Genetically engineered bacterium for producing fucose as well as construction method and application of genetically engineered bacterium
By constructing a genetically engineered bacterium that efficiently produces fucose, and employing CRISPR/Cas gene knockout technology and enzyme gene optimization, efficient fucose synthesis was achieved, solving the problems of low yield and unstable supply in existing technologies, and realizing efficient and low-cost fucose production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- WUHAN TANGZHI PHARM CO LTD
- Filing Date
- 2025-12-30
- Publication Date
- 2026-04-17
AI Technical Summary
The current production of fucose synthesized by microorganisms is low, resulting in high production costs and the inability to produce on a large scale. Moreover, the supply is unstable, mainly relying on foreign companies and is greatly affected by the international situation.
A genetically engineered bacterium capable of efficiently producing fucose was constructed using genetic engineering. CRISPR/Cas gene knockout technology was used to knock out relevant metabolic genes and clone key genes to construct a genetically engineered strain capable of efficiently synthesizing GDP-fucose. Furthermore, by optimizing enzyme gene expression, efficient fucose synthesis was achieved.
High-yield production of fucose has been achieved, with a shake flask yield of 5.4 g/L and a fermenter yield of 49~68 g/L, meeting the needs of industrial production, solving the problems of low yield and high cost, and possessing large-scale production capacity.
Smart Images
Figure CN121874074A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of functional genetically engineered bacteria construction technology, specifically relating to a genetically engineered bacterium that produces fucose, its construction method, and its application. Background Technology
[0002] Fucose, also known as 6-deoxy-L-galactose, is a hexose sugar widely found in various plants and animals, particularly in certain seaweeds, legumes, and dairy products. It has wide applications in medicine, medical devices, and cosmetics. It can be used for immune regulation, inhibiting tumor growth and metastasis, preventing and treating respiratory infections; slowing skin aging, preventing respiratory infections, and inhibiting collagen degradation; as a sweetener, its sweetness is 0.6 times that of sucrose, and it is used in chewing gum and dairy products; as a nutritional fortifier, it can be added to dietary supplements such as calcium tablets; and it can be added to facial cleansers to slow down skin aging.
[0003] Fucose production mainly involves seaweed extraction and microbial synthesis. Extraction methods are difficult to scale up due to low yield and high pollution. Microbial synthesis, on the other hand, is the primary method for fucose production due to its advantages of low pollution, high yield, low production cost, and ease of scale-up. Within microorganisms, fucose is first produced by the cell itself as GDP-L-fucose, then transferred to a suitable glycosyl acceptor (such as lactose) by fucosyltransferase to generate 2'-fucosyllactose (2'-FL). Fucosidase then hydrolyzes the fucose from 2'-fucosyllactose to obtain fucose and lactose. Lactose, acting as a glycosyl acceptor, can be recycled to accept fucose again and be hydrolyzed by fucosidase to obtain fucose once more.
[0004] The main problems with microbial fucose synthesis are: first, the yield of fucose-producing strains is not high, resulting in high production costs; second, most fucose technologies are still in the laboratory stage and cannot be mass-produced; and third, fucose is still mainly produced by foreign companies, and its supply is unstable and greatly affected by the international situation. Summary of the Invention
[0005] In view of this, the present invention constructs a genetically engineered bacterium that efficiently produces fucose through genetic engineering.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: A genetically engineered bacterium for producing fucose, wherein the engineered bacterium is deposited at the China Center for Type Culture Collection (CCTCC) on December 10, 2025, with accession number CCTCC NO: M 20252837.
[0007] The method for constructing the above-mentioned genetically engineered bacteria includes the following steps: S1. First, using Escherichia coli as the initial strain, knock out the two genes lacZ and lacA that metabolize lactose in the E. coli genome, and replace lacZ with a constitutive promoter sequence; then knock out the gene cluster araB-araA-araD that degrades L-arabinose; next, knock out the wcaJ gene to reduce GDP-Fucose metabolism; finally, knock out the genes fucI and fucK to prevent fucose from being metabolized into L-Fuculose, thus obtaining modified strain I; S2. The genes manA, gmd, wcaG, manB, and manC for GDP-fucose synthesis were cloned sequentially into vector I and vector II. S3. The enzyme genes Bli2fuc, BKHT, zwf, and rcsA were cloned into vectors III and IV in sequence. S4. Vectors I, II, III, and IV are electroporated into modified bacteria I and cultured to obtain the genetically engineered bacteria.
[0008] In some specific embodiments, preferably, the Escherichia coli in step S1 is Escherichia coli W3110.
[0009] In some specific embodiments, preferably, the constitutive promoter in step S1 is the J23119 constitutive promoter.
[0010] In some specific embodiments, preferably, in step S2, carrier I is the pBAD-hisA carrier and carrier II is the pRB1k carrier.
[0011] In some specific embodiments, preferably, in step S3, carrier III is the pBAD-hisA carrier and carrier IV is the pRB1k carrier.
[0012] Furthermore, the culture conditions in step S4 are as follows: Culture medium composition: LB medium + 20 g / L glycerol; Culture conditions: Incubate at 37℃ with shaking for 3-8 hours.
[0013] Furthermore, the gene knockout in the construction method is performed using CRISPR / Cas gene knockout technology.
[0014] The application of the above-mentioned genetically engineered bacteria in the fermentation preparation of fucose.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The chassis strain of the present invention is Escherichia coli W3110, which is a food safety production strain that solves the safety problem of fucose in the fields of food, medicine and cosmetics.
[0016] (2) The present invention uses an arabinose promoter vector. The arabinose promoter is more rigorous than the commonly used T7 promoter, which avoids the leakage expression of the target protein and allows the growth stage of the strain to be separated from the fucose synthesis stage.
[0017] (3) By screening fucoidosidases from different sources, this invention obtained the gene Bli2fuc, which is highly efficient at hydrolyzing fucose, thus increasing the yield of fucose. The product yield reached 49~68g / L in a 5L fermenter, laying the foundation for large-scale industrial production of fucose. Attached Figure Description
[0018] Figure 1 This is a flowchart of the engineered bacteria construction technology in Embodiment 1 of the present invention.
[0019] Figure 2 The results of gene knockout detection during the construction of engineered bacteria in Example 1 of this invention are shown.
[0020] Figure 3 This is a plasmid map showing the process of constructing the engineered bacteria in Example 1 of the present invention.
[0021] Figure 4 The results are TLC detection results of the engineered bacteria in the shake flask test in Example 1 of this invention.
[0022] Figure 5 The results are obtained by TLC detection of the fermentation products of the engineered bacteria in Example 2 of this invention. Detailed Implementation
[0023] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.
[0024] Example 1 This embodiment provides a genetically engineered bacterium for fucose production. The specific construction steps are based on *Escherichia coli* W3110, and by knocking out metabolic bypass genes, a strain suitable for fucose production was obtained (see technical route). Figure 1 ), as detailed below: (1) Using CRISPR / Cas gene knockout technology (for details, please refer to the literature Jiang, Yu, et al. "Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system." Applied and environmental microbiology 81.7 (2015): 2506-2514), the bypass gene wcaJ (Gene ID 12934317) for GDP-Fucose metabolism was knocked out in strain W3110 to obtain strain WJ.
[0025] (2) Based on strain WJ, the lactose metabolism gene lacA (Gene ID 12934190) was knocked out using CRISPR / Cas gene knockout technology to obtain strain WJA.
[0026] (3) Based on the WJA strain, the lactose degradation gene lacZ (Gene ID 12934192) was knocked out using CRISPR / Cas gene knockout technology and replaced with the strong constitutive PJ23119 promoter (specific sequence: TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC). Since the lacY gene (Gene ID 12934191) in the E. coli genome is after lacZ, replacing lacZ with the PJ23119 promoter can overexpress lacY in the genome while knocking out lacZ, thus avoiding lactose degradation and enhancing the strain's ability to transport lactose from the culture medium to the cell, resulting in strain WJAZY+.
[0027] (4) The gene cluster araB-araA-araD (Gene IDs 12932489, 12930470, and 12934049, respectively) involved in L-arabinose metabolism was knocked out on the WJAZY+ strain. The plasmid used in this invention contains an arabinose promoter, and L-arabinose is used as an inducer. After knocking out the gene cluster araB-araA-araD, the inducer L-arabinose is no longer degraded, and the expression of the target protein can be stably induced. The resulting strain is WJAZDY+.
[0028] (5) Based on the WJAZDY+ strain, the gene cluster fucI-fucK (Gene IDs 12930472 and 12930231) related to fucose metabolism was further knocked out. After knocking out fucI-fucK, fucose could accumulate in the culture system without being metabolized into other products; the resulting strain was WJAZDIKY+ (see the results of related gene knockout). Figure 2 ).
[0029] The functions of the genes knocked out in steps 1-5 above are detailed in Table 1: Table 1. Functional details of each knocked-out gene.
[0030] (6) To improve the supply of the key precursor GDP-fucose, the key genes for GDP-fucose synthesis, manA, gmd, wcaG, manB, and manC (Gene IDs 12931261, 12930696, 12930697, 12934315, and 12934318, respectively), were cloned sequentially into the pBAD-hisA and pRB1k vectors to obtain plasmids pBAD-ADGCB and pRB1k-ADGCB. For specific procedures, please refer to the article "Molecular Cloning: A Laboratory Manual".
[0031] (7) The key enzyme genes BKHT and Bli2fuc (GenBank accession numbers PAF50342.1 and WP_256887295.1, respectively, and their expression was enhanced through codon optimization) and zwf and rcsA (Gene IDs 12930160 and 12932053, respectively) were cloned sequentially into the pBAD-hisA and pRB1k vectors to obtain plasmids pBAD-CTFA and pRB1k-CTFA. The relevant plasmid maps are shown in [link to relevant data]. Figure 3 .
[0032] (8) The pBAD-ADGCB+pRB1k-CTFA and pBAD-CTFA+pRB1k-ADGCB plasmids were electrotransformed into the WJAZDIKY+ strain, and after culturing, the genetically engineered bacteria were obtained.
[0033] Furthermore, to verify whether the genetically engineered bacteria could produce fucose, the following experiments were conducted: Genetically engineered bacteria were picked from the transformed plates and transferred to LB medium containing 20 g / L glycerol, and cultured with shaking at 37°C until OD reached. 600 After approximately 0.6 μL of culture, add 2 g / L L-arabinose and 3 g / L lactose; continue culturing at 30°C for 72 h. Then, take 1 mL of bacterial culture and centrifuge at 12000 rpm for 10 min. Take the supernatant for TLC detection of fucose production. The test results are shown in the appendix. Figure 4 .
[0034] Depend on Figure 4It can be seen that the fucose yield in the shake flasks of the above samples, after quantification by HPLC, was between 5.4 g / L. Furthermore, for rigorous testing, this application conducted multiple shake flask tests, ultimately showing a fucose yield between 4.6 g / L and 5.4 g / L. This demonstrates that this application has successfully obtained genetically engineered bacteria capable of producing fucose.
[0035] Example 2 This embodiment explores yield improvement based on the engineered bacteria obtained in Example 1. Therefore, the engineered bacteria were fermented in a 5L fermenter to understand their application in scaled-up production. The specific steps are as follows: 1. Preparation of culture medium Seed culture medium (LB medium): yeast extract: 5 g / L, soybean peptone: 10 g / L, NaCl: 10 g / L.
[0036] Fermentation medium composition: Angel yeast extract powder FM885 5g / L, diammonium hydrogen phosphate 4g / L, anhydrous potassium dihydrogen phosphate 13.5g / L, magnesium sulfate heptahydrate 1.4g / L, trace element solution 1ml / L, calcium chloride 2g / L, vitamin B 12.2mg / L, citric acid 1g / L, glucose 5g / L, glycerol 10g / L, ammonium sulfate 5g / L, PPE defoamer.
[0037] The supplemental culture medium consists of: 250 g / L glucose, 20 g / L magnesium sulfate, 250 g / L glycerol, and 1 ml / L trace element solution.
[0038] The trace element composition of the fermentation medium and fed medium is as follows: NaCl 5g / L, MnCl2·4H2O 4g / L, ZnSO4·7H2O 1g / L, sodium molybdate dihydrate 0.5g / L, FeCl3·6H2O 4.75g / L, boric acid 0.575g / L, CuSO4·5H2O 0.4g / L, and concentrated sulfuric acid 2.038ml / L.
[0039] 2. Fermentation process Select engineered bacteria from the plate and incubate overnight in LB broth tubes. Then, inoculate the strain into 100 mL of seed culture medium at a 0.5% inoculation rate and incubate at 37°C with shaking until OD reaches 0.5%. 600 Once the value reaches 1.0, it is used as a seed culture medium.
[0040] Fermentation parameters: In a 5L fermenter, first bring the volume to 3L according to the fermentation medium formula and sterilize at 121℃ for 20 minutes; then, inoculate the seed culture medium into the fermenter at a 3% inoculation rate, controlling the temperature at 37℃, pH 7.0, and dissolved oxygen ≥30%. Once the dissolved oxygen rapidly rises to above 60%, the initial feeding rate is 3g / (L*h), and after feeding, the dissolved oxygen is maintained at ≥30% (adjusting the feeding rate based on dissolved oxygen feedback). When the bacterial density reaches OD... 600 =30, start cooling down, set the temperature to 20℃, add 2g / L lactose for induction while continuously feeding and culturing, induce for 5h, start heating to 30℃, continue continuous feeding and culturing, when the OD value drops, centrifuge in a tank (centrifugation conditions: speed 12000 rpm, time 10 min), collect the supernatant for TLC and HPLC detection and subsequent product purification.
[0041] The final product test results are as follows: Figure 5 HPLC analysis showed that the fucose yield of the fermentation product was 65 g / L (currently, the yield of conventional fucose-producing strains is 40-68 g / L). This yield can fully meet the requirements for industrial-scale production and has a significant capacity advantage.
[0042] Furthermore, to verify the rigor of the results, the applicant also analyzed the seed culture medium at different incubation times (3-8 hours) and OD values. 600 Values (0.8~1.2) and different inoculum amounts (1%~5%) and bacterial density (OD) during fermentation. 600 Multiple experiments were conducted with different temperatures (25~40°C), induction time (4~6h), cooling temperature (16~25°C), and heating temperature (28~30°C). The results showed that the yield of fucose, the fermentation product, was between 49~68 g / L.
[0043] Through the above series of investigations, it can be seen that this application has successfully constructed a genetically engineered bacterium that can be used for the fermentation production of fucose. After scaling up the fermentation process, its yield is generally higher than that of existing fucose-producing strains. In industrial production, it can solve the current problems of low yield, high cost and unstable supply.
[0044] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.
[0045] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A genetically engineered bacterium for producing fucose, characterized by comprising a gene encoding a fucose synthase and a gene encoding a fucose transporter. The engineered bacteria are deposited at the China Center for Type Culture Collection (CCTCC) on December 10, 2025, with accession number CCTCC NO: M 20252837.
2. A method for constructing the genetically engineered bacteria of claim 1, characterized by, Includes the following steps: S1. First, using Escherichia coli as the initial strain, knock out the two genes lacZ and lacA that metabolize lactose in the E. coli genome, and replace lacZ with a constitutive promoter sequence; then knock out the gene cluster araB-araA-araD that degrades L-arabinose; next, knock out the wcaJ gene to reduce GDP-Fucose metabolism; finally, knock out the genes fucI and fucK to prevent fucose from being metabolized into L-Fuculose, thus obtaining modified strain I; S2. The genes manA, gmd, wcaG, manB, and manC for GDP-fucose synthesis were cloned sequentially into vector I and vector II. S3. The enzyme genes Bli2fuc, BKHT, zwf, and rcsA were cloned into vectors III and IV in sequence. S4. Vectors I, II, III, and IV are electroporated into modified bacteria I and cultured to obtain the genetically engineered bacteria.
3. The method of claim 2, wherein, The Escherichia coli in step S1 is Escherichia coli W3110.
4. The method according to claim 3, characterized in that, In step S1, the constitutive promoter is the J23119 constitutive promoter.
5. The method according to claim 2, characterized in that, In step S2, vector I is the pBAD-hisA vector, and vector II is the pRB1k vector.
6. The method according to claim 2, characterized in that, In step S3, vector III is the pBAD-hisA vector, and vector IV is the pRB1k vector.
7. The method according to claim 2, characterized in that, The culture conditions in step S4 are as follows: Culture medium composition: LB medium + 20 g / L glycerol; Culture conditions: Incubate at 37℃ with shaking for 3-8 hours.
8. The method according to claim 2, characterized in that, In the construction method described above, gene knockout is performed using CRISPR / Cas gene knockout technology.
9. The application of the genetically engineered bacteria of claim 1 in the fermentation preparation of fucose.