Impregnation vaccines against larvae

By administering the drug through immersion and removing the mucus from eel larvae and juveniles through pretreatment, combined with inactivated bacteria and adjuvants, an effective vaccine was developed. This solved the vaccine development problem for Edwardsiella tarda infection in eels during the larval and juvenile stages, and improved the edibility and immunization effect of eels.

CN121925269APending Publication Date: 2026-04-24NIPPON LIFE SCIENCES CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NIPPON LIFE SCIENCES CO LTD
Filing Date
2024-11-07
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively develop and evaluate vaccines against Edwardsiella tarda infection in juvenile eels, resulting in reduced eel edibility and increased farming costs.

Method used

A vaccine against Edwardsiella tarda was developed by administering the drug via immersion and combining it with pretreatment to remove gills and body surface mucus from larvae and juveniles. The vaccine was then developed by inducing an immune response in larvae and juveniles using inactivated bacteria and adjuvants such as fucoidan.

Benefits of technology

It significantly reduces the infection and mortality rates of juvenile eels, improves the edibility and immune memory of eels, and promotes the healthy growth of eels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention provides a fish vaccine capable of preventing infections in fish in a larval stage by activating a defensive system of a living body. For example, the present invention provides a vaccine for fish, which comprises cells of Edwardsiella tarda, and which can induce immunization against Edwardsiella tarda to fish at the larval stage (particularly white eel) by impregnating the fish at the larval stage (particularly white eel). In addition, the present invention provides a method for inducing Edwardsiella tarda infections by white or black fry eels.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention provides an immersion vaccine suitable for larvae and juvenile fish. This invention also provides an immersion vaccine suitable for larvae and juvenile eels. Background Technology

[0002] In eel farming, an infection caused by Edwardsiella tarda (formerly known as paracolon disease), presumed to be caused by Edwardsiella tarda, occurs sporadically and causes damage.

[0003] Since the introduction of heated eel farming, paracolon infection has become the most damaging disease in eel farming, which occurs year-round. Countermeasures include drug-based treatments, but these cannot eradicate the disease, requiring repeated year-round administration. In the past, vaccine development has been planned and announced, but no vaccine has actually been marketed.

[0004] On the other hand, there is a global concern about resource depletion surrounding the white eel larvae (juvenile stage) which are the offspring of eels, particularly the European eel. Anguilla anguilla They are unable to conduct international transactions that are not permitted by the exporting country's government under the Washington Treaty. Additionally, there are concerns about Japanese eels (…). Anguilla japonica This is also due to conservation restrictions. While recent technological advancements have led to rapid progress in artificial breeding techniques, it is believed that commercial production of eel larvae will take a considerable amount of time. In this environment, the trading price of white eel larvae (a common name for eel larvae), which constitutes the capital for aquaculture, continues to rise, increasing the burden on aquaculture farmers year by year. Therefore, farmers are racking their brains to improve the edibility of the eel larvae they purchase.

[0005] In the development of aquatic vaccines, the first step is to conduct pathogen confirmation tests using microorganisms isolated from the root cause of the disease. A primary condition is inducing disease in control fish species, which serves as the basis for developing the vaccine's primary strain. For example, Patent Document 1 describes a testing method for an Edwardsiella pneumoniae vaccine for halibut, but without a pathogenic primary strain as indicated in the document, vaccine development is impossible.

[0006] Non-Patent Literature 1 discloses a testing method for a vaccine containing a strain derived from streptococcal disease as an active ingredient. Non-Patent Literature 2 discloses a testing method for a vaccine containing a strain derived from vibriosis as an active ingredient. Non-Patent Literature 3 discloses a testing method for a vaccine containing a virus derived from red sea bream iridovirus disease as an active ingredient. Typically, the microorganisms used in vaccine manufacturing are derived from diseased fish, and potency testing is conducted using the pathogenicity against the target fish species.

[0007] In ayu (sweetfish), a safety potency test for a vaccine using an immersion method was conducted (Non-Patent Literature 2). In larval eels, there are experimental examples of applying this method for testing, but it has not been practically implemented. That is, the method used in ayu cannot infect larval eels with disease; although a method based on high-concentration, long-term immersion conducted by Ishihara et al. (Non-Patent Literature 4) has been disclosed, no testing method has been established.

[0008] Existing technical documents

[0009] Patent documents

[0010] Patent Document 1: Japanese Patent Application Publication No. 2006-312595

[0011] Non-patent literature

[0012] Non-patent literature 1: Animal biological preparation-based inactivated vaccine against amberrine hemolytic disease (injectable type)

[0013] Non-patent literature 2: Animal biological preparations based on inactivated vibrio infection in sweetfish

[0014] Non-Patent Literature 3: Animal Biology Periodic Formulation Standard Inactivated Vaccine for Iridovirus Disease

[0015] Non-patent literature 4: Journal of the Japan Fisheries Society 47(8), 999-1002 (1981)

[0016] Non-patent literature 5: Fish Pathology, 51(3), 87-91 (2016)

[0017] Non-patent literature 6: J Fish Dis. 2022 Nov;45(11):1683-1689 Summary of the Invention

[0018] The problem that the invention aims to solve

[0019] Despite soaring eel prices, the edibility of eels has decreased due to infections in eel farms. Vaccine development is considered the only solution to this problem. Other fish species face similar issues.

[0020] Methods for solving problems

[0021] If white eels are placed in rearing ponds, they will grow into black eels in about one week. Furthermore, white eels are harvested as eels in about six months to one year. In aquaculture farms, due to the difficulty of recovering fish after they are introduced into the ponds, vaccination during the developmental stages after they become black eels (the common name for eels in their larval stage) is practically limited to oral administration. Generally, the effectiveness of oral vaccines is not highly anticipated, and the feeding period until they become black eels significantly influences their subsequent growth, thus presenting considerable obstacles in their development. Paracolon infection is known to occur year-round in eel farms, starting from the larval stage. Vaccination treatment after they become injectable eels has limited effect on improving edibility due to infection prevention.

[0022] Before aquaculture begins, eel larvae are raised in small tanks for a period, a period considered suitable for standardized vaccine administration. However, larvae exhibit strong resistance to infectious diseases. For example, the biggest challenge in developing a vaccine for E. coli infection in larvae is artificially infecting them with Edwardsiella tarda. Due to their small size, it is difficult to inject the bacteria into larvae; only immersion or oral administration is possible. However, infection through immersion or oral administration of the bacteria is not established, hindering the establishment of vaccine testing methods and vaccine development. Effectiveness evaluation methods are essential for vaccine development; without such methods, vaccine development is impossible.

[0023] This invention provides a potency testing method that is also effective for larvae and juveniles as a basis for vaccine development, and provides an immersion vaccine that is also effective for larvae and juveniles.

[0024] The inventors have discovered a method for infecting larvae and juvenile fish (especially eels in their larval stage) with an attack strain. The inventors have also discovered that immersion vaccines induce immunity in larvae and juvenile fish (especially eels in their larval stage). Therefore, vaccines whose effectiveness can be confirmed in larvae and juvenile fish can be provided, for example, improving the edibility of the aforementioned eels.

[0025] According to the present invention, the following invention is provided.

[0026] (1) A vaccine for inducing resistance in fish (e.g., their larvae and juveniles) against fish infections, such as Edwardsiella tarda ( Edwardsiella tarda Immunity to infectious diseases (paracoelinosis) includes the bacterial body of the pathogen causing Edwardsiella tarda (e.g., Edwardsiella tarda) or a portion thereof that is immunogenic.

[0027] (2) According to the vaccine described in (1) above, wherein the target fish has a weight of less than 0.5g.

[0028] (3) The vaccine according to (1) or (2) above, wherein the target fish (i.e., the juvenile fish) is the white eel.

[0029] (4) The vaccine according to any one of (1) to (3) above is administered to fish by immersion method.

[0030] (5) The vaccine according to any one of (1) to (4) above, wherein the bacterial cells comprise inactivated bacterial cells.

[0031] (6) The vaccine according to any one of (1) to (5) above further comprises an adjuvant.

[0032] (7) The vaccine according to any one of (1) to (6) above, wherein the adjuvant comprises fucoidan.

[0033] (8) The vaccine according to any one of (1) to (7) above, wherein the bacterial cells are derived from a pathogenic strain isolated from an eel infected with paracolibacillosis.

[0034] (9) A method for testing the effectiveness of an impregnated vaccine, comprising the following steps: Immunization with immersion vaccines for white or black eels; Then remove the mucus from the body surface or gills of the white or black eel larvae; and The white or black eel larvae, after having their mucus removed, are brought into contact with the attacking bacteria. When the mortality rate caused by the challenge cells is reduced compared to the control group that has not undergone vaccine impregnation treatment, it indicates that the vaccine impregnation is effective.

[0035] (10) A method for promoting infection of white eels or black eels with pathogens, comprising: removing mucus from the body surface or gills of white eels or black eels.

[0036] (11) According to the method described in (9) or (10) above, the step of removing the mucus includes: immersing the white eel or black eel in a solution containing an effective amount of surfactant suitable for their survival.

[0037] (12) A method of manufacturing a vaccine for inducing immunity against a fish infection in larvae and juveniles of fish, the method comprising: In larvae and juvenile fish, confirm the effectiveness (presence or extent of effectiveness) of inactivated bacterial cells or a portion of the immunogenicity of the pathogen causing the fish infection against the challenge strain; and A vaccine containing an inactivated bacterial cell or a portion of the immunogenicity of the pathogen causing the fish infection, with confirmed efficacy, and pharmaceutically acceptable additives (e.g., a vaccine with confirmed efficacy or extent).

[0038] (13) The vaccine according to any one of (1) to (8) above has been shown to reduce mortality of juvenile fish, especially white eel larvae or black eel larvae, or eel larvae weighing less than 0.5g, under the attack strain by more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or 100%.

[0039] (14) According to the method described in (12) above, wherein the vaccine has been confirmed to reduce mortality of juvenile fish, especially white eel or black eel, or juvenile fish weighing less than 0.5g under the attack strain by more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or 100%.

[0040] Infecting the target fish species with disease is the first hurdle when considering vaccines. Overcoming this hurdle is a necessary and sufficient condition for vaccine development. Attached Figure Description

[0041] Figure 1A This demonstrates the impact of Edwardsiella tarda attack on the survival of pretreated white eels.

[0042] Figure 1B This demonstrates the impact of Edwardsiella tarda attack on the survival of untreated white eels.

[0043] Figure 2 This study demonstrates the dose-dependent effect of Edwardsiella tarda challenge strains on the survival of pretreated eels.

[0044] Figure 3 This study demonstrates the effect of additional fucoidan treatment on the survival of pretreated eels after being attacked by Edwardsiella tarda strain.

[0045] Figure 4A This study demonstrates the effect of immersion vaccine on the survival of pretreated eels after challenge with Edwardsiella tarda strain. Figure 4A In this method, white eels are vaccinated, and the attack occurs during their growth into black eels.

[0046] Figure 4B This study demonstrates the effect of immersion vaccine on the survival of pretreated eels after challenge with Edwardsiella tarda strain. Figure 4B In the process, the white eels are vaccinated and then attacked.

[0047] Figure 4C This study demonstrates the effect of immersion vaccine on the survival of pretreated eels after challenge with Edwardsiella tarda strain. Figure 4C In the process, the black eels are vaccinated and then attacked.

[0048] Figure 5 The data shows the temporal variation in the number of surviving eels caused by various attack strains. Detailed Implementation

[0049] In this instruction manual, "farmed fish" refers to fish raised for consumption, such as: yellowtail (juvenile yellowtail), red sea bream, high-bodied yellowtail, bluefin tuna, tiger pufferfish, flounder, golden trevally, horse mackerel, wrasse, striped rock bream, fine-scaled pufferfish, rockfish, scorpionfish, black sea bream, black rockfish, sea bass, blood sea bream, rock bass, large yellow croaker, spotted mackerel, tuna, seven-banded grouper, brown grouper, and eel, etc. Fish can be classified as ray-finned, neopterygian, or teleostor.

[0050] In this manual, "Edwardsiella piscicida" refers to the Gram-negative bacillus that causes paracolonizing infections. While *Edwardsiella piscicida* has been historically recognized as the causative agent of paracolonizing infections, it has been reclassified as *Edwardsiella piscicida* according to the new fish disease nomenclature adopted by the Japanese Society for Fish Pathology in March 2023. However, the causative agent of paracolonizing infections in fish (e.g., farmed fish) is also commonly referred to as *Edwardsiella piscicida*. In this manual, the common usage is followed, and unless otherwise specified, *Edwardsiella piscicida* will be used. *Edwardsiella piscicida* belongs to the genus *Edwardsiella* within the family Enterobacteriaceae in the class Enterobacteriaceae. Additionally, *Edwardsiella anguillarum*, a recently isolated species from *Edwardsiella piscicida*, is also a causative agent of paracolonizing infections. Paracolonizing infections are considered a zoonotic disease, widely infecting various animals including fish, amphibians, reptiles, and mammals. Edwardsiella tarda isolated from fish can be developed as a vaccine for fish. Edwardsiella tarda isolated from the same fish species is preferred for development as a vaccine for that species. In one instance, Edwardsiella tarda was isolated from eels.

[0051] In this specification, "immunity" refers to the defense mechanisms possessed by vertebrates against foreign substances (such as invaders). Immunity includes innate immunity and acquired immunity. Acquired immunity includes antigen-specific immunity. Vertebrates immunized with a vaccine can induce specific immunity against the components contained in that vaccine. Immune memory is the ability of the immune system to rapidly and specifically recognize antigens previously encountered by an individual and initiate an immune response. Immune memory forms the basis of vaccine efficacy. Immune memory occurs after an initial immune response against an antigen. Memory T cells and memory B cells remain after an immune response, enabling an immediate reaction to eliminate the antigen upon encountering the same antigen. Memory cells have a long lifespan and can persist in the body for decades.

[0052] In this specification, "vaccine" is a composition used to induce specific immunity against a pathogen of an infection in a subject (e.g., fish, preferably farmed fish). A subject (e.g., farmed fish) given a vaccine can develop specific immunity against the pathogen of an infection, acquiring resistance to the infection. A subject (e.g., farmed fish) given a vaccine can, for example, alleviate the symptoms of the infection or improve the survival rate of the infected individual. Vaccines for aquatic fish (e.g., farmed fish) are preferably attenuated or inactivated vaccines. Inactivated vaccines are preferably whole-cell vaccines. Inactivated vaccines can be obtained, for example, by subjecting the cells to physical or chemical treatment (preferably formalin treatment). The concentration of formalin and the treatment conditions of the cells can be appropriately set by those skilled in the art. Inactivated vaccines may also contain adjuvants in addition to inactivated cells. Oral administration of the vaccine is achieved by providing the fish with feed containing the vaccine. Immersion administration of the vaccine is achieved by immersing the fish in rearing water containing the vaccine. The rearing water preferably meets aquaculture water standards.

[0053] In this instruction manual, "eel" refers to the general term for fish belonging to the genus *Anguilla* within the family Anguillidae. Japanese eels, European eels, and American eels are abundant, with Japanese and European eels being widely farmed. Eels hatch from eggs in the sea, progressing through stages: leaf eel (small fish less than 1 cm), leaf eel (small fish less than 1–6 cm), white eel larvae (juveniles about 5–6 cm), and black eel larvae (juveniles) to adult eels. It is believed that they develop in the sea up to the white eel stage, after which they migrate from the sea to rivers and develop there. The white eel larvae later acquire morphological characteristics similar to adults. Due to their small size and lack of pigment, the white eel larvae are transparent. If the white eel larvae are raised at a temperature (e.g., approximately 28°C–30°C), they will grow into black eel larvae in about one week. Black eel larvae possess black pigment. Eel farming begins with catching wild eel larvae. In Japan, juvenile eels (shirae) that drift with ocean currents to the Japanese coast are caught and then farmed. Farming typically takes place in heated eel ponds within plastic greenhouses.

[0054] <The vaccine of this invention>

[0055] According to the present invention, a vaccine is provided for infections in farmed fish (particularly eels).

[0056] Vaccines contain the pathogen that causes an infection in fish, or an immunogenic portion thereof. Fish that receive the vaccine are thus able to develop immunity against the pathogen, acquiring resistance to the infection.

[0057] The pathogen can be a microorganism (e.g., bacteria) or a virus. In a preferred embodiment, the pathogen is a bacterium of the genus *Edwardella*, preferably *Edwardella piscicida* (i.e., *Edwardella piscicida*) or *Edwardella anguillarum*. The vaccine can be a live vaccine, an attenuated vaccine, or preferably an inactivated vaccine. The vaccine can be a whole-cell vaccine or a split vaccine. In one embodiment, the vaccine may comprise a whole-cell inactivated vaccine.

[0058] Examples of vaccines for farmed fish include injectable vaccines, oral vaccines, and immersion vaccines. In a preferred embodiment of the present invention, the vaccine is an immersion vaccine.

[0059] According to the present invention, the eel can be a juvenile eel weighing less than 0.5g, such as a white eel or a black eel. The preferred weight of the juvenile eel is 0.1g–0.5g / fish, 0.1g–0.4g / fish, 0.1g–0.3g / fish, 0.1g–0.2g / fish, 0.2g–0.4g / fish, or 0.2g–0.3g / fish, with a more preferred weight of 0.1g–0.2g / fish (hereinafter the same). Furthermore, in one embodiment, the weight of the juvenile eel can be 2000–10000, 3000–9000, 4000–8000, 5000–10000, 5000–9000, 5000–8000, or 5000–7000 per kg of juvenile eel. Eels at this developmental stage have strong resistance to infectious diseases, and the conditions for developing and dying from infectious diseases do not exist, making it difficult to evaluate the effectiveness of vaccines. However, in this invention, by pre-treating the aforementioned eel larvae, their resistance to infectious diseases is successfully weakened, causing them to develop diseases and die. Therefore, the effectiveness of vaccines against the aforementioned eel larvae can be clearly defined, and vaccines (especially vaccines with confirmed efficacy) can be developed for these eel larvae. Therefore, according to this invention, a vaccine (especially a vaccine with confirmed efficacy) for eel larvae is provided.

[0060] Eel larvae weighing less than 0.5g are suitable for immersion administration. Large quantities of larvae can be processed uniformly. Examples of eel larvae weighing less than 0.5g include white eel larvae and black eel larvae.

[0061] Therefore, according to the present invention, a vaccine is provided for inducing immunization against Edwardsiella tarda (i.e., Edwardsiella pisciformis) and / or Edwardsiella eel in larvae of white or black eels, or eels weighing less than 0.5 g. In this manner, the vaccine comprises cells of Edwardsiella tarda or an immunogenic portion thereof (e.g., antigen). The cells of Edwardsiella tarda (i.e., Edwardsiella pisciformis) and / or Edwardsiella eel (which may be a mixture of the two) may be attenuated cells or preferably inactivated cells. The vaccine is preferably administered to larvae of white or black eels, or eels weighing less than 0.5 g, by immersion. The immersion conditions are not particularly limited and can be suitably set by those skilled in the art; for example, immersion can be performed at a water temperature in the range of 4–25°C while aerating the larvae for 30 minutes to 24 hours. Immersion is carried out under conditions suitable for the survival of the larvae (especially suitable for vaccine administration). In one method, the vaccine is administered orally without food. In another method, the vaccine is disposed of under conditions where feeding is not required.

[0062] The effectiveness of the vaccine can be confirmed in juvenile or black eel larvae, or eel larvae weighing less than 0.5g. Of course, the effectiveness can also be further confirmed in later developmental stages of eel juveniles or adults. To rapidly evaluate the vaccine's effectiveness, confirmation of efficacy in juvenile or black eel larvae, or eel larvae weighing less than 0.5g, is desired.

[0063] In testing vaccine efficacy, infection is generally required to confirm the vaccine's effect on the disease. Confirmation can be achieved by demonstrating a statistically significant difference in vaccine efficacy between the vaccinated and unvaccinated groups. Testing vaccine efficacy requires infecting the subjects with the pathogen that causes the disease, thus inducing disease development. To date, methods have been developed to induce disease by injecting the pathogen into the subjects. Therefore, testing vaccine efficacy does not necessarily require an infection pattern occurring in the wild. For fish sizes that cannot be injected, alternative infection pathways need to be considered. For such fish, methods such as oral administration or immersion in the subject to infect them with the pathogen are suitable.

[0064] However, in some fish species or at certain developmental stages, disease symptoms may not fully develop despite contact with pathogens or administration of medication. For example, in larvae of white or black eels, or eels weighing less than 0.5g, disease does not occur even when they are immersed in an aqueous solution containing pathogens. Therefore, it is difficult to verify vaccine efficacy in these eel larvae. Furthermore, vaccine development is therefore inadequate. However, if a vaccine can be developed for larvae at this stage and immunization induced, it would be possible to vaccinate fish (especially eels) at subsequent infectious developmental stages.

[0065] The vaccine was administered to larvae of the white eel during their initial stage, and then challenged with Edwardsiella tarda during their later stage (the black eel stage). The vaccine's effectiveness (preferably improved survival rate) was confirmed. This result suggests that the white eel larvae have established (induced) an immune memory against Edwardsiella tarda. Thus, the vaccine of the present invention can induce immune memory in larvae. In particular, the vaccine of the present invention can induce immune memory (e.g., immune memory against Edwardsiella tarda) in eel larvae. This immune memory is maintained long-term in the individual.

[0066] According to the present invention, the vaccine may further comprise an adjuvant. There are no particular limitations on the adjuvant as long as it enhances the vaccine effect; examples include type I interferon, interferon-γ, polysaccharide adjuvants, and oily adjuvants. Fucoidan is an example of a polysaccharide adjuvant. Fucoidan is a component found in seaweed (especially brown algae, specifically kelp, wakame (wakame root), and sea lettuce) and is a type of water-soluble dietary fiber. Fucoidan is known to be a high-molecular-weight polysaccharide containing sulfated fucose. Complete Freund's adjuvant and incomplete Freund's adjuvant are examples of oily adjuvants. Additionally, brown algae extracts such as sea lettuce extract can be used as adjuvants. Brown algae extracts such as sea lettuce extract contain fucidan (e.g., 60% by weight or more, preferably 70% by weight or more, more preferably 80% by weight or more), exerting an adjuvant effect. The adjuvant itself does not need to have an immune-activating function, but it may itself have an immune-activating function.

[0067] The vaccine of the present invention has been shown to be effective in juvenile fish, particularly white eel larvae or black eel larvae, or eel larvae weighing less than 0.5g. For example, the vaccine of the present invention has been shown to reduce mortality by more than 50%, 60%, 70%, 80%, 90%, or 100% in juvenile fish, particularly white eel larvae or black eel larvae, or eel larvae weighing less than 0.5g, under the attack strain. Thus, the present invention provides a vaccine that has been shown to reduce mortality by more than 50%, 60%, 70%, 80%, 90%, or 100% in juvenile fish, particularly white eel larvae or black eel larvae, or eel larvae weighing less than 0.5g, under the attack strain.

[0068] <Method for inducing infectious diseases in this invention>

[0069] According to the present invention, a method is provided for inducing pathogen infection and preferred disease incidence in eel larvae by subjecting them to specific pretreatment, particularly white eel larvae or black eel larvae, or eel larvae weighing less than 0.5 g. The pretreatment aims to increase the susceptibility (or decrease the resistance) of eel larvae to pathogen infection. Infection promotion in larvae is important in vaccine development, particularly in evaluating vaccine efficacy. Furthermore, infection promotion in larvae is also considered essential for the development of vaccines with high efficacy.

[0070] According to the embodiments described later, juvenile fish can have their resistance to subsequent pathogens weakened by immersing them in an aqueous solution (rearing water) containing an effective amount of surfactant. This weakening of resistance to pathogens is considered to be due to the removal of mucus from the gills and / or body surface of the juvenile fish. This is because mucus is an important tissue for infection defense, and in juvenile fish treated with surfactant, the mucus is removed (e.g., sufficiently removed to the extent that the barrier function of the mucus is disrupted, or the protective function of the mucus tissue is compromised). Therefore, in one manner, the pretreatment can be the removal of mucus from the gills and / or body surface of the juvenile fish. Suitable methods for removing mucus include, for example, immersing the juvenile fish in an aqueous solution (rearing water) containing an effective amount of surfactant. Mucus removal can be, for example, sufficient removal to the extent that the barrier function of the mucus is disrupted, or the protective function of the mucus tissue is compromised. Those skilled in the art can use surfactants at concentrations lower than those that would exhibit unacceptable toxicity (especially lethality) to juvenile fish. Such concentrations can be appropriately determined by those skilled in the art.

[0071] As a surfactant, it can be used without particular limitation as long as it does not have unacceptable toxicity to larvae. Examples of surfactants include ionic and nonionic surfactants. Examples of ionic surfactants include anionic surfactants, cationic surfactants, and amphoteric surfactants. Representative anionic surfactants include fatty acid salts (e.g., carboxylates), alkylbenzene sulfonates, α-olefin sulfonates, higher alcohol sulfates, polyoxyethylene alkyl ether sulfates, alkyl phosphates, and polyoxyethylene alkyl ether phosphates. Representative cationic surfactants include aliphatic quaternary ammonium salts and alkyl benzyl ammonium salts. Representative nonionic surfactants include polyoxyethylene alkyl ethers and polyethylene glycol fatty acid esters. Representative amphoteric surfactants include alkyl carboxybetaines and alkyl amino fatty acid salts. In one embodiment, the surfactant includes a neutral detergent. In one embodiment, the surfactant includes sodium alkyl ether sulfate. In one embodiment, the surfactant includes fatty acid alkanolamides. In one embodiment, it includes sodium alkyl ether sulfate and fatty acid alkanolamides. The surfactant may further include alcohols such as ethanol.

[0072] It is believed that during their actual migration from the sea to rivers, white eels move through household wastewater containing detergents. These detergents are thought to disrupt the barrier function of their body surface mucus, potentially reducing their resistance to infection. Although eel larvae are normally highly resistant to infection, the reduced resistance to infection in farmed eel larvae may be one reason for the confirmed infections.

[0073] Treatment of larvae and juveniles using surfactants can be performed, for example, by immersing them in rearing water containing an effective amount of surfactant. The standard for treatment can be the degree to which the mucus on the larvae's body surface is removed or the degree to which the barrier function of the body surface mucus is disrupted. After treatment, the removal of gill mucus or the disruption of the body surface mucus barrier function can also be observed. Considering that larvae and juveniles cannot survive if the surfactant concentration is too high, those skilled in the art can appropriately set the surfactant concentration. As an example, when using sodium alkyl ether sulfate and fatty acid alkanolamide for treatment, larvae and juveniles can be treated at a concentration of approximately 0.05% by volume for 60 seconds. Complete removal or disruption of the mucus is not necessary. This is because, through partial removal or disruption, the mucus also loses its resistance to pathogens. Larvae and juveniles can be washed before infection testing. Washing can be performed by immersion in rearing water or by running water.

[0074] Pretreated larvae can be used for pathogen infection tests. Pretreated larvae can be immersed in rearing water containing pathogens, thereby becoming infected. The infection conditions can be appropriately determined by those skilled in the art; for example, infection can be established by immersing the larvae in rearing water containing a sufficient amount of pathogens. A sufficient amount of pathogens can be, for example, more than half, 60%, 70%, 80%, 90%, or 100% of the infected fish. In a preferred embodiment, the mortality rate or morbidity rate of individuals caused by the bacterial attack is 60% or more, more preferably 80% or more. When the mortality rate or morbidity rate reaches 100%, it is easy to establish a vaccine efficacy evaluation system. Therefore, in a more preferred embodiment, the mortality rate of individuals caused by the bacterial attack is 100%. Those skilled in the art can appropriately set a sufficient amount of pathogens, for example, it can contain about 10... 5 CFU / mL ~ Approximately 10 9 The range of CFU / mL is preferably about 10. 6 CFU / mL or higher, more preferably about 10 8 CFU / mL or higher, more preferably about 10 9 Amounts of CFU / mL or higher. Immersion of fry in rearing water containing the pathogen is not particularly limited, for example, it can be 10 to 24 hours. The preferred rearing water temperature at infection is approximately 28°C to approximately 32°C, more preferably approximately 30°C to approximately 32°C. Additionally, the rearing water can be aerated. In one method, the attack does not include oral administration of the bacteria. In another method, the attack is carried out under conditions of no feeding.

[0075] After infection treatment, eels can be raised in rearing water. In the rearing water, surfactants such as sodium alkyl ether sulfate and fatty acid alkanolamide can be added at a concentration lower than that of the pretreatment, for example, at a concentration of less than 10%, 5%, 4%, 3%, 2%, or 1% of the pretreatment concentration.

[0076] In the case of eel larvae, for example, infection with Edwardsiella tarda (i.e., Edwardsiella piraceae) or Edwardsiella eel can be achieved by immersing pre-treated larvae in rearing water containing Edwardsiella tarda (i.e., Edwardsiella piraceae) or Edwardsiella eel. In this invention, since infection is possible in eel larvae, the induction of immune response and immune memory induced by the vaccine can be easily evaluated.

[0077] All operations are carried out under conditions suitable for fish farming.

[0078] Example

[0079] In the infection method of the present invention, Edwardsiella tarda is used. Specifically, Edwardsiella tarda is used as strain KG-8401 G-10 obtained from eels through fish passage or as a fresh wild isolate from eels. Furthermore, as a pretreatment before infection, the fry are immersed in a rearing water containing a surfactant (here, sodium alkyl ether sulfate and fatty acid alkanolamide (abbreviated as SDOP·FAA)). It should be noted that the strain used is not limited to strain KG-8401 G-10 or a wild isolate from eels; it can also be a fresh isolate from infected fish such as eels or flounder, or a strain previously isolated and preserved.

[0080] The infection test method followed the testing method for vibrio disease vaccine in sweetfish. By immersing pre-treated larval eels in an infected bacterial solution under aeration, the larval eels were infected with Edwardsiella tarda. Then, during the observation period, the eels could be further cultured in a rearing water containing 0.1% to 3.5% sodium chloride. Alternatively, by further adding 0.001% to 0.005% by volume of SDOP·FAA to the rearing water, a continuous loading could be applied to the eels.

[0081] The bacteria required for infection are prepared as follows: For suitable strains such as KG-8401 G-10, the inoculum is spread using a platinum ring onto a suitable medium such as Brain Heart Infusion Broth (BHI) agar medium supplemented with 1.5% sodium chloride. Colonies formed after culturing at 25°C for 48 hours are suspended in 0.1 mL of phosphate buffer. This suspension is added dropwise to fresh agar medium supplemented with 1.5% sodium chloride, and then spread across the entire medium using a bacterial spreader. After culturing at 25°C for 24–48 hours, the entire culture is scraped off and suspended in 5 mL of phosphate buffer. This bacterial suspension is diluted 10–1000 times with rearing water supplemented with 1% sodium chloride to obtain a concentrated bacterial solution. Alternatively, the inoculum can be cultured in liquid medium supplemented with 1.5% sodium chloride at 25°C for 24 hours, and the resulting bacterial solution can be used as a concentrated bacterial solution. The rearing water temperature for infection is set at 30–32°C.

[0082] Vaccine preparation

[0083] Edwardsiella tarda strain KG-8401G-10, the causative agent of paracoccosis, was cultured in tryptone soybean broth (TSB) liquid medium supplemented with 1.5% sodium chloride at 25°C for 24–48 hours, followed by inactivation with 0.3% formalin to prepare the vaccine. The viable count before preparation was 10-10. 9CFU / mL. Additionally, as an adjuvant, fucoidan is used at a concentration of 0.1% to less than 3%, preferably 0.2% or more, and more preferably 0.5% or more. Fucoidan is extracted from seaweed using conventional methods. Regarding fucoidan, seaweed can be extracted with ethanol, the residue treated with citric acid, the resulting supernatant obtained by centrifugation is ultrafiltered and recovered into the filtrate. The fucoidan content in the seaweed extract is 85% or more. As an adjuvant, it is not limited to fucoidan; immune-activating substances derived from natural sources can also be used.

[0084] Vaccine administration

[0085] The vaccine was diluted with the rearing water to a concentration of 0.1%–10%, and the test fish were immersed in the solution for 30 minutes to 24 hours while being aerated in water at a temperature of 4–25°C. The eels used had a weight of 0.1–0.2 g / fish, and the number of fish was 5000–7000 fish / kg.

[0086] Experiment 1: Infection Experiment

[0087] Three small 1L tanks were used, each containing 10 white eel larvae (average weight 0.14g) caught at the same time. As a pretreatment, the 10 white eel larvae were immersed in a 0.05% SDOP·0.05% FAA solution (hereinafter referred to as "0.05% SDOP·FAA") for 60 seconds, and then rinsed off the medication with running water. Next, the pretreated white eel larvae were transferred to a bacterial infection solution (10g) diluted in rearing water with 1% added salt. 9 The pretreated white eels were immersed in phosphate buffer for 3 hours while aerated at 30°C. This served as an uninoculated control. The eels were then reared for 2 weeks in water containing 0.001% SDOP·0.001% FAA (hereinafter referred to as "0.001% SDOP·FAA") while aerated at 30°C. Feeding was not permitted during the rearing period. The number of eels that died during the post-infection rearing period was counted, and bacterial isolation was performed.

[0088] according to Figure 1A The result, using 10 9 CFU / mL of bacteria were present, and no deaths were confirmed in the uninoculated control, but all eels that underwent pretreatment were confirmed to be dead. Furthermore, Edwardsiella tarda was successfully isolated from all the dead fish. It should be noted that for eels that did not undergo the above pretreatment but were infected using the same method as described above with a solution containing 10... 9 White eels treated with bacterial suspension containing CFU / mL *Edwards latetus* showed no confirmed infection or mortality (see reference). Figure 1BThe experiment involved varying the concentrations of sodium chloride and sodium sulfate in the bacterial solution used for infection, but no infection or death was confirmed in the juvenile eels under any of these conditions. This demonstrates that, without pretreatment, juvenile eels possess extremely strong resistance to infection.

[0089] Trial 2: Evaluation of vaccine efficacy

[0090] Four small 1L tanks were used, each containing 10 eels (average weight 0.14g) caught at the same time. The 10 eels in each experimental group were pretreated by immersing them in a 0.05% SDOP·FAA solution for 60 seconds, followed by rinsing off the solution with running water. Next, the pretreated eels were transferred to a bacterial infection solution diluted with 1% saline (containing 10... 7 10 8 Or 10 9 The bacteria were immersed in a solution containing CFU / mL of bacteria at 30°C for 3 hours under aeration. Additionally, the pretreated eels were immersed in phosphate buffer for 3 hours as an uninoculated control. The eels were then reared for 2 weeks in rearing water containing 0.001% SDOP·FAA at 30°C under aeration. No feeding was performed during the rearing period. The number of eels that died during the post-infection rearing period was counted, and bacterial isolation was performed.

[0091] according to Figure 2 The result was in 10 9 At CFU / mL, 100% mortality was confirmed, at 10 8 At CFU / mL, 20% mortality was confirmed, at 10 7 At CFU / mL and in control eels, 0% mortality was confirmed. Edwardsiella tarda was isolated from the dead fish. Thus, the use of Edwardsiella tarda to challenge larvae and juveniles showed a dose-dependent effect.

[0092] Experiment 3: Protective effect of fucoidan

[0093] Two small tanks, each containing 10 white eel larvae (average weight 0.14g) caught at the same time, were used. A solution containing 1% fucoidan was introduced into one tank, and PBS diluted 100 times was introduced into the other tank. Ten white eel larvae were placed in each tank. The larvae were immersed in water at 20°C for 5 hours. Two weeks after the fucoidan treatment, as a pretreatment, the treated larvae were immersed in a 0.05% SDOP·FAA solution for 60 seconds, followed by rinsing off the medication with running water. The larvae were then transferred to an infection solution diluted with 1% saline (10... 9In a solution containing CFU / mL, the eels were immersed for 3 hours while aerated at 30°C, and then challenged with Edwardsiella tarda. Each white eel larva was then reared for 2 weeks in a rearing solution containing 0.001% SDOP·FAA while aerated at 30°C.

[0094] No abnormalities were observed in eels during the 2-week immunization period with fucoidan solution, thus confirming the safety of the 1% fucoidan solution. Additionally, as... Figure 3 As shown, fucoidan has been confirmed to have a protective effect against paracolon infection.

[0095] Experiment 4: Adjuvant Effect Test of Fucoidan

[0096] To house 10 white eel larvae (average weight 0.14g) caught at the same time, three small tanks with a capacity of 1L each were prepared. A vaccine solution without added fucoidan (1×10⁻⁶) was added to the first tank. 8 CFU / mL seawater (the same applies to all vaccine solutions below), add vaccine solution with 1% fucoidan to the second tank, and add diluted PBS to the third tank. Contain 10 white eels in each tank. Immerse the white eels in each tank at 20°C for 5 hours. In the second week after immunization, as a pretreatment, immerse in 0.05% SDOP·FAA solution for 60 seconds, rinse off the medication with running water, and transfer the eels to rearing water containing the attack bacterial solution with 1% added salt (10...). 9 In a solution containing CFU / mL, the eels were subjected to aeration at 30°C and immersion attack for 3 hours. They were also reared for 2 weeks in a solution containing 0.001% SDOP·FAA at 30°C with aeration. It should be noted that in the second week after immunization, the white eels grew into black eels.

[0097] like Figure 4A As shown, the vaccine improved the survival rate of eels relative to the attacking bacteria, but the addition of fucoidan to the vaccine further improved the eel survival rate. This result confirms the adjuvant effect of fucoidan.

[0098] In the above scenario, white eels were vaccinated, and then black eels were attacked with pre-treatment and challenge bacteria. Similarly, white eels were vaccinated, and one week later, they were attacked with pre-treatment and challenge bacteria. The results were as follows... Figure 4B As shown, the vaccine's effectiveness in the white eel larvae was clearly demonstrated at this stage. Subsequently, black eels were treated with the vaccine, and one week later, they were attacked with the pre-treated and challenge bacteria. The results were as follows... Figure 4CAs shown, the vaccine treatment for black eels was sufficient for immune activation, and its effectiveness was confirmed in black eels. It should be noted that the white eels were not fed while being maintained as white eels. For example, in Figure 4B In this experiment, the white eels were not fed during the trial period. In contrast, in... Figure 4A In the experiment, the white eels were fed, but they quickly transformed into black eels after feeding. It should be noted that... Figure 4B In addition, experiments were conducted while the animals were being fed.

[0099] While eel larvae are highly resistant to infection, pretreatment to establish infection allows for the examination of vaccine efficacy against them. This means that vaccines against eel larvae can be developed, and that eel larvae can be used to determine the efficacy of vaccine candidates.

[0100] Experiment 4: Selection of the attack strain

[0101] Three small 1L tanks were used, each containing 10 white eel larvae (average weight 0.14g) caught at the same time. As a pretreatment, the white eel larvae (10 larvae) were immersed in a solution of 0.05% SDOP and 0.05% FAA (hereinafter referred to as "0.05% SDOP·FAA") for 60 seconds, and then rinsed off the medication with running water. Next, the pretreated white eel larvae were transferred to a bacterial infection solution (10 larvae) diluted in rearing water with 1% added salt. 9 The pretreated white eels were immersed in phosphate buffer for 3 hours while being aerated at 30°C. This served as a no-inoculation control. The eels were then reared for 2 weeks in water containing 0.001% SDOP·0.001% FAA (hereinafter referred to as "0.001% SDOP·FAA") while being aerated at 30°C. Feeding was not permitted during the rearing period.

[0102] For the preparation of bacteria for infection, suitable strains such as KG-8401 G-10, BSET22001, and BSET23001 are prepared by spreading the inoculum onto a suitable culture medium, such as brain heart broth (BHI) agar medium supplemented with 1.5% sodium chloride, using a platinum ring. Colonies formed after culturing at 25°C for 48 hours are suspended in 0.1 mL of phosphate buffer. This suspension is then added dropwise to fresh agar medium supplemented with 1.5% sodium chloride, and then spread across the entire medium using a bacterial spreader. After culturing at 25°C for 24–48 hours, the entire culture is scraped off and suspended in 5 mL of phosphate buffer. This bacterial suspension is diluted 10–1000 times with feeding water supplemented with 1% sodium chloride, and the resulting bacterial suspension is used as the adjusting bacterial suspension. Alternatively, a bacterial suspension obtained by culturing the inoculum in liquid medium supplemented with 1.5% sodium chloride at 25°C for 24 hours can also be used as the adjusting bacterial suspension. The concentration of the bacterial solution used to dilute the adjusted bacterial solution was 0.5 × 10⁻⁶. 9 ~9.9×10 9 The range of CFU / mL.

[0103] The results of the infection experiment are as follows Figure 5 As shown. Figure 5 In this study, the attacking bacteria infected juvenile eels, inducing a decrease in survival rates. The survival time of the attacked eels varied depending on the specific strain used. This suggests that vaccine efficacy can be confirmed across various observation periods through selective strain testing.

[0104] Analysis of the bacterial cells used in Experiment 4 (Refer to Experiment 1)

[0105] Colonies of strains KG8401, BSET22001, and BSET23001, obtained by incubation at 25°C for 24 hours, were picked using tryptone soybean broth (BD), and DNA was extracted using the DNeasy Blood and Tissue Kit (QIAGEN). Using this DNA as a template, qPCR was performed using primers (EP14529F and EP14659R) and probe (EP14615P) specifically designed by Reichley et al. (2015) for detecting *Edwardsiella faecium*, and primers (EPL1583F and EPL1708R) and probe (EPL1611P) specifically for detecting *Edwardsiella eelii* to identify the bacterial species. It should be noted that 6-FAM was appended to the 5' end of both probes, and BHQ1 was appended to the 3' end. In addition, the qPCR reaction solution consisted of 1.5 μL (15 ng) template DNA, 10.0 μL Probe qPCR Mix (Bio-Bio), 0.4 μL each of forward and reverse primers (final concentration 0.2 μM each), and 0.8 μL probe (final concentration 0.4 μM), adjusted to a final volume of 20.0 μL with ultrapure water. The qPCR reaction was performed using a MiniOpticon real-time PCR system (Bio-Rad), with 50 cycles of initial heat denaturation at 95℃ for 30 seconds, followed by two more cycles (95℃ for 5 seconds and 60℃ for 30 seconds).

[0106] Strains KG8401 and BSET22001 were positive for primers specifically detecting *Edwardsiella fish-killing* and negative for primers specifically detecting *Edwardsiella eelensis*, and were therefore classified as *Edwardsiella fish-killing*. Strain BSET23001 was negative for primers specifically detecting *Edwardsiella fish-killing* and positive for primers specifically detecting *Edwardsiella eelensis*, and was therefore classified as *Edwardsiella eelensis*. The sequences of the primers used are as follows.

[0107] Sequences of primers used for amplification of Edwardsiella faecium and sequences of probes used for detection of amplification products.

[0108] EP14529F CTTTGATCATGGTTGCGGAA (Serial Number 1)

[0109] EP14659R CGGCGTTTTCTTTTCTCG (Serial Number 2)

[0110] EP14615P CCGACTCCGCGCAGATAACG (Serial Number 3)

[0111] Sequences of primers for amplification of Edwardsiella elegans and sequences of probes for detecting amplification products.

[0112] EPL1583F GATCGGGTACGCTGTCAT (Serial Number 4)

[0113] EPL1708R AATTGCTCTATACGCACGC (Serial Number 5)

[0114] EPL1611P CCCGTGGCTAAATAGGACGCG (Serial Number 6)

[0115] [Table 1]

[0116] Reference Experiment 2: Analysis of Aggregation Reactions Caused by Antiserum against Edwardsiella tumefaciens and Antiserum against Edwardsiella eel

[0117] The antiserum against Edwardsiella faecium was prepared as follows: An intraperitoneal injection of a solution containing 0.1 mL of Edwardsiella faecium strain KG8401 was administered to an eel weighing approximately 200 g. Three days later, a second intraperitoneal injection of 0.1 mL was administered. Blood was collected from the eel two weeks after the second injection.

[0118] The antiserum against Edwardsiella elegans strain BSET23001 was prepared in the same manner as the antiserum against Edwardsiella tectoris.

[0119] Agglutination reactions were confirmed using a slide agglutination test with live bacteria and a 96-well plate agglutination test with inactivated bacteria.

[0120] The results are shown in Tables 2-4. As shown in Tables 2-4, both the antisera against *Edwardsiella fisheri* and *Edwardsiella anguillarum* showed agglutination reactions against both. Therefore, it is considered that the inactivated vaccines against *Edwardsiella fisheri* and *Edwardsiella anguillarum* are also effective against both. The antigens reacting may differ between antisera prepared from rabbits and antisera prepared from eels. However, cross-reactivity across species was similarly observed in both cases. Therefore, although *Edwardsiella fisheri* and *Edwardsiella anguillarum* are classified as different species based on differences in the sequences of several genes, they are very closely related species, suggesting that they cannot be serologically distinguished. It should be noted that no agglutination was observed with any antiserum against *V. anguillarum*, which served as a negative control.

[0121] [Table 2]

[0122] [Table 3]

[0123] [Table 4]

[0124] Thus, Edwardsiella fish-killing and Edwardsiella eel-killing cannot be serologically distinguished. Furthermore, it has been clarified that vaccines against paracolon infection can be prepared using vaccines containing inactivated cells of either Edwardsiella fish-killing or Edwardsiella eel-killing.

[0125] Trial 5: Trial of vaccine efficacy

[0126] The white eels were treated in the same manner as in Experiment 4, and the challenge strain and vaccine were prepared separately in the same way as in Experiment 4. In Experiment 5, it was confirmed whether the inactivated vaccine against Edwardsiella elatior (BSET23001) could prevent challenge against Edwardsiella flocculationis (BSET22001 strain), and whether the inactivated vaccine against Edwardsiella flocculationis (BSET22001 strain) could prevent challenge against Edwardsiella elatior (BSET23001).

[0127] The results are shown in Table 5. As shown in Table 5, the inactivated vaccine against Edwardsiella elegans (BSET23001) prevented the attack of Edwardsiella harzianum (BSET22001 strain).

[0128] [Table 5]

Claims

1. A vaccine for inducing immunity against a fish infection in larvae or juvenile fish, comprising the cells of a pathogen of paracolon infection or an immunogenic portion thereof.

2. The vaccine according to claim 1, wherein, The target fish species weigh less than 0.5g.

3. The vaccine according to claim 1 or 2, wherein, The target fish for drug administration (i.e., the juvenile fish) is the white eel.

4. The vaccine according to any one of claims 1 to 3, which is administered to fish by immersion method.

5. The vaccine according to any one of claims 1 to 4, wherein, The bacterial cells include inactivated bacterial cells.

6. The vaccine according to any one of claims 1 to 5, further comprising an adjuvant.

7. The vaccine according to any one of claims 1 to 6, wherein, The adjuvant contains fucoidan.

8. The vaccine according to any one of claims 1 to 7, wherein, The bacteria were derived from pathogenic strains isolated from eels infected with paracolibacillosis.

9. A method for testing the effectiveness of an impregnated vaccine, comprising the following steps: Immunization with immersion vaccines for white or black eels; Then remove the mucus from the body surface or gills of the white or black eel larvae; and The white or black eel larvae, after having their mucus removed, are brought into contact with the attacking bacteria. When the mortality rate caused by the challenge cells is reduced compared to the control group that has not undergone vaccine impregnation treatment, it indicates that the vaccine impregnation is effective.

10. A method for promoting infection of white or black eels with a pathogenic agent, comprising: Remove the mucus from the body surface or gills of the white or black eel larvae.

11. The method according to claim 9 or 10, wherein, The steps to remove the slime include immersing the white or black eel larvae in a solution containing an effective amount of surfactant suitable for their survival.

12. A method of manufacturing a vaccine for inducing immunity against a fish infection in larvae and juvenile fish, the method comprising: In larvae, confirm the effectiveness of inactivated bacterial cells or a portion of the immunogenicity of pathogens causing fish infections against challenge strains. as well as A vaccine is obtained containing inactivated bacterial cells or a portion of the immunogenicity of the pathogen causing the fish infection, whose effectiveness has been confirmed, and pharmaceutically acceptable additives.

Citation Information

Patent Citations

  • Automatic screwdriver

    EP0014529A1

  • Process and device for the decoration of a substrate, in particular spectacle frame

    EP0014615A1

  • Flexible device for sucking up large quantities of fluids, especially for pumping seawater from the depth

    EP0014659A1

  • Vaccine for fishes

    JP2006312595A