Alcohol dehydrogenase high-enzyme-activity mutant and application thereof
By mutating a specific amino acid sequence of alcohol dehydrogenase, the activity and stability of the enzyme were improved, solving the problem of insufficient enzyme activity and stability in the enzyme catalysis method, and realizing the industrial production of (R)-4-chloro-3-hydroxy-butyrate with high efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-03
AI Technical Summary
Existing enzyme-catalyzed methods for preparing (R)-4-chloro-3-hydroxy-butyrate ethyl ester suffer from low enzyme activity and poor stability, making industrial application difficult.
The activity and stability of alcohol dehydrogenase can be improved by mutating specific amino acid sequences. Specifically, this involves mutating amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 of the amino acid sequence to create a high-activity mutant.
It significantly improves the conversion rate of COBE, reaching up to 99.4%, which is beneficial for the green synthesis of (R)-4-chloro-3-hydroxy-butyrate ethyl ester.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of enzyme engineering technology, specifically relating to a high-activity mutant of alcohol dehydrogenase and its application. Background Technology
[0002] Alcohol dehydrogenase, as an important biocatalyst, is showing a significant demand trend in the global market. With the rapid development of pharmaceuticals, chemical synthesis, and biotransformation, the market demand for alcohol dehydrogenase continues to grow. In the pharmaceutical field, alcohol dehydrogenase plays an irreplaceable role; in drug synthesis, it can reduce hydroxyl compounds to ketones, a reaction process crucial for improving drug activity and stability. By optimizing reaction conditions, alcohol dehydrogenase can ensure product purity and yield, thus meeting the pharmaceutical industry's demand for high-quality drugs. The rising incidence of chronic diseases and the resulting continuous increase in drug demand further drive the application of alcohol dehydrogenase in the pharmaceutical field. Beyond pharmaceuticals, alcohol dehydrogenase also shows broad application prospects in chemical synthesis and biotransformation. In chemical synthesis, it can efficiently convert ketones into alcohols, facilitating organic synthesis. In biotransformation, it can utilize the body's own metabolic capacity to achieve the biosynthesis of complex compounds, a characteristic of great significance in drug research and development and production. With the continuous development of biotechnology, the application of alcohol dehydrogenase in fields such as chemical synthesis and biotransformation is also constantly expanding to meet more market demands.
[0003] Ethyl (R)-4-chloro-3-hydroxy-butyrate is an important chemical product, and its preparation methods are mainly twofold: chemical and enzymatic methods. The chemical method uses a chiral ruthenium catalyst to catalytically reduce the substrate ethyl 4-chloroacetoacetate. This method suffers from drawbacks such as low chiral purity, low product yield, demanding equipment requirements, harsh reaction conditions, and high production costs. The enzymatic method utilizes highly active and stereoselective ketone reductases to selectively reduce the 3-carbonyl group to an R-configured hydroxyl group using ethyl 4-chloroacetoacetate (COBE) as the substrate. This method offers advantages such as high chiral purity and high substrate conversion. However, the problem with this method is that naturally discovered enzymes have low activity and poor stability, making industrial-scale production difficult. Summary of the Invention
[0004] In view of this, the present invention provides a high-activity mutant of alcohol dehydrogenase and its application. The high-activity mutant of alcohol dehydrogenase has high activity and stability, and can significantly improve the conversion rate of COBE (ethyl 4-chloroacetoacetate), which is beneficial to the green synthesis of (R)-4-chloro-3-hydroxy-butyrate.
[0005] To solve the above technical problems, the first aspect of the present invention provides a high-activity mutant of alcohol dehydrogenase, which is obtained by mutating at least one of the amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 in the amino acid sequence shown in SEQ ID No. 1.
[0006] The initial enzyme with an amino acid sequence as shown in SEQ ID No. 1 has high enzyme activity and stability. By mutating specific amino acids in this amino acid sequence, the present invention obtained mutants with superior activity or stability compared to the protein. The resulting mutants can improve the conversion rate of COBE (ethyl 4-chloroacetoacetate), which is beneficial to the green synthesis of (R)-4-chloro-3-hydroxy-butyrate ethyl ester.
[0007] Preferably, the amino acid at position 3 is mutated to serine.
[0008] Preferably, the amino acid at position 4 is mutated to leucine.
[0009] Preferably, the amino acid at position 22 is mutated to threonine.
[0010] Preferably, the amino acid at position 42 is mutated to leucine.
[0011] Preferably, the amino acid at position 125 is mutated to methionine.
[0012] Preferably, the amino acid at position 180 is mutated to isoleucine.
[0013] Preferably, the amino acid at position 225 is mutated to arginine.
[0014] Preferably, the amino acid at position 327 is mutated to valine.
[0015] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 3 and 180 of the amino acid sequence shown in SEQ ID No. 1.
[0016] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 42 and 125 of the amino acid sequence shown in SEQ ID No. 1.
[0017] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 4, 42, 125, and 180 of the amino acid sequence shown in SEQ ID No. 1.
[0018] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 3, 22, 125, and 327 of the amino acid sequence shown in SEQ ID No. 1.
[0019] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 4, 22, 125, 180, and 225 of the amino acid sequence shown in SEQ ID No. 1.
[0020] In conjunction with the first aspect, the alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 of the amino acid sequence shown in SEQ ID No. 1.
[0021] The above-mentioned high-activity mutant of alcohol dehydrogenase can be used in the asymmetric reduction of ethyl 4-chloroacetoacetate. Specifically, using COBE as a substrate, the high-activity mutant of alcohol dehydrogenase is added to the reaction system (containing 10% v / v isopropanol and 50mM phosphate buffer) to a final concentration of 10~40g / L as a catalytic reaction solution, and the reaction is catalyzed at a pH of 6.0~7.5 and a temperature of 22~30℃.
[0022] Preferably, the concentration of the substrate COBE is 200 g / L.
[0023] A second aspect of the present invention provides a gene encoding the above-mentioned alcohol dehydrogenase high enzyme activity mutant.
[0024] In conjunction with the second aspect, the amino acid sequence of the alcohol dehydrogenase high enzyme activity mutant is shown in SEQ ID No. 2 to SEQ ID No. 16, and its nucleotide sequence is shown in SEQ ID No. 17 to SEQ ID No. 31, respectively.
[0025] A third aspect of the present invention provides a recombinant plasmid containing the nucleotide sequence of the above-mentioned gene.
[0026] In conjunction with the third aspect, the method for constructing the recombinant plasmid is as follows: For single-point mutation mutants: Using the nucleotide sequence containing the high-activity mutant of alcohol dehydrogenase (single-point mutation) as a template, the single-point mutation is constructed using the corresponding primers. First, the target gene is exponentially amplified by PCR. Then, the template strand is removed using the restriction endonuclease Dpn I. Next, the PCR product is rapidly circularized using DNA ligase to obtain a recombinant plasmid containing the gene encoding the high-activity mutant of alcohol dehydrogenase.
[0027] For mutants with multiple mutations: design genes according to the target mutation sequence, send them to a third-party gene synthesis company (Anshengda) for full-sequence synthesis, and construct prokaryotic expression vectors through enzyme digestion and ligation to obtain recombinant plasmids containing genes encoding high-activity mutants of alcohol dehydrogenase.
[0028] A fourth aspect of the present invention provides an engineered bacterium constructed using the above-described recombinant plasmid.
[0029] In conjunction with the fourth aspect, the engineered bacteria is Escherichia coli.
[0030] A fifth aspect of the present invention provides a codon-optimized alcohol dehydrogenase gene, the nucleotide sequence of which is shown in SEQ ID No. 32.
[0031] The sixth aspect of the present invention provides an immobilized enzyme obtained by immobilizing the purified enzyme solution of the above-mentioned alcohol dehydrogenase high enzyme activity mutant onto an amino-based carrier resin or an epoxy-based carrier resin.
[0032] For the preparation of immobilized enzymes, a one-step purification and immobilization method can be used to immobilize the purified enzyme solution of the high-activity mutant of ethanol dehydrogenase onto an amino-based carrier resin.
[0033] The seventh aspect of the present invention provides the application of the above-mentioned high-enzyme-activity mutant or immobilized enzyme of ethanol dehydrogenase in biocatalytic reactions.
[0034] In conjunction with the seventh aspect, the aforementioned high-activity mutant or immobilized ethanol dehydrogenase can be used for asymmetric reduction of COBE to convert it into (R)-4-chloro-3-hydroxy-butyrate ethyl ester.
[0035] The beneficial effects of the present invention are as follows: The high-activity mutant of alcohol dehydrogenase provided by the present invention has higher activity and stability than the protein with the amino acid sequence shown in SEQ ID No.1, and the conversion rate of COBE is greatly improved, up to 99.4%, which is beneficial to the preparation of (R)-4-chloro-3-hydroxy-butyrate ethyl ester by enzyme catalysis. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the following detailed embodiments are provided. For example, the present invention will be described in further detail. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.
[0037] Currently, the chemical synthesis of ethyl (R)-4-chloro-3-hydroxy-butyrate suffers from problems such as poor environmental friendliness, high cost, and low product yield. Enzymatic catalysis for the production of ethyl (R)-4-chloro-3-hydroxy-butyrate has significant advantages over chemical methods in terms of environmental protection and product quality. However, the low enzyme activity and poor stability are the main obstacles hindering the large-scale industrial application of this method. Therefore, improving the stability and catalytic activity of enzymes is an urgent problem to be solved for the industrial production of ethyl (R)-4-chloro-3-hydroxy-butyrate using enzyme catalysis.
[0038] To address the aforementioned problems, this invention provides a high-activity mutant of alcohol dehydrogenase, obtained by mutating at least one of the amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 in the amino acid sequence shown in SEQ ID No. 1. Specifically, a co-mutation of amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 can increase the COBE conversion rate to over 99%; mutations of other amino acids can improve activity and COBE conversion efficiency to varying degrees.
[0039] The technical solution of the present invention will be described below through specific embodiments.
[0040] Unless otherwise specified, all reagents used in the following examples are commercially available or obtained using methods known in the art. The phosphate buffer used is either sodium phosphate buffer or potassium phosphate buffer.
[0041] (I) Methods for obtaining high-activity mutants of alcohol dehydrogenase The sequence “NAD+(P)-dependent alcohol dehydrogenas” was searched on NCBI and PubMed websites to collect the gene sequences of related alcohol dehydrogenases. The collected gene sequences were sent to a third-party service provider to synthesize the full-length gene sequences, which were then digested and constructed into the pET28a vector, transformed into the BL21(DE3) host bacteria, and induced with isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 1 mM. Enzyme activity was detected according to the system in Table 1, and the results are shown in Table 2.
[0042] Table 1 Enzyme activity detection system
[0043] Table 2 Enzyme activity values of various organisms
[0044] It can be seen that the alcohol dehydrogenase derived from Rhodococcus sp ST10 has the highest enzyme activity, so this enzyme was chosen as the subject of subsequent research.
[0045] (II) Construction method of alcohol dehydrogenase hyperenzyme activity mutant gene Using error-prone PCR, a mutant library was constructed by randomly mutagenizing the gene of the initial enzyme Rhodococcus sp ST10 under controlled conditions. The forward primer sequence was: ggatcttccagagatGGATCCACGAAGGAGGTTTCG, and the reverse primer sequence was: ctgccgttcgacgatCTGCAGGTCGACTCTAGAGGATCA. The error-prone PCR system and PCR procedure are detailed in Table 3.
[0046] Table 3
[0047] The obtained mutants were screened for enzyme activity. Specifically, the mutants were screened using the enzyme activity screening conditions in the method for obtaining high enzyme activity of alcohol dehydrogenase (I). A total of 872 mutants were screened. Compared with the initial enzyme activity, the enzyme activity of most mutants did not change significantly, while the enzyme activity of 8 mutants increased significantly. The DNA sequences of the mutants with increased enzyme activity were determined to identify the mutation sites.
[0048] Example 1 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating alanine at position 3 of the amino acid sequence shown in SEQ ID No. 1 to serine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 2, and the nucleotide sequence is shown in SEQ ID No. 17.
[0049] Example 2 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating isoleucine at position 4 of the amino acid sequence shown in SEQ ID No. 1 to leucine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 3, and the nucleotide sequence is shown in SEQ ID No. 18.
[0050] Example 3 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating glutamic acid at position 22 of the amino acid sequence shown in SEQ ID No. 1 to threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 4, and the nucleotide sequence is shown in SEQ ID No. 19.
[0051] Example 4 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating aspartic acid at position 42 of the amino acid sequence shown in SEQ ID No. 1 to leucine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 5, and the nucleotide sequence is shown in SEQ ID No. 20.
[0052] Example 5 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating leucine at position 125 of the amino acid sequence shown in SEQ ID No. 1 to methionine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 6, and the nucleotide sequence is shown in SEQ ID No. 21.
[0053] Example 6 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating threonine at position 180 of the amino acid sequence shown in SEQ ID No. 1 to isoleucine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 7, and the nucleotide sequence is shown in SEQ ID No. 22.
[0054] Example 7 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating lysine at position 225 of the amino acid sequence shown in SEQ ID No. 1 to arginine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 8, and the nucleotide sequence is shown in SEQ ID No. 23.
[0055] Example 8 This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating alanine at position 327 of the amino acid sequence shown in SEQ ID No. 1 to valine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 9, and the nucleotide sequence is shown in SEQ ID No. 24.
[0056] Example 9 (1, 6) This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating alanine at position 3 to serine and threonine at position 180 to isoleucine in the amino acid sequence shown in SEQ ID No. 1. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 10, and the nucleotide sequence is shown in SEQ ID No. 25.
[0057] Example 10 (4, 5) This invention provides a mutant with high alcohol dehydrogenase activity, which is obtained by mutating aspartic acid at position 42 to leucine and leucine at position 125 to methionine in the amino acid sequence shown in SEQ ID No. 1. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 11, and the nucleotide sequence is shown in SEQ ID No. 26.
[0058] Example 11 (1, 2, 3) This invention provides a mutant with high alcohol dehydrogenase activity, wherein the alanine at position 3 of the amino acid sequence shown in SEQ ID No. 1 is mutated to serine, the isoleucine at position 4 is mutated to leucine, and the glutamic acid at position 22 is mutated to threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 12, and the nucleotide sequence is shown in SEQ ID No. 27.
[0059] Example 12 (2, 4, 5, 6) This invention provides a mutant with high alcohol dehydrogenase activity, wherein the isoleucine at position 4 is mutated to leucine, the aspartic acid at position 42 is mutated to leucine, the leucine at position 125 is mutated to methionine, and the threonine at position 180 is mutated to isoleucine in the amino acid sequence shown in SEQ ID No. 13. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 28.
[0060] Example 13 (1, 3, 5, 8) This invention provides a mutant with high alcohol dehydrogenase activity, wherein the amino acid sequence shown in SEQ ID No. 1 is modified by mutating alanine at position 3 to serine, glutamic acid at position 22 to threonine, leucine at position 125 to methionine, and alanine at position 327 to valine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 14, and the nucleotide sequence is shown in SEQ ID No. 29.
[0061] Example 14 (2, 3, 5, 6, 7) This invention provides a mutant with high alcohol dehydrogenase activity, wherein the isoleucine at position 4 is mutated to leucine, the glutamic acid at position 22 is mutated to threonine, the leucine at position 125 is mutated to methionine, the threonine at position 180 is mutated to isoleucine, and the lysine at position 225 is mutated to arginine in the amino acid sequence shown in SEQ ID No. 15, and the nucleotide sequence is shown in SEQ ID No. 30.
[0062] Example 15 (1-8) This invention provides a mutant with high alcohol dehydrogenase activity, wherein the amino acid sequence shown in SEQ ID No. 1 is modified by mutating alanine at position 3 to serine, isoleucine at position 4 to leucine, glutamic acid at position 22 to threonine, aspartic acid at position 42 to leucine, leucine at position 125 to methionine, threonine at position 180 to isoleucine, lysine at position 225 to arginine, and alanine at position 327 to valine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 16, and the nucleotide sequence is shown in SEQ ID No. 31.
[0063] Example 16 This invention provides the application of the alcohol dehydrogenase high-activity mutants from Examples 1-15 in the asymmetric reduction of COBE to prepare (R)-4-chloro-3-hydroxy-butyrate ethyl ester, specifically: Take 200 g / L of the substrate COBE to be converted and add it to the catalytic reaction solution (the components of the catalytic reaction solution are: 10% isopropanol, v / v, 50 mM phosphate buffer at pH 7.0, 40 g / L of alcohol dehydrogenase high enzyme activity mutant, and 0.2 g / L of NAD+). The catalytic reaction is carried out at a temperature of 22~30℃.
[0064] Example 17 This invention provides a recombinant plasmid containing a gene encoding a high-activity mutant of alcohol dehydrogenase and a method for its construction: The method for constructing recombinant plasmids containing genes encoding the alcohol dehydrogenase hyperactivity mutants in Examples 1-8 and Comparative Examples 1-4 is as follows: Taking a recombinant plasmid containing a gene encoding the alcohol dehydrogenase hyperactivity mutant in Example 1 as an example: using the nucleotide sequence encoding the alcohol dehydrogenase hyperactivity mutant in Example 1 as a template, a single-point mutation is constructed using the corresponding primers. First, the target gene is exponentially amplified by PCR. Then, the template strand is removed using the restriction endonuclease Dpn I. Next, the PCR product is rapidly circularized using DNA ligase to obtain a recombinant plasmid containing a gene encoding the alcohol dehydrogenase hyperactivity mutant in Example 1.
[0065] The method for constructing recombinant plasmids containing genes encoding the high-activity mutant of alcohol dehydrogenase in Examples 9-15 is as follows: Taking a recombinant plasmid containing a gene encoding the high-activity mutant of alcohol dehydrogenase in Example 9 as an example: a gene is designed according to the target mutation sequence, sent to a third-party gene synthesis company (Anshengda) for full-sequence synthesis, and a prokaryotic expression vector is constructed by enzyme digestion and ligation to obtain a recombinant plasmid containing a gene encoding the high-activity mutant of alcohol dehydrogenase in Example 9.
[0066] Example 18 This invention provides engineered bacteria containing the recombinant plasmid from Example 17 and its construction method: The recombinant plasmid from Example 17 was transformed into BL21(DE3) competent cells and plated on solid LB agar plates containing 50 μg / mL kanamycin to obtain successfully transformed recombinant engineered bacteria, which are engineered bacteria containing the recombinant plasmids from Examples 1 to 15.
[0067] Example 19 This invention provides the application of the engineered bacteria in Example 18 in asymmetric reduction COBE: The engineered *E. coli* strain constructed in Example 18 was cultured overnight at 37°C. The next day, positive single clones were picked and cultured in liquid LB medium containing 50 μg / mL kanamycin. When the OD... 600 When the value reaches the range of 0.5~0.8, add IPTG (isopropyl-β-D-thiogalactoside) to a final concentration of 1mM, and induce protein expression at 25℃ for 4h.
[0068] Take 200 g / L of the substrate COBE to be converted and add it to the catalytic reaction solution (the components of the catalytic reaction solution are: 10% isopropanol, v / v, 50 mM phosphate buffer at pH 7.0, 40 g / L of alcohol dehydrogenase high enzyme activity mutant, and 0.2 g / L of NAD+). The catalytic reaction is carried out at a temperature of 22~30℃.
[0069] Example 20 Taking the alcohol dehydrogenase hyperactivity mutant from Example 15 as an example, the sequence of the alcohol dehydrogenase hyperactivity mutant from Example 15 was codon optimized using the Newbio online tool. The optimized nucleotide sequence is shown in SEQ ID No. 32. Then, plasmid pet30A was synthesized using Genewiz and transformed into BL21(DE3) competent cells, which were then plated on solid LB plates containing 50 μg / mL kanamycin. The cells were cultured overnight at 37°C. The next day, positive clones were picked and cultured in liquid TB medium containing 50 μg / mL kanamycin for 3 hours. When OD... 600 When the value reaches the range of 0.5~0.8, IPTG (isopropyl-β-D-thiogalactoside) is added to make the final IPTG concentration 1mM / mL, and protein expression is induced at 25℃ for 4h. Wet bacterial cells are collected by centrifugation at 8000 rpm, and 0.1g of wet bacterial cells are resuspended in 1mL of distilled water. 100µL of bacterial resuspension is taken, and 25µL of 5×SDS protein loading buffer is added to stain the target bacterial cells for protein. After mixing, the mixture is heated at 95℃ for 10 min, centrifuged at 12000g for 5 min, and the supernatant is used for SDS-PAGE to detect the expression level of the target protein.
[0070] Example 21 This embodiment provides a method for purifying the protein of alcohol dehydrogenase, providing a purified enzyme solution for the preparation of immobilized enzymes. The specific purification method is as follows: the wet bacterial cells collected in Example 20 are added to 50mM sodium phosphate buffer (containing 20mM imidazole) at pH 7.5 at a mass ratio of 1:10 (bacterial weight: solution volume) and sonicated. Then, the alcohol dehydrogenase is subjected to gradient elution and purification by nickel chelate chromatography (the eluent is 50mM sodium phosphate buffer at pH 7.4 containing 500mM imidazole). The purified solution obtained by elution is concentrated and replaced by ultrafiltration to obtain an alcohol dehydrogenase solution with a concentration of 2mg / mL.
[0071] Example 22 The optimized nucleotide sequence shown in SEQ ID No. 32 obtained in Example 20 was modified by adding a nucleotide sequence encoding LCTPSR, 5'CGAATTTTCTGTCCTCAAAGAT3', before the 3' stop codon. The full-length gene sequence was then constructed using the pet30A vector. The Streptococcus pneumoniae formylglycine synthase gene sequence (FGE gene, Accession No. NC_000962.3) was also constructed using the PDEST17 vector. Both the pet30A and PDEST17 vectors were co-transformed into BL21(DE3) competent cells and plated on solid LB agar plates containing 50 μg / mL kanamycin and 50 μg / mL ampicillin. The cells were incubated overnight at 37°C. On the second day, positive clones were picked and cultured in liquid TB medium containing 50 μg / mL kanamycin and 50 μg / mL ampicillin for 3 hours. When OD... 600 When the pH value reaches the range of 0.5-0.8, IPTG (isopropyl β-D-1-thiogalactopyranoside) is added to bring the final IPTG concentration to 1 mM, and protein expression is induced at 25°C for 4 h. Wet cells are collected by centrifugation at 8000 rpm. 50 mM sodium phosphate buffer (pH 7.5) is added at a ratio of 1:10 (cell weight: solution volume), followed by sonication, centrifugation at 10000 rpm, and the supernatant is collected as the one-step immobilized alcohol dehydrogenase solution.
[0072] Example 23 This embodiment provides an epoxy-based carrier resin immobilized enzyme (taking the mutant in Example 15 as an example). The epoxy resin carrier (model: Lanxiao LXTE-600) was soaked in pH 7.5, 50mM phosphate buffer for 1 hour, filtered and washed, and then mixed with the purified enzyme solution obtained in Example 21 at different volume ratios (carrier: enzyme solution, specific ratios are shown in Table 6). After binding at 20°C and 100 rpm for 24 hours, it was filtered and washed with purified water to obtain the epoxy-based carrier resin immobilized enzyme.
[0073] Example 24 This embodiment provides an amino-carrier resin immobilized enzyme (taking the mutant in Example 15 as an example). The amino-carrier resin (model: Lanxiao LXTE700) was soaked in pH 7.5, 50mM phosphate buffer (containing 2%~5% glutaraldehyde by volume) for 1 hour, filtered and washed, and then mixed with the purified enzyme solution obtained in Example 21 at different volume ratios (carrier: enzyme solution, specific ratios are shown in Table 6). After binding at 20°C and 100 rpm for 24 hours, it was filtered and washed with purified water to obtain the amino-carrier resin immobilized enzyme.
[0074] Example 25 This embodiment provides an amino-carrier resin immobilized enzyme (taking the mutant in Example 15 as an example). The amino-carrier resin (model: Lanxiao LXTE700) was soaked in pH 7.5, 50mM phosphate buffer for 1 hour, filtered and washed, and then mixed with the one-step immobilized enzyme solution corresponding to Example 22 at different volume ratios (carrier: enzyme solution, specific ratios are shown in Table 6). After binding at 20°C and 100 rpm for 24 hours, it was filtered and washed with purified water to obtain the one-step immobilized amino-carrier resin immobilized enzyme.
[0075] Comparative Example 1 This comparative example provides a mutant with high alcohol dehydrogenase activity, which is a mutant in which threonine at position 33 of the amino acid sequence shown in SEQ ID No. 1 is mutated to serine.
[0076] Comparative Example 2 This comparative example provides a mutant with high alcohol dehydrogenase activity, which is a mutant in which tyrosine at position 52 of the amino acid sequence shown in SEQ ID No. 1 is mutated to cysteine.
[0077] Comparative Example 3 This comparative example provides a mutant with high alcohol dehydrogenase activity, which is a mutant in which proline at position 134 of the amino acid sequence shown in SEQ ID No. 1 is mutated to histidine.
[0078] Comparative Example 4 This comparative example provides a mutant with high alcohol dehydrogenase activity, which is a mutant in which glycine at position 270 of the amino acid sequence shown in SEQ ID No. 1 is mutated to valine.
[0079] Test Example 1 The enzyme activities of the mutants in Examples 1-15 and Comparative Examples 1-4 were measured respectively. The measurement method was as follows: the bacterial cells collected after induction were resuspended in 50mM phosphate buffer (pH 7.0) at a concentration of 0.1g / mL.
[0080] The enzyme reaction activity system (5 ml reaction system) includes 0.5 g / mL ethyl 4-chloroacetoacetate, 10% (v / v) isopropanol, 24 mg / mL disodium hydrogen phosphate dodecahydrate, 6.8 mg / mL sodium dihydrogen phosphate monohydrate, 0.2 mg / mL coenzyme NAD+, and 5% (v / v) cell resuspension.
[0081] The reaction was carried out at 30℃ and 200 rpm for 15 minutes on a constant temperature shaker. After centrifugation at 10,000 rpm for 1 minute, the supernatant was collected. The concentration of the intermediate product (R)-CHBE in the supernatant was detected by gas chromatography, and the conversion rate was calculated. Enzyme activity was defined as the rate at which ethyl 4-chloroacetoacetate was converted per unit weight of bacterial cells per unit time after a 15-minute reaction at 30℃.
[0082] The results are shown in Table 4.
[0083] Table 4
[0084] (Compared with SEQ ID No.1, *P<0.05, **P<0.01, ***P<0.001) As shown in Table 4, mutations in amino acids 3, 4, 22, 42, 125, 180, 225, and 327, or mutations in amino acids 3, 180, 42, and 125, or mutations in amino acids 4, 42, 125, and 180, or mutations in amino acids 3, 22, 125, and 327, or mutations in amino acids 4, 22, 125, 180, and 225, or mutations in amino acids 3, 4, 22, 42, 125, 180, 225, and 327, all resulted in enzyme activities significantly superior to those of the proteases with amino acid sequences as shown in SEQ ID No. 1.
[0085] Test Example 2 The results of COBE catalysis for 8 h were examined for the protein with the amino acid sequence shown in SEQ ID No. 1 and the alcohol dehydrogenase mutants of Examples 1-15 and Comparative Examples 1-4.
[0086] The specific method is as follows: Add 43 mL of phosphate buffer (17.907 g of disodium hydrogen phosphate dodecahydrate, dissolved in 800 mL of water, pH adjusted to 7.0 with phosphoric acid, and diluted to 1000 mL with water) and 7 mL of isopropanol to a 250 mL three-necked reaction flask, then add 2 mg of NAD+, 5.0 g of ethyl 4-chloroacetoacetate (purchased from Merck, purity 95%), and 1 g of recombinant alcohol dehydrogenase cells (the protein shown in SEQ ID No. 1 and the alcohol dehydrogenase mutants obtained in Examples 1-15 and Comparative Examples 1-4). Adjust the pH to 6.0-7.5 (using 1 mol / L sodium carbonate solution), and catalyze the reaction at 22-30 °C for 6-8 hours. After the reaction, quench the reaction at 70 °C. Detect the concentration of the intermediate (R)-4-chloro-3-hydroxy-butyrate using gas chromatography (GC), and calculate the conversion rate of COBE. The results are shown in Table 5.
[0087] Table 5
[0088] (Compared with SEQ ID No.1, *P<0.05, **P<0.01, ***P<0.001) As shown in Table 5, mutations in amino acids 3, 4, 22, 42, 125, 180, 225, and 327, or mutations in amino acids 3, 180, 42, and 125, or mutations in amino acids 4, 42, 125, and 180, or mutations in amino acids 3, 22, 125, and 327, or mutations in amino acids 4, 22, 125, 180, and 225, or mutations in amino acids 3, 4, 22, 42, 125, 180, 225, and 327, resulted in mutants exhibiting significantly better catalytic effects than the protein with the amino acid sequence shown in SEQ ID No. 1 within 6–8 hours.
[0089] Test Example 3 The enzyme activity and enzyme immobilization rate of the immobilized enzymes obtained in Examples 23-25 were determined using the BCA protein content assay kit, and the results are shown in Table 6.
[0090] Table 6
[0091] As shown in Table 6, both epoxy and amino carriers can immobilize the target enzyme, with epoxy carriers and amino carriers using one-step immobilization solution showing better immobilization results.
[0092] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A mutant with high alcohol dehydrogenase activity, characterized in that, The alcohol dehydrogenase hyperactivation mutant is obtained by mutating at least one of the amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 in the amino acid sequence shown in SEQ ID No.
1.
2. The alcohol dehydrogenase hyperactivation mutant as described in claim 1, characterized in that, The third amino acid is mutated to serine; and / or Mutate the fourth amino acid to leucine; and / or Mutate the 22nd amino acid to threonine; and / or Mutate the 42nd amino acid to leucine; and / or Mutate the amino acid at position 125 to methionine; and / or Mutate the 180th amino acid to isoleucine; and / or Mutate the amino acid at position 225 to arginine; and / or The amino acid at position 327 was mutated to valine.
3. The alcohol dehydrogenase hyperactivation mutant as described in claim 1 or 2, characterized in that, The alcohol dehydrogenase high enzyme activity mutant is obtained by mutating the amino acids at positions 3, 22, 125, and 327 of the amino acid sequence shown in SEQ ID No.
1.
4. The alcohol dehydrogenase hyperactivation mutant as described in claim 1 or 2, characterized in that, The alcohol dehydrogenase high enzyme activity mutant is obtained by mutating amino acids at positions 3, 4, 22, 42, 125, 180, 225, and 327 in the amino acid sequence shown in SEQ ID No.
1.
5. The gene encoding the high-activity mutant of alcohol dehydrogenase according to any one of claims 1 to 4.
6. The gene as described in claim 5, characterized in that, The amino acid sequences of the alcohol dehydrogenase high enzyme activity mutants are shown in SEQ ID No. 2 to SEQ ID No. 16, and their nucleotide sequences are shown in SEQ ID No. 17 to SEQ ID No. 31, respectively.
7. A recombinant plasmid containing the nucleotide sequence of the gene described in claim 5 or 6.
8. Engineered bacteria constructed using the recombinant plasmid as described in claim 7.
9. A codon-optimized alcohol dehydrogenase gene, characterized in that, The nucleotide sequence of this gene is shown in SEQ ID No.
32.
10. An immobilized enzyme, characterized in that, The purified enzyme solution of the alcohol dehydrogenase high enzyme activity mutant according to any one of claims 1 to 4 is obtained by immobilizing it on an amino-based carrier resin or an epoxy-based carrier resin.
11. The use of a high-activity mutant of alcohol dehydrogenase according to any one of claims 1 to 4 or the immobilized enzyme according to claim 10 in a biocatalytic reaction.