Scutellarin-loaded brain tissue exosome nanoparticles and application thereof in preparation of medicine for penetrating blood brain barrier to treat diseases

Abstract

The invention relates to scutellarin-loaded brain tissue exosome nanoparticles and application thereof in preparation of a medicine for treating diseases by penetrating through a blood brain barrier, and belongs to the technical field of medicines. Brain tissue exosome nanoparticles loaded with scutellarin are added into mouse microglial cells, astrocytes and brain microvascular endothelial cells, so that the nanoparticles can regulate the polarization of the microglial cells caused by PRV infection, remarkably inhibit the expression of M1 type microglial cells CD86, promote the expression of M2 type microglial cells CD 206, inhibit the expression of the PRV infection, and inhibit the PRV infection. The anti-inflammatory effect is achieved; through in-vitro Transwell blood brain barrier and blood brain barrier penetration test of the exosome of a living brain tissue model, it is obtained that the brain tissue exosome can enhance the brain delivery efficiency of scutellarin. The scutellarin-loaded brain tissue exosome nanoparticles provided by the invention solve the problems of difficult scutellarin blood brain barrier penetration and low bioavailability, and have important practical significance in prevention and control of porcine pseudorabies.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to a brain tissue exosome nanoparticle loaded with ligustrazine and its application in the preparation of drugs that penetrate the blood-brain barrier to treat diseases. Background Technology

[0002] Pseudorabies virus (PRV) belongs to the porcine herpesviridae family, whose members can infect almost all humans and animal species. After infecting adult pigs, PRV particles typically remain latent in the host's peripheral ganglia. PRV can cross the blood-brain barrier, causing brain tissue damage and neurological symptoms such as agitation, intense itching, skin ulceration, and even death. Microglia, as inherent immune cells in the central nervous system, play a crucial role in maintaining the integrity of the blood-brain barrier (BBB) ​​and are responsible for immunomodulatory functions during brain repair after damage. To address the pathogenesis of PRV, there is an urgent need for a substance that can efficiently cross the blood-brain barrier, target brain tissue, and possess natural "homing" properties to specific brain cells (such as microglia) to improve the treatment of PRV-induced neurological diseases.

[0003] The brain's biological barrier (BBB) ​​is a highly selective permeability barrier that effectively isolates the central nervous system (CNS) from the peripheral circulatory system, protecting the brain from toxins and pathogens, and strictly regulating the CNS microenvironment to ensure normal neuronal function. This barrier also excludes over 98% of small-molecule drug candidates and almost all large-molecule drugs, becoming a major rate-limiting factor for drug entry into the CNS. Nanoparticle-based drug delivery systems, without disrupting the BBB, can facilitate drug penetration, offering a method for the prevention and treatment of CNS diseases.

[0004] Exosomes are extracellular vesicles with diameters ranging from 30 to 150 nanometers. They mediate unique intercellular communication and interactions, enabling the sorting and transport of substances within cells. The function of exosomes is closely related to the cell type from which they originate, possessing a natural ability to target cells or organs. Exosomes achieve targeted delivery by transferring their contents into the cytoplasm of target cells through ligand-receptor interactions between their surface molecules and target cell receptors, endocytosis, or direct fusion with the target cell membrane. Exosomes derived from the nervous system play a crucial role in regulating neurological diseases.

[0005] Exosomes have advantages such as high stability in body fluids, strong targeting to tissues or cells, good biocompatibility, non-toxicity, and the ability to avoid being cleared by the immune system, making them suitable as loading systems for delivering therapeutic drugs and achieving targeted therapy.

[0006] Breviscapine, also known as edible sedge, is the dried whole herb of *Erigeron breviscapus* (Vant.) Hand.-Mazz, a plant in the Asteraceae family. Clinically, it is mainly used to treat cardiovascular and cerebrovascular diseases. Scu, a representative flavonoid component of edible sedge, accounts for over 90% of its composition and is a key component responsible for its main therapeutic effects in treating cerebrovascular diseases. It protects neurons from ischemic damage through anti-inflammatory, anti-apoptotic, and antioxidant activities. However, the efficacy of scu in the human body is limited. Summary of the Invention

[0007] Based on the problems raised in the background art, this invention provides brain tissue exosome nanoparticles loaded with ligustrazine, achieving high drug loading through an ultrasonic drug delivery method, significantly improving the BBB penetration rate and brain targeting of ligustrazine. These nanoparticles can be specifically taken up by microglia, alleviating neuroinflammation by inhibiting PRV-induced M1 polarization and promoting M2 polarization in microglia, providing a new therapy for central nervous system diseases and offering technical support for the prevention and control of PRV disease.

[0008] Based on this, the first objective of the present invention is to provide brain tissue exosome nanoparticles loaded with ligustrazine, wherein the nanoparticles have a particle size of 100 ± 15 nm and the drug loading of ligustrazine is 31.86 ± 2.5 ng Scu / μg exosomes.

[0009] A second objective of this invention is to provide a method for preparing the aforementioned nanoparticles, comprising the following steps: (1) Brain tissue exosomes were diluted with PBS and then treated with scutellarin and sonicated. (2) Incubation; (3) Centrifuge and discard the supernatant; (4) Resuspend in PBS to obtain exosome-Dendrobium spp.

[0010] Furthermore, 20 mg of ligustrazine was dissolved in 1 mL of PBS, and brain tissue exosomes were diluted to 500 μL with PBS, and 0.8 mg of ligustrazine was added.

[0011] A third objective of this invention is to provide the use of brain tissue exosome nanoparticles loaded with ligustrazine in the preparation of medicaments for treating diseases by penetrating the blood-brain barrier.

[0012] Furthermore, the disease described is a neuroinflammatory disease of the brain caused by PRV or microglial cell polarization.

[0013] A fourth objective of this invention is to provide the use of brain tissue exosome nanoparticles loaded with ligustrazine in the preparation of a medicament for the treatment of related neuroinflammatory diseases by targeting the brain.

[0014] The fifth objective of this invention is to provide a pharmaceutical composition for treating diseases related to PRV, the pharmaceutical composition comprising the above-mentioned brain tissue exosome nanoparticles loaded with ligustrazine.

[0015] The beneficial effects of this invention are: This invention successfully prepared brain tissue exosome nanoparticles loaded with ligustrazine. The prepared exosome-ligustrazine nanoparticles exhibit a saucer-like shape with a diameter of approximately 100 nm, maintaining the typical saucer-like nanovesicle structure of exosomes. The morphology of the exosomes after loading with ligustrazine remained unchanged, exhibiting a characteristic biconcave cup shape. The particle size of the exosome-ligustrazine was determined by NTA, showing an average particle size of 143.3 nm and a concentration of 1.6E+12 particles / mL. Compared with the initial drug loading concentration of 9E+11 particles / mL, the particle size and concentration of brain tissue exosomes increased after drug loading. Western blot analysis of exosome-ligustrazine-labeled proteins showed that exosome-ligustrazine could normally express CD63 and CD9 proteins, demonstrating that the loading of ligustrazine did not damage the exosomes and did not affect their protein expression.

[0016] By adding brain tissue exosomes loaded with ligustrazine (Scu) into mouse microglia (bv2), astrocytes (C8), and brain microvascular endothelial cells (BEnd.3), it was found that exosomes-ligustrazine can regulate microglia polarization induced by PRV infection, significantly inhibit the expression of CD86 in M1 microglia, and promote the expression of CD206 in M2 microglia, thus exerting an anti-inflammatory effect. In vitro Transwell blood-brain barrier and in vivo brain tissue model exosome penetration experiments showed that the BBB permeability of Exo-Scu reached 41%, significantly higher than that of free Scu. After tail vein injection of DiR-labeled exosomes, in vivo imaging showed a brain fluorescence signal lasting for 24 hours. These results indicate that exosomes, as a biocompatible delivery carrier, can enhance the brain delivery efficiency of ligustrazine.

[0017] The brain tissue exosome-Dendrobium scutellarin nanoparticles provided by this invention solve the problems of poor penetration and low bioavailability of Dendrobium scutellarin BBB, and enhance its therapeutic effect on neuroinflammatory diseases caused by PRV infection, which has important practical significance for the prevention and control of pseudorabies in pigs. Attached Figure Description

[0018] Figure 1This is the BCA standard curve diagram of Embodiment 1 of the present invention; Figure 2 These are representative images of the exosomes and exosome-ligustrazine from Embodiment 1 of the present invention under TEM. Figure 3 This is the particle size distribution of exosomes (left figure) and exosome-ligustrazine (right figure) detected by NTA in Example 1 of the present invention; Figure 4 This describes the expression of exosomes and exosome-ligustrazine-labeled proteins in Example 1 of the present invention. Figure 5 This is the HPLC standard curve of scutellarin in Example 1 of the present invention; Figure 6 This describes the uptake of exosomes and exosome-ligustrazine by mouse endothelial cells across the blood-brain barrier in Example 1 of the present invention. Figure 7 In Example 1 of this invention, both the exosomes and exosome-ligustrazine can cross the blood-brain barrier and be taken up by astrocytes. Figure 8 The left figure shows the uptake of exosomes and exosome-ligustrazine by bend 3 in Example 1 of the present invention, and the right figure shows the uptake of exosomes and exosome-ligustrazine by C8. Figure 9 The TEER test results are from Example 2 of this invention; Figure 10 The standard curve of sodium fluorescein in Example 2 of this invention. Figure 11 Example 2 of the present invention: permeability of fluorescent nanoparticles; ** indicates that the difference between the two groups is extremely significant (P < 0.01). Figure 12 This refers to the status of Transwel blood-brain barrier establishment; Figure 13 Standard curves of scutellarin (Figure A) and colchicine (Figure B) in Example 2 of this invention; Figure 14 Example 2 of this invention: the blood-brain barrier crossing of colchicine and scutellarin. ** indicates that the difference between the two groups is extremely significant (P < 0.01). Figure 15 In Example 2 of this invention, the blood-brain barrier permeability of exosomes and exosome-ligustrazine was compared. ** indicates that the difference between the two groups was extremely significant (P < 0.01). Figure 16 In Example 2 of this invention, the uptake of exosomes and exosome-ligustrazine by mouse endothelial cells in an in vitro blood-brain barrier model was demonstrated. Figure 17In Example 2 of this invention, the uptake of exosomes and exosome-ligustrazine by astrocytes across the blood-brain barrier in an in vitro blood-brain barrier model was observed. Figure 18 Example 2 of this invention: The uptake efficiency of exosomes and exosome-ligustrazine by endothelial cells (Figure A) and astrocytes (Figure B). ** indicates that the difference between the two groups is extremely significant (P < 0.01). Figure 19 This refers to the imaging of exosomes within 24 hours in Embodiment 3 of the present invention; Figure 20 This refers to the BV2 survival rate under different conditions in Embodiment 3 of the present invention; Figure 21 This refers to the viral copy number in the cell supernatant of different groups in Example 3 of the present invention; Figure 22 This describes the expression of the MI-type biomarker CD86 in different groups in Embodiment 3 of the present invention; Figure 23 This describes the expression of the M2 type marker CD2066 in different groups in Embodiment 3 of the present invention; Remark: Figure 2 In the diagram, figures A and B represent exosomes, while figures C and D represent exosome-ligustrazine. Figure 10 k×, Figure B and Figure D 60 k×. Detailed Implementation

[0019] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are all within the scope of protection of this invention.

[0020] Unless otherwise specified, all reagents and consumables mentioned in the following examples are commercially available.

[0021] Main materials: Baicalein (a type of scutellarin), purchased from Chengdu Zhibiao Chemical Biotechnology Co., Ltd. SPF and Kunming mice: 6-8 weeks old, half male and half female, purchased from Kunming Medical University, and quarantined for 7 days before experiments. Cells: Mouse microglia (bv 2), mouse cerebellar astrocytes (C8-D1A), and mouse brain microvascular endothelial cells (BEnd.3). Virus strain: PRV-XD-F3 strain, retained by the Yunnan Provincial Key Laboratory of Animal Husbandry and Poultry, with a viral titer of 104.77 TCID50 / 0.1mL.

[0022] Main instruments: The experimental techniques and methods used in the examples are all conventional methods and methods recommended in the reagent instructions.

[0023] Statistical methods: All data represent the results of at least three independent experiments and are expressed as mean ± standard deviation. GraphPad Prism 8.0 was used for statistical analysis of all data, employing one-way ANOVA. A p-value < 0.05 was considered statistically significant.

[0024] Example 1: Extraction and identification of exosomes from mouse brain tissue and loading of ligustrazine B 1. Extraction of exosomes from mouse brain tissue: Brain tissue from Kunming mice was collected and longitudinally sectioned on ice. The brain tissue was transferred to type III collagenase at a ratio of 800 μL / 100 mg brain and incubated in a 37°C water bath for 20 min to dissociate the brain tissue. Subsequently, the tissue samples underwent pretreatment steps, including centrifugation at 4°C. First, centrifugation was performed at 300 g for 5 minutes, followed by centrifugation at 2000 g for 10 minutes, collecting the supernatant to remove cells and cell debris. Next, centrifugation was performed at 10000 g for 30 minutes, and the supernatant was collected again to remove impurities. The sample was filtered through a 0.22 µm filter. Finally, the sample was centrifuged at 180000 g for 2 hours, the supernatant was discarded, the tissue was resuspended in PBS, and centrifuged at 140000 g for 1 hour to obtain exosomes.

[0025] 2. BCA method for measuring exosomal protein concentration in brain tissue: Prepare the BCA working solution according to the kit instructions. Add standards of different concentrations of brain tissue exosome proteins and the test samples to microplates or test tubes, then add the BCA working solution according to the recommended ratio in the kit instructions and mix thoroughly. After sealing, incubate at 37°C for 30 to 60 minutes, then cool the samples to room temperature. Measure the absorbance of the samples at 562 nm using a blank control as a baseline. Then, subtract the average absorbance of the blank standard at that wavelength from the absorbance of each standard and the test protein sample at 562 nm. Set A as concentration and B as absorbance to construct a standard curve (e.g., ...). Figure 1 Based on this, the protein concentration was calculated. The concentration of exosomal protein in brain tissue measured by the BCA method was 487 ug / mL. The standard curve was A = 697 B + 15.769, R... 2 = 0.9975 indicates that the established standard curve has a good linear relationship and meets the standard.

[0026] 3. Ultrasonic drug loading: 0.8 mg of exosomes were diluted to 500 μL with PBS, and 0.8 mg of ligustrazine was added (20 mg of ligustrazine was dissolved in 1 mL of PBS). The mixture was then incubated at 26 W for 30 s with a 30 s pause as one cycle, for a total of 20 cycles. During the pauses, the sample was kept on ice. After sonication, the sample was incubated at 37 °C for 2 h. The loaded sample was then centrifuged at 180,000 g for 2 h. The supernatant was discarded, and the sample was resuspended in PBS to obtain exosome-ligustrazine nanoparticles.

[0027] 4. Transmission electron microscopy (TEM) analysis of the morphology of exosomes and exosome-ligustrazine nanoparticles: Exosomes and exosome-ligustrazine nanoparticle samples were centrifuged at 10000 g at 4°C for 5 minutes. Then, 10 μL of the sample supernatant was added to a copper grid for 2 minutes of precipitation, and excess liquid was removed using filter paper. Next, 10 μL of 3% uranium acetate solution was added to the copper grid, and precipitation was repeated for 2 minutes, with excess liquid removed again using filter paper. After the copper grid dried at room temperature for several minutes, it was examined by transmission electron microscopy at 100 kV. Figure 2 Figures A and B show exosomes, while figures C and D show exosome-Lysimachia nanoparticles; Figures A and C... Figure 10 Figures B and D (60 k×, 60 k×). Results showed that exosomes observed under TEM exhibited a typical "cup-shaped" or "cup-shaped" biconcave disc structure with clear edges, intact membrane structure, and smooth surface. After negative staining, a light-colored depression was observed in the central region of the exosome vesicles due to stain penetration, while the edges showed a dark ring-shaped outline due to the dense membrane structure, with a diameter of approximately 100 nm, consistent with the standard morphology of exosomes. Exosomes loaded with ligustrazine exhibited a cup-shaped structure with a diameter of approximately 100 nm; exosomes loaded with ligustrazine maintained their typical cup-shaped nanovesicle structure, exhibiting a characteristic biconcave cup-shaped morphology. The morphology of exosomes loaded with ligustrazine remained unchanged.

[0028] 5. NTA method for detecting the particle size of exosomes and exosome-ligustrazine: Sample preparation: Fresh samples, or samples removed from the refrigerator, thawed on ice, and sonicated for 15 seconds (frequency 20 kHz, 45 W, sonication for 5 seconds, interval 5 seconds, repeated 3 times) to break up aggregated particles. Exosomes and exosome-ligustrazine were diluted with PBS and then loaded for NTA detection. Detection results (…) Figure 3The results showed that the average exosome particle size was 100 ± 15 nm (n=100), and the concentration was 9 E+11 particles / mL. Particle size statistical analysis showed that the exosome diameter was mainly distributed in the range of 90-120 nm, which conforms to the classic exosome size standard (30-150 nm) defined by the International Society for Extracellular Vesicles (ISEV), and its morphological characteristics are highly consistent with those reported in the literature. Furthermore, no obvious large vesicles (>200 nm) or apoptotic bodies or other impurities were observed in the samples, indicating good exosome purification. The average particle size of exosome-ligustrazine was 143.3 nm, and the concentration was 1.6 E+12 particles / mL. Compared with the unloaded 9 E+11 particles / mL, the particle size and concentration increased after loading.

[0029] 6. Western blot detection of exosomes and exosome-ligustrazine-labeled proteins: The exosomes to be tested and exosome-Dendrobium granules were mixed with exosome-specific lysis buffer (UmibioUR33101) at a 1:1 ratio and lysed at 4°C for 10 min. The mixture was then centrifuged at 12000 r / min for 10 min at 4°C, and the supernatant was collected. Based on the protein concentration, the mixture was diluted with the appropriate lysis buffer to the desired final concentration (e.g., if the supernatant protein concentration is C1 μg / μL, the target loading concentration is C2 μg / μL, and the required loading volume is V μL, then the total protein amount is C2V. The required supernatant volume is (C2V) / C1; any insufficient volume is made up to V with lysis buffer). 1 / 4 volume of SDS-PAGE protein loading buffer (5×) was added, mixed, and slowly added to the loading wells. 8 μL of marker was added to the wells, the mixture was flattened at 50 V, and electrophoresis was performed at 120 V for 60 min to allow the proteins to reach the bottom. After electrophoresis, the PEDV membrane was activated in anhydrous methanol for 3 min, and then the gel was transferred to the PEDV membrane. Using a transfer electrophoresis apparatus, 800 mL of transfer buffer was added, and electrophoresis was performed at a constant current of 200 mA for 90 min in an ice bath. The membrane was blocked with blocking buffer on a shaker at room temperature for 1 h; washed three times with PBST; then incubated overnight at 4 ℃ with primary antibodies CD63 (1:1000) and CD9 (1:1000); washed three times with PBST (10 min); incubated with secondary antibody (1:5000) at room temperature for 1 h; washed four times with TBST (10 min), and twice with PBS; developed using photoluminescence reagent in a developer and exposed. The results showed that exosomes-Dendrobium nobile could normally express CD63 and CD9 proteins, proving that the loading of Dendrobium nobile did not destroy exosomes and did not affect exosome protein expression.

[0030] 7. Determination of exosome-ligustrazine drug loading: Preparation of scutellarin standard solution: Accurately weigh 10 mg of scutellarin standard and place it in a 10 mL volumetric flask. Add PBS buffer to dissolve and dilute to volume to prepare stock solution A with a concentration of 1 mg / mL. Pipette 5 mL of the stock solution into a 50 mL volumetric flask and dilute to volume to prepare a stock solution with a concentration of 100 μg / mL.

[0031] Determination of the maximum absorption wavelength of scutellarin: 1 mg / mL of scutellarin was accurately measured, and the standard solution was diluted with PBS to concentrations of 0 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, and 100 μg / mL. The spectral density was scanned using ultraviolet spectrophotometry in the absorption wavelength range of 200 nm–400 nm. The standard curve for scutellarin was y = 45.285x - 18.114, with R² = 0.9968, showing good linearity and conforming to the standard.

[0032] 8. Determination of drug loading by high performance liquid chromatography (HPLC): HPLC Methodology Implementation: Accurately pipette 1–10 mL of the standard stock solution prepared by the above method into 10 mL volumetric flasks, dilute to the mark with methanol and mix thoroughly, then measure the peak area. Plot a standard curve with the mass concentration of the standard as the x-axis and the peak area as the y-axis to evaluate linearity. Perform six consecutive repeated injections using the standard stock solution, record the peak area of ​​each injection, and calculate the relative standard deviation (RSD) to evaluate the precision of the method. In addition, inject the standard stock solution and reagent solution at 0, 12, 24, 36, and 48 hours, and record the corresponding peak area data. Chromatographic Column: Aglient C18 (4.6 × 250 mm × 5 μm); Injection Volume: 10 μL; Column Temperature: 35℃; Detection Wavelength: 335 nm; Mobile Phase A: Methanol; Mobile Phase B: 3% Acetic Acid.

[0033] The standard curve for the ethyl lamp standard is shown below. Figure 5 The standard curve equation is y = 2E-06x-0.5253, R 2 ≥0.997 indicates that within the linear range of succinate, the injection volume and peak area have a good linear relationship.

[0034] The amount of ligustrazine loaded on exosomes is shown in the table below. The drug loading capacity of exosomes is 31.86 ng ligustrazine / μg exosomes.

[0035] Exosome drug loading Mobile phase elution sequence Table 2-4 Elution sequence of mobile phase 9. Brain tissue exosome cell uptake experiment Cell resuscitation and passage: Brain tissue exosome cells were removed from a -80°C freezer, revived at 37°C, and incubated statically in a 5% CO2 cell incubator. The culture medium was changed every 24 hours after revival. Cell growth and density were observed under an electron microscope, and culture continued. When the cell density in the T25 culture flask exceeded 80-90%, cell passage was initiated. The cells were washed three times with PBS, and after removing the PBS, 1 mL of 0.25% trypsin was added for digestion for 1-3 minutes. Microscopic observation was performed; when the cells became rounded and no longer adhered to the culture vessel, the flask was tapped to detach most of the cells. Trypsin digestion was stopped with an equal volume of complete culture medium, and the cells were transferred to centrifuge tubes. The pellet was collected by centrifugation, resuspended in complete culture medium, and passaged into 2 or 3 flasks according to cell density. The culture medium was added to a final volume of 6 mL, and the cells were incubated statically in a 37°C, 5% CO2 cell incubator. The culture medium was changed every 48 hours, and cell growth and density were observed under an electron microscope. Once the density exceeded 80-90%, cell passage or cryopreservation was performed. Cells in the logarithmic growth phase were used for the experiment.

[0036] Preparation of cell spreaders: Prepare 24-well plates and cell spreaders. First, disinfect the cell spreaders by immersing them in 75% alcohol, then wash off the alcohol with PBS. Place the cleaned cell spreaders into the 24-well plates and add cells at a density of 1 x 10⁻⁶ cells / well. 4 Suspensions of BEnd.3, C8, and BV2 were statically cultured in a cell incubator at 37°C with 5% CO2 until the cell density reached 80%. Each cell type was seeded into three 24-well cell plates.

[0037] 10 Laser confocal cell uptake Exosome labeling: Exosomes were incubated with PKH67 dye at 37°C for 20 min, and the free dye was removed by column chromatography. Cell uptake: Mouse microglia (bv 2), astrocytes (C 8), and brain microvascular endothelial cells (BEnd.3) were washed three times with PBS. 100 μL of PKH67-labeled exosomes were added to each of the three cell types, and the cells were cultured at 37°C in a 5% CO2 cell incubator for 2 h and 10 h, respectively. Fixation: After culture, the supernatant was discarded, and the cells were washed three times with PBS. The PBS was removed, and the cells were fixed with 4% paraformaldehyde for 15 min. Staining: The cells (mouse microglia (bv 2), astrocytes (C 8), and brain microvascular endothelial cells (BEnd.3)) were washed three times with PBS, and Dil was added to the cells according to the Dil dye instructions. The cells were incubated at 37°C in a 5% CO2 cell incubator for 30 min. min, wash three times with PBS. Mounting: Prepare a glass slide, add an anti-fluorescence quencher containing DAPI, gently remove the cell slide from the 12-well plate with tweezers, place the cell-bearing side upside down on the glass slide, drop neutral resin on the edge of the slide, fix the slide, and let it stand at room temperature for the resin to solidify. Observe using a laser confocal microscope. Results ( Figure 6 and Figure 7 and Figure 8 As shown, exosomes can be observed in three different cellular fields of view under a laser confocal microscope. Within the laser confocal field of view, in an in vitro blood-brain barrier model, both exosomes and exosome-ligustrazine can be taken up by mouse endothelial cells. Figure 6 Within the laser confocal field of view, in an in vitro blood-brain barrier model, both exosomes and exosome-ligustrazine can cross the blood-brain barrier and be taken up by astrocytes. Figure 7 Exosomes were scattered near the cell nucleus. The uptake rate of BEnd.3 was 19.56%, C8 was 7.96%, and BV2 was 98%. BV2 cells had the highest number of exosomes near the nucleus (P < 0.01) and the densest distribution, while C8 cells showed the lowest uptake (P < 0.01). Endothelial cells showed significantly higher uptake efficiency of exosomes than of exosome-ligustisol (P < 0.01); astrocytes showed significantly higher uptake of exosome-ligustisol than of exosomes (P < 0.01). Example 2: Exosome-Lysimachia Bryosin in vitro blood-brain barrier permeability 1. Establishment of the in vitro blood-brain barrier With 1×10 5 / cm 2 To achieve the desired cell density, BEnd.3 cells were seeded onto the PET membrane in the upper chamber of a Transwell 12-well plate, and 1500 μL of complete cell culture medium was added. After 24 h, cells were inoculated at 5 × 10⁻⁶ cells / mL. 4 / cm2 To achieve the desired cell density, C8 cells were seeded into the lower chamber of a 24-well Transwell chamber, and complete culture medium was added to a final volume of 500 μL, ensuring the liquid levels in the upper and lower chambers were equal. Three auxiliary wells were prepared and the chambers were incubated at 37°C with 5% CO2. 2 The cells were cultured statically in a cell culture incubator. A blank control group was set up. The medium was changed daily and the cell growth was observed regularly. A series of experiments were conducted to evaluate the in vitro blood-brain barrier model.

[0038] 2. In vitro blood-brain barrier verification The RE1600 epithelial cell voltammetry instrument manufactured by Beijing Jingong Hongtai Technology Co., Ltd. was used to measure transendothelial cell electrical impedance tomography (TEER) in an in vitro blood-brain barrier model. Under a clean bench environment, the instrument and its chopstick electrodes were sterilized with UV light for 30 minutes, followed by immersion in 75% alcohol for 15 minutes. After sterilization, the electrodes were rinsed three times with phosphate-buffered saline (PBS). The instrument was then powered on, and the chopstick electrodes were allowed to stand until the resistance values ​​stabilized. Once stabilized, the chopstick electrodes were vertically inserted into the Transwell chambers, with the shorter electrode in the upper chamber and the longer electrode in the lower chamber, ensuring the electrode membrane was submerged and did not touch the chambers. The resistance values ​​at different locations in each well were measured three times, and the resistance values ​​(Ω) displayed on the screen were recorded. The average value was recorded as the measurement value for each well. The difference between the TEER value and T0 of each model was used to compare the tightness between model groups.

[0039] TEER test results as follows Figure 9 As shown in Figure -A, the resistance value gradually increased from day 4, exceeding 200 Ω by day 7 and then gradually stabilizing. The resistance value of the control group remained around 130 Ω, meeting the standard for in vitro blood-brain barrier resistance, and could be used for subsequent permeability experiments. The resistance value of the control group was 131 Ω, and compared with the control group, the resistance value of the model group increased significantly to 217 Ω by day 8 (P < 0.01).

[0040] 3. Fluorescein sodium permeability test Weigh out sodium fluorescein powder and dissolve it thoroughly in phenol red-free DMEM solution. Mix well to prepare sodium fluorescein solutions of different concentrations (μg / mL): 0, 0.0977, 0.1953125, 0.390625, 0.78125, 1.5625, 3.012, and 6.25 μg / mL. Each concentration solution was prepared in 3 wells. The fluorescence intensity of the sodium fluorescein solutions of different concentrations was measured at 490 nm using a multi-functional microplate reader. Let the absorbance of sodium fluorescein be C, and the concentration be D. Plot a standard curve for the sodium fluorescein solution. Figure 10The standard curve for sodium fluorescein is D = 10.948 C - 0.5979, R. 2 =0.9981, indicating a good linear relationship, which meets the standard.

[0041] Under ultraviolet spectrophotometry, sodium fluorescein has a maximum absorption peak at 490 nm.

[0042] Set up a model group and a control group, with three replicates for each group. Remove the culture medium from the upper and lower chambers of the Transwell plate for both the model and control groups. Rinse the upper and lower chambers separately with phenol red-free DMEM solution. Add 500 μL of 100 μg / mL sodium fluorescein solution to the upper chamber and 1500 μL of phenol red-free DMEM solution to the lower chamber, ensuring the liquid levels in both chambers are equal. At time points of 15, 30, and 60 min, aspirate 100 μL of the solution from the lower chamber into a 96-well plate. Add the collected solution to the 96-well plate and measure the fluorescence intensity of the corresponding solution using a multi-mode microplate reader. Calculate the amount of sodium fluorescein that permeates through the lower chamber based on the sodium fluorescein standard curve plotted above.

[0043] The permeability coefficient (Pd value) of the cell layer is calculated based on the fluorescence intensity. The formula for calculating the Pd value is: Pd (cm / s) = (C / t) × (1 / A) × (V / L), where C is the concentration of sodium fluorescein in the lower chamber, t is the time interval, A is the surface area, V is the volume of the solution in the lower chamber, and L is the concentration of sodium fluorescein in the upper chamber. The permeability of the BBB model is assessed.

[0044] like Figure 11 As shown, compared with the control group, the permeability of sodium fluorescein in the model group did not change significantly at 15 min (P>0.5), suggesting that the tight junctions between cells had not yet fully formed and the barrier function was in a dynamic construction stage. However, it decreased significantly from 30 min onwards (P<0.01), indicating that the model restricted the passage of sodium fluorescein and the BBB barrier function was established.

[0045] Penetration situation: such as Figure 12 As shown, 4 hours after the addition of culture medium, the liquid levels inside and outside the chamber in the blank group were basically the same, and significant leakage occurred in the chamber. In contrast, the model group maintained a significant liquid level difference of more than 0.5 cm, demonstrating that the in vitro BBB model has a certain barrier function for fluids, preventing fluid flow between them. This indicates that the blood-brain barrier was successfully established, consistent with the results of TEER and fluorescein sodium permeability tests.

[0046] 4. Establishment of quantitative analytical methods for ligustrazine and colchicine Preparation of standard solutions for scutellarin and colchicine: Accurately weigh 10 mg of scutellarin standard and place it in a 10 mL volumetric flask. Dissolve and dilute to volume with PBS buffer to prepare stock solution A with a concentration of 1 mg / mL. Accurately pipette 5 mL of the stock solution into a 50 mL volumetric flask and dilute to volume to prepare a stock solution with a concentration of 100 μg / mL.

[0047] Establishment of the standard curve: Accurately measure 100 mg / mL of scutellarin solution and serially dilute it with PBS buffer to prepare a series of standard concentration solutions of 0.5, 0.25, 0.125, 0.0625, 0.03125, 0.015625 mg / mL and 0.005 mg / mL. Using PBS buffer as a blank control, the absorbance corresponding to different concentrations of the standard solutions was determined by ultraviolet spectrophotometry. Concentration was set as X, and absorbance as Y. Linear regression analysis was performed on the corresponding concentrations X and absorbance Y.

[0048] like Figure 13 As shown, the standard curve for ethylene glycol (Figure A) is y = 45.285x - 18.114, R0 2 = 0.9968, indicating a good linear relationship, which meets the standard. The standard curve for colchicine (Figure B) is y = 41.463x - 12.542, R0. 2 = 0.9999, the linear relationship is good and meets the standard.

[0049] 5. Blood-brain barrier crossing rate test of ligustrazine, colchicine, and exosome-ligustrazine. Prepare solutions of 50 μg / mL and 100 μg / mL ligustrazine and colchicine respectively. Dilute the prepared exosomal ligustrazine nanoparticles with a ligustrazine suspension of 100 μg / mL. Add 100 μL of each solution to the upper chamber of the Transwell chamber. Add 1500 μL of phenol red-free DMEM to the lower chamber. After 3 h, measure the absorbance of the lower chamber. Calculate the transmittance by multiplying the amount of drug in the lower chamber by 100% of the initial amount of drug in the upper chamber.

[0050] like Figure 14 As shown in Figure A, at a concentration of 100 μg / mL, the blood-brain barrier passage rate of colchicine in the blank group was 99.7%, and that of scutellarin was 27.5%; in the model group, the blood-brain barrier passage rate of colchicine was 59.85%, and that of scutellarin was 13.5%. Compared with the blank well, the blood-brain barrier model prevented the passage of colchicine and scutellarin. The passage rate of colchicine in the blank well was significantly greater than that in the model well (P < 0.01), and the passage rate of scutellarin in the blank well was significantly greater than that in the model well (P < 0.01), indicating that the blood-brain barrier was intact.

[0051] like Figure 14 As shown in Figure B, in the blood-brain barrier model, the passage rate of colchicine was 49.5%, while that of scutellarin was -20%. Compared with the colchicine group, the passage rate of 50 μg / mL scutellarin was significantly lower (P < 0.01). At 100 μg / mL, the passage rate of colchicine was 59.85%, while that of scutellarin was 13.5%, significantly lower than that of colchicine (P < 0.5). This indicates that compared with colchicine, a positively charged drug that can cross the blood-brain barrier, scutellarin has a lower efficiency in crossing the blood-brain barrier and cannot cross it at low concentrations.

[0052] Experimental data ( Figure 15 The results showed that the blood-brain barrier crossing rate of scutellarin was 13.5%, while that of exosome-scutellarin was 41%. The blood-brain barrier transmembrane transport efficiency of scutellarin loaded with exosomes was significantly improved compared with that of the free drug group (P<0.01), indicating that exosomes, as a biocompatible delivery carrier, can enhance the brain delivery efficiency of scutellarin.

[0053] 6. Laser confocal exosome penetration of the blood-brain barrier experiment The experiment was divided into exosome and exosome-dextrin groups. Cell slides were prepared in the lower chamber of a Transwell assay and plated with C8 substrate, while BEnd.3 substrate was prepared in the upper chamber to create an in vitro blood-brain barrier model. Once the cells had fused and met the modeling requirements, the exosome and exosome-dextrin-based blood-brain barrier penetration experiments began. First, exosomes were incubated with PKH67 dye at 37°C for 20 min, and free dye was removed using column chromatography. Cells were washed three times with PBS. 100 μL of each of the PKH67-labeled exosomes and exosome-dextrin-based group were added to the upper chamber of the Transwell assay and cultured at 37°C and 5% CO2 for 6 h each. Fixation: The PET membrane in the upper chamber and the cell slides in the lower chamber were washed three times with PBS, the PBS was removed, and the cells were fixed with 4% paraformaldehyde for 15 min. Staining: Cells were washed three times with PBS, and Dil dye was added to the cells according to the instructions. The cells were incubated at 37°C and 5% CO2 for 30 min (to allow the dye to penetrate the cells), followed by three washes with PBS. Mounting: Prepare a glass slide, add an anti-fluorescence quencher (containing DAPI), remove the PET membrane and cell slide from the Transwell 12-well plate, place the cell-containing side upside down on the glass slide, drop neutral resin on the edge of the slide, fix the slide, and let it stand at room temperature for the resin to solidify.

[0054] Observe using a laser confocal microscope, such as Figure 16As shown, in the in vitro blood-brain barrier model, both exosomes and exosome-ligustrazine could be taken up by mouse endothelial cells. In the field of view, the uptake of exosomes was greater than that of exosome-ligustrazine; the uptake efficiency of exosomes by endothelial cells was significantly greater than that of exosome-ligustrazine (P < 0.01). Figure 17 As shown, both exosomes and exosome-ligustrazine can cross the blood-brain barrier and be taken up by astrocytes; and as... Figure 18 As shown, the uptake of exosomes by astrocytes of ligustilide was significantly greater than that by exosomes (P < 0.01). This indicates that exosomes can not only effectively cross the blood-brain barrier, but also, as drug carriers, significantly improve the delivery efficiency of ligustilide within the target blood-brain barrier.

[0055] Example 3: In vivo blood-brain barrier permeability and function of exosome-ligustrazine. 1. Exosome in vivo brain tissue imaging Pipettes 50 μL of exosome fluorescently labeled dye into 450 μL of 1×PBS, mix well, and prepare a 100 μM dye working solution. Pipettes 200 μL of exosomes into 50 μL of the 100 μM dye working solution, and vortex for 1 min to prepare the exosome-dye complex. The entire process is performed in the dark.

[0056] Three 7-week-old male KM mice were used. The room temperature was 22-25℃, the humidity was 45%-65%, and the day-night cycle was 12 h:12 h. They were separated into different cages and fed for 7 days to adapt. They were kept in clean environments, and their feed and bedding were changed by designated personnel in a timely manner.

[0057] One KM mouse was randomly selected and injected with 200 μL of a 100 μM dye working solution via the tail vein. Another KM mouse was randomly selected and injected with 200 μL of an exosome-dye complex via the tail vein. In vivo imaging was performed at 6 h, 12 h, and 24 h. DiR excitation wavelength was 748 nm, and emission wavelength was 780 nm. Animals were euthanized by intraperitoneal overdose anesthesia with 10% chloral hydrate, and the brain was dissected and imaged. The brain tissue was then fixed and preserved in paraformaldehyde after imaging.

[0058] The experiment was divided into four groups: PRV group (PRV), PRV + SCU group (PRV+SCU), PRV + exosome group (PRV+EXO), PRV + exosome-SCU group (PRV+EXO-SCU), and a blank control group (Control). BV 2 cells were seeded in 24-well plates, incubated with 100x TCID50 PRV for 2 h, washed once with PBS, and cultured for another 24 h. After 24 h, the drugs for each group (60 µM concentration) were added, and incubation continued for another 24 h. After 24 h, the cells were washed three times with PBS for 5 min each time. 1 ml of 4% paraformaldehyde was added to each well for fixation at room temperature for 15 min, followed by three washes with PBS for 5 min each. 0.1% Triton-X-100 was added to each well, permeabilized for 30 min, followed by three washes with PBS for 5 min each. Finally, the cells were blocked with protein-free blocking buffer at room temperature for 30 min. The primary antibody (CD86 / CD206) was incubated overnight at 4°C, followed by washing three times with PBST for 5 min each time. The secondary antibody (HRP goat anti-rabbit antibody) was incubated at room temperature in the dark for 2 h, followed by washing three times with PBST for 5 min each time. Finally, an anti-fluorescence quencher containing DAPI was added for 1 min, and the sample was observed and images were acquired under an inverted fluorescence microscope.

[0059] like Figure 19 As shown, after intravenous injection of DiR-labeled exosomes, in vivo imaging revealed that the fluorescence signal intensity in the brain remained higher than that in other organs for 6–12 h (A, B, and C represent the results at 6 h, 12 h, and 24 h, respectively). Notably, significant fluorescence signals were still detectable in the isolated brain tissue 24 h after injection (Figure E). These data indicate that exosomes can not only efficiently target brain tissue but also maintain an effective retention time of at least 24 h within the brain.

[0060] 2. Effects of exosome-ligustrazine on microglial phenotypic polarization induced by PRV infection 2.1 Determination of safe drug concentration using the CCK-8 method BV 2 was inoculated into 96-well plates at a concentration of 1×10⁻⁶. 5 Cells were cultured in wells until they reached 70% cell growth. After washing the plates, 0, 20, 40, 60, 80, and 100 μM of ligustrazine diluted with culture medium were added. The same ligustrazine working concentration was used for exosome-ligustrazine groups. The exosome group was divided into high, medium, and low dose groups according to protein concentration. A blank control without drug was also set up. Each group had 3 replicates. After culturing for 48 h, 10 μl of CCK-8 solution was added, and the OD450 was measured after 1 h of incubation. The cell viability of ligustrazine, exosome-ligustrazine, and exosomes was calculated according to formula (2-1).

[0061] like Figure 20 As shown in Figure A, within the concentration range of 20, 40, 60, and 80 μM ligustrazine, the survival rates of BV2 were 114%, 99.5%, 99.6%, and 99.4%, respectively, all greater than 70% and showing a decreasing trend. There were no significant differences among the groups (P > 0.05). At 100 μM, the survival rate was less than 70% and significantly lower than that of the 80 μM group (P < 0.05).

[0062] As shown in 20B, within the working concentration range of 20, 40, 60, 80, and 100 μM exosome-Dendrobium granules, the survival rates of BV2 were 82%, 104%, 103%, 93%, and 80%, respectively, all greater than 70% and showing a decreasing trend starting from 40 μM, with no significant differences among the groups (P > 0.05).

[0063] As shown in Figure 20C, the survival rates of BV2 were 75%, 84%, and 126% at high, medium, and low concentrations of exosomal protein, respectively, all greater than 70%. Low concentrations significantly improved cell survival (P<0.05).

[0064] Viral copy number in cell supernatant: such as Figure 21 As shown, 24 h after PRV infection of BV 2 cells, PRV-gE was detected in the supernatant of the PRV group, the PRV + ligustrazine group, the PRV + exosome group, and the PRV + exosome-ligustrazine group. Compared with the PRV group, the viral copy number of the PRV + exosome group and the PRV + exosome-ligustrazine group was significantly reduced (P < 0.05) (P < 0.05).

[0065] 2.2 TCID50 determination BV 2 was inoculated into 96-well plates, and PRV virus solution was serially diluted 10-fold with serum-free DMEM at a rate of 100 μL per well. A blank control group was included, and each group was replicated 8 times. CPE was observed and recorded for 7 days, and the viral TCID was calculated using the Reed-Muench method. 50 .

[0066] TCID 50 The measurement results are shown in the table below.

[0067] TCID50 assay of PRV on BV2 cells The Reed-Muench method calculated that the half-maximal infection dose of PRV in TG cells was 10. 4.77 TCID50 / 0.1mL.

[0068] 2.3 RT-qPCR detection of PRV-gE gene expression level in cell supernatant The transcriptional level of PRV-gE in cell supernatant was detected using quantitative real-time PCR. β-actin was used as an internal control gene, and the relative expression level of the target gene was analyzed using the 2-ΔΔct method. Specific RT-qPCR reaction system and conditions are shown in the table. Subsequently, the viral copy number in the corresponding samples was calculated by substituting the PRV-gE gene cycle number detected by quantitative real-time PCR into the previously established PRV standard curve. The PRV standard curve was y = -2.395x + 37.091, RV... 2 =0.993, x is the copy number, and y is the Ct value. PRV-gE detection primers (F: TTCGGCGAGGAGGTGCACA; R: TCCATTCGTCACTTCCGGTTTCT).

[0069] Table RT-qPCR reaction system and reaction conditions Table 2-5 RT-qPCR reaction system and reaction conditions Reaction system: Reaction conditions: 24 h after PRV infection with BV 2, PRV-gE was detected in the cell supernatant in the PRV group, PRV + ligustrazine group, PRV + exosome group, and PRV + exosome-ligustrazine group. Compared with the PRV group, the viral copy number in the PRV + exosome group and the PRV + exosome-ligustrazine group was significantly reduced (P < 0.05) (P < 0.05).

[0070] 2.4 Indirect immunofluorescence assay for microglial phenotypic polarization The experiment was divided into four groups: PRV group (PRV), PRV + SCU group (PRV+SCU), PRV + exosome group (PRV+EXO), PRV + exosome-SCU group (PRV+EXO-SCU), and blank control group (Control). BV 2 cells were seeded in 24-well plates, incubated with 100x TCID50 PRV for 2 h, washed once with PBS, and cultured for another 24 h. After 24 h, the drugs for each group (60 µM concentration) were added, and incubation continued for another 24 h. After 24 h, the cells were washed three times with PBS for 5 min each time. 1 ml of 4% paraformaldehyde was added to each well for fixation at room temperature for 15 min, followed by three washes with PBS for 5 min each. 0.1% Triton-X-100 was added to each well, permeabilized for 30 min, followed by three washes with PBS for 5 min each. Finally, the cells were blocked with protein-free blocking buffer at room temperature for 30 min. The primary antibody (CD86 / CD206) was incubated overnight at 4°C, followed by washing three times with PBST for 5 min each time. The secondary antibody (hrP goat anti-rabbit antibody) was incubated at room temperature in the dark for 2 h, followed by washing three times with PBST for 5 min each time. Finally, an anti-fluorescence quencher containing DAPI was added for 1 min, and the sample was observed and images were acquired under an inverted fluorescence microscope.

[0071] Effects on polarization of M1 microglia like Figure 22 As shown, under CD86 staining, the CD86 fluorescence intensity of the PRV group was significantly enhanced compared with the blank group (P < 0.01); compared with the PRV group, the CD86 fluorescence intensity of the PRV + exosome group and the PRV + exosome-ligustrazine group was significantly weakened (P < 0.01); compared with the PRV + ligustrazine group, the fluorescence intensity of the PRV + exosome-ligustrazine group was significantly weakened (P < 0.01).

[0072] Effects on polarization of M2 microglia like Figure 23 As shown, under CD 206 and DAPI staining, the CD 206 fluorescence intensity of the PRV group was significantly enhanced compared with the blank group (P < 0.01); compared with the PRV group, the CD 206 fluorescence intensity of the PRV + ligustrazine group, the PRV + exosome group, and the PRV + exosome-ligustrazine group were all significantly enhanced (P < 0.01); compared with the PRV + ligustrazine group, the fluorescence intensity of the PRV + exosome-ligustrazine group was significantly enhanced (P < 0.01).

[0073] Analysis of indirect immunofluorescence staining results of different microglia phenotypes showed that the PRV+exosome-Dendrobium group significantly inhibited CD86 expression in M1 microglia and promoted CD206 expression in M2 microglia. The PRV+exosome-Dendrobium group could activate microglia polarization and exert anti-inflammatory effects.

[0074] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A type of brain tissue exosome nanoparticle loaded with ligustrazine, characterized in that, The exosome-ligustrazine nanoparticles have a particle size of 100 ± 15 nm, and the drug loading of ligustrazine is 31.86 ± 2.5 ng Scu / μg exosomes.

2. The method for preparing nanoparticles as described in claim 1, characterized in that, Includes the following steps: (1) Brain tissue exosomes were diluted with PBS and then treated with scutellarin and sonicated. (2) Incubation; (3) Centrifuge and discard the supernatant; (4) Resuspend in PBS to obtain exosome-Dendrobium spp.

3. The preparation method according to claim 2, characterized in that, Dissolve 20 mg of ligustrazine in 1 mL of PBS. Dilute brain tissue exosomes to 500 μL with PBS and add 0.8 mg of ligustrazine.

4. The use of the nanoparticles as described in claim 1 in the preparation of a medicament for treating diseases by penetrating the blood-brain barrier.

5. The application as described in claim 4, characterized in that, The disease is a neuroinflammatory disease of the brain caused by PRV or microglial cell polarization.

6. The use of the nanoparticles as described in claim 1 in the preparation of a medicament for treating related neuroinflammatory diseases by targeting the brain.

7. A pharmaceutical composition for treating diseases related to PRV, characterized in that, The brain tissue exosome nanoparticles containing ligustrazine as described in claim 1.

Images