or X1is N, X2is C-S-R 20 one of X4and X5is N and the other is C; R 20 each independently C 1-6 alkyl, haloC 1-6 alkyl, C 3-6 cycloalkyl, or haloC 3-6 cycloalkyl; R3and R4are each independently H or C 1-6 alkyl, which alkyl can be optionally substituted with halogen, -OH, -NH2, -CN, -NR7R8, or -OR7; R8is each independently H or C 1-6 alkyl, R7is each independently H, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, 3-8 membered cycloalkyl, 3-8 membered heterocyclyl, 6-10 membered aryl, or 5-12 membered heteroaryl, which heterocyclyl when containing S, the S atom can be optionally oxidized, and which alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl can be optionally substituted with halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl) substituted, or R7and R8in -NR7R8may be joined together to form a 3-8 membered heterocyclic ring, which when containing S, the S atom can be optionally oxidized, and which can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl) substituted; each R9is independently C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, 3-8 membered cycloalkyl, 3-8 membered heterocyclyl, 6-10 membered aryl, or 5-12 membered heteroaryl, which heterocyclyl when containing S atoms can be optionally oxidized, and which alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl can be optionally substituted with halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl) substituted, or two R9in -NR9R9may be joined together to form a 3-8 membered heterocycle, said heterocycle when containing S, the S atom can be optionally oxidized, and said heterocycle can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl) substituted; R 10 and R 11 each independently is C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, 3-8 membered cycloalkyl, 3-8 membered heterocyclyl, 6-10 membered aryl, or 5-12 membered heteroaryl, which heterocyclyl when containing S atoms can be optionally oxidized, and which alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl can be optionally substituted with halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl), or R 10 R 11 may be linked together to form a 3-8 membered heterocyclic ring, which when containing S, the S atom can be optionally oxidized, and which heterocyclic ring can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, halogenated C 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl); n is 0, 1, or 2; p is 1, 2, or 3.

2. The compound of claim 1 or a pharmaceutically acceptable salt, solvate, deuteride, polymorph, or isomer thereof, wherein R2 is 3-8 membered cycloalkyl or 3-8 membered heterocyclyl, which S atom, when present, is optionally oxidized to or and the cycloalkyl and heterocyclyl groups are optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, haloC 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, -N(C 1-6 alkyl)(C 1-6 alkyl), or R 12 ​ R 12 is 3-8 membered cycloalkyl or 3-8 membered heterocyclyl, which, when containing S, the S atom can be optionally oxidized to and the cycloalkyl and heterocyclyl groups can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, halogenated C 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl).

3. The compound of claim 1 or a pharmaceutically acceptable salt, solvate, deuteride, polymorph, or isomer thereof, wherein, D ring is a benzene ring or a pyridine ring.

4. The compound of claim 1 or a pharmaceutically acceptable salt, solvate, deuteride, polymorph, or isomer thereof, wherein, for or R1 and R6 are as defined in claim 1.

5. The compound of claim 1 or a pharmaceutically acceptable salt, solvate, deuteride, polymorph, or isomer thereof, wherein X3is CH, R 20 is CF3.

6. The compound of claim 1, or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, wherein R2 is 3-8 membered cycloalkyl or 3-8 membered heterocyclyl, which when containing S, the S atom can be optionally oxidized to or and the cycloalkyl and heterocyclyl can be optionally substituted with (=0), halogen, -CN, -NH2, -OH, C 1-6 alkyl, halogenated C 1-6 alkyl, -0-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl).

7. The compound of claim 1, or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, wherein each R6is independently halogen, -CN, -NH2, -OH, C 1-6 alkyl, -O-C 1-6 alkyl, -NH-C 1-6 alkyl, or -N(C 1-6 alkyl)(C 1-6 alkyl), which alkyl groups can be optionally substituted with halogen.

8. The compound of claim 1, or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, wherein each R6is independently -O-C 1-6 alkyl, which alkyl can be optionally substituted with halogen.

9. The following compounds or a pharmaceutically acceptable salt, solvate, deuteride, polymorph, or isomer thereof.

10. A pharmaceutical composition comprising a compound according to any one of claims 1-9 or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, and a pharmaceutically acceptable carrier.

11. Use of a compound according to any one of claims 1-9 or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, or a pharmaceutical composition according to claim 10 in the manufacture of a medicament for treating a disease associated with p53 mutant.

12. The use according to claim 11, wherein the disease associated with p53 mutant is non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, follicular lymphoma, mucosa-associated lymphoid tissue lymphoma, marginal zone lymphoma, T-cell lymphoma, Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, chronic lymphocytic leukemia, small lymphocytic lymphoma, Waldenstrom macroglobulinemia, lymphocytic T-cell leukemia, chronic myelogenous leukemia, hairy cell leukemia, acute lymphoblastic T-cell leukemia, plasmacytoma, immunoblastic large cell leukemia, megakaryocytic leukemia, acute megakaryocytic leukemia, promyelocytic leukemia, erytholeukemia, brain neuroglioma, glioblastoma, breast cancer, colorectal cancer / colon cancer, prostate cancer, lung cancer, gastric cancer, endometrial cancer, melanoma, pancreatic cancer, liver cancer, kidney cancer, squamous cell carcinoma, ovarian cancer, sarcoma, osteosarcoma, thyroid cancer, bladder cancer, head and neck cancer, testicular cancer, Ewing sarcoma, rhabdomyosarcoma, medulloblastoma, neuroblastoma, cervical cancer, renal cancer, urothelial carcinoma, vulvar cancer, esophageal cancer, salivary gland cancer, nasopharyngeal cancer, buccal cancer, oral cancer, or gastrointestinal stromal tumor.

Images