Exosome miRNAs biomarker for evaluating radiation exposure dose of human body and application of exosome miRNAs biomarker

Abstract

The invention discloses an exosome miRNAs biomarker for evaluating the radiation exposure dose of a human body and application of the exosome miRNAs biomarker, the radiation exposure dose is calculated according to the dose effect relationship between the expression quantity of the exosome miRNAs and the radiation exposure dose, and the exosome miRNAs comprise miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p and let-7i-5p. The method has the advantages of being convenient and minimally invasive in sampling, easy and convenient to operate and high in flux, the problems that in the prior art, the process is tedious, and consumed time is long can be solved, and the requirement for dose evaluation on large-scale crowds in nuclear and radiation emergencies is met.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to exosomal miRNA biomarkers for assessing human radiation exposure doses and their applications. Background Technology

[0002] With the widespread application of nuclear energy and technology in national defense, medical diagnosis, and treatment, the probability of nuclear or radiation accidents increases significantly. In the event of a sudden accident involving large-scale public exposure, accurate assessment of radiation dose is crucial for guiding medical treatment and prognosis of radiation injuries. Because physical dosimeters cannot provide timely and effective records of radiation exposure in accident situations, subsequent medical diagnosis and treatment are directly affected. Therefore, establishing rapid, simple, sensitive, and high-throughput biological dosimeters is of significant scientific importance.

[0003] A biodosimeter is a biological system used to estimate radiation dose. The response of this biological system to irradiation has a quantitative relationship with the irradiated dose, which is then used to infer the actual absorbed dose of the irradiated individual. Biodosimeters can be cross-validated and complementary to physical doses. Currently, the most commonly used and effective method for estimating radiation biodosimeters is the analysis of chromosomal aberrations in human peripheral blood lymphocytes, which has played a crucial role in major nuclear radiation accidents both domestically and internationally. However, this method has drawbacks such as being time-consuming and requiring highly skilled analysts, making it unsuitable for dose estimation of large populations in accident situations. In addition, micronucleus analysis is also a commonly used method for dose estimation of irradiated individuals in accidents. Although this method can be automated, its limited application is hindered by numerous influencing factors and a high background level.

[0004] The aforementioned technological status quo has prompted the domestic and international radiobiology community to dedicate themselves to developing new types of radiation biological dosimeters to meet the needs of rapid, high-throughput, and accurate estimation of radiation doses for injured personnel in the event of nuclear or radiation accidents. Summary of the Invention

[0005] Exosomes are considered a reliable source for finding novel biomarkers. Studies have found that ionizing radiation can induce an increase in the release of exosomes from cellular supernatants and alter the expression profiles of genes, proteins, and metabolism within exosomes. Since exosomes contain a relatively high amount of miRNAs, exploring the changes in exosomal miRNA expression induced by ionizing radiation will provide a new direction for radiation biodosimetry research.

[0006] The purpose of this invention is to provide exosomal miRNA biomarkers for assessing human radiation exposure doses and their applications.

[0007] More specifically, according to one aspect of the invention, exosomal miRNAs biomarkers for assessing human radiation exposure doses are provided, said biomarkers being selected from miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p, and let-7i-5p.

[0008] According to an embodiment of the present invention, the radiation is X-ray, gamma-ray, and / or neutron radiation.

[0009] According to another aspect of the present invention, a reagent for detecting exosomal miRNAs in peripheral blood of a human body after radiation exposure is provided for use in the preparation of products for assessing human radiation exposure doses, characterized in that the radiation exposure dose is calculated using the dose-effect relationship between the expression level of exosomal miRNAs and the radiation exposure dose, wherein the exosomal miRNAs are selected from miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p, and let-7i-5p.

[0010] According to an embodiment of the present invention, the product includes at least one of a reagent, a kit, a test strip, and a chip.

[0011] According to an embodiment of the present invention, the product is a diagnostic system or device, the system or device comprising a sample collection device, a sample detection device, and a diagnostic device; wherein:

[0012] The sample collection device is configured to collect peripheral blood samples from a subject who is an irradiated patient.

[0013] The sample detection device is a device capable of detecting the content of exosomal miRNAs in the peripheral blood sample;

[0014] The diagnostic device includes a data acquisition module and a diagnostic module. The data acquisition module is configured to acquire data detected by the sample detection device, and the diagnostic module is configured to determine the radiation exposure of the subject based on the data acquired by the data acquisition module.

[0015] According to an embodiment of the present invention, the evaluation includes the following steps:

[0016] (1) Extracting human peripheral blood for non-therapeutic purposes and extracting exosome RNA from it;

[0017] (2) cDNA was synthesized and real-time quantitative PCR was performed to detect the expression level of the exosomal miRNAs;

[0018] (3) The radiation exposure was determined by the dose-response relationship between the expression level of exosomal miRNAs and the radiation exposure dose.

[0019] According to an embodiment of the present invention, the determination of the dose-response relationship includes obtaining a linear fitting equation for each exosomal miRNA using linear fitting, and then constructing the dose-response relationship using stepwise regression analysis.

[0020] According to an embodiment of the present invention, the dose-response relationship is as follows:

[0021] y = -3.993 + 3.052 (miR-125b-5p) + 0.635 (miR-551b-3p)

[0022] Where y represents the radiation exposure, and (miR-125b-5p) and (miR-551b-3p) represent the relative expression levels of the gene 24 hours after irradiation.

[0023] The present invention discloses a method for predicting the degree of radiation damage and estimating biological dose using radiation-responsive miRNAs from peripheral blood-derived exosomes. 60 Human immortalized lymphocyte line AHH-1 was irradiated with Co-γ rays. Cell supernatant was collected and exosomes were isolated. miRNA microarrays were used to screen and identify miRNAs whose expression was significantly increased in exosomes after ionizing radiation exposure. Systematic validation at cellular and in vitro human peripheral blood levels confirmed that several miRNAs have the potential to serve as radiation biomarkers. Furthermore, their effectiveness was verified in practice. This method offers significant advantages such as convenient and minimally invasive sampling, simple operation, and high throughput. It solves the problems of cumbersome and time-consuming procedures in existing technologies, meeting the needs for large-scale dose assessment of populations during nuclear and radiation emergencies. Attached Figure Description

[0024] Figure 1 AH is 1.0~6 Gy according to the embodiment of the present invention. 60 A dose-response relationship diagram of exosomal miRNAs derived from AHH-1 cell line irradiated with Co γ rays; and

[0025] Figure 2 AH is 1.0~6 Gy according to the embodiment of the present invention. 60 Figure showing the dose-response relationship of exosomal miRNAs derived from human peripheral blood lymphocytes after in vitro Co-γ irradiation. Detailed Implementation

[0026] The following examples will describe in detail the applications of the various exosomal miRNAs provided by this invention as radiation biomarkers. Unless otherwise specified, the reagents and culture media used in the following examples are commercially available, and the nucleic acid electrophoresis, Real-time PCR, and other operations used are performed according to standard protocols. For example, they can be performed according to the methods described in Molecular Cloning (ColdSpring Harbor Laboratory Press (1989)). The following examples are for illustrative purposes only and are not intended to limit the scope of this invention.

[0027] Example 1. 60 Screening and identification of radiation-responsive miRNAs in exosomes derived from AHH-1 cells induced by Co-γ rays

[0028] 1. Cell Culture and Irradiation: Immortalized human lymphocytes (AHH-1) grown in suspension were seeded in RPMI 1640 medium containing 10% fetal bovine serum and cultured in a 37°C, 5% CO2 incubator. The application dose rate was 1 Gy / min. 60 AHH-1 cell line was irradiated with Co g rays at doses of 0, 2, and 5 Gy, and then harvested after being incubated at 37°C for 24 h.

[0029] 2. Exosome extraction: Cell culture supernatant was collected, centrifuged at 300 g, 4°C for 10 min to remove cells, and the supernatant was retained; then centrifuged at 2000 g, 4°C for 10 min to remove cell debris, and the supernatant was retained; then centrifuged at 10000 g, 4°C for 30 min to remove microvesicles, and the supernatant was retained; finally, centrifuged at 100000 g, 4°C for 70 min, discarding the supernatant and retaining the exosome pellet, which was resuspended in 100–200 μl PBS. The collected exosome particles were analyzed for particle size, electron microscopy, and Western blotting of marker proteins.

[0030] 3. Exosomal RNA Extraction: Total exosomal RNA was extracted using the MiRNeasy Serum / Plasma Kit. 1 mL of QIAzol Lysis Reagent was added to 200 μL of sample and incubated at room temperature for 5 min. 200 μL of chloroform was added, the tube was tightly capped, and the mixture was vigorously vortexed for 15 seconds, then incubated at room temperature for 2–3 min. Subsequently, the tube was centrifuged at 12,000 rpm for 15 min at 4 °C. The supernatant was carefully aspirated and transferred to a new collection tube. 1.5 volumes of anhydrous ethanol were added, and the mixture was gently pipetted to mix. The tube was washed with RW1 and RPE buffers, and the waste liquid was discarded after centrifugation. Finally, the RNA was eluted with 14–30 μL of RNase-free water.

[0031] 4. miRNA Microarray Analysis: Expression profiling was performed using Affymetrix miRNA 4.0 arrays (Zhongkangbo Biotechnology Co., Ltd.). The specific experimental procedure for miRNA microarray analysis was as follows: Total exosomal RNA that passed quality control was introduced into the microarray detection stage. The process involved polyA tailing, sample labeling, microarray hybridization, hybridization signal amplification, and scanning imaging, thus completing the entire microarray experiment. Subsequently, digital signal extraction was performed on the images obtained from the microarray scan. Data analysis began with data standardization, importing annotation files, and screening for differentially expressed genes.

[0032] 5. Screening of candidate differentially expressed miRNAs: Exosomal miRNAs with a fold change ≥ 1.5 or ≤ 1.5 and P < 0.05 were selected as differentially expressed miRNAs through miRNA expression profiling. A total of 253 miRNAs were screened that showed changes with increasing dose, including 90 upregulated miRNAs and 163 downregulated miRNAs. Further dose-dependent increases in miRNAs at 0, 2, and 5 Gy levels were selected from the upregulated miRNAs as candidate miRNAs for dose-response studies. The results are shown in Table 1 below.

[0033] Table 1. Screening and identification of candidate exosomal miRNAs with radiation response

[0034]

[0035] Example 2. Dosage-response relationship of radiation-responsive miRNAs from exosomal cells derived from AHH-1 cell line induced by ionizing radiation.

[0036] 1. Cell Culture and Irradiation: The AHH-1 cell culture method was the same as in Example 1. The applied dose rate was 1 Gy / min. 60 AHH-1 cell line was irradiated with Co g rays at doses of 0, 1, 2, 4 and 6 Gy, and then harvested after incubation at 37°C for 24 h.

[0037] 2. Exosome extraction, identification, and RNA extraction: Same as in Example 1.

[0038] 3. cDNA synthesis: cDNA was synthesized using the miRcute Plus miRNA First-Strand cDNA Kit. 2-5 μl of RNA was added to a 20 μl reaction system. The reaction conditions were: 42℃ for 60 min, 95℃ for 3 min, and then the reaction was terminated. The product was stored at -20°C.

[0039] 4. Primer Design and Synthesis: Based on the gene information in the miRDB database, primer sequences for miRNA and internal reference gene U6 were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences are shown in Table 2 below.

[0040] Table 2. Primer sequences

[0041] miRNA Primer sequence (5’–3’) miR-664b-3p CGCTTCATTTGCCTCCCAGCCTACA let-7f-5p CCGCGCGCGTGAGGTAGTAGATTGTA let-7g-5p CGCCGTGAGGTAGTAGTTTGTACAGTT miR-27a-3p CGCCTTCACAGTGGCTAAGTTCCGC miR-181b-5p CGCAACATTCATTGCTGTCGGTGGGT let-7i-5p CGCTGAGGTAGTAGTTTGTGCTGTT miR-30d-5p CGTGTAAACATCCCCGACTGGAAG miR-125b-5p CCTCCCTGAGACCCTAACTTGTGA miR-29a-3p CGCTAGCACCATCTGAAATCGGTTA miR-18a-5p CGCTAAGGTGCATCTAGTGCAGATAG let-7e-5p CGCGTGAGGTAGGAGGTTGTATAGTT miR-551b-3pmiR-16U6 CCGCGCGACCCATACTTGGTTTCAGCGCTAGCAGCACGTAAATATTGGCGCTCGCTTCGGCAGCACATATAC

[0042] 5. Real-time quantitative PCR detection: The reaction system consisted of 20 μl: 10 μl 2×miRcute Plus miRNAPreMix, 1 μl cDNA template, 0.8 μl of forward and reverse primers, and 8.2 μl of double-distilled water. Reaction conditions: After pre-denaturation at 95℃ for 15 min, the following 40 cycles were performed: denaturation at 94℃ for 20 s, annealing and extension at 60℃ for a total of 34 s. Three replicates were set up for each sample. Melting curve analysis was performed after each real-time quantitative PCR reaction to eliminate the influence of primer dimers. A primer-free blank control group was also included. The experiment was repeated three times.

[0043] 6. PCR Data Processing: Results were analyzed using Applied Biosystems 7500 Sequence Detection Software (SDS). 2 -ΔΔCt The method, using U6 as an internal reference gene, was used to quantitatively measure changes in the expression levels of exosomal miRNAs.

[0044] 7. Establishment of dose-response curves: relative gene expression levels are used as... Data analysis was performed using SPSS 25.0 software. The comparisons between groups were found to be normally distributed after a normality test. One-way ANOVA was used, and the difference was statistically significant with P < 0.05.

[0045] Figure 1 To achieve 1.0~6 Gy according to the embodiments of the present invention 60 A dose-response relationship diagram of exosomal miRNAs derived from AHH-1 cell line irradiated with Co γ rays. Figure 1 It can be known that 0~6 Gy 60Following Co g irradiation of the AHH-1 cell line, compared with the unirradiated group, the relative expression levels of eight miRNAs (miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p, and let-7i-5p) in exosomes showed a significant increasing trend with increasing radiation dose at 4 and 24 h post-irradiation, with statistically significant differences (*P < 0.05, **P < 0.01, ***P < 0.001). Furthermore, the expression levels of each miRNA also exhibited a certain time dependence, with significantly higher gene expression changes at 24 h post-irradiation than at 4 h. These results indicate that radiation-induced exosomal miRNAs derived from human lymphocyte cell lines possess a good dose-response relationship and time response range, demonstrating their potential as radiation dose-related biomarkers.

[0046] Example 3. Dosage-response relationship of radiation-responsive miRNAs in exosomes derived from human peripheral blood lymphocytes induced by ionizing radiation.

[0047] 1. Blood sample collection and irradiation conditions: With informed consent, peripheral blood samples were collected from 6 healthy individuals and irradiated at doses of 0, 1, 2, 4, and 6 Gy under a constant temperature of 37°C. 60 Irradiated with Co γ rays (dose rate 1 Gy / min). Peripheral blood lymphocytes were isolated after irradiation, inoculated into RPMI 1640 medium containing 10% exosome-free fetal bovine serum, and cultured in a 37°C incubator for 24 h. The culture supernatant was then collected.

[0048] 2. Extraction and identification of exosomes: Same as in Example 1.

[0049] 3. Peripheral blood exosomal RNA extraction: Exosomal RNA was extracted using the ExoRNeasy MID1 kit. The sample was thoroughly mixed with Buffer XBP and incubated at room temperature. After centrifugation, the supernatant was discarded, and exosomal precipitate was obtained. The precipitate was resuspended with Buffer XWP and washed, and centrifuged again, discarding the supernatant. QIAzol Lysis Reagent was added to the precipitate, and the mixture was vortexed vigorously to completely lyse the exosomal molecule. Chloroform was added, the mixture was vortexed, and centrifuged. The solution was then separated into phases. The upper aqueous phase was aspirated, mixed with ethanol, and transferred entirely into an RNAeasyMID1 column and centrifuged. The column was washed with Buffer RWT and Buffer RPE, and finally, RNA was eluted with 14 μl of RNase-free water.

[0050] 4. cDNA synthesis and real-time quantitative PCR analysis: Same as in Example 2. Using cDNA obtained by reverse transcription of exosomal RNA derived from human peripheral blood lymphocytes after in vitro irradiation as a template, real-time quantitative PCR was used to detect changes in the expression levels of radiation-responsive exosomal miRNAs.

[0051] 5. PCR Data Processing: Results were analyzed using Applied Biosystems 7500 Sequence Detection Software (SDS). 2 -ΔΔCt The method, using miR-16 as an internal reference gene, was used to quantitatively measure changes in the expression levels of exosomal miRNAs.

[0052] 6. Statistical Analysis: Data analysis was performed using SPSS 25.0 software. Relative gene expression levels are expressed as x̅ ± s. Intergroup comparisons were normalized to a normal distribution using one-way ANOVA with a two-tailed test (significance level α = 0.05). Linear regression was used to fit the dose-response curve.

[0053] Figure 2 AH is 1.0~6 Gy according to the embodiment of the present invention. 60 A dose-response relationship diagram of exosomal miRNAs derived from human peripheral blood lymphocytes after in vitro Co-γ irradiation. Figure 2 It can be known that 0~6 Gy 60 After 24 h of in vitro irradiation of human peripheral blood lymphocytes with Co γ rays, the relative expression levels of eight exosomal miRNAs showed a dose-dependent increase compared to the unirradiated group (P < 0.05, 0.01, 0.001), consistent with the trend observed at the cellular level. This further indicates that the altered expression levels of radiation-sensitive miRNAs in exosomals derived from human peripheral blood lymphocytes induced by ionizing radiation meet the essential criteria for radiation biomarkers. Based on the dose-response relationship of the eight exosomal miRNAs, the fitted curves were all linear equations, with R0... 2 The values ​​are all higher than 0.82. The linear equations for each gene are as follows: miR-664b-3p: y = 0.237x + 1.194, R 2 =0.900;miR-551b-3p: y =0.304x + 1.378, R 2 = 0.824;miR-181b-5p: y = 0.104x + 1.113, R 2 = 0.87;miR-125b-5p: y = 0.227x + 1.120, R 2 = 0.976;miR-27a-3p: y = 0.185x +1.205, R2 = 0.892;miR-18a-5p: y = 0.170x + 1.062, R 2 = 0.922;miR-29a-3p: y =0.102x + 1.138, R 2 = 0.836; let-7i-5p: y = 0.107x + 1.161, R 2 = 0.821. By substituting the relative expression levels of each exosomal miRNA into the fitted curve equation above, the received radiation dose can be estimated, which helps to assess the radiation exposure level of personnel exposed in radiation accidents.

[0054] Studies have found that relying on a single biomarker can lead to certain biases in the accuracy of estimating radiation exposure levels. Therefore, establishing a predictive model based on a set of biomarkers will help improve the accuracy of dose estimation. Based on this, by comprehensively analyzing the relative expression level changes of the aforementioned exosomal miRNAs, and using stepwise regression analysis, a gene combination expression model based on radiation-sensitive exosomal miRNAs derived from human peripheral blood lymphocytes was constructed in this embodiment: y = -3.993 + 3.052 miR-125b-5p + 0.635 miR-551b-3p (F = 9.211, P = 0.000, R0.05). 2 =0.884)(y is the radiation dose; miRNA name is the relative expression level of the gene 24 h after irradiation; F and P are the statistics of the model variance analysis; R 2 (The coefficient of determination).

[0055] Example 4: In vivo experiments to verify the altered gene expression of radiation-sensitive miRNAs in exosomes derived from human peripheral blood plasma.

[0056] 1. Blood Sample Collection and Irradiation: With informed consent, peripheral blood samples were collected from 5 patients with no history of radiotherapy who were scheduled for whole-body homogeneous irradiation. Irradiation method: Dose rate of 1 Gy / min 60 Irradiated with 5 Gy of Co gamma rays, and 4 ml of blood was collected twice, once before the first whole-body radiotherapy and again 24 hours after. Plasma was separated immediately after blood collection.

[0057] 2. Exosome extraction and identification: Same as in Example 1.

[0058] 3. Peripheral blood plasma exosome RNA extraction: Same as in Example 3.

[0059] 4. cDNA synthesis and real-time quantitative PCR detection: Same as in Example 2.

[0060] 5. PCR data processing and statistical analysis: Same as in Example 3.

[0061] The results showed that, compared with before radiotherapy, 24 h after radiotherapy, the relative expression levels of miR-664b-3p and miR-551b-3p in the patient's plasma exosomes increased significantly by 3.75 and 2.05 times (P < 0.001), respectively, demonstrating a strong radiation response. The relative expression levels of miR-181b-3p, miR-125b-5p, and miR-27a-3p were 1.76, 1.81, and 1.62 times that of the control group, respectively, with statistically significant differences (P < 0.01, 0.001). The changes in the expression levels of the above five miRNAs were consistent with the experimental results at the cellular and ex vivo peripheral blood levels.

[0062] The gene combination expression model (y = -3.993 + 3.052 miR-125b-5p + 0.635 miR-551b-3p) established in Example 3 based on changes in the expression level of radiation-sensitive miRNAs in exosomals was used to estimate the radiation dose received by radiotherapy patients. The results are shown in Table 3.

[0063] Table 3. Estimation of radiation dose for radiotherapy patients based on exosomal miRNAs-based biological dosimetry model

[0064]

[0065] As shown in Table 3, the estimated average radiation dose was 4.58 ± 0.76, and the relative deviation (|estimated dose - actual radiation dose| / actual radiation dose) was < 10%. This indicates that radiation-responsive miRNAs in human peripheral blood plasma exosomes can be used for the assessment and monitoring of radiation exposure levels and have good practical application value.

[0066] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. Exosomal miRNAs biomarkers for assessing human radiation exposure dose, characterized in that, The biomarkers include miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p and let-7i-5p.

2. The biomarker of claim 1, wherein: The radiation is X-ray, gamma ray and / or neutron radiation.

3. Use of a reagent for detecting exosomal miRNAs in peripheral blood ex vivo after radiation exposure in a human body in the manufacture of a product for assessing the dose of radiation exposure in a human body, characterized in that, The radiation exposure is calculated by using the dose-effect relationship between the expression level of the exosome miRNAs and the radiation exposure dose, wherein the exosome miRNAs include miR-664b-3p, miR-551b-3p, miR-181b-5p, miR-125b-5p, miR-27a-3p, miR-18a-5p, miR-29a-3p and let-7i-5p.

4. Use according to claim 3, characterized in that, The product includes at least one of the following: reagent, kit, test paper and chip.

5. Use according to claim 4, characterized in that, The product is a diagnostic system or device, which includes a sample collection device, a sample detection device and a diagnostic device; wherein: The sample collection device is configured as a device for collecting a peripheral blood sample of a subject, wherein the subject is an irradiated patient; The sample detection device is a device capable of detecting the content of the exosome miRNAs in the peripheral blood sample; The diagnostic device includes a data acquisition module and a diagnostic module, wherein the data acquisition module is configured to acquire data detected by the sample detection device, and the diagnostic module is configured to determine the radiation exposure of the subject according to the data acquired by the data acquisition module.

6. Use according to claim 3, characterized in that, The evaluation includes the following steps: (1) Peripheral blood is extracted from a human body without therapeutic purposes, and exosome RNA is extracted therefrom; (2) cDNA synthesis and real-time quantitative PCR detection are performed to detect the expression level of the exosome miRNAs; (3) The radiation exposure is determined by using the dose-effect relationship between the expression level of the exosome miRNAs and the radiation exposure dose.

7. Use according to claim 6, characterized in that, The determination of the dose-effect relationship includes obtaining a linear fitting equation of each exosome miRNA by linear fitting, and then constructing the dose-effect relationship by using a stepwise regression analysis method.

8. Use according to claim 7, characterized in that, The dose-effect relationship is as follows: y = -3.993 + 3.052 (miR-125b-5p) + 0.635 (miR-551b-3p) wherein y is the radiation exposure, (miR-125b-5p) and (miR-551b-3p) are the relative expression levels of miR-125b-5p and miR-551b-3p at 24 h after irradiation, respectively.

Images