Application of selenoprotein O in lipid metabolism regulation and mitochondrial protection

Abstract

The invention discloses application of selenoprotein O in lipid metabolism regulation and mitochondrial protection, and belongs to the technical field of biochemistry. The technical problem to be solved is that specific mechanisms of lipid metabolism regulation and mitochondrial stress protection in the prior art are not clear. According to the key point of the technical scheme, the application of selenoprotein O in lipid metabolism regulation and mitochondrial protection is provided, NAD < + > in mitochondria is hydrolyzed into NMN and AMP under the action of SelO, Mn < 2 + > is used as a cofactor, the reaction is sensitive to enhanced mitochondrial matrix pH reaction, the mitochondria is protected from continuous excessive metabolism activation, and in addition, the selenoprotein O can be used as a lipid metabolism regulator. The SelO directly interacts with fatty acid oxidation related enzymes to inhibit lipid catabolism. The discovery of the application reveals a conservative space-time NAD + regulation mechanism, and highlights the physiological importance of the space-time NAD + regulation mechanism in prokaryotes and eukaryotes; the kit or the medicine for adjusting the activity of the selenoprotein O in the mitochondria can be used for preparing products for preventing or treating mitochondria-related diseases or preparing weight-losing products.

Description

Application of selenoprotein O in lipid metabolism regulation and mitochondrial protection Technical Field

[0001] This invention belongs to the field of biochemistry and relates to selenoprotein O, specifically to the application of selenoprotein O in lipid metabolism regulation and mitochondrial protection. Background Technology

[0002] NAD (nicotinamide adenine dinucleotide) is a metabolite that plays a central role in energy metabolism; it exists in the form of a redox pair: NAD + (Oxidized form) and NADH (reduced form). NAD + As a cofactor, it accepts and transports hydride ions (H⁺), transferring them from the redox reaction to the electron transport chain (ETC) complex in the form of NADH. Subsequently, H⁺ is pumped into the mitochondrial intermembrane space, generating the membrane potential gradient required for ATP production. Therefore, the increase in matrix pH reflects the efficient use of NAD. + / NADH conversion and energy production. In addition, NAD... + It is used as a cofactor for hundreds of enzymes and plays an important role in regulating various life processes.

[0003] NAD + Mitochondrial NAD+ is widely distributed within cells, yet highly localized. Therefore, mitochondrial NAD+... + (mNAD + The regulation of mNAD is independent of other subcellular repositories. + The homeostasis of mNAD is crucial for many biological processes, making its upregulation and downregulation extremely important. Although regarding mNAD... + The research period was long, and he was responsible for NAD. + Recognition of the mitochondrial transporter SLC25A51 was recently established. Furthermore, the reversible reaction catalyzed by NMNAT3 buffers changes in mNAD+, thereby maintaining its homeostasis. Compared to other metabolites, NAD participates in metabolic pathways through the conversion between its two forms but is not inherently self-consumed. + It can be degraded into NAM and ADPR via SARM17. Furthermore, NAD... + NAD+ can also be passively consumed during protein ADP ribosylation of PARPs or protein deacetylation of SIRTs. However, these protein modifications or demodifications are regulated by multiple signaling pathways, which is not a way to actively control NAD+. Furthermore, protein modifications typically occur in the picomolar to nanomolar range, making it unlikely to explain NAD+ levels in the micromolar to millimolar range over short periods. + Fluctuations. NAD +The regulation of NAD is crucial for many life processes, and revealing novel regulatory mechanisms specific to mitochondria responsible for NAD fluctuations warrants further investigation; however, the mechanisms leading to NAD in mitochondria... + The mechanism of degradation remains unclear.

[0004] Relevant patent documents retrieved:

[0005] This document, published in China (CN111693715A) on September 22, 2020, discloses a method for screening mitochondrial proteins modified by monophosphate uridine monophosphate (UPM). The method uses biotin-labeled UTP (Biotin-16-UTP) as a raw material. Under the action of selenoprotein O (SelO), total mitochondrial proteins are first subjected to UMP modification. The UMP-modified proteins also bear a biotin label. Subsequently, biotin-streptavidin pull-down technology is used to screen out the modified proteins, and finally, mass spectrometry is used to determine the modified proteins and modification sites. This method can screen out UMP-modified proteins from total mitochondrial proteins.

[0006] Relevant non-patent literature retrieved: A 2024 graduation thesis from Northeast Agricultural University, titled "Study on the Mechanism of Selenium Deficiency-Induced Lung Inflammatory Response in Chickens Based on SelO-Regulated Macrophage M1 / M2 Polarization," disclosed that SelO interacts with mitochondrial transcription factor A (TFAM) through amino acid residues, exhibiting a stable conformation, and that TFAM and SelO have an interaction relationship. Silencing SelO in HD11 cells promoted Lon protease-mediated TFAM degradation. After specifically inhibiting Lon with bortezomib to maintain TFAM abundance, silencing SelO did not interfere with macrophage polarization, indicating that SelO regulates macrophage polarization through TFAM. Deficiencies in SelO and TFAM impair mitochondrial biogenesis, increasing mitochondrial reactive oxygen species production, reducing mitochondrial DNA copy number, and inhibiting mitochondrial energy metabolism. However, inhibiting TFAM degradation reversed the negative effects caused by SelO deficiency, suggesting that SelO maintains normal mitochondrial function through TFAM. Mechanistically, SelO deficiency leads to uncontrolled TFAM degradation, impairs mitochondrial function and energy metabolism, and reprograms macrophage metabolism, thereby inhibiting M2 macrophage polarization and promoting M1 macrophage polarization. This study characterizes SelO as supporting macrophage phenotypic transformation by targeting TFAM and maintaining mitochondrial function and oxidative metabolic homeostasis, but does not disclose the role of SelO in NAD hydrolysis. + Related content.

[0007] The journal or book title is *Cell Chemical Biology*, the article title is *From Young to Old: Ampylation Hits the Brain*, volume number 27, publication date 2020.07.16. This article discloses that SelO, as an important adenylate transoxidase, is key to improving mitochondrial function in Alzheimer's disease (AD) through high expression. In vitro and in vivo treatment of Alzheimer's disease mice and mouse neuroma cells with selenomethionine may maintain mitochondrial homeostasis by upregulating SelO expression, promoting mitochondrial fusion or division, restoring mitochondrial membrane potential, and inhibiting intracellular reactive oxygen species generation. This suggests that the correlation between SelO and cellular mitochondrial homeostasis is based on adenylation, and the specific mechanism is still unclear. Summary of the Invention

[0008] The purpose of this invention is to provide: the application of a protein fragment comprising the CSS tail residue C667 of selenoprotein O or its regulator in products for lipid metabolism regulation or mitochondrial protection regulation, and related technologies, to solve the technical problems such as the unclear specific mechanisms of lipid metabolism regulation and mitochondrial stress protection in the prior art, or combinations thereof.

[0009] Terminology: Unless otherwise defined, all technical terms in this document have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and disclosures cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0010] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0011] The definition of standard chemical terms can be found in the reference "Clinical Metabolomics: Methods and Protocols", Humana Press, Martin Giera and Elena Sánchez-López (eds.), 2nd edition (2025)

[0012] Unless otherwise stated, conventional methods within the scope of the art, such as gene knockdown, gene knockout, RNA extraction and detection, shall be used.

[0013] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0014] Mitochondrial NAD + (mNAD) + Nicotinamide adenine dinucleotide (mNAD) is the oxidized form of nicotinamide adenine dinucleotide located in the mitochondrial matrix. It is a core coenzyme in energy metabolism, participating in processes such as the tricarboxylic acid cycle and electron transport chain, and is crucial for ATP production. + Homeostasis regulation is independent of cytoplasmic NAD + The level of SelO directly affects mitochondrial respiratory efficiency and lipid metabolism. SelO can specifically regulate mNAD through hydrolysis. + Concentration should be controlled to avoid excessive accumulation that could cause mitochondrial damage.

[0015] Fatty acid oxidation (FAO) is a metabolic process that occurs in the mitochondrial matrix. Through a series of enzymatic reactions, fatty acid chains are broken down into acetyl-CoA, which then participates in the tricarboxylic acid cycle to generate energy. It is a core pathway for lipid energy supply. Key FAO enzymes (such as HADHA and HADHB) can form complexes, and SelO directly binds to these complexes and locally degrades NAD+. + It selectively inhibits FAO activity, and inhibiting SelO can enhance lipid catabolism.

[0016] Co-immunoprecipitation (CO-IP) is a protein-protein interaction detection technique based on the specific binding of antigen and antibody. It involves coupling an antibody to the target protein to a solid-phase carrier, capturing the target protein and its interacting proteins from cell lysates, and then identifying the binding partners using Western blotting or mass spectrometry. In this invention, this technique is used to verify the direct interaction between SelO and FAO enzymes such as HADHA and HADHB, providing crucial evidence for the molecular mechanism by which SelO regulates FAO.

[0017] Michaelis-Menten kinetics is a kinetic model describing the relationship between enzyme reaction rate and substrate concentration. Key parameters include the Michaelis constant (Km) and the maximum reaction rate (Vmax). Km reflects the enzyme's affinity for the substrate, and Vmax reflects the upper limit of the enzyme's catalytic activity. In this invention, Michaelis-Menten kinetic analysis confirms SelO2-mediated NAD+. + The hydrolysis reaction follows typical enzyme-catalyzed reaction rules, and is effective for NAD+.+ It exhibits high substrate specificity.

[0018] Gene set enrichment analysis (GSEA) is a bioinformatics method for interpreting high-throughput sequencing data (such as RNA-seq). It reveals changes in biological function induced by experimental treatments by assessing the enrichment of predefined functional gene sets (such as metabolic pathways and signaling pathways) in differentially expressed genes. In this invention, this method was used to analyze changes in the liver transcriptome after SelO knockout, confirming a significant upregulation of metabolic pathways such as the tricarboxylic acid cycle and fatty acid oxidation, providing global evidence for the metabolic regulatory function of SelO.

[0019] Mitochondrial homeostasis is the dynamic maintenance of mitochondrial structural integrity, functional stability, and metabolic balance, encompassing the coordinated regulation of mitochondrial morphology, membrane potential, energy metabolism efficiency, and ROS levels. SelO2 hydrolyzes mNAD... + It plays a key regulatory role in maintaining mitochondrial homeostasis by inhibiting excessive FAO and maintaining mitochondrial membrane structure stability, preventing mitochondrial fragmentation and abnormal membrane permeability.

[0020] Targeted ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS) is a highly sensitive and specific metabolite quantification technique. It achieves metabolite separation through ultra-high performance liquid chromatography and combines this with the specific detection capabilities of tandem mass spectrometry to accurately quantify target metabolites (such as NAD) in complex samples. + The concentrations of NAD+, NMN, fatty acid acyl-CoA, etc. are measured. This technique is used in this invention to determine the concentrations of NAD+ in mitochondria. + The changes in the levels of related metabolites and FAO intermediates provide direct data support for the enzymatic function and metabolic regulatory role of SelO.

[0021] Conditional knockout mice are mouse models in which a target gene is specifically knocked out in a specific tissue or cell type using genetic engineering techniques, avoiding embryonic lethality or multi-organ abnormalities that may result from systemic knockout. The liver-specific SelO knockout mouse constructed in this invention inactivates the SelO gene only in liver tissue, allowing for specific investigation of the physiological functions of SelO in liver lipid metabolism and mitochondrial homeostasis, excluding interference from other tissues.

[0022] Nicotinamide mononucleotide (NMN) is NAD+ + A key intermediate in the synthetic pathway, and also a product of SelO2 hydrolyzed NAD2. + One of the direct products can be converted into NAD through NMNAT enzyme catalysis.+ Participating in NAD + The replenishment and turnover of the NMN pool. Changes in intracellular NMN levels directly reflect NAD. + The synthesis and degradation balance of SelO is verified in this invention by detecting NMN content. + Hydrolytic activity.

[0023] Doxycycline (Tet) is a broad-spectrum semi-synthetic tetracycline antibiotic that inhibits protein synthesis by suppressing the function of the 30S ribosomal subunit in bacteria. It has inhibitory effects on Gram-positive bacteria, Gram-negative bacteria, and pathogens such as mycoplasma and chlamydia. In scientific research, doxycycline is often used as an inducer in "tetracycline-inducible gene expression systems," achieving spatiotemporally specific expression of target genes (such as shRNA and protein-coding genes) by regulating promoters (such as the Tet-On / Tet-Off system). For example, in this invention, it is used to induce the expression of SelO-targeting shRNA in HeLa cells to achieve gene knockdown. This drug is well absorbed orally, has strong tissue penetration, and a long half-life (approximately 18-22 hours). Clinically, it can be used to treat respiratory infections, urinary tract infections, acne, and other diseases. When used in scientific research, attention should be paid to its concentration dependence to avoid non-specific cytotoxicity, and it is necessary to verify that it does not interfere with the experimental system (such as cell metabolism and gene expression) (e.g., in this invention, the use of doxycycline alone did not affect the NAD level and SelO expression of HeLa cells).

[0024] To achieve the above objectives, the present invention provides the following technical solution: On the one hand, the present invention provides the application of a protein fragment comprising the CSS tail residue C667 of selenoprotein O or its regulator in products for lipid metabolism regulation or mitochondrial protection regulation.

[0025] Preferably, the regulator is used to enhance or inhibit the activity of the protein fragment, or the regulator is used to promote or inhibit the expression of the protein fragment.

[0026] Preferably, the protein fragment is selenoprotein O.

[0027] Preferably, the product has any one or more of the following functions: increasing selenoprotein O activity and promoting NAD in mitochondria. + Hydrolysis; inhibiting selenoprotein O activity promotes lipid catabolism in mitochondria; increasing selenoprotein O activity enhances mitochondrial stress protection.

[0028] Preferably, the product has any one or more of the following functions: weight regulation, enhanced immunity, relief of physical fatigue, control of body fat, maintenance of healthy blood lipid levels, prevention or treatment of obesity, or prevention or treatment of mitochondrial-related diseases.

[0029] Preferably, the inhibition of selenoprotein O activity to promote lipid catabolism in mitochondria includes inhibiting the binding of selenoprotein O to lipid metabolism enzymes to promote lipid catabolism; the lipid metabolism enzymes include HADHA, HADHB, HADH, ACAA2, or ECHS1.

[0030] Preferably, the enhancement of selenoprotein O activity to strengthen mitochondrial stress protection includes SelO responding to increased matrix pH during enhanced mitochondrial respiration by locally reducing NAD in the vicinity of catabolic enzymes. + It temporarily inhibits the activity of catabolic enzymes, thereby reducing mitochondrial stress.

[0031] Preferably, the regulator includes doxycycline or siRNA targeting SelO.

[0032] Preferably, the product is food, health product, or medicine.

[0033] Preferably, the health product is used to: enhance immunity, relieve physical fatigue, control body fat, or maintain healthy blood lipid levels.

[0034] Preferably, the medicine is used for: weight regulation, prevention or treatment of obesity, or prevention or treatment of mitochondrial-related diseases.

[0035] Preferably, the drug further includes a pharmaceutically acceptable carrier.

[0036] Pharmaceutically acceptable carriers are excipients or excipients used in pharmaceutical formulations in conjunction with the active ingredient, possessing safety, compatibility, and functionality. They themselves have no therapeutic activity but can help improve the physicochemical properties, stability, route of administration suitability, and bioavailability of the drug. These carriers must meet pharmaceutical standards, have no significant toxicity, irritation, or immunogenicity, do not adversely interact with the active pharmaceutical ingredient, and be safely metabolized or excreted in vivo. Common types include fillers (such as lactose and mannitol), binders (such as starch and povidone), disintegrants (such as crospovidone and sodium carboxymethyl starch), lubricants (such as magnesium stearate), solvents (such as water, ethanol, and polyethylene glycol), and nanoparticles for delivery (such as liposomes and exosomes). The specific selection depends on the drug dosage form (tablets, injections, capsules, etc.), route of administration (oral, intravenous, topical, etc.), and the drug's own characteristics (solubility, stability, etc.). Their core function is to ensure the feasibility of drug formulation production, uniformity of quality, and the safety and efficacy of clinical use.

[0037] On the other hand, the present invention also provides a method for weight loss, namely, administering a drug to a subject that regulates the activity of selenoprotein O in mitochondria.

[0038] On the other hand, the present invention also provides a method for preventing or treating mitochondrial-related diseases, namely, administering a drug to a subject that regulates the activity of selenoprotein O in mitochondria.

[0039] The present invention has at least the following beneficial effects: 1. The present invention provides the application of selenoprotein O (SelO) in lipid metabolism regulation or mitochondrial protection. In selenoprotein O knockout mice, lipid breakdown is enhanced, and re-expression of selenoprotein O enhances the stress protection ability of mitochondria, revealing the specific mechanism.

[0040] 2. Through computational screening of potential NAD-binding proteins, this invention discovered a mitochondrial response in which NAD... + Under the action of SelO, it is hydrolyzed into NMN and AMP, and then Mn is used. 2+ As a cofactor, catalysis depends on the C-terminal CSS residues of SelO, particularly selenocysteine ​​667. In addition to a wide range of metabolic effects, this reaction plays a significant role in lipid utilization through the direct interaction of SelO with fatty acid oxidases (FAO), a mechanism conserved in mammalian cells and bacteria. The reaction is sensitive to elevated mitochondrial matrix pH (a signal for enhanced mitochondrial respiration) and protects mitochondria from persistent metabolic overactivation. These findings reveal a conserved spatiotemporal NAD+ regulatory mechanism and highlight its physiological importance in prokaryotes and eukaryotes.

[0041] 3. Regulators that modulate the activity of selenoprotein O in mitochondria have the potential to promote lipid metabolism and treat mitochondrial-related diseases, and can be used to prepare weight-loss related products, as well as products for the prevention or treatment of mitochondrial-related diseases. Attached Figure Description

[0042] Figure 1 shows the enzyme activity of human SelO in the presence of different divalent cations; enzyme activity was determined by HPLC, and error bars represent the standard deviation (SD), n=3.

[0043] Figure 2 shows the hydrolysis of NAD by SelO at different substrate concentrations. + The reaction rate; each data point represents the average of two repeated experiments.

[0044] Figure 3 shows the enzymatic reaction products of human SelO with NADH as a substrate, analyzed by HPLC coupled with UV-Vis. The analysis was performed using a reversed-phase C18 column. SelO can hydrolyze NADH into AMP and NMNH. Note: Due to the presence of the nicotinamide ring, only NADH and NMNH have absorbance at 340 nm.

[0045] Figure 4 shows the verification that SelO does not hydrolyze FAD; the reaction mixture of SelO and FAD was analyzed by HPLC coupled with UV-Vis, using a reversed-phase C18 column.

[0046] Figure 5 shows the verification that SelO does not hydrolyze NADP; the reaction mixture of SelO and NADP was analyzed by HPLC coupled with UV-Vis, using a reversed-phase C18 column.

[0047] Figure 6 shows the phylogenetic tree of SelO homologs constructed using the neighbor-joining method in ClustalX2, with each branch labeled with its evolutionary distance.

[0048] Figure 7 shows the analysis of Escherichia coli ydiU with NAD using HPLC coupled with UV-Vis. + The product of the enzyme-catalyzed reaction of the substrate; analysis was performed using a reversed-phase C18 column. ydiU can convert NAD3 into NAD3. + Hydrolysis yields AMP and NMN; the figure shows the absorbance spectra within the retention time of 0-12 minutes, verifying that the retention time of the enzymatic reaction product is consistent with that of the AMP and NMN standards.

[0049] Figure 8 shows the enzyme activity of Escherichia coli ydiU in the presence of different cations; error bars represent standard deviation (SD), n=3.

[0050] Figure 9 shows the hydrolysis of NAD by ydiU at different substrate concentrations. + The reaction rate; each data point represents the average of two repeated experiments.

[0051] Figure 10 shows the HPLC-UV analysis of the enzymatic reaction products of wild-type SelO and SelO C667A mutant; separation was performed using a reversed-phase C18 column. Compared with the wild-type enzyme, the NAD of the C667A mutant was significantly higher. + The hydrolytic activity decreased, and the chromatogram of the reaction mixture was similar to that of NAD. + Alignment analysis was performed on the standard samples.

[0052] Figure 11 shows the Western blot analysis of AMPation levels in wild-type and C667A mutant SelO under different reaction conditions; after incubation of recombinant SelO with ATP for a specified time, the auto-AMPation level was detected using a monoclonal anti-AMP antibody.

[0053] Figure 12 shows that, compared with wild-type SelO, the SelO C667A mutant could not rescue mitochondrial NAD caused by SelO knockdown to the same extent. + Increased NADH levels; after isolating mitochondria, mitochondrial NAD+ was measured using a WST-8-based colorimetric method. + NADH concentration, error bars represent standard error (SEM), n=3; mitochondrial protein concentration was determined using a BCA kit for NAD. + Normalization at the NADH level.

[0054] Figure 13 shows that the C667A mutant SelO overexpression cannot reduce mitochondrial NAD caused by knockdown. + Quantitative results showing restoration to wild-type SelO levels; NAD+ based on circular rearrangement fluorescent protein with mitochondrial localization sequence. + The sensor was stably transfected into tetracycline-inducible SelO knockdown HeLa cells, and this NAD... + The sensor uses a ratio method to report local NAD. + Level; NAD + The higher the level, the lower the fluorescence intensity under 488 nm excitation, while the fluorescence intensity under 405 nm excitation is unaffected. Therefore, the ratio of fluorescence signals under the two excitation wavelengths is not related to the expression level of the reporter gene. Error bars represent standard errors (SEM), from left to right n=79, 112, 89, 154.

[0055] Figure 14 shows the sequence alignment of the C-terminal tail of SelO homologs from various eukaryotic and prokaryotic species.

[0056] Figure 15 shows the identification of potential SelO interacting proteins by label-free quantitative proteomics analysis of the Flag pull-down elution. HEK293T cells were transfected with Flag-tagged SelO or empty vector control. Cell lysates were pulled down by anti-Flag magnetic beads. Three replicate sample analyses were performed on both the control group and the SelO-Flag group, showing mitochondrial proteins with a total PEP score greater than 100.

[0057] Figure 16 shows the identification of potential SelO interacting proteins using pull-down experiments combined with quantitative proteomics mass spectrometry, followed by gene set enrichment analysis. Purified SUMO-tagged SelO or SUMO-tagged only was immobilized on TALON (cobalt) resin and incubated with mouse liver mitochondrial extracts for pull-down experiments. Three replicates of label-free quantitative proteomics analysis were performed, and gene set enrichment analysis was conducted using the abundance ratio of eluted proteins.

[0058] Figure 17 shows that overexpression of SelO does not affect the interaction between HADHA and HADHB; the results of co-immunoprecipitation experiments of Flag-tagged HADHB and endogenous HADHA after overexpression of SelO in HEK293T cells.

[0059] Figure 18 shows that knocking down SelO does not affect the interaction between HADHA and HADHB; the results of co-immunoprecipitation experiments of Flag-tagged HADHB and endogenous HADHA after knocking down SelO in HEK293T cells.

[0060] Figure 19 shows the interaction between SelO and the complex formed directly with HADHA and HADHB. Recombinant GST-HADHA and HADHB were co-purified from E. coli. After incubating recombinant SelO protein with recombinant HADHA and HADHB in vitro, GST pull-down experiments were performed.

[0061] Figure 20 shows the effect of SelO on HADHA activity. Flag-tagged HADHA was isolated from transfected HEK293T cells by immunoprecipitation. Human SelO purified from E. coli was added to the reaction mixture. The conversion of 2,3-enoylpalmitoyl-CoA to 3-ketopalmitoyl-CoA (forward reaction) was quantified by high-resolution LC-MS. 2,3-enoylpalmitoyl-CoA was generated from palmitoyl-CoA through recombinant human ACOX1 protein. Error bars represent standard errors (SEM), n=3.

[0062] Figure 21 shows the effect of SelO on HADHA activity. Flag-tagged HADHA was isolated from transfected HEK293T cells by immunoprecipitation. Human SelO purified from E. coli was added to the reaction mixture. The conversion of 3-ketopalmitoyl-CoA to 2,3-enoylpalmitoyl-CoA was quantified by high-resolution LC-MS (reverse reaction). Error bars represent standard errors (SEM), n=4.

[0063] Figure 22 shows the TG levels of HepG2 cells after exposure to palmitic acid (PA) and oleic acid (OA). Two days before PA / OA treatment, cells were transfected with siRNA, SelO overexpression plasmid, or control vector. TG levels were measured by colorimetric method using a kit from Nanjing Jiancheng Biotechnology Institute. Error bars represent standard errors (SEM), n=3.

[0064] Figure 23 shows the quantitative results of Oil Red staining of HepG2 cells after exposure to palmitic acid (PA) and oleic acid (OA); cells were transfected with siRNA, SelO overexpression plasmid or control vector 2 days before PA / OA treatment; error bars represent standard errors (SEM), n=6.

[0065] Figure 24 shows the quantitative results of BODIPY 493 / 503 staining of HepG2 cells after exposure to palmitic acid (PA) and oleic acid (OA); cells were transfected with siRNA, SelO overexpression plasmid or control vector 2 days before PA / OA treatment; error bars represent standard errors (SEM), from left to right n=313, 182, 383, 211.

[0066] Figure 25 shows the effect of SelO knockdown in HepG2 cells and the specificity of the SelO antibody, and assesses the relative total NAD level after SelO knockdown; the total NAD concentration was determined using a WST-8-based colorimetric method 36 hours after transfection. + (and NADH), the error bar represents the standard error (SEM), n=3.

[0067] Figure 26 shows that knocking down SelO2 increases NAD2 levels in HepG2 cells. + Levels; HepG2 cells were transfected with siRNA targeting SelO, and NAD was measured using a WST-8-based colorimetric assay 36 hours after transfection. + Concentrations are shown in the figure, illustrating the experimental results for two siRNAs; error bars represent standard errors (SEM), n=3; protein concentrations were determined using a BCA kit for NAD. + Horizontal normalization processing.

[0068] Figure 27 shows the evaluation of NADH levels after SelO knockdown; intracellular NADH levels were measured 36 hours after transfection using a WST-8-based colorimetric method, with error bars representing standard errors (SEM), n=3; cell protein concentrations were measured using a BCA kit and used for normalization of NADH levels.

[0069] Figure 28 shows the effect of SelO knockdown on NAD in mitochondrial and cytoplasmic components. + Levels of cells were affected. Adding the tetracycline antibiotic doxycycline (Tet) to the culture medium induced the expression of shRNA targeting SelO. Thirty-six hours after doxycycline addition, cell lysates were separated into cytoplasmic (right image) and mitochondrial (left image) components. NAD+ levels in each component were determined using a WST-8-based colorimetric assay. + Concentration; error bars represent standard error (SEM), n=3; mitochondrial and cytoplasmic protein concentrations were determined using a BCA kit for NAD. + Horizontal normalization processing.

[0070] Figure 29 shows the assessment of mitochondrial and cytoplasmic NADH levels in HeLa cells after tetracycline-induced SelO knockdown. Twenty-four hours after shRNA expression induction, cell lysates were separated into cytoplasmic (right) and mitochondrial (left) components. NADH levels were determined using a WST-8-based colorimetric assay. Error bars represent standard errors (SEM), n=3. Mitochondrial and cytoplasmic protein concentrations were measured using a BCA kit for normalization of NADH levels.

[0071] Figure 30 shows the quantification of NAD-related metabolites (NAD) using LC-MS / MS. + Metabolites were extracted from HeLa cells stably expressing tetracycline-inducible SelO shRNA, and detected after 24 hours of doxycycline addition. Error bars represent standard errors (SEM), n=5. Cellular protein concentrations were determined using a BCA kit and used for normalization of the levels of each metabolite.

[0072] Figure 31 shows the enzyme activity of human SelO under different pH conditions; the enzyme activity was determined by HPLC, and the error bars represent the standard deviation (SD), n=3.

[0073] Figure 32 shows that knocking down SelO2 increases mitochondrial NAD+ in HeLa cells. + Level-based quantitative results; NAD based on circular rearrangement fluorescent protein with mitochondrial localization sequence fused with mitochondrial localization sequence + The sensor was stably transfected into tetracycline-inducible SelO knockdown HeLa cells, and this NAD... + The sensor uses a ratio method to report local NAD. + Level; NAD +The higher the level, the lower the fluorescence intensity under 488 nm excitation, while the fluorescence intensity under 405 nm excitation is unaffected. Therefore, the ratio of fluorescence signals under the two excitation wavelengths is not related to the expression level of the reporter gene. The error bars represent standard errors (SEM), from left to right n=59, 66, 60.

[0074] Figure 33 shows the quantitative results of NAD levels obtained from metabolomics data. Error bars represent standard errors (SEM), n=6.

[0075] Figure 34 is a volcano plot showing the differentially regulated metabolites in HeLa cells expressing shRNA targeting SelO and control cells.

[0076] Figure 35 shows the quantitative analysis of the isolate from SelO fl / fl and SelO fl / fl NAD+ in the mitochondria of Alb-Cre mouse hepatocytes + And NADH levels; NAD was determined using a WST-8-based colorimetric method. + And NADH concentration, error bars represent standard error (SEM), SelO fl / fl Group n=4, SelO fl / fl Alb-Cre group n=5; liver mitochondrial protein concentration was measured using a BCA kit for NAD. + Normalization at the NADH level.

[0077] Figure 36 shows a 4-month-old SelO fl / fl Alb-Cre and SelO fl / fl Liver NAD in mice under normal diet + Quantification of NMN and AMP levels; metabolites in all samples were extracted from 50 mg liver tissue and determined by LC-MS / MS. Error bars represent standard errors (SEM). fl / fl Alb-Cre group n=16, SelO fl / fl Group n=14.

[0078] Figure 37 shows the rate at which SelO knockout reduces mitochondrial NAD consumption. Mitochondria were isolated from liver tissue and incubated in mitochondrial respiratory medium (MiR05) for a specified time. The remaining NAD content in mitochondria was determined by a WST-8-based colorimetric method. Error bars represent standard deviation (SD), n=3.

[0079] Figure 38 shows the exogenous NAD+ hydrolysis in SelO knockout mitochondria. +The efficiency is low; mitochondria are isolated from liver tissue, and isotope-labeled NAD+ is added to a buffer solution containing suspended mitochondria. + The amount of isotopically labeled NMNH generated was quantified using high-resolution LC-MS. Note that the mitochondrial storage buffer and mitochondrial respiration buffer in the isolation kit contain reducing agents (DTT and TCEP, respectively), which may reduce NMN to NMNH. Error bars represent standard errors (SEM), n=3. Mitochondrial protein concentration was determined using the BCA kit for NAD. + Horizontal normalization processing.

[0080] Figure 39 shows the qPCR analysis of mRNA levels of genes related to fatty acid β-oxidation in liver tissues of SelO knockout mice or control mice. Error bars represent standard errors (SEM), n=3.

[0081] Figure 40 shows SelO fl / fl HE staining results of liver tissue from Alb-Cre and Alb-Cre mice after 8 weeks of high-fat diet feeding; the left image is a representative image, in which lipids are dissolved in ethanol and xylene during processing, forming clear circular vacuoles that cannot be stained by hematoxylin or eosin, with black arrows indicating the vacuoles; the right image is the quantitative result of vacuoles in each field of view, with a scale bar of 100 μm and error bars representing standard errors (SEM), n=15.

[0082] Figure 41 shows SelO fl / fl Oil Red staining results of liver tissue from Alb-Cre and Alb-Cre mice after 8 weeks of high-fat diet; the left image is a representative image, and the right image is the quantitative result of Oil Red staining. The scale bar is 100 μm, and the error bars represent standard errors (SEM). n=8.

[0083] Figure 42 shows the 3-month-old SelO fl / fl The levels of TG and NEFA in liver tissue of Alb-Cre and Alb-Cre mice after 8 weeks of high-fat diet were measured by colorimetric method using a kit from Nanjing Jiancheng Biotechnology Institute. Error bars represent standard errors (SEM). The TG group had n=6 and the NEFA group had n=5.

[0084] Figure 43 shows the quantitative analysis of the levels of acetyl-CoA, butyryl-CoA, hexanoyl-CoA, and octanoyl-CoA in the mitochondria of mouse liver; under normal dietary conditions, from 3 months of age, SelO fl / fl Alb-Cre and SelO fl / flMitochondria were isolated from the liver of mice. Error bars represent standard errors (SEM). The n=3 group was acetyl-CoA and butyryl-CoA, and the n=4 group was hexanoyl-CoA and octanoyl-CoA.

[0085] Figure 44 shows the isolated samples from SelO under normal dietary conditions. fl / fl Oil Red staining results of primary hepatocytes from Alb-Cre and Alb-Cre mouse liver tissues; prior to Oil Red staining, cells were treated with a 1:1 mixture of palmitic acid (PA) and oleic acid (OA) for 24 hours, and cell nuclei were stained with hematoxylin. Scale bar: 20 μm. Error bars represent standard errors (SEM), n=9.

[0086] Figure 45 shows the oxygen consumption rate (OCR) of HepG2 cells after SelO knockdown and transfection with an empty vector or a specified SelO expression vector, detected using a hippocampal analyzer. Error bars represent standard deviation (SD). The siCOnt group has n=5, and the siSelO group, siSelO+SelO-WT group, and siSelO+SelO-C667A group have n=6.

[0087] Figure 46 shows SelO under normal diet. fl / fl and SelO fl / fl Immunohistochemical (IHC) staining results of CD45 in Alb-Cre mouse liver tissue; the left image is a representative image, and the right image is the quantitative result of CD45 IHC staining. The scale bar is 100 μm, and the error bars represent standard errors (SEM). fl / fl Group n=30, SelO fl / fl Alb-Cre group n=27.

[0088] Figure 47 shows a 3-month-old SelO fl / fl Or SelO fl / fl The NAD levels in liver mitochondria of Alb-Cre mice were measured after intravenous injection of either control adenovirus or adenovirus expressing SelO. Tissues were collected 4 days after adenovirus injection. Mice were fed a normal diet during the experiment. After isolating mitochondria, NAD levels were measured using a WST-8-based colorimetric method. Error bars represent standard errors (SEM), with n = 3, 3, 5, and 6 from left to right. Liver mitochondrial protein concentrations were measured using a BCA kit and used for normalization of NAD levels.

[0089] Figure 48 shows a 3-month-old SelO fl / fl Alb-Cre and SelO fl / flThe levels of non-esterified fatty acids (NEFA) and triglycerides (TG) in the liver tissue of mice were measured after 6 weeks of feeding with a high-fat diet. One week before starting the high-fat diet, mice were intravenously injected with either a control adenovirus or an adenovirus expressing SelO. The relevant levels were determined by colorimetric method using a kit from Nanjing Jiancheng Biotechnology Institute. Error bars represent standard errors (SEM), with n = 10, 7, 7, 7 from left to right.

[0090] Figure 49 shows a 3-month-old SelO fl / fl Alb-Cre and SelO fl / fl Quantitative results of Oil Red staining of liver tissue in mice after 6 weeks of high-fat diet feeding; 1 week before starting the high-fat diet, mice were intravenously injected with control adenovirus or adenovirus expressing SelO. Error bars represent standard errors (SEM), from left to right n=28, 24, 34, 24.

[0091] Figure 50 shows a 3-month-old SelO fl / fl Alb-Cre and SelO fl / fl Quantitative results of HE staining of liver tissue in mice after 6 weeks of high-fat diet feeding; mice were intravenously injected with control adenovirus or SelO-expressing adenovirus one week before starting the high-fat diet; error bars represent standard errors (SEM), from left to right n=22, 22, 26, 22.

[0092] Figure 51 shows the SelO2 infants under normal dietary conditions at 10 weeks of age. fl / fl Alb-Cre and SelO fl / fl Quantitative results of mitochondrial projection area were obtained by electron microscopy assessment of mitochondria in mouse liver cells. Two weeks prior to the analysis, mice were intravenously injected with adenovirus expressing SelO, from left to right n=213, 618, 367, 433.

[0093] Figure 52 shows the increase in mitochondrial pH caused by the inability of C667A mutant SelO overexpression to salvage knockdown. HepG2 cells were co-transfected with SelO-targeting siRNA, a SelO expression vector, and a gene-encoded mitochondrial localization ratio pH sensor to monitor pH levels in the mitochondrial matrix. A higher ratio of green fluorescence intensity at 405 nm and 488 nm excitation indicates a higher pH. The left image is a representative image with a scale bar of 5 μm. The right image shows the quantitative results, with error bars representing standard errors (SEM). From left to right, n = 69, 83, 63, 69.

[0094] Figure 53 shows the mitochondrial fragmentation caused by SelO knockdown. HepG2 cells were co-transfected with SelO-targeting siRNA and SelO expression vector, and then treated with a mixture of palmitic acid (PA) and oleic acid (OA). Mitochondrial morphology was observed by MitOtracker-Red staining. Representative images are shown, with a scale bar of 5 μm. Detailed Implementation

[0095] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.

[0096] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.

[0097] In the following embodiments, when quantitative and statistical analysis is involved, the present invention employs the following methods: data are expressed as mean ± standard deviation (SD) or mean ± standard error (SEM); statistical significance is set as p < 0.05, and "ns" indicates "no significance". Student's t-test (unpaired, two-tailed, equal variance) is used to determine the significant difference between the two groups.

[0098] In the following examples, when cellular oxygen consumption rate (OCR) detection is involved, the following method is used as an example: OCR is detected using a Seahorse XFe96 Cell Energy Metabolism Analyzer combined with an XF Mitochondrial Stress Test Kit (Agilent, catalog number 102340-100). At the time of detection, HepG2 cells had approximately 80% confluence. Following the manufacturer's instructions, cells were sequentially treated with 2 μM oligomycin, 2 μM FCCP, and a mixture of 1 μM rotenone and antimycin A. 100 μl of RIPA lysis buffer was collected, and the total protein content of each well was determined using the BCA method. The OCR values ​​were then normalized.

[0099] In the following examples, when colorimetric quantification of cellular and mitochondrial NAD levels is involved, the present invention employs the following method as an example: using a commercial kit (Beyotime S0175) containing WST-8, cellular NAD levels (NAD) are quantified colorimetrically. + (Total NAD+ and NADH). Cell lysates were prepared using the buffer provided in the kit, and formazan was generated by excess alcohol dehydrogenase to assess total NAD levels.

[0100] To determine mitochondrial NAD levels, mitochondria were first isolated from cells using a mitochondrial isolation kit (Beyotime C3606). The absorbance at 450 nm was measured using a Tecan Spark microplate reader with a 3.5 nm slit width. A reaction mixture without cell lysis buffer was used as a blank control, and the background absorbance at 450 nm was subtracted. The protein concentration in the lysis buffer was determined using the BCA method to normalize the cellular NAD levels.

[0101] In the following examples, when Western blotting is involved, the present invention employs the following method as an example: Cells are lysed in PBS containing a mixture of 0.5% TritOn X-100 and a protease inhibitor through repeated freeze-thaw cycles and glass bead vortexing. Protein samples are separated by SDS-PAGE, transferred to a PVDF membrane, blocked with 10% skim milk, and incubated overnight at 4°C with primary antibody under gentle shaking. The membrane is then incubated for 1 hour at room temperature with a secondary antibody conjugated to horseradish peroxidase.

[0102] Except for the antibody used to detect AMP oxidase, all primary and secondary antibodies were diluted in 1×TBST containing 1% skim milk. For AMP oxidase detection, the primary and secondary antibodies were diluted in a protein-free blocking buffer (Pierce, 37585) containing MnCl2, and the PVDF membranes were also blocked with this protein-free blocking buffer. Chemiluminescence imaging was performed using ECL substrates from NCM biotechnology, and the immunoblotting results were observed using a TanOn 5200 chemiluminescence imaging system.

[0103] In the following examples, when dealing with enzyme reactions and high-performance liquid chromatography-ultraviolet analysis of reaction products, as an example, the present invention uses the following method: The recombinant purified protein (such as SelO or ydiU of the present invention) is reacted with NAD... +Alternatively, NADH can be incubated at 30°C (1.5 h unless otherwise specified) in a buffer containing 50 mM MEpes (pH=8.2), 150 mM NaCl, 1 mM MnCl2 and 1 mM TCEP, followed by protein removal and high-performance liquid chromatography (HPLC) analysis.

[0104] For matters involving NAD + For reactions involving NADH, enzymes are removed by acid precipitation, followed by centrifugation to remove the precipitate, and then neutralized with NaOH solution before HPLC analysis. For reactions involving NADH, since NADH is unstable when exposed to strong acids or bases, enzymes are removed by heat inactivation followed by centrifugation.

[0105] The reaction products were separated and absorbance measured using an Agilent 1100 system equipped with a deuterium and tungsten lamp and an Agilent 1200 diode array detector, employing an HC-C18 column (5 μm, 4.6 × 250 mm). The eluents were (A) 100% methanol and (B) an aqueous solution containing 40 mM KH₂PO₄ and 60 mM K₂HPO₄ (pH=7.0). Separation and subsequent HPLC-UV analysis were performed at room temperature.

[0106] NAD + The relevant reactions were eluted isocratically with 100% B, while the NADH-related reactions were eluted using a gradient (solvent gradient: 0–10 min: 100% B; 10–20 min: 100%–80% B). AMP and NMN were quantified based on absorbance at 260 nm, and NMNH was quantified based on absorbance at 340 nm (note: NMNH has no absorbance at 260 nm).

[0107] The following examples involve in vitro enzymatic reactions or NAD in mitochondria of tissues / blood / cultured cells. + For targeted UPLC-MS / MS detection of related metabolites, as an example, the present invention employs the following method: For in vitro enzymatic reactions, the pH is adjusted to 1-2 with 1 M HCl to terminate the reaction, followed by neutralization with 1 M NaOH solution. For the detection of NAD in mitochondria... + At the level of mitochondrial isolation, mitochondria were extracted from mouse liver using a tissue mitochondrial isolation kit (Beyotime C3606), suspended in mitochondrial respiratory medium MiR05 buffer for a specified time, and then metabolites were extracted with 80% methanol and sonicated.

[0108] Quantitative analysis of NAD in whole blood or cultured cells +When reacting with related metabolites, add to 100 μL of whole blood or cell precipitate (approximately 10 μL). 7 Add 400 μL of pre-cooled methanol to the cells, sonicate, and collect the supernatant for subsequent analysis.

[0109] The reaction mixture or extract from the in vitro reaction was filtered through a 0.22 μm pore size centrifuge tube filter (Costar 8169) and analyzed using an ultra-high performance liquid chromatography system equipped with a BEH T3 column (1.7 μm, 2.1 × 100 mm). The NAD-related eluent was (A) an aqueous solution containing 0.25 mM di-n-butylamine acetate (DBAA) and (B) acetonitrile containing 3 mM DBAA, with gradient elution at room temperature (solvent gradient: 0–6.5 min, 0–35% B).

[0110] NAD was analyzed using a mass spectrometer (5500 QTRAP, AB SCIEX). + Targeted analysis of related nucleotides was performed, the mass-to-charge ratio (m / z) was determined in negative ion mode, and the concentration of analytes was detected by multiple reaction monitoring.

[0111] In the following examples, when the Flag pull-down experiment is involved, the present invention uses the following method as an example: Transfected mammalian cells are repeatedly subjected to freeze-thaw cycles and glass bead vortexing, and lysed in PBS containing a mixture of 0.5% Triton X-100 and protease inhibitors; transformed E. coli are sonicated. After the cell pellet (mammalian cells or bacterial cells) is lysed, the lysate is centrifuged at 10,000 g for 10 minutes at 4°C, and the supernatant is loaded onto Flag M2 magnetic beads. After incubation, the magnetic beads are washed three times with PBS, and then the bound proteins are eluted with PBS containing 0.15 mg / ml 3X Flag peptide. The eluted proteins are used for Western blot analysis or mass spectrometry analysis. The mass spectrometry analysis (including trypsin digestion, peptide desalting and separation, mass spectrometry acquisition, and database search for protein identification) is performed by the Tianjin Medical University Proteomics Platform using a Q-extractive Plus mass spectrometer.

[0112] In the following examples, when gel filtration chromatography is involved, the present invention employs the following method as an example: Gel filtration chromatography analysis is performed using an Agilent 1100 system equipped with an Agilent 1200 diode array detector to measure absorbance. A Superdex 200 Increase 10 / 300 GL column is used, and the elution volume is estimated based on the UV absorbance at 280 nm and 260 nm. The mobile phase consists of 50 mM Hepes (pH=7.5) and 150 mM NaCl, with a flow rate of 0.5 ml / min. Each analysis uses 80-100 μl of a protein solution with a concentration of approximately 10 μM. Proteins separated by gel filtration chromatography are collected using an automated sampler, one fraction per minute. The proteins in each fraction are precipitated with three volumes of acetone, redissolved in 1×Laemmli buffer, separated by SDS-PAGE, and analyzed with silver staining.

[0113] In the following examples, when RNA sequencing is involved, the present invention employs the following method as an example: Liver tissue is ground into a fine powder in liquid nitrogen and transferred to a TRIzOl. It is centrifuged at 12,000 g for 5 minutes at 4°C. A mixture of chloroform and isoamyl alcohol (volume ratio 24:1) is added to the supernatant, and the mixture is centrifuged again at 12,000 g for 8 minutes, after which the aqueous phase is recovered. Total RNA is precipitated from the aqueous phase and washed twice with 75% cold ethanol. Library construction and RNA sequencing are performed by BGI Genomics Co., Ltd. using the BGISEQ-500 platform.

[0114] The following examples involve isolating mitochondria to the isotope-labeled NAD. + As an example, the present invention employs the following method for hydrolysis detection: Mitochondria are isolated from liver tissue of wild-type mice or liver-specific SelO knockout mice using a tissue mitochondrial isolation kit (Beyotime C3606), and resuspended in an oxygen-saturated solution (containing 20 mM NH4OAc (pH=7.45), 30 mM lactobionic acid, 20 mM taurine, 0.5 mM EGTA, 1 mM MgCl2, 1 g / L BSA, 1 mM malic acid, 2 mM pyruvate, and 0.1% Tween-20), and 0.1 mM isotopically labeled NAD+ is added. +(C13 labeling was performed on nicotinamide-linked ribose), and the mixture was incubated at 30°C for 1.5 hours. After incubation, metabolites were extracted using a Bioruptor pico sonicator with a mixture of methanol and acetone (1:1 v / v). The solution was centrifuged at 10,000 g for 10 minutes, and the supernatant was collected and dried under vacuum. The sample was redissolved in double-distilled water, filtered through a 0.22 μm pore size centrifuge tube filter (Costar 8169), and analyzed using an ultra-high performance liquid chromatography system equipped with a BEH C18 column (1.7 μm, 2.1 × 100 mm). The eluent was (A) an aqueous solution containing 10 mM NH4OAc (pH=9) and (B) acetonitrile, and gradient elution was performed at room temperature (solvent gradient: 0–2 min, 3% B; 2–4 min, 3–90% B; 4–5 min, 90% B). The generation of isotopically labeled NMNH in the extract was used to quantify the isotopically labeled NAD. + The degree of hydrolysis was determined in positive ion mode to determine the mass-to-charge ratio (m / z).

[0115] In the following embodiments, when involving the detection of biochemical parameters in mouse blood, the present invention uses the following method as an example: Blood is collected from mice via cardiac puncture to detect high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total cholesterol (TC), and triglycerides (TG). Mice are anesthetized with isoflurane before blood collection. Blood samples are analyzed using a fully automated biochemical immunoassay analyzer (Mindray SAL9000). ALT, AST, TC, and TG levels are measured using colorimetric enzymatic methods involving lactate dehydrogenase, malate dehydrogenase, cholesterol oxidase, and triglyceride lipase, respectively. HDL-C and LDL-C levels are measured using direct measurement methods with ready-to-use kits provided by the analyzer manufacturer. Blood glucose is measured using a Sinocare blood glucose meter and matching test strips via tail tip blood collection.

[0116] In the following examples, when detecting non-esterified fatty acids and triglyceride levels in mouse liver, the present invention employs the following method as an example: Mouse tissue is mechanically homogenized in physiological saline (for non-esterified fatty acids, NEFA) or heptane and isopropanol (volume ratio 1:1, for triglycerides, TG) using a bead mill homogenizer. The mixture is centrifuged at 10,000 g for 10 minutes, and the supernatant is collected for determining NEFA and TG levels. NEFA levels are determined using a commercial kit (A042-2-1) from Nanjing Jiancheng Bioengineering Institute via an enzymatic colorimetric method involving acetyl-CoA synthase, acetyl-CoA oxidase, and peroxidase. TG levels are determined using a commercial kit (BC0620) from Solarbiotech in the form of a colorimetric method involving the saponification of triglycerides and the oxidation of glycerol by periodic acid.

[0117] In the following examples, when Oil Red O staining is used to analyze lipid content, the present invention employs the following method as an example: Oil Red O staining is used to assess the level of neutral lipids accumulated in cultured cells or liver tissue. Cultured cells are grown directly on microscope slides and then fixed with paraformaldehyde; liver tissue is pre-fixed with 4% paraformaldehyde, then dehydrated by incubation in 20% and 30% sucrose, and the dehydrated tissue is frozen sectioned and air-dried on pre-coated slides.

[0118] Tissue sections or cell cultures were fixed with 4% paraformaldehyde for 20 minutes at room temperature, briefly washed with water, incubated with 60% isopropanol for 5 minutes, and then stained with Oil Red O working solution at room temperature for 20 minutes. After Oil Red O staining, the sections were washed with water and stained with hematoxylin. Oil Red O staining images were taken using a Nikon Eclipse Ti microscope.

[0119] In the following examples, when real-time quantitative polymerase chain reaction (qPCR) is involved, the present invention employs the following method as an example: liver tissue is ground into a fine powder in liquid nitrogen, TRIzol reagent is added, and the mixture is centrifuged at 10,000 g for 10 minutes. The supernatant is used for total RNA extraction. After the culture medium is discarded from the cultured cells, TRIzol reagent is added directly to the adherent monolayer cells, and total RNA is isolated from the TRIzol solution according to the manufacturer's instructions. Using the total RNA as a template, cDNA is synthesized using a mixture of reverse transcriptase, oligo-dT primers, and random primers (FullGen, AT301-03). PCR reaction is performed using SybrGreen premix according to the manufacturer's instructions, and real-time quantitative polymerase chain reaction (qPCR) analysis is performed using a BioRad CFX96 real-time PCR detection system.

[0120] In the following examples, when targeting the detection of acyl-CoA in mitochondria using ultra-high performance liquid chromatography-tandem mass spectrometry, the present invention employs the following method as an example: Mitochondria were extracted from mouse liver using a tissue mitochondrial isolation kit (Beyotime C3606). Approximately 600 mg of liver tissue was used to isolate mitochondria, which were then suspended in 400 μl of 75% methanol. After sonication to extract metabolites, the mixture was centrifuged at 1,000 g for 10 minutes. The supernatant was mixed with 1 ml of methyl tert-butyl ether, vortexed at room temperature, and then approximately 250 μl of water was added and incubated for another 10 minutes. The mixture was then centrifuged at 12,000 g for 10 minutes, and the upper organic phase was collected and vacuum dried for the detection of acyl-CoA. The dried metabolites were redissolved in 80% methanol, filtered through a 0.22 μm pore size centrifuge tube filter (Costar 8169), and analyzed using an ultra-high performance liquid chromatography system equipped with a BEH C18 column (1.7 μm, 2.1 × 100 mm). The eluent was (A) acetonitrile and (B) water, and gradient elution was performed at room temperature (solvent gradient: 0–2 min, 40% A; 2–7.5 min, 40–100% A; 7.5–8 min, 100% A). NAD+ was analyzed using a mass spectrometer (5500 QTRAP, AB SCIEX). + Targeted analysis of related nucleotides was performed to determine the mass-to-charge ratio (m / z) in positive ion mode.

[0121] In the following examples, when immunohistochemical staining of liver tissue is involved, the present invention employs the following method as an example: Human liver paraffin sections are prepared from freshly collected tissue. After fixation overnight with 4% paraformaldehyde, the tissue is embedded in paraffin. The paraffin block is cut into 6 μm thick sections and attached to a glass slide. After dewaxing with xylene, the sections are rehydrated by sequentially immersing them in ethanol solutions of different concentrations (100%-60%). Antigen retrieval is performed using 10 mM sodium citrate buffer (pH=6.0), followed by incubation with 3% H2O2 to quench endogenous peroxidase activity. The sections are blocked with 10% goat serum at room temperature for 1 hour. After discarding the blocking buffer, the sections are incubated overnight at 4°C with a primary antibody solution containing 0.5% BSA, followed by incubation at room temperature with a secondary antibody solution conjugated to horseradish peroxidase for 30 minutes. The sections were stained with DAB substrate solution and antibody, counterstained with hematoxylin for 5 minutes, dehydrated with ethanol, and then immunohistochemical images were taken using a Nikon Eclipse Ti microscope.

[0122] In the following embodiments, when fluorescence microscopy detection is involved, as an example, the present invention employs the following method for quantifying mitochondrial NAD. +Horizontal fluorescence images were obtained from live cells, CD45 stained images from liver paraffin sections, and mitochondrial images from paraformaldehyde-fixed cells. The preparation procedure for liver paraffin sections was the same as that for immunohistochemical staining, but a fluorophore-conjugated secondary antibody was used instead of a horseradish peroxidase-conjugated secondary antibody. The final step was to apply an anti-fluorescence quenching mounting solution (Beyotime, P0126) to the microscope slide.

[0123] After fixing the cultured cells with 2.5% paraformaldehyde, they were blocked and permeabilized with PBS buffer containing 3% BSA and 0.2% Triton X-100. Following permeabilization and blocking, the cells were incubated sequentially with primary and secondary antibody solutions diluted in PBS containing 1% BSA and 0.02% Triton-X 100. All fluorescence images were taken at room temperature using a Zeiss LSM 800 confocal laser scanning microscope with a 63× oil immersion objective.

[0124] In the following examples, when analyzing mitochondrial morphology using electron microscopy, the present invention employs the following method: Cells or tissues are fixed with 2.5% glutaraldehyde solution at 4°C for 12 hours, followed by further fixation with 1% osmium tetroxide, and dehydrated using a series of acetone solutions. After dehydration, the samples are embedded in epoxy resin, cut into 70-90 nm thick slices, and attached to a sample grid. They are then stained sequentially with uranium acetate and lead citrate. After drying the filter paper, electron microscopic images are captured using a Hitachi-800 transmission electron microscope.

[0125] Basic Example 1: NAD + This invention employs three molecular docking programs (Vina, Autodock 4, and Ledock) to screen for potentially uncharacterized NAD+ proteins in mitochondria. + Protein binding. Subcellular localization information of all proteins in the human proteome was obtained from the UniProt database, and based on the catalytic activity, binding site, and cofactor information in this database, known NAD proteins were identified. + NADH, NADP + Or NADPH-binding proteins. After downloading the data using UniProt's ID mapping function, subcellular localization and NAD(P)-related activity information were extracted using program-assisted keyword search.

[0126] Using a reverse blind docking method, the interaction of each protein with NAD was evaluated based on AlphaFold2 modeling structure. +The binding affinity was determined. These structures were all downloaded from the AlphaFold2 database, except for selenoproteins. Since the AlphaFold2 algorithm only recognizes the residue abbreviations of 20 common amino acids, and the online database lacks structures of selenoproteins, the algorithm was used to replace selenocysteine ​​residues with cysteine ​​residues in the sequence before generating the modeling structure locally.

[0127] Before molecular docking, the inherent disordered regions in the AlphaFold2 modeled structures were pruned, and based on the prediction alignment error matrix generated for each structure, the Leiden graph clustering method was used to divide the structure into individual structural domains. Individual structural domains with insufficient topological complexity (α-helices + β-folds ≤ 3) were discarded, and the number of α-helices and β-folds in each structural domain was determined using the STRIDE program.

[0128] When assessing binding affinity, the molecular docking program automatically determines binding sites by searching the entire protein surface. The search box is defined by the minimum and maximum x, y, and z coordinates of all heavy atoms in the PDB structure. A configuration file containing search box information is prepared for each structure before docking. All three molecular docking programs use default parameters, but Vina's search demi-extensibility is increased from the default value of 8 to 12. The docking program versions are as follows: Vina 1.2, Autodock 4.2, and LedOck 1.0.

[0129] This invention evaluated all mitochondrial proteins (excluding known NAD). + / NADH or NADP + / NADPH-binding proteins) and known intracellular or extracellular NAD+ + Binding proteins (not limited to mitochondrial proteins) and NAD + The binding affinity is determined. Using the Python module `concurrentFutures` for parallel processing to accelerate computation, the conformation with the lowest binding fraction is selected for each protein, based on known NAD+. + Using the average fraction of bound proteins as a threshold, we screen for potential uncharacterized NAD in mitochondria. + The binding protein. All the above steps were completed using a custom program written in Python 3.8.

[0130] Metabolic reactions are initiated by metabolites acting as substrates for proteases. This leads to mitochondrial NAD+. + (mNAD) +The potential enzymes involved in the fluctuation must be NAD-binding proteins. To explore novel NAD-binding proteins, this invention used three tools—Vina, AutoDock 4, and LeDock—to perform a computer-based screening of the AlphaFold2 modeled structures of all human proteins, using the scores of known NAD-binding proteins as a threshold reference.

[0131] Basic Example 2: Materials, Laboratory Animals, and Experimental Methods The key materials involved in this invention are shown in Table 1: Table 1 Material Description

[0132] 1. Animal model construction: Floxed SelO mice were purchased from Cyagen Biosciences (serial number: CKOCMP-223776-SelenOO-B6J), with a genetic background of C57BL / 6.

[0133] floxed SelO mice (named SelO) fl / fl The loxP mouse (a mouse with loxP sites on its flanks) is a core tool mouse in the field of gene editing. It is constructed by inserting loxP sequences in the same direction on both sides of the key exon / functional region of SelO. Since the target gene is not knocked out, the phenotype of this mouse is consistent with that of the wild type. It needs to be crossed with a mouse expressing Cre recombinase (such as the Alb-Cre mouse below) and then the target gene is conditionally knocked out (KO) in a specific tissue / cell and at a specific developmental stage through site-specific recombination of the Cre-loxP system.

[0134] Alb-Cre mice were originally created by POstic et al. (J. Biol. Chem. 1999, 274, 305-315) by microinjecting the Alb-Cre DNA fragment into the pronucleus of B6D2 F2 hybrid mice. These transgenic mice were expected to contain 7 copies of the transgene.

[0135] Alb-Cre mice are hepatocyte-specific Cre recombinase tool mice. They express Cre recombinase driven by the mouse albumin (Albumin, Alb) gene promoter, specifically expressing Cre only in hepatocytes. When crossed with flxed (fl / fl) mice, the target gene can be conditionally knocked out (KO) in hepatocytes. They are core tool mice for research in liver development, liver cancer, liver fibrosis, metabolic liver diseases, and other liver-related fields. They do not exhibit spontaneous liver injury phenotypes and their reproductive capacity is consistent with that of wild-type mice.

[0136] Methods for obtaining SelO knockout mice: (1) Parental mouse pairing: homozygous fluxed mice (SelO fl / fl (1) Mice) mated with Alb-Cre mice to obtain F1 offspring; (2) F1 generation genotyping: F1 generation was identified by genotyping to screen out SelO mice. fl / fl Alb-Cre heterozygous mice (named SelO) fl / fl Alb-Cre mice, also known as SelO knockout mice, are mice that have had their Alb-Cre mice knocked out.

[0137] For genotyping, mouse tail DNA was extracted: approximately 2 mm of tail tissue was placed in a test tube containing 50 mM NaOH and incubated at 95°C for 30 minutes; the lysate was neutralized with 1 M Tris buffer (pH 8.0), centrifuged at 14,000 × g for 10 minutes, and the supernatant was collected for direct PCR analysis.

[0138] The primers for detecting the fluxed SelO allele are as follows: SelO_flox_fwd (SEQ ID NO.1): ACGTGGCTGTGTAGTTTTGTTTC; SelO_flox_rev (SEQ ID NO.2): CATGAGTAAGCTGTTAGCGGTTC; Expected PCR products: homozygous fluxed type: 1 band at 201 bp; heterozygous fluxed type: 1 band each at 201 bp and 143 bp; wild type: 1 band at 143 bp.

[0139] The primers for detecting the Cre transgene under the albumin promoter are as follows: Alb-Cre-F (SEQ ID NO.3): GCAAACATACGCAAGGGATT; Alb-Cre-R (SEQ ID NO.4): AGGCAAATTTTGGTGTACGG; Mice expressing Cre produce a single band at 300 bp. Mice carrying both the Alb-Cre transgene and the homozygous fluxed SelO allele are considered liver-specific SelO knockout mice.

[0140] In all mouse experiments, littermates of the same sex were randomly assigned to experimental groups, with the male-to-female ratio in each group kept as close to 1:1 as possible.

[0141] 2. Method of reintroducing the SelO gene into knockout mice via adenovirus expression: 3-month-old SelO fl / fl Mouse or SelO fl / flIn mice combined with Alb-Cre, either the control group or the SelO-expressing group was treated with intravenous injection of a SelO-expressing adenovirus. Tissue samples were collected 4 days after adenovirus injection.

[0142] 3. Mouse SelO knockdown method: (1) System composition 1.1 Tet repressor protein-transcription activation fusion protein (TTA): It is formed by the fusion of bacterial Tet repressor protein (TetR) and eukaryotic transcription activation domain (such as VP16). The TetR part is responsible for specifically binding to specific DNA sequences, while the VP16 part has the function of activating transcription.

[0143] 1.2 Tet Response Element (TRE): Composed of multiple tandem Tet operon sequences (TetO), typically seven repeated TetO sequences. TREs are designed to be placed downstream of the promoter of the target gene as TTA binding sites.

[0144] 1.3 Target gene: The gene that needs to be knocked down or regulated (such as SelO in this invention), whose expression is controlled by the TRE promoter.

[0145] (2) Working mechanism 2.1 In the absence of doxycycline: TTA protein can specifically bind to the TRE sequence. Since TTA is fused with the transcription activation domain (VP16), it initiates the transcription of downstream target genes after binding to TRE, so that gene expression is in the "on" state.

[0146] 2.2 With doxycycline: After doxycycline binds to TTA, it causes a conformational change in the TTA protein, preventing it from effectively binding to the TRE sequence. Because TTA cannot bind to TRE, transcriptional activation function is inhibited, and transcription of downstream target genes is suppressed, thus achieving gene expression "shutdown" or knockdown. By adding or removing doxycycline, the expression level of target genes can be precisely controlled, achieving dynamic regulation of gene function.

[0147] 4. Construct liver-specific SelO knockout (KO) mice and measure the body weight and liver mNAD of these mice. + The horizontal detection method is as follows: SelO in 7-month-old infants fl / fl Alb-Cre mice and SelO fl / fl Mice (32.3-38.5g) were fed under normal dietary conditions, and their body weight and liver weight were measured.

[0148] Additionally, the feeding and sampling methods for high-fat diet mice: 3-month-old SelO mice... fl / fl Alb-Cre and Selo fl / flIn mice, NEFA (non-esterified fatty acids) and TG (triglycerides) levels in liver tissue were measured after a 6-week high-fat diet. One week prior to starting the high-fat diet, these mice received intravenous injections of either control adenovirus or SelO-expressing adenovirus. These levels were determined colorimetrically using a kit from Nanjing Jiancheng Biotechnology Co., Ltd.

[0149] 5. SelO knockdown combined with OA / PA treatment-induced mitochondrial fragmentation: HepG2 cells were co-transfected with SelO-targeting siRNA and a SelO expression vector, and then treated with a mixture of palmitic acid (PA) and oleic acid (OA). Mitotracker-Red staining was used to observe mitochondrial morphology.

[0150] 6. Monitoring mNAD in living cells + The horizontal approach uses genes located in mitochondria that encode NAD. + Sensor, specific method: A mitochondrial localization sequence fusion-type NAD based on a circularized mutant fluorescent protein. + The sensor was stably transfected into tetracycline-induced SelO knockout HeLa cells. This NAD... + The sensor reports local NAD using a ratio method. + Horizontal. NAD + The higher the level, the lower the fluorescence intensity at 488 nm excitation, while the fluorescence intensity at 405 nm excitation remains unaffected. Therefore, the ratio of fluorescence signals at the two excitation wavelengths is not affected by the reporter gene expression level.

[0151] 7. Cell lines HEK293T, Hepa1-6, HepG2, and HeLa were all purchased from the American Type Culture Collection (ATCC). All cells were cultured in a humidified incubator at 37°C and 5% CO2, and mycoplasma contamination was tested every two months to ensure the cultures were free of contamination.

[0152] 8. Stable Cell Line Construction: Using TRANIT-LT1, pLKO-shSelO, packaging plasmid psPAX2, and envelope plasmid pMD2.G were co-transfected into HEK293T cells. The supernatant containing lentiviral particles was collected and filtered through a 0.8 μm sterile filter to remove suspended cells or cell debris. HeLa cells were infected with lentivirus in the presence of polybrene and selected with 2 μg / ml puromycin for at least three days. To improve cell line homogeneity, single colonies were isolated from culture plates with low-concentration inoculation to construct monoclonal cell lines. Western blotting was used to verify tetracycline-induced shSelO expression.

[0153] 9. Construction of ydiU knockout E. coli cells: The ydiU gene was knocked out in BL21 (DE3) E. coli using the λ RED recombinase system. First, the helper plasmid pKD46 encoding the RED recombinase was transformed into BL21 (DE3) cells. Then, the PCR product containing the kanamycin resistance gene with FRT flanking markers (homological to the sequences before the start codon and after the stop codon of the ydiU gene at both ends) was transformed back into the cells. This PCR product was amplified from the pKD4 plasmid using the following primers: ydiU_knockout_fwd (SEQ ID NO.5): GACGAGAGTAACCGTCTACACTATCAAACAGGAGGATCTGTGTAGGCTGGAGCTGCTTC; ydiU_knockout_rev (SEQ ID NO.6): AAAACTCAGGCTGGCAAGCTGCTGTTGACCAAGTAGCCTCATATGAATATCCTCCTTAG.

[0154] The resistance gene was recombined at the ydiU site by kanamycin selection, and then removed by transformation with the pCP20 plasmid encoding the FLP recombinase. Both pKD46 and pCP20 plasmids contain temperature-sensitive replicons, and the plasmids can be easily removed by increasing the culture temperature.

[0155] 10. Metabolomics analysis of cultured cells: HeLa cells expressing tetracycline-inducible SelO-targeting shRNA were collected and counted 48 hours after treatment with doxycycline or a control. Approximately 5 × 10⁻⁶ cells were used for each replicate sample. 6 Cells were washed with PBS, and metabolites were extracted using a mixture of methanol, acetone and water (2:2:1, v / v). The mixture was centrifuged at 14,000 g for 20 minutes, and the supernatant was dried under vacuum.

[0156] For LC-MS analysis, the sample was redissolved in a mixture of acetonitrile and water (1:1, v / v) and analyzed by Shanghai Applied Protein Technology Co., Ltd. using a UPLC (1290 Infinity LC) coupled with a quadrupole time-of-flight mass spectrometer equipped with a BEH amide column (1.7 μm, 2.1 × 100 mm). The eluent was (A) containing 25 mM NH4OAc and 25 mM NH3. Aqueous solutions of H2O and (B) acetonitrile were eluted at room temperature using a gradient elution (solvent gradient: 0–0.5 min, 95% B; 0.5–7 min, 96–65% B; 7–8 min, 65–40% B; 8–9 min, 40% B), while simultaneously scanning the positive and negative ion modes of electrospray ionization. Data were processed using XCMS software.

[0157] 11. Recombinant protein purification: Transform bacterial expression vectors containing fadB, fadA, HADHB, GST-HADHA, and ACOX1 into BL21(DE3) cells; transform expression vectors containing wild-type or mutant ydiU, SUMO-tagged SelO, or SUMO-tagged only into BL21(DE3) ΔydiU cells (following the steps in "5. Construction of ydiU knockout E. coli cells" above). Knocking out the ydiU gene prevents the formation of chimeric heteropolymers between endogenous ydiU and the inducible protein.

[0158] Bacteria were cultured in LB medium at 37°C until an OD600 of 0.5–0.9 was reached. Protein expression was induced by adding 0.5 mM isopropyl-β-D-thiogalactoside and incubated at 16°C for 12–16 hours. After induction, bacterial cells were collected and sonicated in lysis buffer (50 mM NaH2PO4 (pH 7.0), 0.1% Triton X-100, 10 mM imidazole, 5 mM BME, and 1 mM MPMSF). The lysis buffer was centrifuged at 10,000 g for 10 minutes.

[0159] Nucleic acid in the supernatant was precipitated by gradually adding streptomycin sulfate (final concentration w / v 2%), followed by centrifugation. The supernatant was then loaded onto a cobalt column (TALON). After washing with 5 column volumes of wash buffer (50 mM NaH2PO4 (pH 7.0), 0.1% Triton X-100, 20 mM imidazole, 5 mM BME, and 800 mM NaCl), proteins were eluted with elution buffer (50 mM NaH2PO4 (pH 7.0), 250 mM imidazole, 1 mM BME, and 300 mM NaCl). The eluent was concentrated using Amicon Ultra and then replaced with storage buffer (containing 50 mM Hepes, 100 mM NaCl, 10% glycerol, and 1 mM DTT) using a Sephadex G-25 exchanger.

[0160] 12. Purification of selenocysteine-containing recombinant protein: To generate recombinant human SelO containing selenocysteine ​​(Sec), an E. coli expression plasmid with three modifications compared to the original SelO vector was constructed: First, selenocysteine ​​was encoded via the UAG codon, and a substitution of cysteine ​​for selenocysteine ​​was introduced at the C(Se)667 site; second, the His6 tag was moved to the C-terminus of the protein, so that recombinant proteins that failed to incorporate Sec were removed during affinity purification due to the lack of a purification tag; third, the vector backbone was changed to pET21a (containing an ampicillin resistance marker) for co-transformation with the pSecUAG-Evol2 plasmid (kanamycin resistance); this plasmid encodes the orthogonal tRNA / tRNA synthetase pair required for site-specific incorporation of Sec at the UAG codon.

[0161] To induce expression of the Sec-containing protein, the bacterial culture was diluted, and 10 μM sodium selenite and 0.2% arabinose were added to LB medium, followed by IPTG induction. The arabinose was used to induce the expression of the Sec incorporation mechanism in pSecUAG-Evol2. The subsequent induction and purification steps for the Sec-containing SelO protein were identical to those for the non-Sec variant.

[0162] 13. The crystallization and structural determination of ydiU protein were performed using the hanging drop gas-phase diffusion method. ydiU crystals were obtained at 18°C ​​using a stock solution containing 75 mM TRIS (pH=8.5), 1.25 M ammonium sulfate, and 25% (v / v) glycerol. The crystals were then subjected to the addition of 10 mM NAD+. + Or 10 mM NAD + After immersion in a stock solution of 10 mM manganese chloride for a specified time, the sample was rapidly frozen and stored in liquid nitrogen for data collection.

[0163] Soaking in NAD + YdiU crystals immersed in manganese chloride solution for 15 minutes were subjected to diffraction data (wavelength 0.979191 Å) collected at the BL02U1 beamline of the Shanghai Synchrotron Radiation Facility (SSRF); [further details about the diffraction data are needed for accurate translation.] + Diffraction data (wavelength 0.97853 Å) were collected on the SSRF BL18U1 beamline after the ydiU crystal was in solution for 2 minutes.

[0164] Soaking in NAD + Crystallography data of the solution were processed using the XDS software package (Acta Crystallogr D. 2010, 66, 125-13); immersion in NAD+... +The crystal diffraction data of the manganese chloride solution were processed using the XIA2-DIALS procedure (J. Appl. Crystallogr. 2010, 43, 186-190; Methods Enzymol 2024, 709, 207-244). All crystals belong to the space group P212121 and have similar cell parameters.

[0165] Soaking in NAD + The crystal structure of ydiU after 15 minutes in manganese chloride solution was determined by molecular substitution using the MOLREP program (Acta Crystallogr D2010, 66, 22-25), with the previously reported ydiU structure (PDB6LNA) as the search model; [The text abruptly ends here, likely due to an incomplete sentence or missing information.] + The crystal structure of ydiU in solution after 2 minutes was obtained using the MOLREP program, with the crystal structure of ydiU after 15 minutes of soaking as the search model.

[0166] The structure was checked and corrected using COOT and O software (Acta Crystallogr D2004, 60, 2126-2132; Acta Crystallogr A1991, 47(Pt 2), 110-119), and refined using PHENIX software (Acta Crystallogr D2010, 66, 213-221). The relevant diffraction data and refined structure have been stored in the protein database (www.rcsb.org), with accession numbers 9JYM (soaked for 15 minutes) and 9L29 (soaked for 2 minutes), respectively.

[0167] 14. Quantitative proteomics analysis of pull-down test eluates: When performing quantitative analysis of potential SelO interacting proteins by mass spectrometry, the proteins captured on the magnetic beads are first digested with trypsin, and then the generated trypsin peptides are desalted using μ-C18 ZipTips.

[0168] For cells expressing Flag-tagged bait proteins, Flag resin pull-down experiments were performed. The eluted proteins were reduced with DTT and then alkylated with iodoacetamide. For cobalt-based resin pull-down experiments using His-tagged purified proteins as bait, the reduction and alkylation steps were omitted. The reducing agent may cause cobalt ion leakage, interfering with subsequent mass spectrometry analysis.

[0169] Trypsin digestion products were injected into a nano-level liquid chromatography system (EASY-nLC 1200, Thermo Fisher Scientific). Peptides were separated on a C18 analytical column (75 μm inner diameter × 15 cm length, 3 μm C18). The HPLC eluent was then analyzed using a Q-Exactive mass spectrometer (Thermo Fisher Scientific). The spray voltage was set to 2.4 kV, the ion transfer tube temperature was set to 320 °C, and MS1 spectra were acquired in the orbital trap at a resolution of 70,000 m / z in the range of 350–1750. The automatic gain control (AGC) target and maximum injection time for MS1 were set to 3e6 / 80 ms, and for MS2 to 5e4 / 180 ms.

[0170] Precursor ions with charges ranging from +2 to +5 were selected for MS2 analysis. The dynamic exclusion time was set to 30 seconds, the MS2 isolation window was 2.2 Da, and the normalized collision energy (NCE) for precursor fragmentation was set to 27%. The raw mass spectrometry files were processed using ProteomeDiscoverer (PD) 3.0 and searched against the UniProtKB / Swiss-Prot human proteome database (which does not contain protein isoforms) downloaded from UniProt on November 6, 2023.

[0171] Peptide sequence searching employed trypsin specificity, allowing a maximum of two missed cleavages. The Flag dropdown samples used cysteine ​​carbamoyl methylation as a fixed modification, and N-terminal methionine deletion and / or N-terminal acetylation as variable modifications. The minimum peptide length was set at 6 amino acids, with a precursor ion mass tolerance of ±10 ppm and a fragment ion mass tolerance of ±0.02 Da. Label-free protein quantification was employed, requiring at least two peptides for protein identification. Peptide intensity was quantified using MS1 intensity, and total abundance was used to calculate protein abundance values.

[0172] 15. Purified SelO protein was reacted with NAD under various in vitro conditions. + Co-incubation and detection of recombinant purified SelO (or ydiU) with NAD in a buffer solution consisting of 50 mM Hepes (pH=8.2), 150 mM sodium chloride, 1 mM manganese chloride, and 1 mM TCEP. + Alternatively, NADH can be incubated at 30°C, followed by protein removal before HPLC analysis. Unless otherwise specified, the incubation time is 1.5 hours. For cases involving NAD... +The reaction involved removing the enzyme through acid precipitation, followed by centrifugation to eliminate the precipitate. The solution was then neutralized with sodium hydroxide before HPLC analysis. For reactions involving NADH, enzyme removal was achieved by heat inactivation followed by centrifugation, as NADH is unstable in strong acids or bases. Detection parameters included: AMP / NMN / NMNH.

[0173] 16. Purified SelO protein was co-incubated with isolated liver mitochondrial lysates for quantitative mass spectrometry analysis. Purified His6-tagged SUMO-SelO or SUMO proteins were immobilized on cobalt resin (TALON). The resin was then incubated with mouse liver mitochondrial extracts. The bound proteins were digested on the resin and proteomics analysis was performed. Three samples were analyzed under both SUMO and SUMO-SelO conditions. Proteins with a total PEP score greater than 20 were shown.

[0174] Specific methods: Potential SelO interacting proteins were quantitatively analyzed by mass spectrometry. Proteins captured on magnetic beads were digested with trypsin, and the resulting trypsin-digested peptides were desalted using μ-C18 ZipTips. For Flag-tagged bait proteins, when performing Flag resin pull-down experiments, the eluted proteins were reduced with DTT and then alkylated with iodoacetamide. In cobalt-based resin pull-down experiments using His-tagged purified proteins as bait, the reduction and alkylation steps were omitted because the reducing agent might cause cobalt ion leakage, potentially interfering with subsequent mass spectrometry analysis.

[0175] Trypsin digestion products were injected into a nano-liquid chromatography system (EASY-nLC 1200, Thermo Fisher Scientific). Peptides were separated on a C18 analytical column (75 μm × 15 cm, 3 μm C18). The HPLC eluent was electrosprayed into an Orbitrap Q-Exactive mass spectrometer (Thermo Fisher Scientific). The spray voltage was set to 2.4 kV, and the ion transfer tube temperature was set to 320°C. MS1 spectra were acquired at a resolution of 70,000 m / z in the Orbitrap mass spectrometer, ranging from 350 to 1750 m / z.

[0176] 17. In the forward reaction of the in vitro HADHA / HADHB activity assay, HADHA-Flag and HADHB-V5 were co-transfected into HEK293T cells. The mitochondrial trifunctional protein (MTP) complex was purified by immunopurification using FlagM2 magnetic beads and elution with 3X Flag peptide. Starting with 60 μM palmitoyl-CoA, ACOX1 protein, purified by over-recombinant synthesis, was in situ converted to trans-hexadecyl-2-enoyl-CoA (this substance is not commercially available) in oxygen-saturated buffer. After heat inactivation of ACOX1 protein, the reaction mixture was centrifuged at 10,000 g for 10 minutes. The supernatant containing trans-hexadecyl-2-enoyl-CoA was directly used for HADHA and HADHB experiments. The in vitro reaction was carried out at 30°C for 2 hours, and the system contained 250 μM NAD. + The reaction was terminated by heat inactivation, with or without 1 μM of recombinant purified SelO, as well as purified HADHA and HADHB.

[0177] In the reverse reaction, HADHA-Flag was transfected into HEK293T cells, followed by elution with Flag M2 magnetic beads and 3X Flag peptides for immunopurification of HADHA protein, using 60 μM 3-ketopalmitoyl-CoA as the starting material. The in vitro reaction was carried out at 30°C for 3 hours, containing 250 μM NADH, with or without 1 μM of recombinant purified SelO, and purified HADHA. The reaction was terminated by heat inactivation.

[0178] After the reaction was terminated, 30 μM stearoyl-CoA was added as an internal standard to compensate for the loss of fatty acyl-CoA molecules in subsequent steps. The sample was vacuum dried and redissolved in a mixture of methanol and water (1:1, v / v). After filtration through a 0.22 μm centrifuge tube filter (Costar 8169), the sample was analyzed using an ultra-high performance liquid chromatography system equipped with a BEH C18 column (1.7 μm, 2.1 × 100 mm). The eluent was (A) an aqueous solution containing 5 mM NH4OAc and 2.5 mM DBAA and (B) a mixture of 95% acetonitrile and 5% (A). Gradient elution was performed at room temperature (solvent gradient: 0–1 min, 2–50% B; 1–8.5 min, 50–98% B; 8.5–13.5 min, 98% B).

[0179] Non-targeted analysis of fatty acyl-CoA was performed using a Thermo Fisher Scientific Exploris 480 mass spectrometer. The mass-to-charge ratio (m / z) was determined in positive ion mode, and the data were analyzed using Thermo Fisher Scientific Xcalibur Qual Browser software. The enzyme activity of the forward reaction was quantified by the production of 3-ketopalmitoyl-CoA, and the enzyme activity of the reverse reaction was quantified by the production of 3-hydroxypalmitoyl-CoA.

[0180] Example 1: In vitro efficacy verification of SelO (1) To verify whether SelO directly consumes NAD + This invention purified human SelO protein (see Basic Example 2) and reacted it with NAD under various in vitro conditions. + Co-incubation. Results showed that NAD... + Enzymatic hydrolysis occurred, and the products, identified by LC-MS / MS and HPLC-UV, were NMN and AMP, indicating the existence of an unrecognized reaction in eukaryotic cells. Importantly, Mn²⁺... + It was identified as an essential cofactor (Figure 1). SelO-mediated NAD + Hydrolysis kinetics analysis showed that the reaction strictly followed Michaelis kinetics (Figure 2). In addition, SelO can also hydrolyze NADH to NMNH and AMP (Figure 3), but it cannot hydrolyze the two NAD analogues FAD (Figure 4) and NADP (Figure 5), demonstrating its substrate specificity.

[0181] (2) SelO homologs are found in metazoans, plants, fungi, and bacteria. These homologs are phylogenetically distant from their common ancestor by approximately 0.3, indicating high conservation (Figure 6). Therefore, this invention further purified the homologous protein ydiU from *E. coli* (see Basic Example 2). The results showed that ydiU can hydrolyze NAD+. + (Figure 7), and with Mn² + It is an essential cofactor (Figure 8). ydiU hydrolyzes NAD. + The kinetic parameters strictly follow Michaelis kinetics, and the efficiency is comparable to that of human SelO recombinant protein (Figure 9).

[0182] To gain a deeper understanding of the molecular mechanism of the reaction, this invention crystallized full-length ydiU, and in the presence or absence of Mn 2+ Under the conditions of NAD + Co-incubation. First, the crystal is incubated with NAD. + and Mn² + After 15 minutes of incubation, only NAD was observed. +The electron density of the AMP moiety. Since the electron density of each group represents the average of all molecules in the crystal, this data indicates that even in the absence of cations, NAD+... + It can also bind ydiU in the crystalline state, and most of it is cleaved during immersion experiments. These electron densities allow the present invention to construct a model of the cleaved state, in which the AMP group is bound in the active pocket of ydiU.

[0183] To reduce NAD + By cutting the crystals, this invention shortens the soaking time. When the crystals were soaked for 2 minutes under cation-free conditions, significantly different electron densities were observed at the ydiU active sites. In addition to the AMP moiety, NAD was also observed. + The electron density of the NMN group was measured. Furthermore, compared to the cleaved state, the phosphate group in the AMP moiety shifted to a new position. The relatively weak electron density of the NMN group indicates that NAD+ was significantly reduced during the immersion experiment. + Partial cutting occurs. Nevertheless, the present invention will still preserve the complete NAD. + Molecular modeling was incorporated into electron density to construct a state-structure model before cutting.

[0184] Except NAD + In addition to the functional groups, slight structural differences were observed at the C-terminus of ydiU before and after cleavage. Unlike previously reported ydiU structures, the C-terminus of the full-length structure of this invention is orderly arranged, although the electron density of the terminal C476-S477-S478 residues is weak. These residues are associated with NAD+. + Interactions may stabilize its structure.

[0185] AlphaFOld3 predicts human SelO-NAD + Conformation and experimentally obtained ydiU-NAD + The structures were compared. The crystal structure of ydiU is highly consistent with the predicted SelO structure, especially in the catalytic pocket region. Mn² + Ions and NAD + The AMP portion has a similar conformation. In the AlphaFOld structure, NAD... + The NMN portion remains bound.

[0186] A notable feature of human SelO is the presence of a rare selenocysteine ​​residue (corresponding to C476 in ydiU) at its C-terminal tail. In both the ydiU crystal structure and the AlphaFOld-predicted SelO structure, C476 in ydiU and C667 in SelO are consistently located at NAD. +The presence of C667 (C476 in ydiU) near the easily broken PO bond suggests that C667 is likely to act as a nucleophile to initiate the hydrolysis reaction.

[0187] Consistent with this, the present invention found that the C667A mutation inhibits the NAD enzyme activity of SelO (Figure 10). The same batch of purified C667A mutant protein, however, exhibited slightly enhanced auto-adenylation (Figure 11), indicating that the mutation did not disrupt the protein's native structure. Within the physiological pH range of the mitochondrial matrix, the adenylation activity of SelO also increased with gradually increasing pH.

[0188] The recombinant SelO protein used in this invention has a conventional cysteine ​​residue at position 667 instead of a selenocysteine ​​residue, because the incorporation of selenocysteine ​​remains technically challenging. Given the selenool anion (Se... - The nucleophilicity of ) is higher than that of thiol (S) - Natural SelO is expected to have higher NAD enzyme activity. Despite the challenges, this invention successfully obtained small amounts of C(Se)667 SelO protein. As expected, the C(Se)667 form exhibited significantly higher NAD enzyme activity, supporting the evolutionary significance of the selenocysteine ​​residue. Furthermore, reexpression of the C667A mutant in SelO knockdown cells, compared to wild-type (WT) SelO, reduced mitochondrial NAD. + The ability to reduce levels of NAD is diminished (detected by isolating mitochondria, Figure 12; or by using mitochondrial-targeted NAD). + Sensor detection (Figure 13).

[0189] In summary, crystal structure and mutation analysis data reveal that SelO(ydiU) binds to and hydrolyzes NAD. + The mechanism by which the C-terminal residues (including selenocysteine ​​at position 667) play a key role explains the high conservation of the CSS tail across different species (Figure 14).

[0190] (3) Direct interaction between SelO and fatty acid oxidase: SelO catalyzes NAD+ oxidation. + The specific effects of hydrolysis on lipid utilization suggest a unique association between SelO and lipid pathways. Since functionally related metabolic enzymes typically form complexes, and metabolic flux is regulated by local substrate availability within multi-enzyme complexes, this invention further investigates whether SelO selectively binds to lipid-metabolizing enzymes.

[0191] In quantitative mass spectrometry analysis of SelO-related proteins, most candidate proteins were cytoplasmic proteins, possibly derived from lysed artificial products. Therefore, this invention limited the analysis to mitochondrial proteins. Under high-threshold conditions, the key FAO enzyme HADHA was the only metabolic enzyme among soluble mitochondrial matrix candidate proteins (Figure 15). To minimize cytoplasmic interference and expand the mitochondrial candidate protein library, this invention co-incubated purified SelO protein with isolated liver mitochondrial lysates for quantitative mass spectrometry analysis. Although false-positive interactions may exist, gene set enrichment analysis (GSEA) showed that the FAO pathway consistently ranked high among candidate proteins (Figure 16). These findings indicate a clear functional association between SelO and FAO. Therefore, this invention validated the interaction between SelO and various FAO cycle-related enzymes, including HADHA, HADHB, HADH, ACAA2, and ECHS1. The mitochondrial trifunctional protein (MTP) HADHA and HADHB form a complex that catalyzes three of the four key steps of β-oxidation. SelO interacts with this complex (Figure 17) but does not affect the interaction between HADHA and HADHB (Figure 18). However, HADHA knockdown significantly reduces HADHB levels, making it impossible to investigate whether the binding of SelO to HADHB depends on HADHA. The fact that only the HADHA / B complex, rather than HADHA alone, can be purified further indicates that the two are mutually stable. Furthermore, in vitro experiments showed that SelO directly binds to the purified HADHA / B complex (Figure 19). SelO does not significantly adenylate either HADHA or HADHB, but exhibits strong self-adenylation. This self-modification does not affect the interaction between SelO and the HADHA / HADHB complex.

[0192] NAD + HADHA is essential for the catalytic conversion of hydroxyacyl-CoA to ketoacyl-CoA. Therefore, this invention uses LC-MS to detect HADHA activity in vitro. The results show that after adding SelO protein, HADHA activity is significantly increased. + Both the forward reaction with NADH as the substrate (Figure 20) and the reverse reaction with NADH as the substrate (Figure 21) were inhibited. The C667A mutant, which binds efficiently to the MTP complex, failed to inhibit HADHA activity in vitro. These observations suggest that SelO degrades NADHA around the MTP complex. +SelO preferentially inhibits β-oxidation. Consistently, under OA / PA treatment, SelO knockdown reduced cellular TG levels (Fig. 22) and lipid deposition (detected by Oil Red O staining, Fig. 23; detected by BODIPY staining, Fig. 24), while re-expression of wild-type SelO rescued this phenotype, but not the C667A mutant.

[0193] Escherichia coli possesses two sets of trifunctional enzymes: one set, composed of FadA and FadB, is used under aerobic conditions; the other set, composed of yfcX and yfcY, is used under anaerobic conditions. SelO selectively interacts with fadB. ydiU directly interacts with either fadA or fadB proteins, and the presence of either fadA or fadB does not affect their binding to ydiU; gel filtration chromatography further confirmed that ydiU can stably assemble into the fadA / fadB complex. To investigate the functional consequences, this invention constructed a ydiU-knockout Escherichia coli strain (ΔydiU). With glucose as the carbon source, the proliferation rate of ΔydiU was similar to that of the parent strain; however, in a auxotrophic medium with OA as the sole carbon source, the proliferation rate of ΔydiU was significantly faster than that of the parent strain, indicating that ydiU has an inhibitory effect on fatty acid utilization. In summary, these results indicate that in both prokaryotes and eukaryotes, SelO / ydiU directly binds to the FAO complex and preferentially inhibits lipid oxidation.

[0194] Example 2: Verification of SelO knockdown or elimination effect (1) After SelO knockdown (KD) was achieved by transfecting cells with siRNA, the total NAD level (NAD) of the cells was measured. + And NADH) changed (Figure 25), and NAD + Both NADH levels increased (Figures 26 and 27).

[0195] Furthermore, by inducing SelO knockdown with doxycycline, mitochondrial and cytoplasmic NAD+ levels were reduced. + The levels of NADH also increased in a consistent manner (Figures 28 and 29). Regarding NAD... + Mass spectrometry (MS) analysis of SelO and related metabolites further supports the role of SelO in cellular NAD+. + The regulatory role of the level (Figure 30).

[0196] NAD + In the matrix H of mitochondrial respiratory coupling +SelO2 is essential in the pumping process, which raises the substrate pH. During mitochondrial activation, the substrate pH is typically between 7.2 and 8.2, and can rise above 9.0 under hyperrespiratory conditions. Within this physiological pH range, SelO2 activity significantly increases with gradually increasing pH (Figure 31), indicating that SelO2 hydrolysis activity responds to changes in mitochondrial respiration rather than remaining constant. This is to monitor mNAD in living cells. + At the horizontal level, this invention uses a gene located in mitochondria that encodes NAD. + Sensor. This sensor shows that mNAD is knocked down by SelO. + Elevated levels, while re-expression of SelO2 can restore mNAD. + Horizontal (Figure 32).

[0197] To explore the direct role of SelO in human cells, metabolomics analysis was performed shortly after tetracycline-induced knockdown (see Basic Example 2). RNA-seq results showed that the overall gene expression pattern was not significantly affected at this time. Metabolomics analysis revealed that NAD+... + It is one of the significantly upregulated metabolites (Figure 33). The volcano plot shows that transient SelO knockdown leads to a wide range of metabolomics changes, with lipids being the most affected category, while amino acids, carbohydrates, and nucleosides also change (Figure 34). In summary, these results indicate that SelO catalyzes NAD... + Hydrolysis, triggered by an increase in substrate pH, plays a broad role in metabolic regulation.

[0198] (2) SelO is widely expressed in human and mouse tissues, with the highest expression level in the liver. Therefore, this invention first constructed liver-specific SelO knockout (KO) mice (see Basic Example 2). These mice showed no significant changes in body weight and liver weight. SelO knockout in the liver led to liver mNAD... + Elevated levels (Figure 35). Mass spectrometry analysis of the livers of knockout mice showed elevated NAD levels. + Levels of NMN were consistently elevated, while NMN levels decreased (Figure 36). Furthermore, in mitochondria isolated from the livers of knockout mice, endogenous mNAD levels were significantly reduced. + The degradation rate (Figure 37) and the exogenously supplemented isotope-labeled NAD + The hydrolysis efficiency of all decreased (Figure 38).

[0199] With mNAD +Consistent increases were observed in the liver transcriptome. Gene set enrichment analysis (GSEA) revealed that after SelO knockout, the tricarboxylic acid cycle (TCA cycle) and fatty acid oxidation (FAO) were among the most enriched upregulated pathways. The upregulation of FAO genes was verified by qPCR (Figure 39). Transient SelO knockout cellular metabolomics analysis (Figure 34) also showed that a large number of altered metabolites were lipid molecules, and these were highly enriched in downregulated metabolites. Both cellular and individual-level omics analyses indicate that SelO broadly regulates metabolic pathways and has a significant impact on lipid metabolism. Therefore, this invention will next focus on investigating SelO-catalyzed NAD50. + The role of hydrolysis in lipid metabolism.

[0200] Metabolic cage analysis revealed increased lipid utilization in knockout mice, manifested as a decreased respiratory exchange rate (RER). Consistently, in the livers of high-fat-fed knockout mice, lipid deposition detected by HE staining (Fig. 40) and Oil Red O staining (Fig. 41), as well as levels of triglycerides (TG) and non-esterified fatty acids (NEFA), were decreased (Fig. 42). However, there was no significant change in body weight or liver weight, suggesting that SelO knockout may have other effects on the liver. Increased inguinal white adipose tissue (iWAT) weight suggests interorgan crosstalk between the liver and adipose tissue. Furthermore, the levels of various FAO intermediates (especially medium- and short-chain acyl-CoA derivatives) were elevated in the mitochondria of the knockout mouse livers (Fig. 43). Lipid accumulation in primary hepatocytes of knockout mice was also inhibited after treatment with palmitic acid (PA) / oleic acid (OA) (Fig. 44).

[0201] (3) SelO-catalyzed NAD + Hydrolysis is essential for mitochondrial homeostasis; SelO2 knockout increases mNAD. + The reduction in hepatic lipid deposition suggests that inhibiting SelO may have beneficial effects. This result was confirmed by re-expression of wild-type and C667A mutant SelO in transiently knocked-down cells (Figure 45). SelO activity was activated by increased matrix pH (Figure 31), a marker of enhanced mitochondrial respiration. This indicates that the primary role of SelO in catalytic reactions is not to inhibit normal mitochondrial activity, but rather as a response mechanism to protect mitochondria from overactivation. Therefore, this invention, through electron microscopy observation of liver mitochondria, found that mitochondria in knockout mice were more fragmented, and this fragmentation intensified with age. Previous studies have reported that mitochondrial fragmentation is associated with enhanced FAO.

[0202] FAO and the tricarboxylic acid cycle occur in the mitochondrial matrix. The intermembrane space (IMS) between the inner and outer mitochondrial membranes (OMM / IMM) is physically divided into two regions: the peripheral membrane space (PIMS), primarily used for molecular transport, and the cristae space (ICS), primarily used for oxidative phosphorylation. In knockout mouse liver mitochondria, the matrix is ​​condensed (darker in color), and the cristae space is expanded; this phenotype is associated with elevated FAO levels. These phenotypes further support the specific role of SelO in lipid oxidation, in addition to its broad metabolic functions. Among various fuel sources, lipid utilization places a particularly heavy burden on mitochondria, which may explain the evolutionary conservation of its binding to the FAO complex.

[0203] Another finding was that the PIMS portion of mitochondria in knockout mice was blurred, and this blurring gradually worsened with age, suggesting a defect in the outer membrane (OMM) or inner membrane (IMM). To verify this hypothesis, this invention detected OMM markers (Tom20), IMM markers (ETC components), and matrix markers (Hsp60). In the liver tissue of 3-month-old knockout mice, Tom20 levels were consistently reduced, confirming OMM deficiency. To specifically observe OMM, this invention performed Tom20 and Hsp60 co-staining on primary hepatocytes from 3-month-old knockout mice, and the results showed that their co-localization was severely impaired. Mitochondrial outer membrane permeability transition (MOMP) is known to be a key driver of inflammatory signaling and cell damage. Consistently, CD45 staining of liver sections showed enhanced inflammatory responses in knockout mice (Figure 46).

[0204] Example 3: Verification of SelO reintroduction effect in SelO knockout mice. This invention reintroduces wild-type SelO and the catalytically inactivated C667A mutant into knockout mice via adenovirus expression. Subsequent analysis (including mouse liver mNAD) was performed. + The levels of NEFA and TG in the liver of mice fed a high-fat diet (Figure 47), as well as the lipid deposition in the liver (Figure 48), all consistently indicate that these functions are primarily catalyzed by SelO2-mediated NAD+ production. + Hydrolysis-mediated.

[0205] Reintroducing wild-type SelO (instead of the C667A mutant) into knockout mice via adenovirus expression largely rescued liver mitochondrial fragmentation (Figure 51) and membrane structure alterations, suggesting that these effects are primarily mediated by the NAD enzyme activity of SelO.

[0206] This invention further utilizes two mitochondrial-targeted pH sensors (hyperecliptic pHluOrin (SEpHluOrin) and ratiometric pHluOrin) to confirm the role of SelO in maintaining matrix pH homeostasis, a function dependent on its NAD enzyme activity (verified by re-expression of wild-type or C667A mutant SelO, Figure 52). Furthermore, short-term SelO knockdown or OA / PA treatment alone had no significant effect on mitochondrial morphology, but combined treatment induced significant fragmentation. Similarly, each condition alone resulted in only a slight increase in matrix pH, while combined treatment led to a significant increase, highlighting the crucial role of SelO in maintaining matrix pH homeostasis under metabolic stress. Moreover, mitochondrial fragmentation induced by SelO knockdown combined with OA / PA treatment could be rescued by re-expression of wild-type SelO (rather than the C667A mutant) (Figure 53). In summary, these findings suggest that SelO responds to increased matrix pH, protecting mitochondria from persistent metabolic overactivation.

[0207] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. The use of protein fragments containing the CSS tail residue C667 of selenoprotein O or their regulators in products regulating lipid metabolism or mitochondrial protection.

2. The application according to claim 1, characterized in that, The regulator is used to enhance or inhibit the activity of the protein fragment, or the regulator is used to promote or inhibit the expression of the protein fragment, wherein the protein fragment is preferably selenoprotein O.

3. The application according to claim 2, characterized in that, The product has any one or more of the following functions: increasing selenoprotein O activity and promoting NAD in mitochondria. + Hydrolysis; inhibits selenoprotein O activity and promotes lipid catabolism in mitochondria; Enhancing selenoprotein O activity strengthens mitochondrial stress protection.

4. The application according to claim 1, characterized in that, The product described herein has any one or more of the following functions: weight regulation, immune enhancement, physical fatigue relief, body fat control, maintaining healthy blood lipid levels, prevention or treatment of obesity, or prevention or treatment of mitochondrial-related diseases.

5. The application according to claim 3, characterized in that, The inhibition of selenoprotein O activity to promote lipid catabolism in mitochondria includes inhibiting the binding of selenoprotein O to lipid metabolism enzymes, thereby promoting lipid catabolism; the lipid metabolism enzymes include HADHA, HADHB, HADH, ACAA2, or ECHS1.

6. The application according to claim 3, characterized in that, The enhancement of selenoprotein O activity to strengthen mitochondrial stress protection includes SelO responding to increased matrix pH during enhanced mitochondrial respiration by locally reducing NAD near catabolic enzymes. + It temporarily inhibits the activity of catabolic enzymes, thereby reducing mitochondrial stress.

7. The application according to claim 1, characterized in that, The regulators mentioned include doxycycline or siRNA targeting SelO.

8. The application according to any one of claims 1-7, characterized in that, The products mentioned are food, health products, or medicines.

9. The application according to claim 8, characterized in that, The health products mentioned are used to: enhance immunity, relieve physical fatigue, control body fat, or maintain healthy blood lipid levels.

10. The application according to claim 8, characterized in that, The medicine is used for: weight regulation, prevention or treatment of obesity, or prevention or treatment of mitochondrial-related diseases.

Images