Method for producing all-male largemouth micropterus salmoides based on soaking induction of sex reversal of largemouth micropterus salmoides

By inducing sex reversal in largemouth bass through soaking in water containing pregestrene, the problems of high operational difficulty, low survival rate, and high deformity rate in existing technologies have been solved, enabling efficient and convenient large-scale production of all-male largemouth bass.

CN121970703APending Publication Date: 2026-05-05HUNAN NORMAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUNAN NORMAL UNIVERSITY
Filing Date
2026-03-17
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing technologies for sex induction in largemouth bass present challenges such as high operational difficulty, low survival rate, high deformity rate, and high cost, making it difficult to achieve large-scale production of all-male largemouth bass.

Method used

The immersion induction method was used to immerse largemouth bass fry in a sex reversal induction reagent of a specific concentration. Sex reversal was achieved by dissolving etoposide in the water. The immersion time was 60 days. Afterward, they were transferred to conventional aquaculture water for cultivation to obtain all-male largemouth bass.

Benefits of technology

It achieves high survival rate and low deformity rate in sex reversal, is easy to operate, and is suitable for large-scale production of all-male largemouth bass, with a sex reversal rate of up to 100%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121970703A_ABST
    Figure CN121970703A_ABST
Patent Text Reader

Abstract

The invention discloses a method for producing all-male largemouth micropterus salmoides based on soaking induction of sex reversal of largemouth micropterus salmoides, and particularly relates to the field of artificial propagation of all-male largemouth micropterus salmoides, the method comprises the following steps: S01, taking fairy shrimps as initial feed when largemouth micropterus salmoides fries obtained by incubation swim flatly; s02, transferring the largemouth micropterus salmoides fry into a water body in which a sexual reversal induction reagent is dissolved, keeping feeding three times every day during the period, and soaking and breeding the fry for 60 days; and S03, after soaking and culturing for 60 days, transferring the largemouth bass fry into a conventional culture water body for culturing, and after sexual maturity of the largemouth bass fry, obtaining a male population capable of generating seminal fluid, namely the all-male largemouth bass. According to the method, largemouth bass fries are soaked in a sex reversal induction reagent with a specific concentration, sex reversal fishes with a high survival rate and a low malformation rate can be directly obtained, and then large-scale cultivation of all-male largemouth bass is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of artificial breeding of all-male largemouth bass, and more particularly to a method for producing all-male largemouth bass based on soaking-induced sex reversal. Background Technology

[0002] Largemouth bass, commonly known as California bass, belongs to the order Perciformes, suborder Perciformes, and family Sunfishidae. Native to freshwater areas of North America, it was first introduced to my country in 1983. Due to its tender and delicious flesh, short cultivation cycle, strong environmental adaptability, and ease of harvesting, its aquaculture scale has continued to expand, making it one of my country's important and high-quality freshwater aquaculture species. Research shows that after gonadal development begins, male and female largemouth bass exhibit significant dimorphism in energy allocation. Females prioritize the use of a large amount of ingested energy for ovarian development. This physiological energy redistribution strategy directly leads to a significant slowdown in the growth rate of female largemouth bass, while simultaneously increasing the feed conversion ratio, thus restricting the economic benefits of large-scale aquaculture. Therefore, cultivating an all-male largemouth bass population is the most effective way to overcome the current bottlenecks in the industry's development and improve aquaculture efficiency and economic returns.

[0003] Sex reversal technology can produce monosex populations, solving problems such as growth differences and reproductive losses caused by sex in aquaculture. Currently, sex-directed control can be achieved through hormone induction (such as methyltestosterone) and temperature induction to obtain all-male largemouth bass. In the past, hormone induction often involved treating feed with hormones to achieve a high sex reversal rate. However, in practice, acclimatizing largemouth bass fry to feed is difficult, and hormone ingestion causes stress in the fish, thus reducing the survival rate of offspring. Temperature induction, through precise control of water temperature, can successfully cultivate sex-reversed fish with high survival rates and low deformity rates. However, in large-scale aquaculture, the energy consumption and equipment investment costs required to maintain a constant water temperature for a long time are high, limiting the widespread application of this technology in the industry.

[0004] In view of this, it is a problem that technicians need to solve to design a more energy-efficient, stable and easy-to-operate method for inducing sex reversal in largemouth bass, which also has high survival rate, high sex reversal rate and low deformity rate, so as to achieve large-scale production of all-male largemouth bass. Summary of the Invention

[0005] This invention provides a method for producing all-male largemouth bass based on immersion-induced sex reversal. The method involves immersing largemouth bass fry in a sex reversal induction reagent of a specific concentration, directly obtaining sex-reversed fish with high survival rates and low deformity rates, thereby enabling large-scale breeding of all-male largemouth bass.

[0006] The objective of this invention is achieved through the following technical solution: A method for producing all-male largemouth bass based on immersion-induced sex reversal, comprising the following steps: S01. When the hatched largemouth bass fry are swimming horizontally, use brine shrimp as their first food. S02. Transfer the largemouth bass fry that have just opened to water containing a sex reversal induction agent. During this period, feed them 3 times a day and soak and cultivate the fry for 60 days. S03. After soaking and cultivating for 60 days, the largemouth bass fry are transferred to conventional aquaculture water for further cultivation. The male population that can produce sperm after they reach sexual maturity is the all-male largemouth bass.

[0007] As a preferred option, in step S01, the largemouth bass fry are allowed to swim horizontally for 5-7 days after hatching.

[0008] Preferably, in step S02, the sex reversal induction agent is etoposide at a concentration of 100-200 ng / L.

[0009] As a preferred method, the preparation method of etoposide is as follows: first, it is fully dissolved in anhydrous ethanol at 60-70℃ to prepare a stock solution with a concentration of 100 mg / L; then, the stock solution is added to the aquaculture tank in proportion so that the final concentration of etoposide in the aquaculture tank water is maintained in the range of 100-200 ng / L.

[0010] Preferably, in step S02, the stocking density is 200 fish / m². 3 The water volume in the aquaculture tank is 50L.

[0011] As a preferred option, in step S02, during the feeding period, brine shrimp are fed for the first 7 days, and then feed with feed powder containing >50% protein from 7 to 15 days. During this period, the water is changed once every 3 days using aerated tap water with 100-200 ng / L of etoposide, and the water volume is one-third of the water volume in the breeding tank.

[0012] As a preferred method, in step (3), the verification method for all male largemouth bass is as follows: 30 XX-type common largemouth bass are randomly selected, and their genetic sex is determined by PCR amplification using specific molecular markers and agarose gel electrophoresis analysis. Their phenotypic sex is determined by HE staining of the gonads.

[0013] Compared with the prior art, the advantages or beneficial effects of the technical solution of this application include: 1. This scheme has made significant optimizations in terms of administration route. Compared with conventional hormone-fed reversal largemouth bass, it only requires soaking treatment, which is simpler and more efficient. Compared with temperature-controlled induced reversal largemouth bass, it only requires soaking treatment, which is more energy-efficient and suitable for large-scale production.

[0014] 2. This method successfully induced female largemouth bass to convert to males using etoposide immersion, providing a new technical approach for sex control and parthenogenesis in largemouth bass. By treating XX♀ common largemouth bass with etoposide immersion, they can be reversibly converted into XX♂ common largemouth bass pseudo-males, with a reversal rate of up to 100%. A fully male largemouth bass population can be quickly obtained through large-scale production.

[0015] 3. This invention involves treating XX♀ female gynogenetic largemouth bass with etoposide to induce the transformation into XX♂ female gynogenetic largemouth bass pseudomales. Further screening with specific primer pairs yields 100% female largemouth bass pseudomales. Mating the selected XX♀ female gynogenetic largemouth bass pseudomales with XX♂ female gynogenetic largemouth bass allows for the large-scale acquisition of gynogenetic largemouth bass populations. Attached Figure Description

[0016] Figure 1 Gynogenesis in largemouth bass morphology; Figure 2 Female development in pseudo-male largemouth bass; Figure 3 The appearance of a common largemouth bass; Figure 4 The appearance of a common largemouth bass pseudo-male; Figure 5 Paraffin section of testis of pseudo-male largemouth bass undergoing gynogenesis; Figure 6 Paraffin-embedded testis of a pseudo-male common largemouth bass. Detailed Implementation

[0017] The following detailed description of the embodiments of this application, in conjunction with the accompanying drawings, will provide a thorough understanding of how this application uses technical means to solve technical problems and achieve corresponding technical effects, enabling its implementation. The embodiments of this application and the various features within them can be combined with each other without conflict, and all resulting technical solutions are within the protection scope of this application.

[0018] It should be clearly stated that the embodiments described below are merely some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without inventive effort are within the scope of protection of this application.

[0019] Example 1: The steps for inducing gynogenesis in largemouth bass pseudo-males through soaking are as follows: 1. Immersion induction Fertilized eggs of gynogenetic largemouth bass were transferred to hatching tanks and incubated in still water at 18-20℃. Once the fish began swimming horizontally and opening their mouths, 10-day-old juveniles were transferred to 50-liter rearing tanks at an initial density of 200 fish / m².3 Etogestene was first dissolved in anhydrous ethanol at 60-70℃ to prepare a stock solution with a concentration of 100 mg / L. This stock solution was then added to the aquaculture water in a specific ratio to maintain the final concentration of etogestene in the water within the range of 100-200 ng / L. To ensure the stability of the exposure environment, the water was changed every 3 days using aerated tap water containing 100-200 ng / L of etogestene, with the water volume being one-third of the aquaculture tank volume, to maintain a constant target concentration range. The juvenile fish were continuously immersed and cultured for 60 days, resulting in sex-reversed gynogenetic largemouth bass fry. All groups of fish were fed brine shrimp for the first 7 days, gradually transitioning (7-15 days) to feed powder (protein content >50%). After 60 days, the fry were transferred to ponds for intensive culture, resulting in gynogenetic largemouth bass pseudo-males. The gynogenetic largemouth bass resembled... Figure 1 As shown, the female-developing pseudo-male largemouth bass resembles... Figure 2 As shown, the gonads of the pseudo-male largemouth bass develop from females as follows: Figure 5 As shown.

[0020] 2. Individual analysis and survival rate statistics of sex reversal Sex-reversed gynogenetic largemouth bass were intensively cultured for one year until they reached sexual maturity, at which point males capable of producing sperm were obtained. The detection method involved gently pressing the abdomen of the fish; individuals from which a milky white or pale white liquid could be expelled from the vent were identified as sex-reversed gynogenetic largemouth bass pseudo-males. This method resulted in a 100% male reversal rate and a 75% survival rate. After raising the fry, we examined the countable traits of the gynogenetic largemouth bass pseudo-males and compared them with those of the fully developed largemouth bass, as shown in Table 1 below.

[0021] Table 1 Comparison of countable traits in gynogenetic largemouth bass pseudo-males and gynogenetic largemouth bass Fish species BL / BW BL / BH BL / HL HL / HW TL / TW BW / HW Gynogenesis in largemouth bass 1.13 ± 0.04 3.19 ±0.26 3.47 ±0.06 1.03 ± 0.26 1.88 ± 0.14 1.08 ± 0.03 Gynogenesis in largemouth bass pseudo-male 1.13 ± 0.03 3.21± 0.13 3.50 ±0.04 0.99 ± 0.05 1.86 ± 0.13 1.07 ± 0.03 This embodiment demonstrates how XX♀ female gynogenetic largemouth bass can be reversibly sex-reversed into XX♂ female gynogenetic largemouth bass pseudo-males by immersion in pregnane. Mating these XX♀ female gynogenetic largemouth bass pseudo-males with XX♂ female gynogenetic largemouth bass allows for the large-scale acquisition of gynogenetic largemouth bass populations. Compared to existing technologies that utilize hormone-fed sex reversal, this invention, through immersion, offers advantages such as ease of operation, high success rate, and high survival rate.

[0022] Furthermore, sex reversal can be achieved directly using offspring developed from gynogenetic cells. Successful reversal can be confirmed simply by checking whether the offspring can produce sperm during the breeding season, making the process simple and easy. This invention not only provides a solid foundation for improving the germplasm resources of largemouth bass, but also has significant implications for genetic breeding and biological evolution.

[0023] Example 2: The steps for inducing the formation of pseudo-male common largemouth bass through soaking are as follows: 1. Immersion induction Fertilized eggs of common largemouth bass were transferred to hatching tanks and incubated in still water at 18-20℃. Once the fish began swimming horizontally and opening their mouths, 10-day-old juveniles were transferred to 50-liter rearing tanks at an initial density of 200 fish per tank. Etopregnene was first fully dissolved in anhydrous ethanol at 60-70℃ to prepare a stock solution with a concentration of 100 mg / L. This stock solution was then added to the rearing water in a specific ratio to maintain a final concentration of etopregnene in the water within the range of 100-200 ng / L. To ensure the stability of the exposure environment, aerated tap water containing 100-200 ng / L of etopregnene was used for water changes every 3 days, with the water volume being one-third of the rearing tank volume, to maintain a constant target concentration range. The juveniles were immersed and reared for 60 days, resulting in sex reversal and development into largemouth bass fry. All groups of fish were fed brine shrimp for the first 7 days, gradually transitioning to feed powder (protein content >50%) over 7-15 days. After 60 days, the fish fry are transferred to a pond for intensive rearing, thus obtaining pseudo-male common largemouth bass. The common largemouth bass resembles... Figure 3 As shown, the common largemouth bass pseudo-male has the following appearance: Figure 4 As shown, the gonads of the common largemouth bass pseudo-male are as follows: Figure 6 As shown.

[0024] 2. Individual analysis and survival rate statistics of sex reversal Thirty XX-type largemouth bass of 60 days old were randomly selected. Genetic sex was determined by collecting tail fin tissue, extracting genomic DNA using a DNA extraction kit, and performing PCR amplification using sex-specific molecular markers. After PCR amplification, detection was performed using 1% agarose gel electrophoresis. The primer sequences used for PCR amplification were: forward primer: GACTCAGGTCCGACACTTTCAT, reverse primer: AAGCCTCACCCTGGCAAGCAACT. In agarose gel electrophoresis, genetically males showed two bands, while genetically females showed only one band. Phenotypic sex was determined by observing gonadal hematoxylin and eosin (HE) staining.

[0025] In this embodiment, 30 genetically female but physiologically male pseudo-male individuals were detected in a randomly selected group of 30 common largemouth bass, indicating successful sex reversal. The statistical reversal success rate was 100%, the survival rate was 78%, and the deformity rate was low. After identification using the aforementioned primers and HE staining of the gonads, the resulting pseudo-male population was confirmed to exhibit no reproductive behavior, facilitating high-density, intensive aquaculture. Furthermore, it can be used as a key paternal parent for an all-male population.

[0026] After the fry were reared, we tested the countable traits of pseudo-male largemouth bass and compared them with gynogenetic largemouth bass and common largemouth bass, as shown in Table 2 below.

[0027] Table 2 Comparison of countable traits between common largemouth bass and pseudo-male common largemouth bass Fish species BL / BW BL / BH BL / HL HL / HW TL / TW BW / HW Common largemouth bass 1.13 ± 0.04 3.22 ± 0.13 3.50 ± 0.03 1.01 ± 0.05 1.88 ± 0.17 1.07 ± 0.04 Common largemouth bass pseudo-male 1.11 ± 0.04 3.22 ± 0.26 3.48 ± 0.05 1.01 ± 0.22 1.84 ± 0.14 1.05 ± 0.03 The immersion induction technique used in this invention is more convenient to operate and has a higher sex reversal survival rate compared to hormone intake induction techniques for the same purpose; it is also more energy-efficient than temperature induction techniques for the same purpose. Because fish exhibit significant differences in their response to sex reversal at different etoposide immersion concentrations, there is no universally applicable concentration and duration treatment for fry. For largemouth bass, this uncertainty undoubtedly increases the difficulty of immersion-induced sex reversal. In this invention, through extensive preliminary exploratory experiments, we discovered that treating 10-day-old largemouth bass fry with 100-200 ng / L etoposide and maintaining them until 60 days of age achieves a good sex reversal success rate. Furthermore, by using specific primer pairs combined with HE staining of the gonads, we were able to identify pseudo-male largemouth bass, laying a solid foundation for the large-scale production of all-male largemouth bass.

Claims

1. A method for producing all-male largemouth bass based on immersion-induced sex reversal, characterized in that, Includes the following steps: S01. When the hatched largemouth bass fry are swimming horizontally, use brine shrimp as their first food. S02. Transfer the largemouth bass fry that have just opened to water containing a sex reversal induction agent. During this period, feed them 3 times a day and soak and cultivate the fry for 60 days. S03. After soaking and cultivating for 60 days, the largemouth bass fry are transferred to conventional aquaculture water for further cultivation. The male population that can produce sperm after they reach sexual maturity is the all-male largemouth bass.

2. The method for producing all-male largemouth bass based on immersion-induced sex reversal according to claim 1, characterized in that, In step S01, the largemouth bass fry swim horizontally for 5-7 days after hatching.

3. The method for producing all-male largemouth bass based on immersion-induced sex reversal according to claim 1, characterized in that, In step S02, the sex reversal induction agent is etoposide at a concentration of 100-200 ng / L.

4. The method for producing all-male largemouth bass based on immersion-induced sex reversal according to claim 3, characterized in that, The preparation method of etoposide is as follows: First, it is fully dissolved in anhydrous ethanol at 60-70℃ to prepare a stock solution with a concentration of 100 mg / L; then, the stock solution is added to the aquaculture tank in proportion so that the final concentration of etoposide in the aquaculture tank water is maintained in the range of 100-200 ng / L.

5. The method according to claim 4, characterized in that, In step S02, the stocking density is 200 fish / m². 3 The water volume in the aquaculture tank is 50L.

6. The method according to claim 5, characterized in that, In step S02, during the feeding period, brine shrimp are fed for the first 7 days, and from 7 to 15 days, they are switched to feed powder with a protein content of >50%. During this period, the water is changed once every 3 days using aerated tap water with 100-200 ng / L of etoposide, and the water volume is one-third of the water volume of the breeding tank.

7. The method according to claim 1, characterized in that, In step (3), the verification method for all male largemouth bass is as follows: 30 XX-type common largemouth bass are randomly selected, and their genetic sex is determined by PCR amplification using specific molecular markers and agarose gel electrophoresis analysis. Their phenotypic sex is determined by HE staining of the gonads.