Genetically modified saccharomyces cerevisiae cells

By genetically modifying Saccharomyces cerevisiae cells and introducing key enzymes such as GDP-mannose dehydrating enzyme peptides, the lactose transport pathway was optimized, solving the problem of insufficient lactose transport in Saccharomyces cerevisiae and achieving efficient and safe fucoidosyl lactose synthesis, which is suitable for the industrial production of food and infant products.

CN121914883APending Publication Date: 2026-04-24HENRUI (QINGDAO) BIOTECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENRUI (QINGDAO) BIOTECH CO LTD
Filing Date
2023-12-15
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies are difficult to synthesize fucoidosyllactose efficiently, especially 2'-fucosyllactose and 3-fucosyllactose. Furthermore, chemical synthesis methods are cumbersome and costly, while the lactose transport capacity of Saccharomyces cerevisiae in microbial synthesis methods is insufficient to meet industrial needs.

Method used

By genetically modifying Saccharomyces cerevisiae cells, introducing GDP-mannose dehydrating enzyme peptides and other key enzymes, and optimizing the lactose transport pathway, de novo synthesis of fucoidosyllactose, including 2'-fucosyllactose and 3-fucosyllactose, was achieved.

Benefits of technology

It improves the synthesis efficiency and conversion rate of fucose-based lactose, has high product safety, is suitable for food and infant products, reduces production costs, and is suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004613000500000131
    Figure BDA0004613000500000131
  • Figure BDA0004613000500000141
    Figure BDA0004613000500000141
  • Figure BDA0004613000500000142
    Figure BDA0004613000500000142
Patent Text Reader

Abstract

The invention relates to a genetically modified cell containing GDP-mannose dehydratase polypeptide, which can be applied to synthesis of human milk oligosaccharide HMOs, and belongs to the technical field of synthetic biology. The present invention provides a genetically modified cell comprising a recombinant nucleic acid sequence encoding a GDP-mannose dehydratase polypeptide (GDP-mannose dehydratase) having an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100% identical to SEQ ID NO: 1 and / or polypeptides M1-M13, and a genetically modified cell having a fucosyllactose synthesis activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a genetically engineered Saccharomyces cerevisiae containing GDP-mannose dehydrating enzyme polypeptide, which can be used in the synthesis of human milk oligosaccharides (HMOs), and belongs to the field of bioengineering technology. Background Technology

[0002] Human milk oligosaccharides (HMOs) are a unique and diverse mixture of oligosaccharides found in human milk, and are the third largest solid component of breast milk after fat and lactose. Among them, 2'-fucosyllactose (2'-FL) and 3'-fucosyllactose (3'-FL) are important components of HMOs and have been proven to play a vital role in the brain, gut health, and growth and development of infants and young children.

[0003] 2'-FL and 3'-FL have been approved by the US FDA, EU, Australia, New Zealand, Canada and other countries and regions as raw materials for infant formula and can be added to infant formula, general food, dietary supplements and / or medical food.

[0004] The synthesis of fucoidan is primarily achieved through chemical, enzymatic, or microbial cell factory methods. While chemical synthesis has made significant progress, the process involves repeated and complex protection and deprotection of the fucoidan molecule, resulting in low yields and high production costs. Therefore, achieving large-scale synthesis of 2'-fucosylated lactose and 3-fucosylated lactose using chemical methods remains extremely challenging. Microbial synthesis of fucoidan is currently a feasible method for large-scale production. Furthermore, microbially synthesized fucoidan is functionally identical to naturally occurring fucoidan and has not caused adverse reactions in clinical trials. Compared to chemical synthesis, microbial synthesis is safer and faster, avoiding the introduction of large amounts of toxic reagents. It also allows for the direct production of 2'-FL and 3-FL using food-grade microorganisms, significantly increasing product safety.

[0005] The biosynthesis of 2'-FL and 3-FL was initially achieved through enzymatic catalysis. In 2000, Albermann et al., through exogenous expression and purification of GDP-mannose-4,6-dehydratase and GDP-fucose synthase from *Escherichia coli* K12, converted GDP-D-mannose to GDP-fucose in vitro. GDP-fucose is a crucial precursor in the synthesis of 2'-fucosyllactose and 3-fucosyllactose. They also found that the activity of GDP-mannose-4,6-dehydratase could be inhibited by GDP-fucose, indicating that GDP-mannose-4,6-dehydratase is a critical rate-limiting enzyme. Therefore, it is necessary to study GDP-mannose-4,6-dehydratase to improve the synthesis efficiency and conversion rate of 2'-fucosyllactose and 3-fucosyllactose. Modification of key enzymes is crucial for improving their catalytic efficiency.

[0006] Saccharomyces cerevisiae strains are recognized as safe microorganisms, characterized by their non-pyrogenicity, lack of toxicity, and high food safety, while also reducing subsequent isolation and purification costs. Furthermore, Saccharomyces cerevisiae is widely used industrially. However, it cannot utilize lactose or transport it into the cell. Although scientists have introduced lactose transporters into Saccharomyces cerevisiae, the yield of 2'-fucosylated lactose synthesized by the recombinant strain is only 0.5 g / L (Yuet al., Microb Cell Fact, 2018, 17:101. DOI:10.1186 / s12934-018-0947-2), which is insufficient to meet the needs of industrial production.

[0007] Chinese patents 202010187309.1 and 202010187632.9 utilize recombinant Saccharomyces cerevisiae to synthesize 2'-fucosylated lactose, which includes GDP-mannose-dehydratase, GDP-fucosylated enzyme, and α-1,2-fucotransferase, with yields reaching 2.9 g / L and 3.8 g / L, respectively. Chinese patent 202080061688.8 discloses genetically modified yeast cells to produce one or more human lactose oligosaccharides, wherein the yeast cells include GDP-mannose-dehydratase, GDP-fucosylated enzyme, and ABC transporter protein. Expressing heterologous ABC transporter protein in genetically modified yeast cells can increase the yield and purity of HMOs.

[0008] With the rise of HMOs in recent years, optimizing key factors in the fucose synthesis pathway to improve fucose synthesis efficiency is of great significance. Summary of the Invention

[0009] Objective of the invention: To provide a gene-modified cell and its application in the synthesis of fucoidan, which has de novo fucoidan synthesis activity. The fucoidan includes, but is not limited to, 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL).

[0010] The technical solution of this invention is:

[0011] A genetically modified Saccharomyces cerevisiae cell containing a recombinant nucleic acid sequence encoding a polypeptide with GDP-mannose dehydratase activity.

[0012] The GDP-mannose dehydratase polypeptide, also known as GDP-D-mannose-4,6-dehydratase or GDP-mannose-6-dehydrogenase, belongs to the lyase family and has the activity of catalyzing the conversion of GDP-mannose to GDP-4-keto-6-deoxymannose. The GDP-mannose dehydratase polypeptide is one of the key enzymes in GDP-fucose synthesis.

[0013] The heterologous GDP-mannose dehydratase polypeptide gene sources include, but are not limited to: *Escherichia coli*, *Caenorhabditis elegans*, human *Homo sapien*, *Arabidopsis thaliana*, *Dictyostelium discoideum*, *Musmusculus*, *Drosophila melanogaster*, *Sinorhizobium fredii*, *Pandoraea vervacti*, *Caenorhabditis briggsae*, *Candidatus Curtissbacteria*, *Pseudomonas sp.*, *Clostridium sp.*, and *Cricetulus*. Natural or genetically modified strains of bacteria such as *Griseus*, *Arthrobacteric citollerans*, *Paraburkholderia piptadeniae*, and *Bacillus smithii*.

[0014] Preferably, the GDP-mannose dehydratase polypeptide is a GDP-mannose dehydratase derived from Bacillus smithii, which is excavated from nature, named BSGMD, and its amino acid sequence is shown in SEQ ID NO:1 and its nucleotide sequence is shown in SEQ ID NO:12.

[0015] A comparison with the NCBI database revealed that the GDP-mannose dehydratase with the amino acid sequence shown in SEQ ID NO:1 was most similar to that of GDP-mannose dehydratase derived from *Escherichia coli* (as of November 15, 2023). The two enzymes shared only 69.03% amino acid sequence similarity, indicating that SEQ ID NO:1 does not have a high degree of similarity to known enzymes. The amino acid sequence of the GDP-mannose dehydratase from *Escherichia coli* is shown in SEQ ID NO:2.

[0016] In some embodiments, the GDP-mannose dehydratase polypeptide comprises a polypeptide whose amino acid sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of the polypeptide shown in SEQ ID NO:1 or SEQ ID NO:2, or polypeptides M1-M13. Wherein, polypeptides M1-M13 are derived peptides of the polypeptide whose amino acid sequence is as shown in SEQ ID NO:1.

[0017] The genetically modified cells include, but are not limited to, GDP-mannose dehydratase polypeptides whose amino acid sequences are identical to those of the polypeptide shown in SEQ ID NO:1 or whose amino acid sequences are at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to those of polypeptides M1-M13.

[0018] Preferably, the GDP-mannose dehydratase polypeptide comprises the polypeptide (BSGMD) with the amino acid sequence shown in SEQ ID NO:1 and its derivative peptides M1-M13. The derivative peptides M1-M13 are dehydratase polypeptides formed by substitution of one or more amino acid residues / fragments in the polypeptide with the amino acid sequence shown in SEQ ID NO:1.

[0019] Preferably, the derived peptide M1-M13 is obtained by modifying at least one of the following sites in the amino acid sequence shown in SEQ ID NO:1: positions 69-72, 118-119, 123-124, 176, 203-205, 213-217, 257-264, 273-276, 288, 304-312, 339-443, and 365.

[0020] Preferably, the modification is a mutation, and the mutation is selected from any of the following mutations:

[0021] 1) In the amino acid sequence shown in SEQ ID NO:1, the amino acid fragment at positions 69-72 is replaced with ASIR by EKIK, thereby obtaining polypeptide M1;

[0022] 2) In the amino acid sequence of polypeptide M1, the amino acid fragment at positions 118-119 is replaced by LD, thereby obtaining polypeptide M2;

[0023] 3) In the amino acid sequence of polypeptide M2, the amino acid fragment at positions 123-124 is replaced by EK with QD, thereby obtaining polypeptide M3;

[0024] 4) In the amino acid sequence of polypeptide M3, the amino acid fragment at position 176 is replaced with D instead of N, thus obtaining polypeptide M4;

[0025] 5) In the amino acid sequence of polypeptide M4, the amino acid fragment at positions 203-205 is replaced by IQL with RDI, thereby obtaining polypeptide M5;

[0026] 6) In the amino acid sequence of polypeptide M5, the amino acid residues at positions 213-217 are replaced by LDTLY with KKVLK, thereby obtaining polypeptide M6;

[0027] 7) In the amino acid sequence of polypeptide M6, the amino acid fragment at positions 257-264 is replaced by FTVREAVE with YTVKEIVK, thereby obtaining polypeptide M7;

[0028] 8) In the amino acid sequence of polypeptide M7, the amino acid fragment at positions 273-276 is replaced by ELEF with ALRW, thereby obtaining polypeptide M8;

[0029] 9) In the amino acid sequence of polypeptide M8, the amino acid fragment at position 288 is replaced by K with E, thereby obtaining polypeptide M9;

[0030] 10) In the amino acid sequence of polypeptide M9, amino acid residues at positions 304-312 are replaced by ILEVDPSFL with VLKVDPAFR, thereby obtaining polypeptide M10.

[0031] 11) In the amino acid sequence of polypeptide M10, the amino acid fragment at positions 339-443 is replaced by FEEMM with IEEMI, thereby obtaining polypeptide M11;

[0032] 12) In the amino acid sequence of polypeptide M11, the amino acid fragment at position 35260 is replaced by KVAEEYAEK with AVAEKYAEL, thereby obtaining polypeptide M12.

[0033] 13) In the amino acid sequence of polypeptide M12, the amino acid residue at position 365 is replaced by Y with E, thereby obtaining polypeptide M13.

[0034] Preferably, the GDP-mannose dehydratase polypeptide further comprises an amino acid substitution mutation functionally equivalent to the schemes described in 1)-13) above. In some embodiments, the substitution mutation comprises a mutation to a charged residue; in some embodiments, the substitution mutation comprises a mutation to a basic residue. In some embodiments, the substitution mutation comprises a mutation homologous to the amino acid sequence described in 1)-13) above.

[0035] The method for producing GDP-mannose dehydrating enzyme peptides as described above includes:

[0036] (1) Transformed host cells are cultured under conditions suitable for expressing the polypeptide;

[0037] (2) The polypeptide is recovered.

[0038] In some embodiments, the host cell includes, but is not limited to, natural strains or genetically modified strains such as bacteria, yeast, and mold;

[0039] Preferably, the host cell includes, but is not limited to, natural strains or genetically modified strains such as Escherichia sp., Bacillus sp., and yeast sp.;

[0040] Further preferably, the yeast cells include, but are not limited to, natural or genetically modified strains such as *Saccharomyces cerevisiae*, *Kluyveromyces lactis*, *Yarrowialipolytica*, *Saccharomyces paradoxus*, *Saccharomyces bayanus*, *Saccharomyces pastorianus*, *Saccharomyces cariocas*, *Saccharomyces mikatae*, and *Saccharomyces kudriavzevii*, or other nucleic acid constructs capable of converting the polypeptide and / or derived peptides M1-M13 shown in SEQ ID NO:1.

[0041] More preferably, the host cell is the genetically engineered Escherichia coli E.coli BL21(DE3).

[0042] In a specific implementation, step (1) includes: firstly, introducing a nucleic acid construct or recombinant expression vector containing a polypeptide encoding GDP-mannose dehydratase as described above into a host cell to construct an engineered host cell expressing the polypeptide; then, culturing the engineered host cell and inducing it to express the polypeptide.

[0043] In a specific implementation, step (2) includes the steps of separating and purifying the polypeptide from the culture.

[0044] Host cells can be cultured in nutrient media suitable for peptide production using methods known in the art. For example, cells can be cultured by shake-flask culture or by small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, feed-feed fermentation, or solid-state fermentation) in a laboratory or industrial fermenter in a suitable medium and under conditions that allow for peptide expression and / or isolation. The culture occurs using procedures known in the art in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts. Suitable media can be purchased commercially or prepared according to publicly available compositions.

[0045] In some embodiments, preferably, the genetically modified cells include, but are not limited to, yeast genetically modified cells.

[0046] Preferably, the yeast gene cells include, but are not limited to, Saccharomyces cerevisiae gene-modified cells;

[0047] More preferably, the genetically modified Saccharomyces cerevisiae cells include, but are not limited to, genetically modified Saccharomyces cerevisiae, Saccharomyces paradoxus, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cariocas, Saccharomyces mikatae, and Saccharomyces kudriavzevii.

[0048] Furthermore, in some embodiments, in addition to the heterologous nucleic acid encoding the aforementioned dehydrating enzyme, the genetically modified yeast gene cell may also include one or more heterologous nucleic acids encoding GDP-L-fucose synthase, alpha-1,2-fucosyltransferase, or alpha-1,3-fucosyltransferase. The genetically modified yeast gene cell is capable of de novo synthesis of fucoidan lactose using lactose and glucose, or glycerol, or sucrose as carbon sources.

[0049] The α-1,2-fucosyltransferase gene is derived from, but is not limited to, natural or genetically modified strains of Helicobacter pylori, Thermophilic Chlorella, Escherichia coli, Caenorhabditis elegans, Schistosoma mansoni, Bacillus cereus, Pseudopedobater saltans, Helicobacter mustelae, Bacillus fragilis, Bacteroides vulgatus, Bacteroides fragilis, or Bacillus smithii.

[0050] The α-1,3-fucosyltransferase gene is derived from, but is not limited to, European wild boar (Sus scrofa), green monkey (Chlorocebus sabaeus), chimpanzee (Pan troglodytes), Helicobacter pylori, Akkermansia muciniphila, Bacteroides fragilis, and maize (Zea mays), Escherichia coli, western lowland gorilla (Gorilla gorilla gorilla), rhesus monkey (Macaca mulatta), rabbit (Oryctolagus cuniculus), Borneo orangutan (Pongo pygmaeus), brown rat (Rattus norvegicus), Akkermansia muciniphila, gibbon (Hylobates lar), and domestic cattle (Bos Natural or genetically modified strains of bacteria such as *Helicobacter hepaticus*, *Hylobatesagilis*, *Eulemur fulvus*, *Helicobacter hepaticus*, and *Azospirillum brasilense*.

[0051] The heterologous GDP-fucose synthase gene may be derived from, but is not limited to, natural or genetically modified strains of Escherichia coli, Mus musculus, Homo sapiens, Marinobacter alaris, Sinorhizobium fredii, Citrobacter, Pongo abelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria, Azorhizobium caulinodans, or Nitrospira Candida.

[0052] In some embodiments, the genetically modified *Saccharomyces cerevisiae* cells further contain a heterologous nucleic acid encoding lactose permease. Lactose permease is a lactose transport protein responsible for transferring lactose from the extracellular space to the intracellular space. In some embodiments, the lactose permease source includes, but is not limited to, *Neurospora crassa*, *Neofusicoccum parvum*, *Scheffersomyces stipitis*, *Aspergillus lentulus*, *Emericella nidulans*, *Microdochium bolleyi*, *Beauveria bassiana*, *Metarhizium robertsii*, *Phialocephala*, *Botryosphaeria parva*, *Moniliophthoraroreri*, *Cordyceps fumosarosea*, *Diplodiaseriata*, *Hypocrea jecorina*, *Kluyveromyces lactis*, and *Kluyveromyces maculata*. Natural or genetically modified strains of bacteria such as *Marxianus*, *Helicobacter pylori*, *Magnaporthe oryzae*, *Phialophora attae*, *Rhizobium meliloti*, *Zymomonas mobilis*, or *Escherichia coli*.

[0053] In some embodiments, the genetically modified *Saccharomyces cerevisiae* cells further include a heterologous nucleic acid encoding a transporter polypeptide that exports fucosylated lactose. The heterologous nucleic acid encoding the transporter polypeptide is integrated into the genome of the yeast cell.

[0054] In some embodiments, the transporter polypeptide that exports fucosyllactose is a transporter polypeptide that exports 2'-fucosyllactose or 3-fucosyllactose, and its source includes, but is not limited to, natural strains or genetically modified strains such as Escherichia coli, Kluyveromyces marxianus, Kluyveromyces lactis, and Neurospora crassa.

[0055] In some embodiments, the heteronucleotide encoding the transporter polypeptide that outputs fucosylated lactose is integrated into the genome of the yeast cell, and / or one or more heteronucleotides that each independently encode at least one enzyme in the biosynthetic pathway of fucosylated lactose.

[0056] In some embodiments, the heteronucleotide encoding the transport protein polypeptide that exports fucosylvite and / or one or more heteronucleotides that each independently encode at least one enzyme in the biosynthetic pathway of fucosylvite may be encoded, for example, by one or more plasmids in free form. For example, the enzyme encoded by one or more heteronucleotides that independently encode at least one enzyme in the biosynthetic pathway of fucosylvite may include one or more of GDP-mannose dehydratase, GDP-fucose synthase, α-1,2-fucosyltransferase or α-1,3-fucosyltransferase, lactose permease, and transport proteins that export fucosylvite.

[0057] Any gene encoding the aforementioned enzymes, or any other enzymes mentioned in this application, can be optimized through genetic or protein engineering techniques, such as directed evolution or rational mutagenesis, techniques known to those skilled in the art. This allows those skilled in the art to optimize enzyme expression and enhance activity in yeast.

[0058] The starting strain of the genetically modified cells can be easily purchased commercially or from a culture depository.

[0059] In one embodiment, a preferred technical solution is that the starting strain of the genetically modified cell is Saccharomyces cerevisiae CCTCCNO:M20231127 (Saccharomyces cerevisiae SctgtP8).

[0060] The genetically modified *Saccharomyces cerevisiae* cells, compared to the starting strain, have been genetically engineered to include increased intracellular GDP-fucose and fucosyl lactose production capacity. Preferably, the genetically modified cells have been genetically engineered to:

[0061] 1) Overexpress at least one of the genes encoding GDP-mannose dehydratase, GDP-fucose synthase, a transporter polypeptide that exports fucosyl lactose, and lactose permease.

[0062] 2) Express genes encoding α-1,2-fucosyltransferase or α-1,3-fucosyltransferase.

[0063] Optionally, the GDP-mannose dehydratase, GDP-fucose synthase, fucose-exporting transporter polypeptide, and lactose permease may be wild-type enzymes or genetically modified enzymes.

[0064] The present invention also provides a gene-modified cell containing a molecular marker. The molecular marker has the amino acid sequence shown in SEQ ID NO:7.

[0065] Preferably, the gene-modified cells containing molecular markers have molecular marker nucleotide sequences as shown in SEQ ID NO:13.

[0066] The present invention also provides a method for preparing gene-modified cells, wherein the method uses Saccharomyces cerevisiae as the starting strain and integrates heterologous α-1,2-fucosyltransferase gene or α-1,3-fucosyltransferase gene, heterologous GDP-fucose synthase gene, heterologous GDP-mannitol dehydratase gene, heterologous lactose permease gene, and heterologous fucose-exporting transporter polypeptide gene into the Saccharomyces cerevisiae genome.

[0067] Preferably, the GDP-mannose dehydratase gene includes, but is not limited to, genes of GDP-mannose dehydratase polypeptides whose amino acid sequences are at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequences of the polypeptide or polypeptide M1-M13 shown in SEQ ID NO:1.

[0068] Preferably, the method for preparing the gene-modified cells specifically includes the following steps:

[0069] (1) Cultivate the starting strain;

[0070] (2) Construct an expression cassette and introduce a heterologous α-1,2-fucosyltransferase gene or α-1,3-fucosyltransferase gene into the starting strain;

[0071] (3) Construct an expression cassette and introduce a heterologous GDP-fucose synthase gene into the starting strain;

[0072] (4) Construct an expression cassette and introduce a heterologous GDP-mannose dehydrase gene into the starting strain;

[0073] (5) Construct an expression cassette and introduce the fucoidosyl lactose transporter polypeptide gene into the starting strain;

[0074] (6) Construct an expression cassette and introduce a heterologous lactose permease gene into the starting strain.

[0075] Preferably, the recombinant construction technology for the gene-modified cells further includes:

[0076] (7) Construct a molecular marker expression cassette and introduce the marker gene into the starting strain.

[0077] Optional, as in the above method for preparing gene-modified cells, the steps described are not in any particular order;

[0078] Preferably, it further includes (8) the step of recovering the genetically modified cells;

[0079] Preferably, the GDP-mannose dehydrase comprises a polypeptide gene with an amino acid sequence as shown in SEQ ID NO:1, or any one of polypeptide genes M1-M13;

[0080] Preferably, the starting strain includes, but is not limited to, genetically modified cells such as: Saccharomyces cerevisiae, Saccharomyces paradoxus, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cariocas, Saccharomyces mikatae, and Saccharomyces kudriavzevii;

[0081] Preferably, the gene-modified cells prepared by the above method include, but are not limited to, yeast gene-modified cells; more preferably, they include, but are not limited to, Saccharomyces cerevisiae gene-modified cells; and even more preferably, they include, but are not limited to, Saccharomyces cerevisiae CCTCC NO:M20231127 gene-modified cells.

[0082] In some embodiments of the present invention, the application of gene-modified cells as described above in the synthesis of fucosylated lactose is described.

[0083] In some embodiments, the culture medium can be any genetically modified cell capable of maintaining growth and viability to produce fucosylated lactose. In some embodiments, the culture medium may also include appropriate salts, minerals, metals, or other nutrients. In some embodiments, the carbon source and each nutrient necessary for cell growth are added to the culture medium in an incremental or continuous manner.

[0084] This application also provides a method for preparing fucoidosyl lactose, wherein the preparation method involves obtaining it through one or more fermentations in the gene-modified cells described in this application;

[0085] Preferably, the fucoidyl lactose includes, but is not limited to, 2'-fucosyl lactose or 3-fucosyl lactose;

[0086] Preferably, the application of gene-modified cells in the synthesis of fucoidan or the method for preparing fucoidan, as described above, uses lactose and glucose, or glycerol, or sucrose as carbon sources to synthesize fucoidan de novo.

[0087] In some embodiments, the culture medium does not contain fucose. In some embodiments, the mass ratio of carbon source (such as sucrose) to lactose is also adjusted to regulate the fucose-based lactose yield.

[0088] The fermentation method described in this application can be carried out in conventional culture modes, including but not limited to batch, fed-batch, cell-recirculating, continuous, and semi-continuous modes. In some embodiments, fermentation is carried out in a fed-batch mode. In this case, some components of the culture medium are depleted during the culture, for example, during the production phase of fermentation. In some embodiments, the culture can be replenished with a relatively high concentration of such components, for example, at the beginning of the production phase, so as to support growth and / or fucoidan production for a period of time before additional addition is required. Preferred ranges of these component concentrations can be maintained by adding them as the culture is depleted throughout the culture process. The levels of components in the culture medium can be monitored, for example, by periodically sampling the culture medium and determining the concentration. Alternatively, once a standard culture procedure has been developed, additions can be made at specific times throughout the culture process at time intervals corresponding to known levels. As those skilled in the art will recognize, the rate of nutrient consumption during culture increases with increasing cell density in the culture medium. Furthermore, to avoid introducing foreign microorganisms into the culture medium, aseptic addition methods known in the art can be used. Additionally, a small amount of antifoaming agent can be added during the culture process.

[0089] This application also provides a method for recovering fucoidosyl lactose from a fermentation composition. In some embodiments, the fermentation composition is any fermentation composition disclosed herein and described above. The method includes isolating at least a portion of a yeast cell population from a culture medium. In some embodiments, the isolation includes centrifugation. In some embodiments, the isolation includes filtration, rinsing the isolated cells with a washing solution, and then collecting the washing solution.

[0090] The term "heterogeneous" refers to polynucleotides, genes, nucleic acids, polypeptides, or enzymes that are derived from or originate from sources other than the host organism species.

[0091] The term "molecular marker" refers to a specific DNA segment that reflects a certain difference in the genome of an individual or population.

[0092] Terminology: Fucosyl lactose includes, but is not limited to, 2'-fucosyl lactose and 3-fucosyl lactose.

[0093] Beneficial effects

[0094] This application provides gene-modified cells containing the nucleotide sequence of GDP-mannose dehydratase polypeptide or polypeptide M1-M13 as shown in SEQ ID NO:1. Its beneficial effects are as follows:

[0095] (1) Compared to the original strain, the genetically modified Saccharomyces cerevisiae cells produced the activity of synthesizing fucoidan lactose.

[0096] (2) Compared with fucoidan produced by Escherichia coli or Escherichia coli genetically modified cells, fucoidan synthesized by recombinant yeast genetically modified cells does not contain endotoxins or other allergens, and is safe to eat, making it more suitable for application in food, health products, infant food and other fields.

[0097] (3) The process of synthesizing fucoidan-based lactose by gene modification of the brewing yeast cells described in this invention is simple and easy to implement, which improves production efficiency and reduces production costs.

[0098] This invention provides excellent microbial resources for the bioprocessing of GDP-fucose and fucose-based lactose.

[0099] The technical solution of this application has positive significance for the industrial production of human milk oligosaccharides. This method is green, efficient, and sustainable, and is conducive to large-scale industrial production, thus having important practical value. Attached Figure Description

[0100] Figure 1 HPLC chromatogram of .2'-FL standard, rt = 13.43 min.

[0101] Figure 2 HPLC chromatogram of .3-FL standard, rt = 14.16 min.

[0102] Figure 3 HPLC chromatogram of SC-M6 fermentation broth in Example 3.

[0103] Figure 4 HPLC chromatogram of SC-M10-1 fermentation broth in Example 3.

[0104] Figure 5 .2'-FL standard quality spectrum.

[0105] Figure 6 .3-FL standard quality spectrum.

[0106] Figure 7 The mass spectrum of the substance with rt=13.43 min in the HPLC chromatogram of the fermentation broth of strain SC-M6 in Example 3.

[0107] Figure 8 The mass spectrum of the substance with rt=14.16min in the HPLC chromatogram of the fermentation broth of strain SC-M10-1 in Example 3. Detailed Implementation

[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents are commercially available unless otherwise specified.

[0109] The present invention will be further described in detail below through embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Modifications or substitutions to the details and form of the technical solution without departing from the structural concept and scope of use of the present invention shall fall within the protection scope of the present invention.

[0110] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art. Generally, the nomenclature used in this specification and the experimental methods described below are well-known and commonly used in the art.

[0111] It should be understood that the scope of protection of this invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of this invention is for describing specific embodiments and not for limiting the scope of protection of this invention. Experimental methods in the following specific embodiments, unless otherwise specified, generally follow conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or the conditions recommended by the manufacturer.

[0112] Unless otherwise specified, the experimental methods described in the following specific embodiments are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature; all materials, reagents, etc., are commercially available unless otherwise specified.

[0113] The fermentation products of yeast gene-modified cells described in this invention can be purified by centrifugation, filtration, decolorization, nanofiltration, chromatographic purification, and crystallization to obtain a reaction solution or solid with high purity; or they can be made into powder by spray drying or freeze drying technology.

[0114] Explanation of abbreviations in the examples: GMD: GDP-mannose dehydratase; WcaG: GDP-fucose synthase; futC: α-1,2-fucosyltransferase polypeptide; futA: α-1,3-fucosyltransferase polypeptide; lac12: lactose permease; CDT2: transporter polypeptide that transports fucosyllactose.

[0115] This document also provides a method for preparing fucosyllactose. The method includes providing genetically modified yeast cells capable of producing fucosyllactose. The yeast cells include the GDP-glucose dehydratase polypeptide gene described in this application. In some embodiments, the method further includes providing a culture medium and culturing the yeast cells in the culture medium under conditions suitable for yeast cells to produce fucosyllactose.

[0116] The cultivation can be carried out in suitable containers, including but not limited to cell culture plates, culture flasks, or fermenters in suitable culture media. Any suitable fermenter can be used, including but not limited to stirred fermenters, airlift fermenters, bubble fermenters, or any combination thereof. In a specific embodiment using *Saccharomyces cerevisiae* CCTCC NO: M20231127 as the host cell, the strain can be grown in a fermenter. Furthermore, the method can be performed at any scale of fermentation known in the art to support the industrial production of microbial products. The materials and methods used for maintaining or growing cell cultures are well known to those skilled in the art of microbiology or fermentation.

[0117] In some embodiments, the culture medium contains lactose and sucrose or glucose. In some embodiments, the carbon source in the culture medium consists primarily of lactose and sucrose or glucose. Preferably, in some embodiments, the carbon source in the culture medium consists of lactose and sucrose.

[0118] In the following examples, the starting strain was Saccharomyces cerevisiae CCTCC NO:M20231127 (Saccharomyces cerevisiae SctgtP8).

[0119] GDP-mannose dehydratase (GMD): amino acid sequence as shown in SEQ ID NO:1, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:5, or polypeptide M1-M13.

[0120] GDP-fucose synthase (WcaG) is derived from Escherichia coli, and its amino acid sequence is shown in SEQ ID NO:6.

[0121] The α-1,2-fucosyltransferase polypeptide (futC) is derived from Helicobacter pylori, and its amino acid sequence is shown in SEQ ID NO:8.

[0122] The α-1,3-fucosyltransferase polypeptide (futA) is derived from Helicobacter pylori, and its amino acid sequence is shown in SEQ ID NO:9.

[0123] Lactose permease (lac12) is derived from Kluyveromyces lactis, and its amino acid sequence is shown in SEQ ID NO:10.

[0124] The fucoidan transporter polypeptide (CDT2) that exports fucosyl lactose is derived from Neurosporacrassa, and its amino acid sequence is shown in SEQ ID NO:11.

[0125] Those skilled in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA molecules with different nucleotide sequences can be used to encode the given heterologous polypeptides of this application. The natural DNA sequences encoding the aforementioned biosynthetic enzymes are described herein and used only to illustrate embodiments of this disclosure, and this disclosure includes DNA molecules of any sequence encoding the amino acid sequence of polypeptides and proteins used in the methods of this disclosure. Similarly, polypeptides are generally tolerant to substitutions, deletions, and insertions of one or more amino acids in their amino acid sequence without loss or significant loss of desired activity. This disclosure includes such polypeptides with amino acid sequences different from the specific proteins described herein, provided that the modified or variant polypeptides have the enzymatic anabolic or catabolitic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein are only illustrative of embodiments of this disclosure.

[0126] In the following embodiments, the artificial amino acid sequence of the encryption tag was synthesized by a bioengineering company. The artificial amino acid sequence of the encryption tag is shown in SEQ ID NO:7, and the nucleotide sequence is shown in SEQ ID NO:13.

[0127] Example 1. Expression of the polypeptides shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3-SEQ ID NO:5 and polypeptides M1-M13 in Escherichia coli. The microbial sources of the polypeptides are as follows;

[0128] SEQ ID NO:1 is the amino acid sequence of GDP-mannose dehydratase from Bacillus smithii;

[0129] SEQ ID NO:2 is the amino acid sequence of GDP-mannose dehydratase from Escherichia coli;

[0130] SEQ ID NO:3 is the amino acid sequence of GDP-mannose dehydratase derived from Caenorhabditis elegans;

[0131] SEQ ID NO:4 is the amino acid sequence of GDP-mannose dehydratase derived from Arabidopsis thaliana;

[0132] SEQ ID NO:5 is the amino acid sequence of GDP-mannose dehydrase derived from Clostridium acetobutylicum.

[0133] Using the amino acid sequence as shown in SEQ ID NO:1 (nucleotide sequence as shown in SEQ ID NO:12) or the polypeptide shown in SEQ ID NO:2-SEQ ID NO:5 as templates, the gene coding sequences shown in SEQ ID NO:1 and SEQ ID NO:2-SEQ ID NO:5 were synthesized respectively, and finally constructed into the PET32a vector to obtain the plasmids PET32a-BSGMD-WT, PET32a-ECGMD-WT, PET32a-CEGMD-WT, PET32a-ATGMD-WT and PET32a-CAGMD-WT.

[0134] 2. By utilizing computer-aided rational design, different mutation sites were obtained. Referring to the methods in *Molecular Cloning: A Laboratory Manual*, and based on the sequence of SEQ ID NO:12 of PET32a-wt, Primer-BLAST was used. Primer designing tool(nih.gov) Mutant primers were designed, and a series of recombinant plasmids (pET32a-M1 to pET32a-M13) were constructed using a point mutation kit.

[0135] 3. Transform the above recombinant plasmids into Escherichia coli BL21(DE3) according to the following steps:

[0136] Prepared Escherichia coli BL21(DE3) competent cells were thawed on ice for 30 min. 100 μL of competent cells were mixed with 10 μL of pET32a-M1 to pET32a-M13 recombinant plasmids (concentration 50 ng / μL) and heat-shocked in a 42℃ water bath for 45 s. Immediately afterward, the mixture was cooled on ice for 2 min. 1 mL of fresh LB medium (LB medium: peptone 1.0%, yeast extract 0.5%, NaCl 1.0%, plate with 1.5% agar powder) was added, and the mixture was incubated at 37℃ and 100 rpm for 1 h. Then, 100 μL of the bacterial solution was spread on LB plates containing ampicillin (100 μg / mL) and incubated at 37℃ for 12 h. Single colonies were picked for colony PCR to screen for positive transformants.

[0137] 4. Cultivate positive transformants, then extract their plasmids, and use double enzyme digestion and gene sequencing to verify whether the pET32a-M1 to pET32a-M13 recombinant plasmids were successfully introduced into E. coli.

[0138] 5. Inoculate the correct transformants into LB liquid medium and incubate at 37°C and 200 rpm on a shaker for 12 hours to obtain the seed culture; then inoculate the seed culture into fresh LB medium at a 1% (v / v) inoculation rate and incubate at 37°C with shaking until OD reaches 100%. 600 The concentration was 0.8, and then induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1 mmol / L. Induction was performed at 16℃ for 12 h at 200 rpm. After induction, the fermentation broth was centrifuged at 5000 r / min for 30 min at 4℃ to collect the cells. The cells were resuspended in 20 mM pH 7.4 PBS buffer and sonicated at a frequency of plus on 5 s / off 5 s for 30 min to lyse the cells. The lysed liquid was centrifuged at 13000×g at 4℃ for 30 min to remove cell debris and the supernatant was collected.

[0139] 6. Soluble peptide sequences were purified using nickel column affinity chromatography as follows: Deionized water was added to the top of the nickel column, and after natural elution, elution was performed with 5 volumes of binding buffer. Crude enzyme solution filtered through a 0.45 μm membrane was then loaded onto the column, and the sample was allowed to fully bind to the nickel column at a flow rate of 1.5 mL / min. After the sample dried, impurities were removed by a continuous gradient elution with 5 column volumes of washing buffer. Finally, the target protein was eluted with 5 volumes of elution buffer, and the eluent was collected. The expression of the target protein was then analyzed using SDS-PAGE.

[0140] SDS-PAGE results showed that the gene-modified cells had obvious specific expression bands after induction, and the molecular weight of the bands was basically consistent with the expected molecular weight of 35.3 kDa. Therefore, the polypeptides and polypeptides M1-M13 shown in SEQ ID NO:1, SEQ ID NO:2 to SEQ ID NO:5 were obtained. For details, please refer to Table 1.

[0141] Table 1. Correspondence between GDP-mannose dehydratase polypeptides and their amino acid sequence numbers or nomenclature

[0142]

[0143]

[0144] Example 2. Construction of gene-modified cells of Saccharomyces cerevisiae.

[0145] (1) Construction of the SC-ΔARO3::FutC-WCAG / SC-ΔARO3::FutA-WCAG expression cassette

[0146] Using the *Saccharomyces cerevisiae* genome as a template, the following sequences were amplified: upstream and downstream homologous arm sequences aro3-up and aro3-do, promoter sequence TDH3p and terminator sequence PGK1t, promoter sequence TFF1p and terminator sequence GPMt. Using synthesized FutC and FutA sequences as templates, the target gene sequences FutC and FutA were amplified. Using synthesized wcaG as a template, the target gene sequence wcaG was amplified. Referring to the applicant's prior patent: 202211453172.5, invention title: Recombinant Yeast and its Application, KL... Using the -ΔLAC4 knockout cassette as a template, the G418+loxp sequence was amplified. Aro3-up, TDH3p, FutC / FutA, PGK1t, TEF1p, WCAG, ADH1t, G418+loxp, and aro3-do were fused using a sequential fusion PCR method. Finally, using primers ARO3-F and ARO3-R as primers and the fusion PCR system as a template, the SC-ΔARO3::FutC-WCAG / SC-ΔARO3::FutA-WCAG expression cassette was amplified by PCR.

[0147] Table 2. Plasmids and primers

[0148]

[0149] (2) Construction of the SC-ΔTRP3::CDT2-LAC12 expression cassette

[0150] Using the *Saccharomyces cerevisiae* genome as a template, the upstream and downstream homologous arm sequences *trp3-up* and *trp3-do*, the promoter sequence *TFF1p*, the terminator sequence *CYC1t*, the terminator sequence *GPMt*, and the promoter sequence *TPILp* were amplified. Using the synthesized CDT2 sequence as a template, the CDT2 target gene sequence was amplified. Using the *Kluyveromyces lactis* genome as a template, the lac12 gene was amplified. Using SC-ΔARO3::GMD-WCAG as a template, the G418+loxp sequence was amplified. *trp3-up*, *TFF1p*, CDT2, *CYC1t*, *GPMt*, lac12, *TPILp*, G418+loxp, and *trp3-do* were fused using a two-fragment sequential fusion PCR method. Finally, using primers TRP3-F and TRP3-R as primers and the fusion PCR system as a template, the expression cassette SC-ΔTRP3::CDT2-LAC12 was amplified by PCR.

[0151] Table 3. Plasmids and primers

[0152]

[0153]

[0154] (3) Construction of expression boxes from SC-ΔGK::BSGMD-WT, SC-ΔGK::BSGMD-M1 to SC-ΔGK::BSGMD-M13, SC-ΔGK::ECGMD-WT, SC-ΔGK::CEGMD-WT, SC-ΔGK::ATGMD-WT, and SC-ΔGK::CAGMD-WT.

[0155] Using *Saccharomyces cerevisiae* genomic DNA as a template, PCR amplification yielded the upstream and downstream homologous arms gk-up and gk-down, the promoter sequence CUP1p, and the terminator sequence GPMt, respectively. Using the SC-ΔTRP3::CDT2-LAC12 expression cassette as a template, resistance selection markers containing G418 resistance and loxp sites were amplified. Using PET32a-BSGMD-WT, PET32a-BSGMD-M1 to PET32a-BSGMD-M13, PET32a-ECGMD-WT, PET32a-CEGMD-WT, PET32a-ATGMD-WT, and PET32a-CAGMD-WT as templates, PCR amplification yielded BSGMD-WT and its mutant sequence, as well as the genes ECGMD-WT, CEGMD-WT, ATGMD-WT, and CAGMD-WT. Sequences: gk-up, CUP1p, BSFutGMD-WT, and mutant sequences / ECGMD-WT / ECFut-wtCEGMD-WT / ATGMD-WT / CAGMD-WT, GPMt, G418+loxp, and gk-do were fused using a two-fragment sequential fusion PCR method. Finally, using primers GK-F and GK-R as primers, and with the fusion PCR system as a template, expression cassettes SC-ΔGK::BSGMD-WT, SC-ΔGK::BSGMD-M1 to SC-ΔGK::BSGMD-M13, SC-ΔGK::ECGMD-WT, SC-ΔGK::CEGMD-WT, SC-ΔGK::ATGMD-WT, and SC-ΔGK::CAGMD-WT were amplified by PCR and used in the next step of constructing recombinant strains.

[0156] Primers were constructed for expression cassettes SC-ΔGK::BSGMD-WT, SC-ΔGK::BSGMD-M1 to SC-ΔGK::BSGMD-M13, SC-ΔGK::ECGMD-WT, SC-ΔGK::CEGMD-WT, SC-ΔGK::ATGMD-WT, and SC-ΔGK::CAGMD-WT.

[0157] Table 4. Plasmids and primers

[0158] plasmid Primers GK-F CGGTCACACAAATCAACCTCAT GK-R AAGTTGGCGAGAGTTCAATCT

[0159] (2) Transformation of recombinant expression cassettes and verification of recombinant strains.

[0160] The expression cassettes constructed in (1) above were transformed into the starting strain Saccharomyces cerevisiae CCTCC NO:M20231127 cells.

[0161] The specific method is as follows:

[0162] 1) First, prepare competent yeast cells: Streak a small amount of frozen yeast strain onto a plate of solid culture medium and incubate upside down at 30°C for 2 days. Pick a single yeast colony and place it in 50 mL of liquid culture medium, incubate at 30°C and 220 rpm until OD reaches 100%. 600 The pH should be between 0.8 and 1.5. Collect the bacterial cells, wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the precipitate, centrifuge at 12000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the precipitate, and obtain competent yeast cells. Aliquot into 50 μL tubes for transformation.

[0163] Meanwhile, boil 1 mL of salmon sperm DNA for 5 minutes, then quickly place it on an ice bath to prepare single-stranded DNA.

[0164] 2) Transformation: Centrifuge the prepared competent yeast cells and remove residual lithium chloride solution using Tips. For each transformation, add the following in order: 50% PEG3350 (240 μL); 1M LiCl (36 μL); 2 mg / mL single-stranded Salmon sperm DNA (25 μL); 5–10 μg / 50 μL plasmid DNA aqueous solution (50 μL), vortex vigorously until the precipitated cells are completely and evenly distributed; incubate at 30°C for 30 min; heat shock at 42°C for 20–25 min; centrifuge at 8000 rpm for 10 min, and collect the yeast cells; then, resuspend the yeast in 500 μL of liquid medium and incubate at 30°C on a shaker; after 1–4 h, take 25–100 μL of the bacterial suspension and spread it on selective medium plates, and incubate upside down at 30°C.

[0165] 3) Verification: The correspondence between recombinant strains and their genotypes is shown in Tables 5 and 6. To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive.

[0166] Table 5. Engineered Saccharomyces cerevisiae and their genotypes (α-1,2-fucosyltransferase gene)

[0167]

[0168]

[0169] Encryption tags were introduced into the recombinant strains described in Table 5 to obtain strains SC-1-J to SC-7-J and SC-M1-J to SC-M13-J, respectively.

[0170] Table 6. Engineered Saccharomyces cerevisiae and their genotypes (α-1,3-fucosyltransferase gene)

[0171]

[0172] Encryption tags were introduced into the recombinant strains described in Table 6 to obtain strains SC-1-1-J to SC-7-1-J and SC-M1-1-J to SC-M13-1-J, respectively.

[0173] Validation of marker genes: To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains, and performed PCR amplification on the genomes using the corresponding knockout or expression cassette primers. If a unique band was obtained after PCR amplification, and its size matched that of the knockout or expression cassette, the strain was considered correct; otherwise, it was considered a false positive. For tag validation, PCR amplification was performed using primers, followed by sequencing for verification; otherwise, the strain was considered a false positive.

[0174] Example 3. The gene-modified cells obtained in Example 2 were fermented to synthesize fucoidosyl lactose.

[0175] Yeast was cultured using glucose as the carbon source. Gene-modified cells obtained in Example 2 were taken and allowed to grow rapidly until they entered the late logarithmic or stationary phase. The strains were streaked onto solid media such as YDP and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of LYPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of the culture was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (out of growth) was reached. 600 =1, add lactose to a final concentration of 10 g / L, 3% (w / v) sucrose, and 0.1 mM CuSO4, and culture at 30℃ with shaking at 200 rpm for a total fermentation time of 72 h. After 72 h of fermentation, take samples and boil for 10 min. After cooling, the contents of 2'-FL and 3-FL in the supernatant are measured.

[0176] HPLC detection method: Detection conditions: Column type: Shodex Asahipak NH2P-50 4E, mobile phase: 65% acetonitrile aqueous solution, flow rate: 0.5 ml / min, column temperature: 35℃, injection volume: 10 μL, evaporative light detector, evaporation temperature: 75℃, nebulization temperature: 45℃.

[0177] The LC-MS analysis conditions are as follows:

[0178] Column type: Shodex Asahipak NH2P-50 4E, detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 0.5 mL / min, column temperature: 35 ℃, mobile phase: acetonitrile:water = 65:35; ESI-MS mode, molecular weight scan range 100–800.

[0179] The standard and reaction solution were analyzed using the aforementioned analytical method. HPLC analysis results showed:

[0180] (1) The peak elution time rt of 2'-FL standard was 13.43 min; the HPLC chromatogram rt of 3-FL standard was 14.16 min.

[0181] (3) The brewing gene-modified cells (SC-3, SC-4 and strains with M1-M13 genes introduced, as well as the above strains with marker genes introduced) obtained in Example 2 showed a strong absorption peak around 13.43 min, which was consistent with the peak time of 2'-FL standard, indicating that 2'-FL was generated in the fermentation broth of the gene-modified cells obtained in Example 2.

[0182] (3) The Saccharomyces cerevisiae gene-modified cells (SC-3-1, SC-4-1, SC-3-1, SC-4-1 and strains with M1-M13 genes introduced, as well as the above strains with marker genes introduced) obtained in Example 2 showed a strong absorption peak around 14.16 min, which was consistent with the peak time of 3-FL standard, indicating that 3-FL was generated in the fermentation broth of the gene-modified cells obtained in Example 2.

[0183] The LC-MS analysis conditions are shown above, and the analysis results show:

[0184] 2'-FL and 3-FL are compounds with the same molecular formula but different structures, and are called isomers of each other. They have the same molecular weight.

[0185] The products at rt=13.43 min and rt=14.16 min of the HPLC chromatographic peaks of the reaction solution were analyzed by LC-MS. The MH value was 487.17, which was consistent with the results of the mass spectra of the 2'-FL and 3-FL standards. It was also within the allowable error range of the theoretical molecular weight of 2'-FL and 3-FL, which is 488.44.

[0186] The yields of 2'-FL and 3-FL in the fermentation broth were determined using the HPLC analysis method described above, and the results are recorded in Tables 7-8.

[0187] Table 7. Study on the synthesis of 2'-FL and 3-FL in cells modified by gene modification of Saccharomyces cerevisiae CCTCC NO:M20231127

[0188]

[0189] Table 8. Study on the synthesis of 2'-FL and 3-FL in cells modified by gene modification of Saccharomyces cerevisiae CCTCC NO:M20231127

[0190]

[0191] Table 7-8 Data Explanation:

[0192] (1) The original strain of *Saccharomyces cerevisiae*, and the genetically modified cells SC-1 and SC-2 could not synthesize 2'-FL; SC-3 produced 2'-FL; the original strain of *Saccharomyces cerevisiae*, and the genetically modified cells SC-1-1 and SC-2-1 could not synthesize 3-FL, while SC-3 produced 3-FL. Explanation: *Saccharomyces cerevisiae* cells themselves do not have the ability to synthesize 2'-FL and 3-FL, and even after the introduction of GMD (GDP-mannose-4,6-dehydratase) and WcaG (GDP-L-fucose synthase), the synthesis of 2'-FL or 3-FL could not be achieved. The successful introduction of BSFut-wt resulted in the detection of 2'-FL production.

[0193] (2) The Saccharomyces cerevisiae gene-modified cells of the present invention have the activity of synthesizing 2'-FL or 3-FL.

[0194] Example 4. Saccharomyces cerevisiae SC-M10, SC-M10-1, SC-M10-J, and SC-M10-J-1 were streaked onto solid media such as YDP and cultured at 30°C for 2-3 days. Single colonies were then picked and inoculated into 1.5 mL of LYPD liquid medium and cultured overnight at 30°C with shaking at 200 rpm. Subsequently, 2% of each colony was inoculated into 50 mL shake flasks of liquid medium and cultured at 30°C with shaking at 200 rpm until OD (October Expiratory Count). 600=1, 2% of each yeast extract was inoculated into 1L of YPD medium (10g / L yeast extract, 20g / L peptone, 20g / L glucose) in a 3L fermenter. After 6-7 hours of cultivation, CuSO4 was added to maintain the Cu ion concentration at approximately 0.1mM, and sucrose (50% mother liquor concentration) was added at a flow rate of 8mL / h. Simultaneously, lactose (40% mother liquor concentration) was added to maintain a final lactose concentration of 15g / L. The total fermentation time was 72 hours. After 72 hours of fermentation, the fermentation broth was centrifuged, and the supernatant and precipitate were collected separately. The precipitate was homogenized using a high-pressure homogenizer, and the protein was removed by boiling and centrifugation. The supernatants were combined to obtain the final yeast fermentation product. The contents of 2'-FL and 3-FL in the supernatant were measured, and the results are recorded in Table 9.

[0195] Table 9

[0196] Gene-modified cells 2'-FL yield, g / L Gene-modified cells 3-FL yield, g / L SC-M10 24.6 SC-M10-1 19.8 SC-M10-J 25.2 SC-M10-J-1 21.4

[0197] While the invention has been described in considerable detail by way of illustration and example for purposes of clarity, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be made. Therefore, this specification and the embodiments should not be construed as limiting the scope of the invention.

Claims

1. A gene-modified cell, characterized in that, Contains a recombinant nucleic acid sequence encoding a polypeptide containing GDP-mannose dehydratase; Preferably, the gene-modified cells include, but are not limited to, gene-modified yeast cells; Preferably, the genetically modified cells include, but are not limited to, genetically modified cells of *Saccharomyces sp.*; preferably, the genetically modified cells include, but are not limited to, genetically modified cells of *Saccharomyces cerevisiae*, *Saccharomyces paradoxus*, *Saccharomyces bayanus*, *Saccharomyces pastorianus*, *Saccharomyces cariocas*, *Saccharomyces mikatae*, and *Saccharomyces kudriavzevii*. More preferably, the genetically modified cells include, but are not limited to, genetically modified Saccharomyces cerevisiae cells.

2. The gene-modified cell as described in claim 1, characterized in that, The GDP-mannose dehydratase polypeptide includes, but is not limited to, polypeptides whose amino acid sequences are at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to those of the polypeptide shown in SEQ ID NO:1 or polypeptides M1-M13. Preferably, the GDP-mannose dehydratase polypeptide includes, but is not limited to, the polypeptide shown in SEQ ID NO:1, or polypeptides M1-M13.

3. The gene-modified cell as described in claim 2, characterized in that, The polypeptide M1-M13 is obtained by modifying at least one of the following sites in the amino acid sequence shown in SEQ ID NO:1: positions 69-72, 118-119, 123-124, 176, 203-205, 213-217, 257-264, 273-276, 288, 304-312, 339-443, and 365. Preferably, the modification is a mutation, and the mutation is selected from any of the following mutations: 1) In the amino acid sequence shown in SEQ ID NO:1, the amino acid fragment at positions 69-72 is replaced with ASIR by EKIK, thereby obtaining polypeptide M1; 2) In the amino acid sequence of polypeptide M1, the amino acid fragment at positions 118-119 is replaced by LD, thereby obtaining polypeptide M2; 3) In the amino acid sequence of polypeptide M2, the amino acid fragment at positions 123-124 is replaced by EK with QD, thereby obtaining polypeptide M3; 4) In the amino acid sequence of polypeptide M3, the amino acid fragment at position 176 is replaced with D instead of N, thus obtaining polypeptide M4; 5) In the amino acid sequence of polypeptide M4, the amino acid fragment at positions 203-205 is replaced by IQL with RDI, thereby obtaining polypeptide M5; 6) In the amino acid sequence of polypeptide M5, the amino acid residues at positions 213-217 are replaced by LDTLY with KKVLK, thereby obtaining polypeptide M6; 7) In the amino acid sequence of polypeptide M6, the amino acid fragment at positions 257-264 is replaced by FTVREAVE with YTVKEIVK, thereby obtaining polypeptide M7; 8) In the amino acid sequence of polypeptide M7, the amino acid fragment at positions 273-276 is replaced by ELEF with ALRW, thereby obtaining polypeptide M8; 9) In the amino acid sequence of polypeptide M8, the amino acid fragment at position 288 is replaced by K with E, thereby obtaining polypeptide M9; 10) In the amino acid sequence of polypeptide M9, amino acid residues at positions 304-312 are replaced by ILEVDPSFL with VLKVDPAFR, thereby obtaining polypeptide M10. 11) In the amino acid sequence of polypeptide M10, the amino acid fragment at positions 339-443 is replaced by FEEMM with IEEMI, thereby obtaining polypeptide M11; 12) In the amino acid sequence of polypeptide M11, the amino acid fragment at positions 352-360 is replaced by KVAEEYAEK with AVAEKYAEL, thereby obtaining polypeptide M12. 13) In the amino acid sequence of polypeptide M12, the amino acid residue at position 365 is replaced by Y with E, thereby obtaining polypeptide M13.

4. The gene-modified cell according to any one of claims 1-3, characterized in that, The method for producing the GDP-mannose dehydrating enzyme polypeptide includes: (1) Transformed host cells are cultured under conditions suitable for expression of the polypeptide; and (2) The polypeptide is recovered. Preferably, the host cell includes, but is not limited to, natural strains or genetically modified strains such as bacteria, yeast, and mold; More preferably, the host cell includes, but is not limited to, natural strains or genetically modified strains such as Escherichia sp., Bacillus sp., and Kluyveromyces sp.; Further preferably, the host cell, the yeast cell, includes, but is not limited to, natural or genetically modified strains such as *Saccharomyces cerevisiae*, *Cloveromyces cerevisiae*, *Yarrowialipolytica*, *Saccharomyces paradoxus*, *Saccharomyces bayanus*, *Saccharomyces pastorianus*, *Saccharomyces cariocas*, *Saccharomyces mikatae*, and *Saccharomyces kudriavzevii*, or other nucleic acid constructs capable of transforming the polypeptide and / or derived peptides M1-M13 shown in SEQ ID NO:1; Preferably, the yeast cells are selected from natural strains or genetically modified strains of Saccharomyces cerevisiae. More preferably, the host cell is the genetically engineered Escherichia coli E.coli BL21(DE3).

5. The gene-modified cell according to any one of claims 1-4, characterized in that, It also includes one or more heterologous nucleic acids encoding GDP-L-fucose synthase, alpha-1,2-fucosyltransferase, or alpha-1,3-fucosyltransferase. Preferably, the α-1,2-fucosyltransferase gene is derived from, but is not limited to, natural or genetically modified strains of Helicobacter pylori, Thermophilic Chlorella, Escherichia coli, Caenorhabditis elegans, Schistosoma mansoni, Bacillus cereus, Pseudopedobater saltans, Helicobacter mustelae, Bacillus fragilis, Bacteroides vulgatus, Bacteroides fragilis, or Bacillus smithii. Preferably, the α-1,3-fucosyltransferase gene is derived from, but is not limited to, European wild boar (Susscrofa), green monkey (Chlorocebus sabaeus), chimpanzee (Pan troglodytes), Helicobacter pylori, Akkermansia muciniphila, Bacteroides fragilis, and maize (Zea mays), Escherichia coli, western lowland gorilla (Gorilla gorilla gorilla), rhesus monkey (Macaca mulatta), rabbit (Oryctolagus cuniculus), Bornean orangutan (Pongo pygmaeus), brown rat (Rattus norvegicus), Akkermansia muciniphila, gibbon (Hylobates lar), domestic cattle (Bos taurus), and black-handed gibbon (Hylobates lar). Natural or genetically modified strains of bacteria such as *Agilis*, *Eulemur fulvus*, *Helicobacter hepaticus*, and *Azospirillum brasilense*. Preferably, the heterologous GDP-fucose synthase (WcaG) gene is derived from, but is not limited to, Escherichia coli and mouse. Musmusculus Natural or genetically modified strains of bacteria such as Homo sapiens, Marinobacter salarius, Sinorhizobium fredii, Citrobacter, Pongo abelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria, or Azorhizobium caulinodans are used.

6. The gene-modified cell according to any one of claims 1-5, characterized in that, The Saccharomyces cerevisiae gene-modified cells also contain heterologous nucleic acids encoding lactose permease; Preferably, the lactose permease source includes, but is not limited to, Neurospora crassa, Neofusicoccum parvum, Schefferssomyces stipitis, Aspergillus lentulus, Emericella nidulans, Microdochium bolleyi, Beauveria bassiana, Metarhizium robertsii, Phialocephala, Botryosphaeria parva, Moniliophthoraroreri, Hypocrea jecorina, Kluyveromyces lactis, Kluyveromyces marxianus, Helicobacter pylori, and Magnaphthium oryzae. Natural or genetically modified strains of bacteria such as *Oryzae*, *Phialophora attae*, *Rhizobium meliloti*, *Zymomonas mobilis*, or *Escherichia coli*.

7. The gene-modified cell according to any one of claims 1-6, characterized in that, The Saccharomyces cerevisiae gene-modified cells also include heterologous nucleic acids of transport protein polypeptides that export fucosylated lactose; Preferably, the transporter polypeptide that exports fucose-based lactose is derived from, but is not limited to, natural or genetically modified strains of Escherichia coli, Kluyveromyces marxianus, Kluyveromyces lactis, Neurospora crassa, etc.

8. The method for preparing gene-modified cells according to any one of claims 1-7, characterized in that, Includes the following steps: (1) Cultivate the starting strain; (2) Construct an expression cassette and introduce a heterologous α-1,2-fucosyltransferase gene or α-1,3-fucosyltransferase gene into the starting strain; (3) Construct an expression cassette and introduce a heterologous GDP-fucose synthase gene into the starting strain; (4) Construct an expression cassette and introduce a heterologous GDP-mannose dehydrase gene into the starting strain; (5) Construct an expression cassette and introduce the fucoidosyl lactose transporter polypeptide gene into the starting strain; (6) Construct an expression cassette and introduce a heterologous lactose permease gene into the starting strain; Preferably, the recombinant construction technology for the gene-modified cells further includes: (7) Construct a molecular marker expression cassette and introduce marker genes into the starting strain; Optional, as described above, the steps in the preparation method of gene-modified cells are not in any particular order; Preferably, it further includes (8) the step of recovering the genetically modified cells; Preferably, the GDP-mannose dehydratase includes, but is not limited to, a polypeptide gene with an amino acid sequence as shown in SEQ ID NO:1, or any one of polypeptide genes M1-M13; Preferably, the starting strain includes, but is not limited to, genetically modified cells such as: Saccharomyces cerevisiae, Saccharomyces paradoxus, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cariocas, Saccharomyces mikatae, and Saccharomyces kudriavzevii; Preferably, the gene-modified cells include, but are not limited to, yeast gene-modified cells; Preferably, the yeast gene-modified cells include, but are not limited to, Saccharomyces cerevisiae gene-modified cells; Preferably, the starting strain is selected from Saccharomyces cerevisiae CCTCC NO:M20231127.

9. The use of the gene-modified cells according to any one of claims 1-7 in the synthesis of fucoidosyllactose; Preferably, the application involves the de novo synthesis of fucoidosyllactose using lactose and glucose, or glycerol, or sucrose as carbon sources.

10. A method for preparing fucoidosyl lactose, characterized in that, Obtained by one or more fermentations in the genetically modified cells according to any one of claims 1-7; Preferably, the fucoidyl lactose includes, but is not limited to, 2'-fucosyl lactose or 3-fucosyl lactose; Preferably, the preparation method uses lactose and glucose, or glycerol, or sucrose as carbon sources to synthesize fucose-syllactose de novo.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae engineering strain with high yield of fucosyllactose and application of saccharomyces cerevisiae engineering strain

    CN111471605A

  • Optimized saccharomyces cerevisiae strain capable of producing fucosyllactose at high yield and application of saccharomyces cerevisiae strain

    CN111471606A

  • Enhanced oligosaccharide production in yeast

    CN114450417A

  • Recombinant yeast and its applications

    CN116042562B