Compositions containing hydrogels, methods of preparation and uses thereof

Abstract

The invention provides a hydrogel-containing composition, a preparation method and application thereof, the hydrogel-containing composition comprises a plurality of hydrogel with non-uniform sizes, the average diameter of the hydrogel is 45-225 [mu] m, the hydrogel comprises an inner core gel material and a shell layer, a biological material is embedded in the inner core gel material, and the shell layer is coated with the biological material. The hydrogel can be used for simultaneous sequencing of mtDNA, chromatin openness and transcriptome, is convenient for reagent exchange of multi-step biochemical reactions, provides a protective package for cells, expands the boundary of cell membranes, is helpful for experimental operation, and prevents cell loss.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a combination containing a hydrogel, a preparation method thereof, and its use. Background Technology

[0002] Mitochondria are often referred to as the "powerhouse" of the cell, producing adenosine triphosphate (ATP) through oxidative phosphorylation, the primary energy source in eukaryotes. Furthermore, mitochondria serve as hubs for various biological processes, including calcium signaling, iron homeostasis, steroid synthesis, heme biosynthesis, reactive oxygen species (ROS) production, and programmed cell death. Mitochondria are the only organelles that possess their own genetic material, mtDNA, which exists in multiple copies. Compared to the nuclear genome, mtDNA exhibits a significantly higher mutation rate, approximately 10-100 times higher, due to the lack of protective structures such as the nuclear membrane and histones. Moreover, mtDNA lacks similar repair mechanisms compared to those found in the nuclear genome, and given the uneven distribution of mutations during cell division, it inevitably accumulates within the cell. Therefore, mtDNA mutations are considered a key factor in mitochondrial dysfunction, affecting various diseases, including neurodegenerative diseases, cancer, and autoimmune diseases.

[0003] Manipulating the mitochondrial genome is crucial for studying and addressing mitochondrial diseases. Multiple studies have demonstrated that various genome editing technologies, such as mitoTALEN and mitochondrial base editing, can effectively eliminate or correct mutated mtDNA, restoring mitochondrial function in disease models. However, despite advances in mtDNA editing tools, the results lack comprehensive characterization due to limitations in current analytical methods.

[0004] Generating successful mitochondrial gene-edited cell lines is a time-consuming and tedious process. After mitochondrial gene editing, the edited cells need to be isolated into individual clones using single-cell selection methods such as flow cytometry. Subsequently, they require careful culturing for a period of time before genotyping can be performed. Traditional genotyping methods involve Sanger sequencing (Sanger-seq), which, while simple and intuitive, produces semi-quantitative results and lacks precision in reflecting specific editing efficiencies. Furthermore, because single-clone cells grow slowly, sufficient cell growth time is required for the extraction of genomic DNA needed for the PCR amplification step in Sanger-seq, making the entire process time-consuming and unable to simultaneously provide phenotypic information about the edited cells. Compared to Sanger-seq, next-generation sequencing (NGS) offers higher throughput, resolution, cost-effectiveness, speed, and sensitivity in detection. Therefore, for the challenging task of obtaining mitochondrial-edited cells, an NGS-based sequencing platform, requiring very few samples and capable of simultaneously assessing mitochondrial gene editing efficiency and post-editing molecular phenotypes, would be the optimal research tool.

[0005] With increasing interest in mtDNA manipulation, such as mtDNA deletion and mtDNA base transitions, researchers are increasingly keen to develop techniques that can simultaneously detect editing efficiency and post-editing phenotypes. mtDNA represents the genetic coding information of mitochondria, chromatin openness represents the structural basis of transcription initiation, and the transcriptome represents the functional phenotype of a biological system. Currently, simultaneously sequencing mtDNA, chromatin openness, and the transcriptome faces significant challenges. There is a lack of comprehensive multi-omics technologies, and existing multi-omics experimental procedures are complex and challenging. Summary of the Invention

[0006] To address the technical problems existing in the prior art, this application provides a combination containing hydrogel, a preparation method therein, and its uses. The hydrogel can effectively retain multi-omics information. Furthermore, encapsulating biomaterials in a hydrogel allows for easy observation of the hydrogel, facilitating experimental operations and reducing cell loss.

[0007] The specific technical solution of this application is as follows:

[0008] 1. A combination containing hydrogels comprising a plurality of hydrogels of varying sizes, the hydrogels having an average diameter of 45-225 μm, the hydrogels comprising a core gel material and a shell layer, the core gel material being embedded with biomaterial.

[0009] 2. The combination according to item 1, wherein the biological material is selected from one or more of proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and cells, as well as complexes formed therefrom, preferably cells.

[0010] 3. The combination according to item 1 or 2, wherein the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starch, and glucose; and / or

[0011] The outer shell layer is selected from one or more of polyethylene glycol diacrylate, polypropylene glycol, and ethylene oxide and propylene oxide;

[0012] Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:1.

[0013] 4. The combination according to any one of items 1-3, wherein the hydrogel is prepared by a method comprising the steps of:

[0014] A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil.

[0015] The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

[0016] 5. The combination according to item 4, wherein the eddy current is performed at 1800-2200 rpm, preferably at 1933 rpm.

[0017] 6. The combination according to item 5, wherein the eddy current oscillates horizontally for 7-15 seconds and vertically for 1-3 minutes.

[0018] 7. A method for preparing a composition containing a hydrogel, comprising:

[0019] A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil.

[0020] The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

[0021] 8. The method according to item 7, wherein the eddy current is performed at 1800-2200 rpm, preferably at 1933 rpm.

[0022] 9. The method according to item 8, wherein the eddy current oscillates horizontally for 7-15 seconds and vertically for 1-3 minutes.

[0023] 10. The method according to any one of claims 7-9, wherein the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starch, and glucose; and / or

[0024] The outer shell layer is selected from one or more of polyethylene glycol diacrylate, polypropylene glycol, and ethylene oxide and propylene oxide;

[0025] Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:1.

[0026] 11. The method according to any one of items 7-10, wherein the biological material is selected from one or more of proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and cells, as well as complexes formed therefrom, preferably cells.

[0027] 12. The method according to any one of claims 7-11, wherein the combination comprises a plurality of hydrogels of varying sizes, the hydrogels having an average diameter of 45-225 μm, the hydrogels comprising a core gel material and a shell layer, the core gel material being embedded with biomaterial.

[0028] 13. Use of the combination of any one of items 1-6 or the combination prepared by any one of items 7-12 in the preparation of biological samples.

[0029] 14. The use of any combination of items 1-6 or the combination prepared by any method of items 7-12 in high-throughput tri-omics library construction.

[0030] 15. Use of the combination of any one of items 1-6 or the combination prepared by any one of items 7-12 in mitochondrial gene editing.

[0031] 16. The use of any combination of items 1-6 or any combination prepared by any method of items 7-12 in the molecular phenotypic evaluation after mitochondrial gene editing.

[0032] The effects of the invention

[0033] The hydrogel described in this application can be used for simultaneous sequencing of mtDNA, chromatin open regions, and the transcriptome. The hydrogel (OmicsCam) exhibits an asymmetric distribution of porosity in its outer shell, with different permeability properties in its inner and outer layers. This design allows for control over the permeation of mtDNA, DNA from open chromatin regions, and RNA biomolecules. The OmicsCam facilitates reagent exchange in multi-step biochemical reactions and provides a protective envelope for cells, expanding the cell membrane boundary, aiding experimental manipulation, and preventing cell loss. Attached Figure Description

[0034] Figure 1 This is a flowchart of the preparation of the hydrogel (OmicsCam).

[0035] Figure 2 This is a schematic diagram of the hydrogels obtained by using a horizontal vortex for 10 seconds and a vertical vortex for 1 minute, 2 minutes and 3 minutes.

[0036] Figure 3 This is a flowchart of the preparation of hydrogels and the preparation of tri-omics libraries using hydrogels.

[0037] Figures 4A to 4F This is a schematic diagram illustrating the preparation of hydrogels and the execution of tri-omics analysis, in which... Figure 4A This is a schematic diagram of cells encapsulated in a hydrogel. Figure 4B This is a schematic diagram of cells in a hydrogel as observed under a microscope. Figure 4C This analysis is based on the average mitochondrial DNA coverage, chromatin open fragment retention rate score, and gene number of different numbers of cells obtained from hydrogels. Figure 4D This is a schematic diagram illustrating the analysis of the average mitochondrial DNA coverage of different numbers of cells based on hydrogels. Figure 4E This is a schematic diagram of TSS enrichment analysis based on hydrogels for different numbers of cells. Figure 4F This is a schematic diagram of the distribution of readings of different numbers of cells in the genome based on hydrogel.

[0038] Figures 5A to 5H This is a schematic diagram illustrating the preparation of hydrogels containing magnetic beads and the subsequent omics analysis. Figure 5A This is a schematic diagram of the preparation of hydrogels containing magnetic beads. Figure 5B This is a schematic diagram of TSS enrichment analysis using a hydrogel containing magnetic beads. Figure 5C It is a comparison of the number of genes under two segregation conditions. Figure 5D This is a schematic diagram of the intersection analysis between mtDNA SNPs and publicly available SNPs under two isolation conditions. Figure 5E This is a schematic diagram illustrating the separation of hydrogels containing magnetic beads using a magnetic rack. Figure 5FThis is a schematic diagram of the distribution of genome region readouts using a hydrogel containing magnetic beads. Figure 5G A schematic diagram comparing mtDNA SNPs identified using hydrogels under two separation conditions with publicly available SNP data. Figure 5H This is a schematic diagram of mtDNA coverage analysis using a hydrogel containing magnetic beads.

[0039] Figures 6A to 6E This is a schematic diagram illustrating the efficiency and off-target effects of hydrogel-based mitochondrial gene editing. Figure 6A It is the genotype of the gene-edited cell line. Figure 6B This is a schematic diagram illustrating gene editing efficiency detected using hydrogels. Figure 6C The mitochondrial DNA mutation load in the edited and unedited groups was detected using hydrogel analysis. Figure 6D This is an intersection analysis of mitochondrial DNA mutation load in the edited and unedited groups, detected using hydrogel analysis. Figure 6E This is a Sanger sequencing analysis using hydrogel detection of potential non-target sites.

[0040] Figures 7A to 7D This is a schematic diagram illustrating the quality control analysis of ATAC-seq data generated using hydrogels. Figure 7A This is an enrichment analysis of TSS in three replicate samples from the edited and unedited groups generated using hydrogels. Figure 7B This is a diagram illustrating the percentage of edited and unedited fragments generated using hydrogel. Figure 7C This is a schematic diagram showing the distribution of difference peaks generated using hydrogels on various chromosomes. Figure 7D This is a schematic diagram of the differential peak annotation generated using hydrogel.

[0041] Figures 8A to 8B This is a schematic diagram illustrating the quality control analysis of RNA-seq data generated using hydrogels. Figure 8A This is a schematic diagram illustrating the proportion of reads from different genomic regions in three replicate samples generated using hydrogels, comparing the edited and unedited groups. Figure 8B This is a schematic diagram of the principal components of differentially expressed genes generated using hydrogels.

[0042] Figures 9A to 9L This is a schematic diagram of the molecular phenotype analysis of the mitochondrial gene editor using hydrogels, in which... Figure 9A This is a schematic diagram illustrating the differential expression peaks between the edited and unedited groups. Figure 9B This is a schematic diagram of the intersection analysis of differentially expressed genes and annotation peaks between the edited and unedited groups, as well as the disease enrichment analysis using the intersection genes. Figure 9C This is a schematic diagram of transcription factor enrichment analysis of differentially expressed peaks. Figure 9D It is an analysis of differentially expressed genes between the edited and unedited groups. Figure 9E It is a gene probe enrichment analysis (GSEA) of differentially expressed genes related to mitochondrial pathway annotation. Figure 9F This is an enrichment map of the complex 1 pathway. Figure 9G It is an enrichment diagram of the oxidative phosphorylation pathway. Figure 9H This involves biological process analysis of the top 5 enriched transcription factors associated with differential expression peaks. Figure 9I It measures the intact cellular oxygen consumption rate (OCR) of cells in the edited and unedited groups. Figure 9J It is an analysis of basic breathing. Figure 9K It is an analysis of maximum respiration. Figure 9L It is an analysis of ATP production. Detailed Implementation

[0043] The present application will now be described in detail with reference to the described embodiments. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and will fully convey the scope of the present application to those skilled in the art.

[0044] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in function. The terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to." The following descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.

[0045] This application provides a combination containing hydrogels comprising several hydrogels of varying sizes, the hydrogels having an average diameter of 45-225 μm, the hydrogels including a core gel material and a shell layer, the core gel material being embedded with biomaterials.

[0046] In this application, the core gel material and the outer shell layer are porous structures. This application does not impose any restrictions on the core gel material and the outer shell layer, as long as the function is achieved. For example, the pore size of the core gel can be 2-5 μm, and the pore size of the outer shell layer can be 24-86 nm.

[0047] For example, the pore size of the core gel material can be 2μm, 2.1μm, 2.2μm, 2.3μm, 2.4μm, 2.5μm, 2.6μm, 2.7μm, 2.8μm, 2.9μm, 3μm, 3.1μm, 3.2μm, 3.3μm, 3.4μm, 3.5μm, 3.6μm, 3.7μm, 3.8μm, 3.9μm, 4μm, 4.1μm, 4.2μm, 4.3μm, 4.4μm, 4.5μm, 4.6μm, 4.7μm, 4.8μm, 5μm, etc.;

[0048] The aperture of the outer shell layer can be 24nm, 25nm, 26nm, 27nm, 28nm, 29nm, 30nm, 31nm, 32nm, 33nm, 34nm, 35nm, 3 6nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm , 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61n m, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74 nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, etc.

[0049] In this application, no restrictions are placed on the methods for determining the pore size of the core gel material and the pore size of the outer shell layer. Those skilled in the art can use conventional methods in the field based on actual needs, such as observing the pore size of the generated hydrogel using a bright-field microscope or a cryo-scanning electron microscope.

[0050] In this application, the pore size of the outer shell layer is smaller than the average size of the biomaterial.

[0051] In this application, the average size of the biological material refers to the average diameter of the biological material.

[0052] In this application, no limitation is placed on the thickness of the outer shell layer, as long as the resulting hydrogel can achieve the functions of this application. For example, the thickness of the outer shell layer can be 1-2 μm, such as 1 μm, 1.1 μm, 1.2 μm, 1.3 μm, 1.4 μm, 1.5 μm, 1.6 μm, 1.7 μm, 1.8 μm, 1.9 μm, 2.0 μm, etc. In this application, no limitation is placed on the method for measuring the thickness of the outer shell layer; those skilled in the art can perform the measurement based on conventional methods in the field.

[0053] In this application, the combination containing hydrogels refers to a combination of several hydrogels of different sizes prepared by the methods mentioned below.

[0054] The average diameter of the hydrogel can be 45μm, 50μm, 60μm, 70μm, 80μm, 90μm, 100μm, 110μm, 120μm, 130μm, 140μm, 150μm, 160μm, 170μm, 180μm, 190μm, 200μm, 210μm, 220μm, 225μm, etc.

[0055] In this application, no restrictions are placed on the method for determining the diameter of the hydrogel. Those skilled in the art can make conventional choices as needed. For example, the average diameter of the hydrogel can be measured by placing the hydrogel on a glass slide and performing imaging analysis under a microscope, and then using ImagJ software to perform direct statistical analysis of the hydrogel.

[0056] In this application, the hydrogel can be a commonly used hydrogel in the art, except that the core gel material of the hydrogel contains embedded biological material, the outer shell of the hydrogel has a porous structure, and the pore size of the outer shell is smaller than the average size of the biological material, so that the obtained hydrogel can be used for three-omics analysis, namely mtDNA, chromosome reachability and transcriptome analysis.

[0057] In some embodiments, the biomaterial is selected from one or more of proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and cells, as well as complexes formed therefrom, preferably cells. In some embodiments, the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starches, and glucose; and / or

[0058] The outer shell layer is selected from one or more of polyethylene glycol diacrylate (PEGDA), polypropylene glycol, and ethylene oxide and propylene oxide.

[0059] Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:1.

[0060] For example, the mass ratio of the core gel material to the outer shell layer (m 内核凝胶材料 :m 外壳层The possible ratios are 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, etc.

[0061] In some embodiments, the hydrogel is prepared by a method comprising the following steps:

[0062] A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil.

[0063] The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

[0064] In this application, no restrictions are placed on the type of oil. Those skilled in the art can make conventional choices based on their needs. For example, the oil can be FS10 formed in HFE-7500 fluorinated oil or 008-Fluoro Surfactant formed in HFE-7500 fluorinated oil.

[0065] In this application, the oil is used as a surfactant. After forming water-in-oil droplets, ultraviolet crosslinking is performed and the oil is removed to obtain a hydrogel.

[0066] In some embodiments, the eddy currents are generated at 1800-2200 rpm, preferably at 1933 rpm.

[0067] For example, the eddy currents are at 1800rpm, 1850rpm, 1900rpm, 1950rpm, 2000rpm, 2050rpm, 2100rpm, 2150rpm, 2200rpm, etc.

[0068] In some embodiments, the eddy current oscillates horizontally for 7-15 seconds and vertically for 1-3 minutes.

[0069] For example, the eddy current oscillates horizontally for 7s, 8s, 9s, 10s, 11s, 12s, 13s, 14s, 15s, etc.

[0070] The vertical oscillation time was 1 minute, 1.5 minutes, 2 minutes, 2.5 minutes, and 3 minutes.

[0071] In this application, no restrictions are placed on the equipment used for eddy centrifugation. Those skilled in the art can make conventional selections based on their needs, as long as it can form hydrogels of varying sizes.

[0072] The hydrogel combination described in this application contains hydrogels of varying sizes, which can be used for micro-scale cellular multi-omics analysis.

[0073] In this application, "micro-cells" refers to cells with a cell count of less than 100,000.

[0074] This application provides a method for preparing a combination containing a hydrogel, comprising:

[0075] A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil.

[0076] The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

[0077] The method described in this application uses eddy current centrifugation to prepare hydrogels, resulting in hydrogels of varying diameters, which can then be used for micro-cell multi-omics analysis.

[0078] In some embodiments, the eddy currents are generated at 1800-2200 rpm, preferably at 1933 rpm. In some embodiments, the eddy currents oscillate horizontally for 7-15 seconds and vertically for 1-3 minutes.

[0079] For example, the eddy current is at 1800rpm, 1850rpm, 1900rpm, 1950rpm, 2000rpm, 2050rpm, 2100rpm, 2150rpm, 2200rpm, etc.

[0080] The eddy current oscillates horizontally for 7s, 8s, 9s, 10s, 11s, 12s, 13s, 14s, 15s, etc.

[0081] The vertical oscillation time was 1 minute, 1.5 minutes, 2 minutes, 2.5 minutes, and 3 minutes.

[0082] In some embodiments, the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starch, and glucose; and / or

[0083] The outer shell layer is selected from one or more of polyethylene glycol diacrylate, polypropylene glycol, and ethylene oxide and propylene oxide;

[0084] Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:1. In some embodiments, the biomaterial is selected from proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and one or more of cells, as well as complexes formed therefrom, preferably cells.

[0085] The mass ratio of the core gel material to the outer shell layer (m 内核凝胶材料 :m 外壳层 The possible ratios are 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, etc.

[0086] In some embodiments, the combination comprises several hydrogels of varying sizes, the hydrogels having an average diameter of 45-225 μm, the hydrogels including a core gel material and a shell layer, the core gel material being embedded with biomaterials.

[0087] The average diameter of the hydrogel can be 45μm, 50μm, 60μm, 70μm, 80μm, 90μm, 100μm, 110μm, 120μm, 130μm, 140μm, 150μm, 160μm, 170μm, 180μm, 190μm, 200μm, 210μm, 220μm, 225μm, etc.

[0088] This application provides the use of any combination described above or any combination prepared by any of the methods described above in the preparation of biological samples.

[0089] This application also provides the use of the combination described in any of the above claims or the combination prepared by the method described in any of the above claims in high-throughput tri-omics library construction.

[0090] This application further provides the use of any of the combinations described above or any of the combinations prepared by the methods described above in mitochondrial gene editing.

[0091] This application further provides the use of any of the combinations described above or any of the combinations prepared by the methods described above in the molecular phenotypic evaluation after mitochondrial gene editing.

[0092] Example

[0093] This application provides a general and / or specific description of the materials and experimental methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products. For the culture of the Zhonghua No. 1 M8 cell line, the procedure is as follows:

[0094] The Zhonghua No. 1 M8 cell line was cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37°C with 5% CO2. Edited human 293FT cells were cultured in DMEM medium containing 20% ​​fetal bovine serum under the same conditions. Before the experiment, cells were collected, washed once with 1×PBS, and counted using Calcein staining.

[0095] The construction of the mitochondrial gene-editing cell line was completed by a team led by Professor Shen Bin of Nanjing Medical University, who generously provided it for use in this application. The editing process mainly employed the TALE-DdCBE single-base editor, and the key steps involved were flow cytometry-based single-cell sorting, monoclonal culture, and single-cell genotyping, all of which were performed using conventional methods in the field.

[0096] The Sanger sequencing method is as follows:

[0097] Genomic DNA of the cell samples to be tested was obtained using PureLink. TM Genomic DNA was extracted using a ThermoFisher kit (cat.no.K182001). Subsequently, the following primers were used:

[0098] Forward primer for off-target site 1 (non-target editing site): ACAACATATTTTGTCACCAAGA SEQ ID NO:5;

[0099] (Non-target editing site) Reverse primer for off-target site 1: CTGGGACTCAGAAGTGAAAG SEQ ID NO:6;

[0100] Forward primer for off-target site 2 (non-target editing site): ACCAAATCAACAACAACCTATT SEQ ID NO:7;

[0101] (Non-target editing site) Reverse primer for off-target site 2: GCAGATGGAGCTTGTTATAATT SEQ ID NO: 8;

[0102] The target DNA fragment was amplified by PCR. The amplified DNA fragment was then sent to Sangon Biotech for Sanger sequencing.

[0103] The data analysis methods are as follows:

[0104] After filtering low-quality reads and removing adapters using trim_galore, the raw data were sorted using the samtools sort command. mtDNA sequencing depth was assessed using samtools depth, and mtDNA mutation analysis was performed using the MitoMutCall package

[94] . Chromatin accessibility information was analyzed using MACS2 via peak calling. Differential expression peak analysis was performed using Diffbind. Transcriptome analysis involved aligning the data with a reference transcriptome using STAR, followed by differential expression analysis using DEseq2. Statistical analysis and plotting were performed using R (version 4.3.1). Basic R plotting and ggplot2 were used to create graphs.

[0105] Experimental Methods of XF-96 Extracellular Flow Analyzer

[0106] The intact cellular oxygen consumption (OCR) of unedited and edited cells was assessed using a Seahorse XF-96 extracellular flow analyzer (Agilent Technologies) in accordance with conventional methods in the art, such as those described below.

[0107] 1. Cell Preparation: First, prepare an appropriate cell volume and pretreat the cells. Use a 96-well XF cell culture plate, whose well bottom area is 40% of that of a standard 96-well cell culture plate. Seed each well with 80 μl of cell suspension. Seed the appropriate cell volume and replace with the assay medium.

[0108] 2. Drug preparation: Oligomycin, FCCP, and rotenone / antimycin were added to drug addition chambers A, B, and C of each well in the probe plate, respectively. These drugs are used to inhibit different mitochondrial functions, thereby allowing observation of changes in cellular oxygen consumption under different conditions.

[0109] 3. Instrument Setup: An Agilent Seahorse XFe96 analyzer was used, which measures the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of live cells in 96-well plates. OCR and ECAR are key indicators of mitochondrial respiration, glycolysis, and ATP production rates.

[0110] 4. Data Analysis: After the experiment, data screening, standardization correction, and other indicator overviews are required. This includes checking the accuracy of the experiment, standardizing the data, and reviewing other relevant indicators to comprehensively analyze the cell's energy metabolism.

[0111] The results came from three independent experiments, each of which included four replicates of unedited and edited cells.

[0112] In this application, the TALE protein in the TALE-DdCBE single-base editor is a sequence-programmable transcription factor composed of a 34-amino acid repeat sequence. Each repeat sequence forms two helices connected by a short loop. The loop contains repeat-variable di-residues (RVDs) that can specifically recognize DNA bases. DdCBE is a novel gene-editing tool capable of targeted C·G→T·A base editing in the mitochondrial genome.

[0113] TALE-DdCBE refers to a protein complex formed by TALE and DdCBE. TALE targets specific bases on mitochondrial DNA, pulls DdCBE to the specific base, and then DdCBE edits that base.

[0114] The materials described in this application are obtained based on the optimization of domestic application CN2023115270892.

[0115] Example 1

[0116] (1) Preparation of hydrogels

[0117] The Zhonghua No. 1 M8 cell line was mixed with 3.53% (w / v) PEGDA solution, 4.58% (w / v) Dextran solution, and oil (2% (w / v) FS10 in HFE-7500 fluorinated oil or 5% (w / v) 008-Fluoro Surfactan in HFE-7500 fluorinated oil, 70 μL) in a 500 μL centrifuge tube and vortexed. The vortexing was performed at 1933 rpm for 10 seconds horizontally and 1, 2, and 3 minutes vertically, respectively. Rapid polymerization was induced by 365 nm light for 2 minutes to obtain a two-phase system of ATPS droplets and an oil phase. Demulsification was then performed to obtain the hydrogel OmicsCams. The preparation process is as follows: Figure 1 As shown, the obtained hydrogel OmicsCams were photographed using a ZOE fluorescence micrograph, and a schematic diagram is shown below. Figure 2 As shown in the figure. The average diameter of the OmicsCams obtained by vortexing in the vertical direction for 2 minutes is 109 μm.

[0118] from Figure 2It can be seen that the size of the hydrogels obtained varies depending on the duration of the vertical vortex. The hydrogels produced after 1 minute of vertical vortexing are relatively large (greater than 100 μm), while those produced after 2 minutes and 3 minutes are relatively small and similar in size. However, the 2-minute time is shorter, so 2 minutes was chosen for subsequent experiments.

[0119] (2) Lysis of OmicsCams containing cells

[0120] OmicsCam cells were immersed in 100 μL of cell lysis buffer containing 10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% (vol / vol) ethyl phenyl polyethylene glycol (NP-40), and 1% (vol / vol) bovine serum albumin (BSA) and incubated on ice for 5 minutes. Subsequently, 900 μL of wash buffer containing 10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, and 1% (vol / vol) BSA was added. The supernatant was removed by centrifugation at 1000 g, completing the mild lysis of the cells.

[0121] (3) Tn5 assembly and cutting:

[0122] To assemble the Tn5 naked transposon with the insert sequence, transposon annealing was first performed. Adapter A (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG SEQ ID NO:1) and adapter B (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG SEQ ID NO:2) were mixed with pMENTS (Phos / CTGTCTCTTATACACATCT SEQ ID NO:3, where Phos in SEQ ID NO:3 refers to a base with a phosphate group at the 5' end) at a final concentration of 30 μM. The temperature was cycled at 95 °C for 5 minutes, then slowly cooled to 14 °C at a rate of -0.1 °C / s to anneal the transposons. Subsequently, each annealed transposon was diluted to 5 μM with 100 μL of EB buffer (1014609, Qiagen). The diluted transposons were mixed with 6 μg of naked Tn5 enzyme (ABclonal, RM21303), vortexed, and incubated at room temperature for 30 minutes to obtain transposons A and B. Finally, transposons A and B were mixed in a 1:1 ratio to form Tn5 carrying the nextera S5 / S7 sequence, or transposons B and B were mixed in a 1:1 ratio to form Tn5 carrying the Nextera S7 / S7 sequence. The resulting mixtures were stored at -20°C. For Tn5 cleavage, after cell lysis, 25 μL of the OmicsCams from step (2) was transferred to a solution containing 50 μL of 1.25 mM MgCl2, 0.2 μg / μL Tn5 transposons, and 1× cleavage buffer (ABclonal, RM21303) to obtain the mixture.The mixture was incubated at 30°C with continuous shaking at 600 rpm for 30 minutes to perform the first step of the Tn5 reaction (Tn5 carrying the nextra S5 / S7 sequence), followed by reverse transcription. OmicsCams were placed in 100 μL of a solution containing 2 μM TruSeqR1 primers (CAGACGTGTGCTCTTCCGATCTN10T30VN, where V is one of A, G, or C, N is one of A, T, C, or G, N10 is 10 consecutive Ns, and T30 is 30 consecutive Ts, SEQ ID NO:4), 0.5 mM dNTPs, 10 U / μL Maxima H minus Reverse Transcriptase (ThermoFisher, cat.no.EP0753), 1.2 U / μL RiboLock RNase inhibitor (ThermoFisher, cat.no.EO0382), and 0.4 U / μL... SUPERaseIn RNase inhibitor (ThermoFisher, cat.no.AM2694), 0.8 U / μL RNaseOUT RNase inhibitor (ThermoFisher, cat.no.10777019), 1X Maxima H minus RT buffer and 12% (w / v) PEG8000 (Sigma, cat.no.89510-250G-F) were incubated at 50°C for 30 minutes for reverse transcription. Then, the second step Tn5 reaction (Tn5 carrying the nextra S7 / S7 sequence) was performed using Eppendorf ThermoMixer R, with continuous shaking at 600 rpm at 37°C for 30 minutes. The operation procedures of steps (1) to (3) are as follows. Figure 3 As shown.

[0123] Example 2

[0124] Hydrogels were prepared using the same method as in Example 1, employing the Zhonghua No. 1 M8 cell line. The cells were vortexed vertically for 2 minutes and horizontally for 10 seconds. Analysis was performed using conventional tri-omics methods in the art, such as... Figures 4A to 4F As shown.

[0125] from Figures 4C to 4F It can be seen that mtDNA sequencing of different cell numbers showed good homogeneity. Figure 4D Coverage gradually increased with increasing cell infusion volume, reaching an average coverage of 22,673.44 × ( ) when 25,000 cells were infused. Figure 4C and Figure 4DThis is sufficient for mtDNA mutation analysis. TSS (transcription start site) enrichment analysis at different cell numbers ( Figure 4E ) and FRiP (peak-to-read ratio) analysis ( Figure 4C The results showed that 25,000 input cells exhibited characteristics of a standard-quality open chromatin library. Relative to transcriptomic information, libraries generated from different cell numbers were theoretically 3'-end transcriptomic libraries, with exon regions comprising over 60% ( Figure 4F In all cases, the number of identified genes exceeded 10,000, with 16,646 genes identified when 25,000 cells were input. Figure 4C In summary, OmicsCams enables the construction of tri-omics libraries from tiny, invisible cells with a minimum input of 25,000 cells, providing high-quality tri-omics information.

[0126] Example 3

[0127] OmicsCam was prepared according to the method in Example 1, except that magnetic beads were added, and triple recombinant sequencing—mtDNA, chromatin accessibility, and transcriptome analysis—was performed on 25,000 Zhonghua 1 M8 cells. The results were obtained by replacing the reaction solution in a magnetic separation experiment. Figures 5A to 5H As shown.

[0128] From such Figures 5A to 5H As shown, by encapsulating magnetic beads in OmicsCam ( Figure 5A This achieves a powerful magnetic adsorption effect. Figure 5E This demonstrates the applicability of OmicsCams in constructing automated reaction systems and observes enrichment of nuclear genomic DNA sequencing reads in the TSS region. Figure 5B ), and achieved an average mtDNA sequencing coverage of 21822.8 times ( ). Figure 5H The generated transcriptome data includes a standard 3' end transcriptome library (). Figure 5F ), identified 18,891 genes ( Figure 5C These findings are consistent with results obtained using conventional centrifugation methods. Figure 5C , 5D Furthermore, by comparing mutation analysis of mtDNA data obtained through magnetic separation and centrifugation, and combining this with publicly available whole-genome sequencing data from the Zhonghua No. 1 M8 cell line, 39 mtDNA SNP mutation sites were identified from the three data sources. Figure 5D , 5G In summary, OmicsCams enables the construction of microscale cell omics libraries using traditional centrifugation and magnetic separation methods, providing a multifunctional container for integrated automated reaction systems.

[0129] Example 4: Application of OmicsCams in Mitochondrial Gene Editing

[0130] Studies have shown that mitochondrial base editors (DdCBEs) are promising tools for precisely modifying mammalian mtDNA, offering potential for establishing mitochondrial disease models (cell or mouse models of mitochondrial diseases), correcting harmful mutations, and advancing our understanding of mitochondrial biology. Therefore, to demonstrate the application of OmicsCam in mitochondrial gene editing research, we employed conventional methods in the field to target and edit positions 11163 and 11166 of the ND4 gene in the mitochondrial genome (mitochondrial DNA) of HEK293FT cells using the TALE-DdCBE single-base editor. Specifically, we modified positions 11163 and 11166 of the mitochondrial ND4 gene in HEK293FT cells, resulting in a C-to-A conversion in the non-coding strand and a G-to-A conversion in the coding strand. This genetic modification led to a change at amino acid position 136, replacing tryptophan with a premature TAA stop codon. Therefore, this strategy induced premature termination of ND4 protein translation, effectively reducing the overall physiological function of ND4. Based on this method, OmicsCams were prepared using the same method as in Example 2, and then lysed, Tn5 was assembled and cleaved. Single cells were then sorted by flow cytometry and placed in 96-well plates with 200 μL of cell culture medium (DMEM medium containing 10% fetal bovine serum) added. The cells were cultured for 2 weeks, and genomic DNA was extracted and Sanger sequencing analysis was performed after 2 weeks. The successfully edited cells were the final edited cells, with an editing efficiency of over 90%. Based on this, an ND4 gene-editing cell line was established, where the editing efficiency was obtained by analyzing the Sanger sequencing data using TIDE software.

[0131] After filtering low-quality reads and removing adapters using `trim_galore`, the raw data was sorted using the `samtools sort` command. The mtDNA sequencing depth was assessed using `samtools depth`, and mtDNA mutation analysis was performed using the MitoMutCall software package. This involved simultaneous omics analysis of mtDNA, chromatin accessibility, and transcriptome using OmicsCam. The results are as follows: Figures 6A to 6C As shown.

[0132] from Figures 6A to 6C It can be seen that the editing efficiency at site 11163 of mtDNA is 99%, and at site 11166 it is 96%. Figure 6B ), and Sanger sequencing data ( Figure 6AConsistent with OmicsCams data, and exhibiting higher quantitative accuracy based on NGS data generated by OmicsCams. The Shannon index was further used to assess the overall mtDNA mutation load ( Figure 6C The study observed a higher mutation load in the edited group than in the unedited group (WT), further validating the practicality of OmicsCams for mtDNA mutation detection and analysis.

[0133] Another potential issue is the off-target effects of mitochondrial gene editors, which could occur at the nuclear genome level or at non-target editing sites within mtDNA. Given OmicsCam's multi-omics detection capabilities, including mtDNA sequence information and chromatin accessibility sequence information, mtDNA sequence information can be used for non-target site analysis at the mtDNA level, while chromatin accessibility sequence information can be used for preliminary analysis of non-target effects within the nuclear genome. Therefore, mtDNA mutations were analyzed, such as... Figures 6D to 6E As shown.

[0134] Analysis of mtDNA mutations showed that, compared with the unedited group, the edited group had mutations at two non-target editing sites (mtDNA locations 4429 and 11245). Figure 6D Sanger sequencing confirmed the presence of these two potential non-target sites, and the sequence mutations were consistent with expectations: a C-to-A transition on the non-coding strand at mtDNA position 11245 and a G-to-A transition on the coding strand at mtDNA position 4429. Figure 6E Analysis of chromatin accessibility sequence information using GATK4 and Mutect2 revealed no specific mutation sites between the edited and unedited groups. In conclusion, OmicsCams has proven to be a valuable tool for mitochondrial gene editing research, enabling precise measurement of mitochondrial gene editing efficiency and off-target site analysis.

[0135] Example 5: OmicsCam enables simultaneous evaluation of mitochondrial editing efficiency and post-editing molecular phenotype.

[0136] To demonstrate that OmicsCam can be used not only to assess gene editing efficiency but also to assess the edited molecular phenotype, the raw data were sorted using the "samtools sort" command after filtering low-quality reads and removing adapters using trim_galore. mtDNA sequencing depth was assessed using "samtools depth," and mtDNA mutation analysis was performed using the MitoMutCall package

[94] . Chromatin accessibility information was analyzed using peak calling with MACS2. Differential expression peak analysis was performed using Diffbind. Transcriptome analysis involved comparing the data with a reference transcriptome using STAR, followed by differential expression analysis using DEseq2. Statistical analysis and plotting were performed using R (version 4.3.1). Basic R plotting and ggplot2 plotting were used to analyze transcriptome and chromatin accessibility data for both edited and unedited groups, as shown below. Figures 7A to 7D , Figures 8A to 8B as well as Figures 9A to 9L As shown.

[0137] The results showed that the obtained data exhibited the standard characteristics of a quality-controlled transcriptome and chromatin accessibility library. Figures 7A-7D , Figures 8A-8B Volcano plot analysis of transcriptome data showed that, compared with the unedited group, the edited group had 371 upregulated genes and 316 downregulated genes (p≤0.01, fold change≥2 or fold change≤0.5). Figure 9D Similarly, volcano plot analysis of different chromatin accessibility showed that the edited group had 128 increased accessibility peaks corresponding to 123 genes compared to the unedited group, and 4472 decreased accessibility peaks corresponding to 3236 genes (p≤0.01, fold change≥2 or fold change≤0.5). Figure 9A These findings highlight the multifaceted utility of OmicsCams in elucidating the molecular consequences of mitochondrial editing.

[0138] Intersection analysis of genes corresponding to different expression peaks and different chromatin accessibility peaks revealed that 132 genes underwent coordinated changes at both the transcriptomic and chromatin accessibility levels after editing. Figure 9B Based on these 132 genes, enrichment analysis using the DisGeNET database identified the top five pathways associated with diseases such as Alzheimer's disease, hormone-resistant prostate cancer, acute megakaryocytic leukemia, uterine sarcoma, and carcinomatous lesions. Figure 9BAll of these pathways are associated with mitochondrial dysfunction. These findings highlight the precise measurement of functional phenotypes following mtDNA gene editing by OmicsCam.

[0139] Further gene set enrichment analysis (GSEA) transcriptome data showed inhibition of mitochondrial functional pathways, including complex I and the oxidative phosphorylation pathway (OXPHOS). Figure 9E (9F, 9G). This observation is consistent with our hypothesis that silencing the ND4 gene leads to a decrease in mitochondrial oxidative phosphorylation levels, as ND4 encodes a subunit of complex I. To verify this, the effect of cellular oxygen consumption rate (OCR) in unedited and edited cells was analyzed. The results showed that overall OCR was significantly reduced after ND4 silencing. Furthermore, detailed analysis of OCR data at various time points showed that basal respiration, maximal respiration, and ATP production were all significantly reduced in edited cells (9F, 9G). Figure 9I (9J,9K,9L), thus further validating OmicsCam's accurate measurement of phenotype-genotype relationships.

[0140] Motif analysis of different accessibility peaks identified transcription factors such as NF-Y, SP1, SP5, KLF1, and KLF3. Figure 9C These transcription factors are primarily enriched in biological processes related to histone modification pathways. Figure 9H This is consistent with reports of mitochondrial metabolites serving as substrates for post-translational protein modifications. Based on multi-omics data analysis generated by OmicsCams, we hypothesize that mtDNA editing may affect cell phenotype by influencing histone modifications and nuclear gene expression through aberrant metabolite intermediates.

[0141] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A combination containing hydrogels comprising several hydrogels of varying sizes, the hydrogels having an average diameter of 45-225 μm, the hydrogels including a core gel material and a shell layer, the core gel material being embedded with biomaterial.

2. The combination of claim 1, wherein, The biological material is selected from proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and one or more of them in cells, as well as complexes formed therefrom, preferably cells; Preferably, the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starch, and glucose; and / or The outer shell layer is selected from one or more of polyethylene glycol diacrylate, polypropylene glycol, and ethylene oxide and propylene oxide; Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:

1.

3. The combination according to any one of claims 1-2, wherein the hydrogel is prepared by a method comprising the steps described below: A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil. The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

4. The combination according to claim 3, wherein, The eddy current is generated at 1800-2200 rpm, preferably at 1933 rpm; Preferably, the eddy current oscillates horizontally for 7-15 seconds and vertically for 1-3 minutes.

5. A method for preparing a composition containing a hydrogel, comprising: A mixture is prepared by mixing the core gel material, the material forming the outer shell layer, the biomaterial, and the oil. The mixture is centrifuged by vortexing and induced to solidify, thereby crosslinking the core gel material and the material forming the outer shell layer to embed the biomaterial into the core gel material, and the oil is removed to obtain a combination containing hydrogel.

6. The method according to claim 5, wherein the eddy current is performed at 1800-2200 rpm, preferably at 1933 rpm; Preferably, the eddy current oscillates horizontally for 7-15 seconds and vertically for 1-3 minutes. Preferably, the core gel material is selected from one or more of dextran, polyvinyl alcohol, hydroxypropyl starch, and glucose; and / or The outer shell layer is selected from one or more of polyethylene glycol diacrylate, polypropylene glycol, and ethylene oxide and propylene oxide; Preferably, the mass ratio of the core gel material to the outer shell layer is 2-25:1, more preferably 5-20:1; Preferably, the biological material is selected from one or more of proteins, nucleic acids, sugars, lipids, metabolites, polypeptides, bacteria, viruses, organelles, and cells, as well as complexes formed therefrom, preferably cells; More preferably, the combination comprises several hydrogels of varying sizes, the average diameter of the hydrogels being 45-225 μm, the hydrogels comprising a core gel material and a shell layer, the core gel material being embedded with biomaterials.

7. Use of the combination of any one of claims 1-4 or the combination prepared by the method of any one of claims 5-6 in the preparation of biological samples.

8. Use of the combination of any one of claims 1-4 or the combination prepared by the method of any one of claims 5-6 in high-throughput tri-omics library construction.

9. Use of the combination of any one of claims 1-4 or the combination prepared by the method of any one of claims 5-6 in mitochondrial gene editing.

10. Use of the combination of any one of claims 1-4 or the combination prepared by the method of any one of claims 5-6 in molecular phenotypic evaluation after mitochondrial gene editing.

Images