Sequence combination for detecting tomato leaf miner based on RAA-CRISPR / Cas12a and application

Abstract

The invention relates to the technical field of biological detection, and discloses a sequence combination for detecting tomato leaf miner based on RAA-CRISPR / Cas12a and application of the sequence combination. The invention discloses a sequence combination for detecting tomato leaf miners based on RAA-CRISPR / Cas12a. The sequence combination comprises an RAA specific primer pair and a crRNA sequence for detecting the tomato leaf miners, a kit prepared by utilizing the sequence combination and a detection method for detecting the tomato leaf miners by utilizing the kit. According to the detection method disclosed by the invention, an RAA amplification method and a CRISPR / Cas12a detection method are combined to detect the tomato leaf miner. The method provided by the invention has the characteristics of strong specificity and high sensitivity, can effectively reduce and avoid false positive results generated by RAA amplification, is suitable for the field, is easy to popularize in the basic level, can provide a reliable technical basis for prevention and control of the tomato leaf miner, and plays an important role in early discovery and invasion prevention and control of the tomato leaf miner.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a sequence combination and its application for detecting tomato leafminer based on RAA-CRISPR / Cas12a. Background Technology

[0002] Tomato leafminer ( Tuta absoluta Meyrick, also known as the tomato leafminer, belongs to the order Lepidoptera and the family Gelechiidae. Native to South America, it is one of the most devastating pests of tomatoes. Currently, the identification of the tomato leafminer mainly relies on traditional morphological and molecular biological methods. Morphological identification requires specialized technicians, and the morphological characteristics of larvae and eggs are not obvious, making it difficult to accurately distinguish closely related species and similar species. While molecular biological methods such as conventional PCR and real-time fluorescence PCR can achieve accurate identification, they rely on expensive PCR instruments and quantitative fluorescence instruments, are complex to operate, have long testing cycles, and require specialized laboratory environments, which cannot meet the needs of field testing and rapid quarantine at ports of entry.

[0003] Isothermal amplification techniques (such as RAA, RPA, and LAMP) can achieve rapid nucleic acid amplification under isothermal conditions without the need for complex instruments. However, when used alone, they are prone to nonspecific amplification, aerosol contamination, and false positive results. The CRISPR / Cas12a system has strong specific recognition and nucleic acid cleavage capabilities. When Cas12a forms a binary complex with crRNA to recognize and cleave target double-stranded DNA, it activates its trans-cleavage activity against nonspecific single-stranded DNA (ssDNA). CRISPR / Cas12a is currently widely used in species molecular detection, along with RAA, RPA, and LAMP isothermal amplification techniques.

[0004] With the development of tomato leafminer detection technology and the demand for efficient control, we need to develop a visual detection method that is highly specific, sensitive, easy to operate, and requires no complicated instruments, so as to achieve real-time field identification of tomato leafminers. Summary of the Invention

[0005] To address the problems existing in the prior art, one objective of this invention is to provide a sequence combination for detecting tomato leafminer based on RAA-CRISPR / Cas12a, wherein the sequence combination includes... COI RAA-specific primer pair sequences and crRNA sequences designed for gene therapy; The RAA-specific primer pair sequences are: The sequence of the forward primer RAA-F3 is shown in SEQ ID NO:1: CTTCACGGAACTCAAATTAATTATAGTCCTTC.

[0006] The sequence of the reverse primer RAA-R1 is shown in SEQ ID NO:2: AGGTATTCCGGCTAATCCTAAGAAATGTTGTG.

[0007] The crRNA sequence is shown in SEQ ID NO:3: UAAUUUCUACUAAGUGUAGAGGGGGAUUUAUUCAUUGAUAU. A second objective of this invention is to provide a detection kit for detecting tomato leafminer, the kit comprising, according to... COI RAA-specific primer pair sequence and crRNA sequence designed by the gene. Preferably, the detection kit for detecting tomato leafminer further includes a signal reporter molecule: FAM-TTATT-BHQ1; the 5' end of the signal reporter molecule sequence is labeled with FAM fluorescent marker, and the 3' end is labeled with BHQ-1 marker.

[0008] Preferably, the detection kit for detecting tomato leafminer further includes RAA amplification reagent and CRISPR / Cas detection reagent.

[0009] Preferably, the RAA amplification reagent comprises: RAA lyophilized enzyme, MgOAc, and buffer V.

[0010] Preferably, the CRISPR / Cas12a detection reagent comprises: LbaCas12a(Cpf1) nuclease and 1×NEBuffer r2.1.

[0011] The third objective of this invention is to provide a sequence combination for detecting tomato leafminer based on RAA-CRISPR / Cas12a or a detection kit for detecting tomato leafminer in the detection of tomato leafminer.

[0012] Both the RAA amplification reagent and the CRISPR / Cas12a detection reagent are commercially available standard reagents.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention targets the tomato leafminer and develops a primer set and kit for rapid, visual detection of the tomato leafminer in the field. This kit is based on recombinase polymerase amplification (RAA) technology combined with clustered regularly interspaced short palindromic repeats (CRISPR) and the CRISPR-related protein system—CRISPR / Cas12a. The reaction can be carried out under a constant temperature of 37°C, without the need for complex instruments and equipment. It has high specificity and extremely high detection sensitivity, filling the gap in high-sensitivity rapid detection of the tomato leafminer in the field, and plays an important role in the early detection and invasion control of the tomato leafminer. Attached Figure Description

[0014] Figure 1 The results are for primer screening of recombinase polymerase amplification (RAA).

[0015] Figure 2 Screening for optimal crRNA: (A) Fluorescence results visualized under blue light; (B) Terminal fluorescence signals of different crRNAs from the tomato leafminer.

[0016] Figure 3 Construction of a RAA-CRISPR / Cas12a detection method for tomato leafminer: visualization of fluorescence results under blue light.

[0017] Figure 4 The results of fluorescence sensitivity verification for RAA-CRISPR / Cas12a for the tomato leafminer: (A) Fluorescence results visualized under blue light; (B) Terminal fluorescence signal for sensitivity assessment.

[0018] Figure 5 The results of fluorescence specificity verification for RAA-CRISPR / Cas12a for tomato leafminer: (A) Fluorescence results visualized under blue light; (B) Terminal fluorescence signal for specificity assessment. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] In the embodiments of the present invention, the RAA-specific primers and crRNA used were specially designed by the applicant to achieve specific detection purposes and are innovative contents of the present invention. Unless otherwise specified in the embodiments, the conditions shall be performed in accordance with conventional conditions or the conditions recommended by the manufacturer.

[0021] The HiPure Tissue DNA Mini Kit (D3121-02) used in the following examples is a product of Guangzhou Meiji Biotechnology Co., Ltd.; the RAA nucleic acid amplification kit (B00000A) is a product of Jiangsu Qitian Biotechnology Co., Ltd.; the LbaCas12a (Cpf1) nuclease and 1×NEBuffer r2.1 are products of New England Biolabs; the signal reporter molecule was synthesized by General Biotechnology (Anhui) Co., Ltd.; and the ABI QuantStudio 6 Flex real-time fluorescence quantitative PCR instrument is a product of Thermo Fisher Scientific.

[0022] I. Experimental Materials This study used the tomato leafminer moth as the target species, and collected closely related species, insects with similar damage, and other economically significant insects from the field as control species for specificity verification experiments (see Table 1). All insects used were samples collected in our laboratory, and all tested insect samples were identified and confirmed as species using morphological methods and DNA barcoding molecular identification methods before testing. DNA was extracted from the tested insects using the HiPure Tissue DNA Mini Kit.

[0023] Table 1. Information on insect species collected in the field Example 1 Design of RAA-specific primers and crRNA for tomato leafminer Specific genes targeting the tomato leafminer, mitochondrial cytochrome oxidase I ( COI The gene sequence (sequences were found and downloaded from NCBI (http: / / ncbi.nlm.nih.gov / )) was used to design matching RAA-specific primers and crRNA using CRISPR RGEN Tools and Premier 5.0 software, respectively. The primer design principles included appropriate length (generally 20-30 bp), moderate GC content (40%-60%), and avoidance of primer dimers and non-specific amplification. After design, BLAST comparison was performed using the NCBI database to ensure that the primers had low homology with sequences from other species, thus ensuring their specificity. The RAA-specific primers and crRNA were designed manually. The RAA-specific primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the crRNA was synthesized by Sangon Biotech Co., Ltd. The designed primer sequences are shown in Table 2.

[0024] Table 2. Specific RAA primer sequences and crRNA sequences Example 2 Screening of RAA-specific primers and crRNA for tomato leafminer 1. RAA-specific primer screening, the specific steps are as follows: (1) Using the genomic DNA of the tomato leafminer moth as a template, RAA amplification was performed using a RAA nucleic acid amplification kit. The reaction system and steps were optimized appropriately according to the kit instructions. The established RAA system was used to perform cross-priming verification experiments of RAA-specific primers, and RAA recombinase polymerase amplification was performed to obtain the amplification product.

[0025] The specific ratios are as follows: DNA template: 0.5 μL; buffer V: 6.25 μL; ddH2O: 3.5 μL; RAA-F primer and RAA-R primer: 0.5 μL each (primer concentration is 10 μM); RAA enzyme lyophilized powder; MgOAc (concentration is 280 μmol / L): 1.25 μL.

[0026] (2) After mixing the above system multiple times, place it in a water bath and incubate at 37°C for 20 minutes.

[0027] (3) After the reaction is complete, take out the reaction tube and add 50 μL of Tris saturated phenol-chloroform-isoamyl alcohol mixture to each reaction tube, tighten the tube cap, mix thoroughly using a vortex mixer, centrifuge for 10 min in a handheld centrifuge, and after the solution is separated into layers, take 5 μL of the supernatant as the amplification product and perform agarose gel electrophoresis (gel concentration is 1.5%).

[0028] Electrophoresis results as follows Figure 1 As shown in the figure, M is the DNA 2000 Marker, P is the positive control, and 1 to 9 are the products amplified by F1×R1, F2×R2, F3×R3, F1×R2, F1×R3, F2×R1, F2×R3, F3×R1, and F3×R2, respectively. The electrophoresis results show that the amplification length of each primer set is about 500 bp. Among them, the RAA primer set F3×R1 has a clear and bright band and no non-specific amplification. It is the best primer set combination and will be used for subsequent experiments.

[0029] 2. Screening for the optimal RAA-CRISPR / Cas12a crRNA (1) RAA nucleic acid amplification kit was used to perform RAA amplification reaction. The reaction system and steps were optimized appropriately according to the kit instructions. The specific ratios were as follows: DNA template: 0.5 μL; buffer V: 6.25 μL; ddH2O: 3.5 μL; RAA-F primer and RAA-R primer: 0.5 μL each (primer concentration: 10 μM); RAA enzyme lyophilized powder; MgOAc (concentration: 280 μmol / L): 1.25 μL; Place the prepared RAA system at the bottom of the tube.

[0030] (2) The CRISPR / Cas12a detection system uses LbaCas12a(Cpf1) nuclease and matching reagents. The ratio of each component in the CRISPR / Cas12a system reaction system is as follows: 1×NEBuffer r2.1: 4μL; LbaCas12a(Cpf1) (concentration of 1μM): 4μL; signal reporter molecule (concentration of 5μM): 1μL; crRNA1 or crRNA2 or crRNA3 (concentration of 1μM): 2μL; RNase-free water is added to 40μL; the prepared CRISPR / Cas12a detection system is placed on the tube cap.

[0031] (3) The reaction tube was kept at 37°C for 20 min. After the reaction was completed, the CRISPR / Cas12a detection system on the tube cap was centrifuged to the bottom of the tube and reacted at 37°C for 15 min.

[0032] In step (2), crRNA1, crRNA2, and crRNA3 were used to perform the RAA-CRISPR / Cas12a optimal crRNA screening experiment. After the reaction, the samples were irradiated with a blue light lamp, and the fluorescence values ​​were read using an ABI QuantStudio 6 Flex real-time fluorescence quantitative PCR instrument. The parameters were set as follows: reaction at 37℃ for 2 min, and the terminal fluorescence signal of the FAM channel was collected.

[0033] The results are as follows Figure 2 As shown in the figure, 1 to 10 represent crRNA1, crRNA2, crRNA3, NO-crRNA, crRNA1-NO-FQ-ssDNA, crRNA2-NO-FQ-ssDNA, crRNA3-NO-FQ-ssDNA, crRNA1-NO-DNATarget, crRNA2-NO-DNATarget, and crRNA3-NO-DNATarget, respectively. The results show that both crRNA1 and crRNA2 exhibit strong green fluorescence under blue light, and the fluorescence intensity values ​​are relatively high. Therefore, crRNA2 was selected for subsequent experiments.

[0034] Example 3 The establishment of the RAA-CRISPR / Cas12a detection system method involves the following steps: (1) RAA nucleic acid amplification kit was used to perform RAA amplification reaction. The reaction system and steps were optimized appropriately according to the kit instructions. The specific ratios were as follows: DNA template: 0.5 μL; buffer V: 6.25 μL; ddH2O: 3.5 μL; RAA-F primer and RAA-R primer: 0.5 μL each (primer concentration: 10 μM); RAA enzyme lyophilized powder; MgOAc (concentration: 280 μmol / L): 1.25 μL; Place the prepared RAA system at the bottom of the tube.

[0035] (2) The CRISPR / Cas12a detection system uses LbaCas12a(Cpf1) nuclease and matching reagents. The ratio of each component in the CRISPR / Cas12a system reaction system is as follows: 1×NEBuffer r2.1: 4μL; LbaCas12a(Cpf1) (concentration of 1μM): 4μL; signal reporter molecule (concentration of 5μM): 1μL; crRNA2 (concentration of 1μM): 2μL; RNase-free water is added to 40μL; the prepared CRISPR / Cas12a detection system is placed on the tube cap.

[0036] (3) The reaction tube was kept at 37°C for 20 min. After the reaction was completed, the CRISPR / Cas12a detection system on the tube cap was centrifuged to the bottom of the tube and reacted at 37°C for 15 min.

[0037] After the reaction was completed, the RAA-CRISPR / Cas12a reaction products were read out using a blue light gel imaging system. Positive reactions showed visible green fluorescence. Figure 3 (Left) indicates that the sample being tested is a tomato leafminer; conversely, a negative reaction shows no visible fluorescence. Figure 3 If the result is on the right, it indicates that the sample is not a tomato leafminer. Fluorescence values ​​were read using an ABI QuantStudio 6 Flex real-time quantitative PCR instrument with the parameters set to 37℃ for 2 min and the terminal fluorescence signal of the FAM channel was collected.

[0038] Example 4 Sensitivity verification of the RAA-CRISPR / Cas12a system The DNA of the tomato leafminer was diluted to obtain a concentration of 4.377 × 10⁻⁶. -1 ng / μL, 4.377×10 -2 ng / μL, 4.377×10 -3 ng / μL, 4.377×10 -4ng / μL, 4.377×10 -5 ng / μL, 4.377×10 - 6 A sample of tomato leafminer DNA (ng / μL) was collected, and enzyme-free water was used as the blank control (NC). The sensitivity verification experiment of the RAA-CRISPR / Cas12a system was performed according to the method in Example 3.

[0039] The results are as follows Figure 4 As shown, Figure 4 In A, concentrations 1 through 7 are respectively 4.377 × 10⁻⁶. -1 ng / μL, 4.377×10 -2 ng / μL, 4.377×10 -3 ng / μL, 4.377×10 -4 ng / μL, 4.377×10 -5 ng / μL, 4.377×10 -6 DNA at ng / μL, blank control group (NC), from Figure 4 From B, we can see 4.377 × 10 -1 ng / μL - 4.377 × 10 -5 The fluorescence signal in the DNA experimental group (ng / μL) was significantly higher than that in the blank control group (NC), but 4.377 × 10⁻⁶. -6 There was no significant difference in fluorescence signal between the ng / μL DNA experimental group and the blank control group (NC). P >0.05). Therefore, the limit of detection for this method can reach 4.377 × 10⁻⁵. -5 The concentration of ng / μL demonstrates that this method has good sensitivity.

[0040] Example 5 RAA-CRISPR / Cas12a system specificity verification To test the specificity of the RAA-CRISPR / Cas12a system, insects listed in Table 1 were used as non-target species controls, and the tomato leafminer was used as the target species. Sterile enzyme-free water was used as the blank control group (NC), and the specificity verification experiment of the RAA-CRISPR / Cas12a system was carried out according to the method in Example 3.

[0041] The results are as follows Figure 5As shown in Figure A, 1-23 represent the following insect species: tomato leafminer, Indian millet moth, tomato leafminer, diamondback moth, cotton bollworm, potato tuber moth, black-bellied fruit fly, fall armyworm, beet armyworm, tobacco powder borer, narrow-stem gall moth, grass roller moth, standard cutworm, grassland moth, small water lily moth, wheat moth, spotted field moth, neighboring silkworm moth, bean pod borer, net moth, bryophyte moth, rowan tobacco leafminer, and blank control group (NC). The figure shows that only the reaction system with tomato leafminer DNA template exhibited a green fluorescent signal under blue light; the reaction systems with other non-target insect DNA templates were colorless and transparent. Fluorescence values ​​were read using an ABI QuantStudio 6 Flex real-time quantitative PCR instrument. Results are as follows: Figure 5 As shown in Figure B, it can be seen from the figure that the reaction system with added tomato leafminer DNA template reached the positive threshold of 3.5 × 10⁻⁶. 5 None of the others reached the threshold, proving that the method has good specificity.

[0042] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A sequence combination for detecting tomato leafminer based on RAA-CRISPR / Cas12a, characterized in that: The sequence combination includes according to COI RAA-specific primer pair sequences and crRNA sequences designed for gene therapy; The RAA-specific primer pair sequences are: The sequence of the forward primer RAA-F3 is shown in SEQ ID NO:1: CTTCACGGAACTCAAATTAATTATAGTCCTTC; The sequence of the reverse primer RAA-R1 is shown in SEQ ID NO:2: AGGTATTCCGGCTAATCCTAAGAAATGTTGTG; The crRNA sequence is shown in SEQ ID NO:3: UAAUUUCUACUAAGUGUAGAGGGGGAUUUAUUCAUUGAUAU.

2. A detection kit for detecting tomato leafminer, characterized in that: The kit contains the RAA-specific primer pair sequence and crRNA sequence as described in claim 1.

3. The detection kit for detecting tomato leafminer according to claim 2, characterized in that: The detection kit also contains a signal reporter molecule: FAM-TTATT-BHQ1, wherein the 5' end of the signal reporter molecule sequence is labeled with FAM fluorescent label and the 3' end is labeled with BHQ-1.

4. The application of the sequence combination of claim 1 or the kit of claim 2 in the detection of tomato leafminer.

Images