Guide editing system based on bidirectional micro homologous arm and application thereof

Abstract

The invention relates to the technical field of biology, and provides a guide editing system based on a bidirectional micro homologous arm and application of the guide editing system. Based on a guided editing technology, two pairs of independent pegRNAs are adopted, single-stranded DNA (ssDNA) micro homologous arms with the length of 20-60 nt are generated at the two ends of a genome target and the two ends of a donor carrier insertion fragment respectively, and efficient integration of donor DNA and genome DNA can be promoted. At the two target points of the genome, the ssDNA is homologous with the DNA sequence of the integration site in the donor vector, so that the seamless connection of the donor DNA and the genome DNA is effectively promoted by the micro homologous arm in the integration process. In the donor vector, ssDNA on the two sides of the integration part is homologous with a sequence on the upstream of a targeting nick site in a genome, so that the integration efficiency and accuracy are further improved. According to the method, high editing efficiency can be kept between different target sites and cell types, and large-fragment DNA can be inserted to realize seamless editing.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a guided editing system based on bidirectional microhomological arms and its applications. Background Technology

[0002] In mammalian genomes, the precise integration and replacement of large DNA sequences (>1 kb) holds transformative potential for gene therapy, synthetic biology, and disease modeling. While the CRISPR-Cas system has revolutionized genome editing, current methods for manipulating large fragments remain inherently limited. Homologous directed repair (HDR), the gold standard for precise integration, requires double-strand breaks (DSBs) and long homologous arms (>600 bp); however, it is inefficient (below 5% in most cell types), cell cycle dependent, and induces significant DNA damage, thus reducing cell viability. Meanwhile, the requirement for long homologous arms presents a significant challenge to donor construct delivery. Recently, to improve the efficiency of large fragment integration, researchers have focused on enhancing HDR capabilities by using small molecules to inhibit specific repair pathways. However, this approach may exhibit cytotoxicity and pose a potential risk to genome stability. Non-homologous end joining (NHEJ), while highly efficient, introduces unpredictable insertion / deletion mutations and integrates extensively at non-target sites. Other approaches have explored mechanisms mediated by microhomologous origins, such as microhomologous-mediated end joining (MMEJ) and single-strand annealing (SSA). These methods improve efficiency but still rely on DSBs and carry the risk of chromosome rearrangement or involve overly complex donor preparation processes.

[0003] Prime editing (PE) is a relatively new and innovative technology that enables small sequence editing without DSBs, but due to the limited procedural nature of reverse transcriptase, it cannot accommodate the integration of large fragments (>100 bp). A recent study showed that Cas9-PE technology, which introduces microhomologous arms, can promote homology-directed repair, thereby enabling the integration of larger exogenous sequences. However, this method requires the generation of DSBs and the use of two different Cas9 proteins, complicating the process and potentially introducing additional genomic instability.

[0004] Transposon and integrase methods bypass DSBs, but are generally lacking in programmability and leave residual sequences at the integration site. Researchers have attempted to combine PEs with recombinase systems (e.g., Bxb1-attB / attP) or CRISPR-Cas with transposase systems to achieve targeted insertion, but this leaves a large trace on the genome. Conversely, combining retrotransposons with the CRISPR-Cas9 nickase enables traceless integration, but its efficiency is relatively low. While these advances represent significant progress, they fail to address the core trade-off between precision, efficiency, and DSB-related genotoxicity. Therefore, developing a universal method for efficient, precise, DSB-free, and long-homologous-arm-independent multi-kilobase genomic sequence substitution remains a pressing issue. Summary of the Invention

[0005] The purpose of this invention is to provide a guided editing system based on bidirectional micro-homogeneous arms and its applications.

[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a guided editing system based on bidirectional micro-homogeneous arms, the system comprising: ①Synthesis enzyme-reverse transcriptase fusion protein; ② A first set of pegRNAs, capable of guiding the fusion protein to target sites near the 5' and 3' ends of the target nucleic acid sequence in the target genome, and creating a nick at the target site, while simultaneously using its own reverse transcription template to guide the synthesis of first and second genome single-stranded DNA elongates; and, ③ The second pegRNA group can guide the fusion protein to the target site near the 5' and 3' ends of the exogenous insertion sequence on the donor DNA molecule, and create a nick at the target site. At the same time, it uses its own reverse transcription template to guide the synthesis of the first donor single-stranded DNA elongate and the second donor single-stranded DNA elongate. The donor DNA molecule contains the exogenous insertion sequence; Wherein, the first genomic single-stranded DNA extension is homologous to the sequence upstream of the 5' end target site of the exogenous insertion sequence on the donor DNA molecule; The second genomic single-stranded DNA extension is homologous to the sequence upstream of the 3' end target site of the exogenous insertion sequence on the donor DNA molecule; The first donor single-stranded DNA extension is homologous to the sequence upstream of the 5' end of the target nucleic acid sequence in the target genome; The second donor single-stranded DNA extension is homologous to the sequence upstream of the 3' end of the target nucleic acid sequence in the target genome.

[0007] Furthermore, the nicking enzyme-reverse transcriptase fusion protein also contains an exonuclease protection factor.

[0008] Further, the nicking enzyme is a Cas9 nicking enzyme, preferably nCas9(H840A); the reverse transcriptase is an M-MLV reverse transcriptase; the exonuclease protection factor is a La protein or its active N-terminal domain, preferably the exonuclease protection factor is composed of the 1st to 194th amino acid residues of the N-terminus of the La protein.

[0009] Furthermore, the first pegRNA group includes a first target pegRNA targeting the 5' end of the target nucleic acid sequence and a second target pegRNA targeting the 3' end of the target nucleic acid sequence.

[0010] Furthermore, the second pegRNA group includes a third donor pegRNA targeting the 5' end of the exogenous insertion sequence and a fourth donor pegRNA targeting the 3' end of the exogenous insertion sequence.

[0011] Furthermore, the length of the single-stranded DNA elongate is 20-60 nucleotides, preferably 30 nucleotides.

[0012] Secondly, the present invention provides a method for guided editing using the system (including non-disease diagnosis and treatment purposes), which is a method for replacing a target nucleic acid sequence with a foreign insertion sequence in a target genome, comprising: introducing components according to the system into a target cell, thereby generating homologous single-stranded DNA extensions, i.e. microhomologous arms, on the target genome and the donor DNA molecule, respectively, and integrating the foreign insertion sequence into the target genome through homologous recombination mediated by the single-stranded DNA extensions, thereby replacing the target nucleic acid sequence.

[0013] The aforementioned method, in which the replacement process does not produce DNA double-strand breaks.

[0014] Furthermore, the target nucleic acid sequence and the exogenous insertion sequence are between 50 bp and 11 kb in size.

[0015] Thirdly, the present invention provides the application of the system in gene editing, synthetic biology, or in the construction of disease models (including non-disease diagnosis and treatment purposes).

[0016] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: (i) Bidirectional microhomologous arm design: Two pairs of independent pegRNAs (Prime Editing Guide RNAs) are used to generate single-stranded DNA (ssDNA) microhomologous arms at both ends of the genomic target site and at both ends of the donor vector insert fragment, respectively. These microhomologous arms are 20-60 nt in length and can promote efficient integration of donor DNA and genomic DNA.

[0017] (II) Homology Design of Microhomologous Arms: At both target sites in the genome, single-stranded DNA (ssDNA) extensions are homologous to the DNA sequences at the integration sites in the donor vector. This design ensures that the microhomologous arms effectively facilitate seamless ligation between the donor DNA and genomic DNA during integration. In the donor vector, the ssDNA extensions flanking the integration site are homologous to sequences upstream of the target cleavage sites in the genome. This bidirectional homology design further improves integration efficiency and accuracy. Testing integration mediated by homologous arms of different lengths revealed that 30 nt achieved the highest integration efficiency.

[0018] (III) Optimization of the Prime Editing system: By combining PE7 (which is fused with the N-terminal domain of the exonuclease protection factor La protein (La(1-194)) after reverse transcriptase) and donor design, integration efficiency was significantly improved. These optimizations ensured efficient generation of microhomologous arms and precise integration of donor DNA.

[0019] (iv) Minimizing genotoxic stress: Utilizing the nCas9 (H840A) nickase to target genomic sites and donors, it generates single-strand cuts only on the genome and donor, without producing double-strand breaks. Traditional HDR and NHEJ rely on double-strand breaks (DSBs), which lead to significant DNA damage and inhibit cell proliferation. PREMIER, however, utilizes the nCas9 (H840A) nickase to generate only single-strand cuts, significantly reducing DNA damage.

[0020] (v) The guided editing system provided by this invention can maintain high editing efficiency across different target sites and cell types, and can insert large DNA fragments to achieve seamless editing, with broad application prospects. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the plasmid structure expressing nCas9(H840A)-MLVRT-La in a preferred embodiment of the present invention.

[0022] Figure 2 This is the expression cassette of four pegRNAs in a preferred embodiment of the present invention.

[0023] Figure 3 In a preferred embodiment of the present invention, PREMIER is applied to each point of GAPDH (A), RPL13A (B), and EEF2 (C).

[0024] Figure 4The diagram above illustrates the replacement of endogenous fragments (of different lengths) at the PPP1R12C locus by a GFP-based reporter system mediated by PREMIER in a preferred embodiment of the present invention; the efficiency of PREMIER in replacing endogenous fragments of different lengths at the PPP1R12C locus using the EF1α-GFP reporter system (middle); and the efficiency of PREMIER-mediated replacement of endogenous fragments of different lengths at the PPP1R12C locus using EF1α-GFP-intron reporter systems of different sizes (bottom).

[0025] Figure 5 In a preferred embodiment of the present invention, PREMIER mediates the simultaneous integration of IRES-GFP at the GAPDH locus and EF1α-tdTomato at the TRAC locus.

[0026] Figure 6 In a preferred embodiment of the present invention, the frequency of Indels at the 5'-3' junction of EF1α-CD19 CAR-2A-GFP at the TRAC locus in HeLa cells after integration via the PREMIER, HDR, and NHEJ pathways is shown in the bar graph. Reverse insertion of IRES-GFP at the GAPDH locus mediated by NHEJ and PREMIER was detected by PCR. The nCas9 and dCas9 groups served as negative controls, with nCas9-RT replaced by either nCas9 or dCas9 (electrophoresis image). Detailed Implementation

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0028] Example 1 utilizes a bidirectional microhomological arm-based guided editing system to precisely integrate the exogenous sequence IRES-GFP-puro (GAPDH NCBI Gene ID: 2597, RPL13A NCBI Gene ID: 23521, EEF2 NCBI Gene ID: 1938) at three endogenous sites in humans: GAPDH, RPL13A, and EEF2. use Figure 1The plasmid shown expresses nCas9(H840A)-MLVRT-La (the full sequence of the plasmid is formed by tandemly connecting the sequences shown in SEQ ID NO:7 and SEQ ID NO:8, where bases 1710-8621 of the sequence shown in SEQ ID NO:7 encode nCas9(H840A)-MLVRT-La). nCas9(H840A) is capable of binding to pegRNA and recognizing the target site using the pegRNA spacer sequence, generating a single-stranded cleavage at the PAM-3 bp position. MLV-RT is the MLV-RT used by PE2max, responsible for reverse transcribing an ssDNA flap (single-stranded DNA extension, i.e., microhomologous arm) at the cleavage site based on the reverse transcription template sequence on the pegRNA. La is the N-terminal domain of the exonuclease protection factor La protein (La(1-194, amino acid sequence as shown in SEQ ID NO:4, nucleotide sequence as shown in SEQ ID NO:5)), which protects the stability of pegRNA and improves its efficiency. Amp-ori is a prokaryotic backbone used for amplifying plasmids in E. coli. Puro and Cherry are both selection elements used to screen successfully transfected cells and can be replaced or deleted as needed for experiments.

[0029] The four pegRNAs that generate microhomological arms by reverse transcription at the donor vector and genomic target site were expressed using an expression cascaded expression cascade (U6 promoter-pegRNA1-polyT-U6 promoter-pegRNA2-polyT-U6 promoter-pegRNA3-polyT-U6 promoter-pegRNA4-polyT, which is inserted between bases 1315-1316 of the plasmid sequence shown in SEQ ID NO:6) on the same plasmid (SEQ ID NO:6). Figure 2 ).

[0030] The sequences of the expression frames (U6 promoter -pegRNA1 -polyT -U6 promoter -pegRNA2 - polyT -U6 promoter -pegRNA3 -polyT -U6promoter -pegRNA4 -polyT) designed for each site of GAPDH, RPL13A, and EEF2 are shown in SEQ ID NO:1-3, respectively.

[0031] like Figure 3As shown, a total of four pegRNAs are required to complete the replacement event. The pegRNA targeting the 5' end of the substituted genomic fragment (tested to be 59 bp to 10795 bp in size) is called Target peg-1. Its spacer sequence (20 bp) and orientation are marked with yellow arrows. Its reverse transcription template sequence is the green-marked base sequence, with the order 5'>3' (for example, at the GAPDH site, it is TTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTTAATTAAC). PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flop at the nCas9 cleavage site (i.e., the PAM-3 bp position), marked with a short red line, with a length of 20~60 bp. The flap of this single-stranded DNA is homologous to the sequence upstream of the 5' end target site of the inserted sequence on the Donor (taking the GAPDH site in the figure as an example, both are GTTAATTAAGGATCCGCCCCTCTCCCCCCCCCCCCTAA).

[0032] The pegRNA targeting the 3' end of the replaced genomic fragment is called Target peg-2. Its spacer sequence (20 bp) and orientation are marked with a purple arrow. Its reverse transcription template sequence is the green-marked base sequence, with the order 5'>3' (for example, at the GAPDH site, it is AATAAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTT). PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flap at the nCas9 cleavage site (i.e., the PAM-3 bp position), marked with a short green line. The length can be 20~60 nt. This single-stranded DNA flap is homologous to the sequence upstream of the cleavage site at the 3' end of the inserted sequence on the Donor (for example, at the GAPDH site shown in the figure, both are AAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATT).

[0033] The pegRNA targeting the 5' end of the inserted fragment on the Donor is called Donor peg-1. Its spacer sequence (20 bp) and orientation are marked with red arrows. Its reverse transcription template sequence is the yellow-highlighted base sequence, with the order 5'>3' (for example, at the GAPDH site, it is GGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGAC). PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flap at the nCas9 cleavage site (i.e., the PAM-3 bp position), marked by a short yellow line. The length can be 20~60 nt. This single-stranded DNA flap is homologous to the sequence upstream of the cleavage site at the 5' end of the target site of the replaced genomic fragment (for example, at the GAPDH site shown in the figure, both are GTCTTACTCCTTGGAGGCCATGTGGGCCATGAGGTCCACC).

[0034] The pegRNA targeting the 3' end of the inserted fragment on the Donor is called Donor peg-2. Its spacer sequence (20 bp) and orientation are marked with green arrows. Its reverse transcription template sequence is the purple-marked base sequence, with the order 5'>3' (for example, at the GAPDH site, it is CCTAGGCCCCTCCCCTCTTCAAGGGGTCTACATGGCAACT). PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flap at the nCas9 cleavage site (i.e., the PAM-3 bp position), marked with a short purple line. The length can be 20~60 nt. This single-stranded DNA flap is homologous to the sequence upstream of the cleavage site at the 3' end of the target site of the replaced genomic fragment (for example, at the GAPDH site shown in the figure, both are AGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGG).

[0035] The above-constructed guided editing system based on bidirectional micro-homogeneous arms ( Figure 1 plasmids Figure 2 The plasmid and Donor transfected host cells (such as HeLa cells), and the results showed that an integration efficiency of about 60% was achieved, and the sequencing at the adapter site was accurate with no obvious indels.

[0036] Example 2: The large-scale replacement and multi-target editing capabilities of the present invention's guided editing system 1. Large-scale replacement: At the PPP1R12C site in HeLa cells (NCBI Gene ID: 54776), PREMIER successfully replaced genomic fragments ranging from 56 bp to 10795 bp, demonstrating consistently high efficiency across a wide fragment size range. This confirms that the distance between pegRNAs on the genome does not significantly limit PREMIER's efficiency and that it can replace genomic fragments exceeding 10 kb. Testing with donors of different sizes revealed that it can achieve integration of exogenous sequences >10 kb while maintaining high efficiency. Further experiments were conducted using the EF1a-GFP reporter system, with the pegRNAs targeting the 5' end of the genomic sequence to be replaced and the pegRNAs targeting the 5' end of the inserted sequence remaining unchanged. By progressively increasing the distance between the two pegRNA cleavages targeting the genome, the length of the replaced fragment on the genome was increased.

[0037] The replacement event requires a total of four pegRNAs. The pegRNA targeting the 5' end of the replaced genomic fragment is called Target peg-1. Its spacer sequence is the positive strand sequence at the 5' end of the replaced genomic fragment (for example, targeting the PPP1R12C site, the sequence is accctctgctgcgccacctg). Its reverse transcription template sequence, for example targeting the PPP1R12C site, is cggagcctcacgaGGTATGTCGGGAACCTC. PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flop at the nCas9 cleavage site (i.e., the PAM-3 bp position). This single-stranded DNA flop is homologous to the sequence upstream of the cleavage site at the 5' end of the inserted sequence on the Donor (for example, targeting the PPP1R12C site, both are GAGGTTCCCGACATACCtcgtgaggctccg).

[0038] The pegRNA targeting the 5' end of the inserted fragment on the Donor is called Donor peg-1. Its spacer sequence is the antisense strand sequence at the 5' end of the inserted sequence on the Donor (for example, the sequence is GGTATGTCGGGAACCTCTCC for EF1a-GFP used to target the PPP1R12C site). Its reverse transcription template sequence, for example, targeting the PPP1R12C site, is cggggccaggtccaccctctgctgcgccac). PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flop at the nCas9 cleavage site (i.e., the PAM-3bp position). This single-stranded DNA flop is homologous to the sequence upstream of the cleavage site at the 5' end of the target site of the replaced genomic fragment (for example, targeting the PPP1R12C site, both are gtggcgcagcagagggtggacctggccccg).

[0039] The pegRNA targeting the 3' end of the replaced genomic fragment is called Target peg-2. Its spacer sequence is the antisense strand sequence at the 3' end of the replaced genomic fragment (for example, targeting the PPP1R12C site and replacing a 59bp genomic fragment, the sequence is gcatagggtggcaaagccca). Its reverse transcription template sequence, for example, targeting the PPP1R12C site, is GGCATGCTGGGGAAATGCGATACCCTCACT. PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flop at the nCas9 cleavage site (i.e., the PAM-3bp position). This single-stranded DNA flop is homologous to the sequence upstream of the cleavage site at the 3' end of the inserted sequence on the Donor (for example, targeting the PPP1R12C site, both are AGTGAGGGTATCGCATTTCCCCAGCATGCC).

[0040] The pegRNA targeting the 3' end of the inserted fragment on the Donor is called Donor peg-2. Its spacer sequence is the antisense strand sequence at the 3' end of the inserted sequence on the Donor (taking EF1a-GFP used to target the PPP1R12C site as an example, the sequence is AATGCGATACCCTCACTGCT). Its reverse transcription template sequence, taking the PPP1R12C site and replacing a 59bp genomic fragment as an example, is ggacggggtgtcagcatagggtggcaaagc. PE can use this reverse transcription template to reverse transcribe a single-stranded DNA flop at the nCas9 cleavage site (i.e., the PAM-3 bp position). This single-stranded DNA flop is homologous to the sequence upstream of the cleavage site at the 3' end of the target site of the replaced genomic fragment (taking the PPP1R12C site and replacing a 59bp genomic fragment as an example, both are gctttgccaccctatgctgacaccccgtcc).

[0041] In the experiment, to increase the distance between the two pegRNA cleavage sites targeting the genome, thereby increasing the length of the replaced fragment on the genome, we kept Target peg-1 and Donor peg-1 unchanged. We modified the spacer sequence of Target peg-2 to increase the distance between its target site and the target site of Target peg-1 on the genome. Simultaneously, we modified the RT sequence of Donor peg-2 to be homologous to the sequence upstream of the cleavage site at the target site of Target peg-2 after the 3' end modification of the replaced genomic fragment. This increased the length of the replaced fragment on the genome (for example, increasing the length of the replaced sequence on the genome to 10795 bp, keeping Target peg-1 and Donor peg-1 unchanged, and changing the spacer sequence of Target peg-2 from gcatagggtggcaaagccca to gctagaacaaggcaaagctg, thus increasing the distance between the cleavage sites of Target peg-1 and Target peg-2 on the genome from 59 bp to 10795 bp). The RTT (reverse transcription template) of peg-2 remains unchanged because the Donor sequence is unchanged, while the PBS sequence changes with the spacer sequence. The RTT sequence of the Donor peg-2 is changed from ggacggggtgtcagcatagggtggcaaagc to caggagtggaactgctagaacaaggcaaag, which reverse transcribes a single-stranded DNA flop. This single-stranded DNA flop is homologous to the sequence upstream of the cleavage site at the 3' end of the Target peg-2 target site of the replaced genomic fragment, namely ctttgccttgttctagcagttccactcctg. At the same time, the spacer and PBS of the Donor peg-2 remain unchanged because the Donor sequence is unchanged.

[0042] The results showed that the length of the replaced genomic fragment had no significant impact on PREMIER's efficiency, and both achieved highly efficient replacement.

[0043] Furthermore, by inserting intron splicing sites and intron sequences into GFP, EF1a-GFP donor vectors with insert sequences ranging from 2.19 kb to 10.3 kb were generated. These vectors were then used to replace 112 bp, 1976 bp, and 10260 bp of the genome sequence, respectively. The results showed that efficient replacement (>30%) was successfully achieved in all cases. Even when using the largest donor (10.3 kb), PREMIER still achieved a replacement efficiency of up to 54.7%.

[0044] Figure 4A schematic diagram (top) of PREMIER-mediated replacement of endogenous fragments (of different lengths) at the PPP1R12C locus by a GFP-based reporter system; the efficiency of PREMIER in replacing endogenous fragments of different lengths at the PPP1R12C locus using an EF1α-GFP reporter system (middle); and the efficiency of PREMIER-mediated replacement of endogenous fragments of different lengths at the PPP1R12C locus using EF1α-GFP-intron reporter systems of different sizes (bottom).

[0045] 2. Multi-target editing: PREMIER can edit multiple gene sites simultaneously. For example, IRES-GFP and EF1a-tdTomato reporter genes were inserted into the GAPDH and TRAC sites, respectively, and cells integrating both reporter genes were successfully observed by flow cytometry, confirming PREMIER's ability in multi-target integration events.

[0046] The four pegRNAs at the GAPDH site were designed as in Example 1. For the TRAC site, the RTT sequence of Target peg-1 is ctttttattgccgGGTATGTCGGGAACCTC, and its corresponding homologous sequence is GAGGTTCCCGACATACCcggcaataaaaag; the RTT sequence of Target peg-2 is ATggcgcgccTTTgagatcgagtgccgcat, and its corresponding homologous sequence is atgcggcactcgatctcAAAggcgcgccAT; the RTT sequence of Donor peg-1 is ccagccccacagagccccgcccttgtccat, and its corresponding homologous sequence is atggacaagggcggggctctgtggggctgg; the RTT sequence of Donor peg-1 is ttagagtctctcagctggtacacggcaggg, and its corresponding homologous sequence is ccctgccgtgtaccagctgagagactctaa. All required pegRNAs targeting GAPDH and TRAC sites, IRES-GFP targeting GAPDH, EF1α-tdTomato targeting TRAC sites, and nCas9-RT-La were transfected into HeLa cells. 24 hours after transfection, positively transfected cells were screened using puro (1 μg / ml) for 48 hours. After normal passage and culture for approximately 10 days, once the unintegrated free plasmids had metabolized, flow cytometry was performed to sort and analyze the integrated positive cells. The experimental results are as follows: Figure 5 As shown.

[0047] Example 3: The high accuracy and extremely low non-targeting activity of the guided editing system of the present invention 1. Accuracy: At the TRAC site (NCBI Gene ID: 28755), the indel rate of PREMIER was comparable to HDR and significantly lower than NHEJ. At the GAPDH site, no reverse integration events were detected in PREMIER, while NHEJ showed detectable reverse integration. The pegRNA design is shown in Example 2, and the experimental results are as follows. Figure 6 As shown.

[0048] 2. Non-targeting activity: Through UMI-linked Tn5 transposase labeling, ligation PCR amplification, and deep sequencing, PREMIER achieved precise mapping of the vast majority of sequencing reads to the predetermined target site during integration at the PPP1R12C site. In contrast, NHEJ-mediated integration exhibited extensive non-targeting activity across all 20 autosomes, with only 27.68% of reads mapping to the target PPP1R12C site. This demonstrates PREMIER's extremely high integration specificity, with a non-targeting rate approximately 100 times lower than that of NHEJ-based methods.

[0049] Example 4: The guided editing system of the present invention minimizes genotoxic stress. DSB-free mechanism: Traditional HDR and NHEJ rely on double-strand breaks (DSBs), which lead to significant DNA damage and inhibit cell proliferation. PREMIER, on the other hand, utilizes the nCas9 (H840A) nickase, which produces only single-strand nicks, significantly reducing DNA damage.

[0050] Cell damage and proliferation: After integration at the PPP1R12C site, the γ-H2A.X level (γ-H2A.X is measured by immunofluorescence staining, where fluorescence intensity reflects the extent of DNA damage) in PREMIER-treated cells was not significantly different from the control group, indicating minimal DNA damage. However, the HDR and NHEJ groups showed significantly elevated γ-H2A.X signaling. Ki67 staining showed that cell proliferation was not impaired in PREMIER and control cells, while Ki67 intensity was significantly reduced in the HDR and NHEJ groups. These data confirm that PREMIER has superior safety due to its lack of a DSB mechanism.

[0051] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A guided editing system based on bidirectional micro-homogeneous arms, characterized in that, The system includes: ①Synthesis enzyme-reverse transcriptase fusion protein; ② A first set of pegRNAs, capable of guiding the fusion protein to target sites near the 5' and 3' ends of the target nucleic acid sequence in the target genome, and creating a nick at the target site, while simultaneously using its own reverse transcription template to guide the synthesis of first and second genome single-stranded DNA elongates; and, ③ The second pegRNA group can guide the fusion protein to the target site near the 5' and 3' ends of the exogenous insertion sequence on the donor DNA molecule, and create a nick at the target site. At the same time, it uses its own reverse transcription template to guide the synthesis of the first donor single-stranded DNA elongate and the second donor single-stranded DNA elongate. The donor DNA molecule contains the exogenous insertion sequence; Wherein, the first genomic single-stranded DNA extension is homologous to the sequence upstream of the 5' end target site of the exogenous insertion sequence on the donor DNA molecule; The second genomic single-stranded DNA extension is homologous to the sequence upstream of the 3' end target site of the exogenous insertion sequence on the donor DNA molecule; The first donor single-stranded DNA extension is homologous to the sequence upstream of the 5' end of the target nucleic acid sequence in the target genome; The second donor single-stranded DNA extension is homologous to the sequence upstream of the 3' end of the target nucleic acid sequence in the target genome.

2. The system according to claim 1, characterized in that, The nicking enzyme-reverse transcriptase fusion protein also contains an exonuclease protection factor.

3. The system according to claim 2, characterized in that, The nicking enzyme is a Cas9 nicking enzyme, preferably nCas9(H840A); the reverse transcriptase is an M-MLV reverse transcriptase; the exonuclease protection factor is a La protein or its active N-terminal domain, preferably the exonuclease protection factor is composed of the 1st to 194th amino acid residues of the N-terminus of the La protein.

4. The system according to claim 1, characterized in that, The first pegRNA group includes a first target pegRNA targeting the 5' end of the target nucleic acid sequence and a second target pegRNA targeting the 3' end of the target nucleic acid sequence; The second pegRNA group includes a third donor pegRNA targeting the 5' end of the exogenous insertion sequence and a fourth donor pegRNA targeting the 3' end of the exogenous insertion sequence.

5. The system according to any one of claims 1-4, characterized in that, The length of the single-stranded DNA elongate is 20-60 nucleotides.

6. The system according to claim 5, characterized in that, The length of the single-stranded DNA elongation is 30 nucleotides.

7. A method for guided editing using the system according to any one of claims 1-6, characterized in that, It is a method for replacing a target nucleic acid sequence with a foreign insertion sequence in a target genome, comprising: introducing each component of the system according to any one of claims 1-6 into a target cell, thereby generating homologous single-stranded DNA elongations, i.e. microhomologous arms, on the target genome and the donor DNA molecule, respectively, and integrating the foreign insertion sequence into the target genome through homologous recombination mediated by the single-stranded DNA elongations, thereby replacing the target nucleic acid sequence; The method described is not for disease diagnosis and treatment purposes.

8. The method according to claim 7, characterized in that, The replacement process does not produce DNA double-strand breaks.

9. The method according to claim 7 or 8, characterized in that, The target nucleic acid sequence and the exogenous insertion sequence are between 50 bp and 11 kb in size.

10. The application of the system according to any one of claims 1-6 in gene editing, synthetic biology, or the construction of disease models; The application is for purposes other than disease diagnosis and treatment.

Images