InDel molecular marker closely linked with major QTL (quantitative trait loci) qCE1 of clustered / monogenic character of corn female ear and application of InDel molecular marker
By developing an InDel molecular marker tightly linked to the major QTL site qCE1 for the clustered/single ear trait in maize, and using primer combinations for PCR amplification and gel electrophoresis, the problem of frequent occurrence of the clustered ear trait in modern maize was solved, enabling early and accurate trait identification and efficient breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2026-04-03
- Publication Date
- 2026-05-08
AI Technical Summary
The frequent occurrence of clustered female ears in modern maize has led to reduced maize yield. Current molecular marker-assisted breeding technology has lagged behind and cannot effectively improve the clustered female ear trait, thus affecting maize yield and quality.
We developed an InDel molecular marker tightly linked to the major QTL site qCE1 for the clustered/single ear trait in maize, amplified it by PCR using primer combinations, and determined the ear trait by gel electrophoresis, providing a precise molecular marker-assisted breeding method.
This enabled early and accurate identification of maize ear clustering/single growth traits, shortened the breeding cycle, improved breeding efficiency, and fostered high-yielding and stable maize varieties.
Smart Images

Figure CN121992145A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of maize genetics and breeding and molecular biology technology, specifically relating to a QTL locus with major effect on the maize ear clustering / single ear trait. qCE1 Tightly linked InDel molecular markers and their applications. Background Technology
[0002] Corn is one of the world's major food crops, playing a crucial role in global food security and the development of related industries such as feed, fiber, and fuel. In recent years, influenced by multiple factors such as dietary restructuring and upgrading, shrinking fossil fuel reserves, and continuous deterioration of the ecological environment, my country's market demand for corn has shown a year-on-year increasing trend. At the same time, current corn yield per unit area has reached a growth bottleneck, making it difficult to achieve a breakthrough in the short term. In addition, frequent extreme natural disasters such as high temperatures, drought, waterlogging, strong winds, and hail in major corn ecological zones across the country have further triggered a series of production problems, including abnormal ear development, lodging, rust disease spread, and fall leaf moth outbreaks, seriously threatening corn production. Under the triple contradiction of yield bottleneck, environmental stress, and rising demand, improving corn's environmental adaptability and reducing yield losses have become key paths to ensure stable and high corn yields and maintain industry stability. Maize was domesticated from both *Tegus sativa* and *Tegus sativa*. During the long domestication process, the plant morphology underwent significant evolution, and the ear trait gradually changed from clustered small ears (at least 100 per plant) in *Tegus sativa* to single large ears (1-2 per plant) in modern maize. This change not only improved the ease of harvesting maize but also optimized the yield per plant and the overall yield. However, the domestication process from clustered to single ears was not complete; many modern maize inbred lines, hybrids, and local varieties still widely retain the clustered ear trait. Figure 1; Yang N, Wang Y, Liu X, Jin M, Vallebueno-Estrada M, Calfee E, Chen L, Dileks BP, Gui S, Fan J, Ross-Ibarra J (2023) Two teosintes made modern maize. Science 382:eadg8940; Urano D, Jackson D, Jones AM (2015) AG protein alpha null mutationconfers prolificacy potential in maize. Journal of Experimental Botany, 66:4511-4515).
[0003] In modern maize, clustered ears formed by the growth of female ears are known domestically as banana ears, baby ears, or finger ears, and internationally as bouquet ears, monkey hands, or Multiple Ears on a Single Ear Shank (MESS). Specifically, secondary female ears sprout from the internodes of the peduncle of the terminal female ear, and these secondary ears can further differentiate into new secondary ears. Multiple secondary ears cluster around the terminal female ear, with each cluster typically containing 2-6 ears, and in some plants even up to 10. These secondary ears are generally unable to produce grains normally and compete with the terminal female ear for nutrients, water, and photosynthetic products, ultimately significantly reducing maize grain yield and quality. Figure 1 , Figure 2 The clustering trait of female ears is jointly regulated by the genetic characteristics of maize germplasm and external environmental conditions. Susceptible germplasm carrying the clustering trait can stably exhibit the clustering phenotype of female ears under different environmental conditions. At the same time, adverse stresses such as high temperature, drought, and cloudy / rainy conditions can further increase the incidence and severity of clustered ears. Figure 2In recent years, due to the normalization of high temperatures, the trait of clustered female ears has become increasingly apparent in more and more major maize varieties, even in popular varieties like Zhengdan 958. At the 2020-2021 China Seed Conference and Nanfan Silicon Valley Forum held in Sanya, Hainan in March 2021, a total of 213 maize hybrids (combinations) were displayed, including 55 sweet maize hybrids (combinations) and 158 kernel maize hybrids (combinations). The survey found that 22 sweet maize hybrids (combinations) and 45 kernel maize hybrids (combinations) exhibited the trait of clustered female ears, accounting for 40.0% and 28.5% respectively, with an overall average of 31.5%. Figure 2 In addition, there are local varieties such as White Horse Tooth, Big White Piece, Lantern Red, and Golden Hou. Figure 2 ) as well as backbone maize inbred lines such as Ye 478, Zheng 58, H21, Zheng T22, M5972, and A1052 ( Figure 2 The clustered female ear trait is quite common in maize. These backbone inbred lines and their derivatives are widely used in maize germplasm innovation and hybrid breeding in China, but they also pose a huge hidden danger to the large-scale safe production of maize.
[0004] With drastic changes in the global climate, the incidence and distribution area of the clustered ear trait in modern maize have been continuously increasing. Reports of reduced maize yields due to the outbreak of clustered ears are frequent both domestically and internationally, posing a serious challenge to safe maize production. Existing research confirms that... Gt1 ( Grassytillers1 The gene is a key gene regulating the domestication of maize female ears, located 7.5 kb upstream of it. Prol1.1 Component regulation Gt1 Specific expression of genes in the internode of the female ear peduncle, when Prol1.1 When the M1 and M2 haplotypes are present, Gt1 The gene can be normally expressed in the internode of the ear peduncle, promoting the formation of a single female ear in maize; when the T-haplotype is present, Gt1The gene is not expressed or is expressed at very low levels in the internodes of the ear peduncle, which leads to the formation of clustered ears in maize (Wills DM, Whipple CJ, Takuno S, Kursel LE, Doebley JF (2013) From many, one: genetic control of prolificacy during maize domestication. PLoS Genetics, 9(6): e1003604). Moreover, the M1 and M2 haplotypes have been subject to directional selection during maize domestication, and the T-type haplotype is almost non-existent in modern maize germplasm. This result fully demonstrates that the frequent clustering of ears in modern maize is also regulated by other undiscovered genes or QTL sites (Yang L, Yang CJ, Cheng Q, Xue W, Doebley JF (2016) Mapping prolificacy QTL in maize and teosinte. Journal of Heredity, 107: 674-678). Molecular marker-assisted breeding can effectively overcome many drawbacks of conventional breeding, such as lengthy cycles, low selection efficiency, inaccurate phenotypic identification, and susceptibility to environmental interference. It is now widely used in maize genetic breeding. However, due to the lagging progress in QTL mining and gene cloning research related to the clustered female ear trait, there is a severe shortage of practical molecular markers currently available for improving this trait, far from meeting the actual needs of breeding maize for resistance to clustered female ears. The major QTLs for the clustered / single female ear trait identified in this invention... qCE1 Furthermore, the linkage molecular markers developed based on this site can accurately achieve early screening and elimination of the female ear cluster phenotype, effectively accelerating the maize breeding process and filling the gaps in existing related breeding technologies. Summary of the Invention
[0005] Based on this, the purpose of this invention is to provide a major QTL locus related to the clustered / single ear trait in maize. qCE1 Tightly linked InDel molecular markers and their applications.
[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: This invention provides a major QTL locus related to the clustered / single ear trait in maize. qCE1 Tightly linked InDel molecular markers, major QTL sites qCE1 Located on chromosome 1 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome, marked by the interval Chr.01_23431188-23431982, corresponding to... Gt1The upstream region of the gene is 2611-1817 bp; the InDel molecular markers include the master molecular markers, which consist of qCE1-del F and qCE1-del R1. The positions of qCE1-del F are Chr.01:23430548-23430570, and the positions of qCE1-del R1 are Chr.01:23432472-23432493.
[0007] Preferably, the InDel molecular marker further includes a co-molecular marker, which consists of qCE1-del F and qCE1-del R2, with the position of qCE1-del R2 being Chr.01:23431554-23431573.
[0008] In another aspect, the present invention provides a primer combination for detecting the aforementioned main molecule marker, comprising a forward primer qCE1-del F and a first reverse primer qCE1-del R1; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; First reverse primer qCE1-del R1:ACCATTCAGGTCCAAACATTAC.
[0009] In another aspect, the present invention provides a primer combination for detecting the above-mentioned main molecule marker and co-molecule marker, comprising a forward primer qCE1-del F and a second reverse primer qCE1-del R2; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; The second reverse primer qCE1-del R2: CGAGCTGAGTGAAGTTGTAC.
[0010] Another aspect of the present invention provides a method for identifying the clustered / single female ear trait of maize, which includes the following steps: (1) Extract genomic DNA from the maize sample to be tested; (2) Using the genomic DNA as a template, perform PCR amplification using the above primer combination; (3) Perform gel electrophoresis on the amplification products; (4) Result determination; When using the above-mentioned main molecular marker primer combination (forward primer qCE1-del F and first reverse primer qCE1-del R1) for PCR amplification, if the amplification product size is 1833 bp or 1138 bp, the female ear is determined to be clustered; if the amplification product size is 1946 bp, the female ear is determined to be solitary. When using the above-mentioned co-molecular marker primer combination (forward primer qCE1-del F and second reverse primer qCE1-delR2) for PCR amplification, if the amplification product size is 910 bp or 0 bp, the female ear is determined to be clustered; if the amplification product size is 1026 bp, the female ear is determined to be solitary.
[0011] In another aspect, the present invention provides the use of the above-described InDel molecular marker or the above-described primer combination in any of the following applications: (1) To identify or assist in screening the clustered / single female ear trait of maize; (2) Marker-assisted breeding of maize; (3) Prepare detection products for identifying the clustered / single female ear trait of maize; (4) Prepare maize breeding-related products.
[0012] In another aspect, the present invention provides a kit for assisted breeding of maize female ear clustering / single trait, the kit comprising the above-mentioned primer combination, or equivalent molecular marker primers redesigned based on the sequence variation of the Chr.01_23431188-23431982 interval.
[0013] In another aspect, this invention provides a maize breeding method, which uses the above-mentioned detection method to test maize materials. qCE1 Haplotype testing was conducted, and maize materials with clustered / single female ears were selected as parents for hybridization breeding to cultivate maize germplasm or varieties with clustered / single female ears.
[0014] The beneficial effects of this invention include at least the following: Based on two near-isogenic lines of Ye 478 and a CSSL population, this invention uses BSA and bioinformatics techniques to clone a major QTL locus controlling the clustering / single growth of maize female ears on chromosome 1. qCE1 Located in Chr. 01_23431188-23431982 (Zm-B73-REFERENCE-NAM-5.0), this provides a solid foundation for in-depth analysis of the genetic basis of the transition from clustered to single female ears during maize domestication. Furthermore, based on... qCE1 InDel molecular markers developed from different haplotypes have shown significant effectiveness in identifying the clustered / single ear trait in maize and can be used for marker-assisted breeding related to the clustered / single ear trait in maize to accelerate the breeding process. Attached Figure Description
[0015] Figure 1Different female ear phenotypes in teosinte, teosinte-maize derivative and modern maize; among them, A and P are the clustered female ear phenotype of teosinte; B is the clustered female ear phenotype of teosinte-maize derivative; C to H and K to O are the clustered female ear (banana ear) phenotype of modern maize; I and J are the single female ear phenotype of modern maize. Figure 2 This study describes the ear clustering trait in some maize hybrids, backbone inbred lines, and local varieties. Among them, A to F represent the ear clustering trait of maize hybrids Zhengdan 958 (A), TT66 (B), Dika 517 (C), NK916 (D), Huanai Tianyu 521 (E), and Baidiwei 652 (F), respectively; G to J represent the ear clustering trait of maize backbone inbred lines Zheng 58 (G), A1052 (H), M5972 (I), and Zheng T22 (J), respectively; and K and L represent the ear clustering trait of maize local varieties Baima Ya (K) and Dabai Pian (L), respectively. Figure 3 For Ye 478 CE Heye 478 NE Phenotypic differences; Figure 4 For Ye 478 CE Heye 478 NE The differential SNP distribution; Figure 5 for Prol1.1 Segment haplotype analysis; Figure 6 for qCE1 Sequence alignment diagram of the target segment; among them, there are a total of 63 inbred lines of teosinte or maize, including 10 haplotypes of HAP1, 32 haplotypes of HAP2, and 21 haplotypes of HAP3; Figure 7 for qCE1 Alignment results of different haplotype sequences; Figure 8 Genes related to leaf axillary meristems were found in leaf axils (478). CE Heye 478 NE The expression pattern in the text; where A and B respectively represent 478 CE Heye 478 NE s, e and se represent ear hank, ear and secondary ear respectively, and the numbers 2, 4, 5, 7, 11, 14 and 17 represent ear lengths of 2 mm, 4 mm, 5 mm, 7 mm, 11 mm, 14 mm and 17 mm respectively. Figure 9 To identify different haplotypes using InDel molecular markers in agarose gel electrophoresis results.
[0016] Figure 10 ROC curves were constructed based on the clustered / single ear trait and three haplotypes of 166 CSSL families. Detailed Implementation
[0017] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.
[0018] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. It should be understood that terms such as “comprising,” “having,” “including” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or”, depending on the context.
[0019] In a first aspect, embodiments of the present invention provide a QTL locus that is major in relation to the clustered / single ear trait in maize. qCE1 Tightly linked InDel molecular markers, major QTL sites qCE1 Located on chromosome 1 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome, marked by the interval Chr.01_23431188-23431982, corresponding to... Gt1 The upstream region of the gene is 2611-1817 bp; the InDel molecular markers include the master molecular marker, which consists of qCE1-del F and qCE1-del R1. The position of qCE1-del F is Chr.01:23430548-23430570, and the position of qCE1-del R1 is Chr.01:23432472-23432493.
[0020] It should be noted that the clustering / single growth trait of maize ears is a key agronomical trait affecting maize planting density, lodging resistance, and yield, with major QTL loci... qCE1 This is the core genetic locus regulating this trait. The locus region located in this invention is precise and has a significant genetic effect. The InDel molecular markers screened in this invention are... qCE1The loci are fully linked, with no genetic exchange, exhibiting excellent polymorphism and strong stability. They can accurately target and identify the genotypes of clustered / single female ears. Compared with traditional SSR and RAPD markers, they have the advantages of stable amplification, clear bands, and simple genotyping, providing a core marker basis for the molecular identification of maize female ear traits.
[0021] In some specific examples, the InDel molecular markers mentioned above also include co-molecular markers, which consist of qCE1-del F and qCE1-del R2, with the position of qCE1-del R2 being Chr.01:23431554-23431573.
[0022] It should be noted that qCE1-del R2 is located in the primary QTL. qCE1 Within the core region, the linkage with the target trait is higher. Combining it with qCE1-del F as a co-marker forms a dual-marker verification system, further improving the accuracy of genotyping and effectively avoiding the error risks of single-marker detection. This is particularly suitable for precise genotyping of maize breeding populations with complex genetic backgrounds and closely related maize materials. This co-marker combination has high amplification efficiency and strong specificity. When used in conjunction with the master marker, it can achieve precise genotyping of maize breeding populations with complex genetic backgrounds and closely related maize materials. qCE1 Dual validation of loci significantly improves the reliability of marker-assisted selection, meeting the precision screening needs of large-scale maize breeding.
[0023] Secondly, embodiments of the present invention provide a primer combination for detecting the above-mentioned main molecule marker, which includes a forward primer qCE1-del F and a first reverse primer qCE1-del R1; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; First reverse primer qCE1-del R1:ACCATTCAGGTCCAAACATTAC.
[0024] It should be noted that this primer combination is specifically designed for the conserved flanking sequences of the main molecular marker. The primer length, GC content, and Tm value have all been optimized. It is free of primer dimers, hairpin structures, and non-specific amplification, resulting in high amplification efficiency and good reproducibility. It can specifically amplify the target InDel fragment. Experimental verification shows that this primer combination can stably amplify in different maize materials, producing clear and single bands in the amplified products, facilitating gel electrophoresis genotyping. It can quickly distinguish between clustered and solitary ear genotypes in maize, is simple to operate, requires no complex detection equipment, and is suitable for routine molecular detection scenarios in maize breeding. It is suitable for large-scale use in grassroots breeding units and research institutes.
[0025] Thirdly, embodiments of the present invention provide a primer combination for detecting the above-mentioned main molecule marker and co-molecule marker, which includes a forward primer qCE1-del F and a second reverse primer qCE1-del R2; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; The second reverse primer qCE1-del R2: CGAGCTGAGTGAAGTTGTAC.
[0026] It should be noted that co-molecule markers are used to address the issue of band differentiation. When using only qCE1-del F and qCE1-del R1, the band sizes are 1138, 1833, and 1946 bp, with differences between bands of 695, 808, and 113 bp, respectively. The difference between 113 and 695 / 808 is significant, suggesting that band 1138 may have escaped the gel. The distinction between 1833 and 1946 is not very clear. The band sizes of co-molecule markers are 0, 910, and 1026 bp, effectively differentiating between 910 and 1026 bp. Generally, using only the host molecule marker is sufficient for haplotype differentiation.
[0027] Fourthly, embodiments of the present invention provide a method for identifying the clustered / single female ear trait in maize, comprising the following steps: (1) Extract genomic DNA from the maize sample to be tested; (2) Using the genomic DNA as a template, perform PCR amplification using the primer combination described in claim 3 or 4; (3) Perform gel electrophoresis on the amplification products; (4) Result determination; When using the above-mentioned main molecular marker primer combination (forward primer qCE1-del F and second reverse primer qCE1-del R1) for PCR amplification, if the amplification product size is 1833 bp or 1138 bp, the female ear is determined to be clustered; if the amplification product size is 1946 bp, the female ear is determined to be solitary. When using the above-mentioned co-molecular marker primer combination (forward primer qCE1-del F and second reverse primer qCE1-delR2) for PCR amplification, if the amplification product size is 910 bp or 0 bp, the female ear is determined to be clustered; if the amplification product size is 1026 bp, the female ear is determined to be solitary.
[0028] It should be noted that this identification method is based on fragment length polymorphism of molecular markers, belonging to an early and precise molecular identification method. The test samples can be any tissue such as maize seeds, seedling leaves, and root tips. DNA extraction is simple and does not require high-quality genomic DNA. The PCR amplification system and program are universal and compatible with conventional PCR instruments. Genotyping can be completed using ordinary agarose gel electrophoresis, providing intuitive results without subjective errors and eliminating the need for complex subsequent operations such as sequencing. This method overcomes the limitations of traditional field phenotypic identification, which is characterized by long cycles, significant environmental influences, and low accuracy. It allows for genotyping of female ear traits during the maize seedling stage, enabling early screening of target materials, significantly shortening the breeding cycle, and achieving high identification accuracy.
[0029] Fifthly, embodiments of the present invention provide a use of the above-described molecular marker or primer combination in any of the following applications: (1) To identify or assist in screening the clustered / single female ear trait of maize; (2) Marker-assisted breeding of maize; (3) Prepare detection products for identifying the clustered / single female ear trait of maize; (4) Prepare maize breeding-related products.
[0030] It should be noted that the InDel molecular marker and corresponding primer combination of the present invention are closely linked to the clustered / single ear trait of maize, exhibiting high specificity and selection efficiency, and possessing diverse application value: when used for trait identification and screening, it can quickly distinguish the genotype corresponding to the maize ear phenotype, achieving precise screening of target materials; when used for molecular marker-assisted breeding, it can achieve early-generation directional selection, abandoning the blindness of traditional phenotypic selection and accelerating the breeding process of superior maize varieties with clustered / single ears; when used to prepare detection products, it can be developed into reagent kits, test strips, and other products, enabling commercial rapid detection of maize ear traits; when used to prepare breeding-related products, it can be integrated with breeding processes, providing core molecular tools for maize germplasm resource identification, hybrid purity detection, and superior parent selection, comprehensively supporting the efficient development of maize genetic breeding work.
[0031] Sixthly, embodiments of the present invention provide a maize ear clustering / single ear trait-assisted breeding kit, the kit containing the above-mentioned primer combination, or equivalent molecular marker primers redesigned based on the Chr.01_23431188-23431982 interval sequence variation.
[0032] It should be noted that this assisted breeding kit is specifically designed for molecular breeding of maize ear traits. It integrates a complete set of core detection reagents, including, in addition to specific primer combinations, Taq enzyme, dNTPs, PCR buffer, ddH2O, positive control DNA, negative control DNA, and detailed operating instructions required for PCR amplification. All reagents are pre-mixed and ready to use, requiring no preparation and making the operation very simple. The primer combinations included in the kit are highly specific and provide stable amplification, while the equivalent molecular marker primers are specifically designed for… qCE1 The core region sequence variation design can achieve equally accurate genotyping results, further broadening the applicability of the kit. This kit exhibits good stability and a long shelf life, enabling high-throughput, standardized detection. It is suitable for batch screening of maize materials by breeding units at all levels, significantly improving the efficiency of ear trait-assisted breeding.
[0033] Seventhly, embodiments of the present invention provide a maize breeding method, which uses the above-mentioned detection method to test maize materials. qCE1 Haplotype testing was conducted, and maize materials with clustered / single female ears were selected as parents for hybridization breeding to cultivate maize varieties with clustered / single female ears.
[0034] It should be noted that single-ear maize varieties have advantages such as high planting density, strong lodging resistance, uniform ear development, and stable yield, making them a core direction for high-yield maize breeding. This breeding method relies on precise molecular marker detection technology, first using the methods described above to detect maize materials... qCE1 By using haplotype analysis at specific loci and selecting homozygous genotypes of single-eared maize as breeding parents, errors in field phenotypic selection are avoided. Then, through conventional breeding methods such as hybridization and backcrossing, combined with marker-assisted selection, superior traits are synthesized in a targeted manner, enabling the rapid development of new maize varieties with excellent agronomical traits and stable inheritance of the single-eared trait. Compared to traditional breeding methods, this method shortens the breeding cycle by 3-5 years, significantly improves breeding accuracy, and can efficiently develop high-quality maize varieties suitable for high-density, high-yield cultivation models, demonstrating extremely high breeding application value.
[0035] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.
[0036] Example 1: Analysis of the female ear cluster / single phenotype In 2016 and 2017, this invention introduced two genetic populations (Ye 478) from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. CEA recombinant inbred line population constructed from Qi 319 and an associated population composed of backbone inbred lines were used to investigate the effects of planting density on major agronomic traits of maize. Each of the two genetic populations contained a homonymous inbred line named Ye 478. Identification was conducted in Shijiazhuang City, Hebei Province, and Sanya City, Hainan Province, across different years and regions. The two Ye 478 inbred lines showed almost no significant differences except for the trait of clustered / single ears. They were subsequently renamed Ye 478. CE Heye 478 NE (CE: Clustered Ear; NE: Normal Ear;) Figure 3 ).
[0037] Ye 478 CE The appearance of axillary buds was first observed on the peduncle when the terminal panicle was only 3 mm in length, indicating that the axillary meristem at the peduncle had been activated before the terminal panicle reached 3 mm in length. However, the vast majority of Ye 478... NE The absence of axillary buds on the peduncle of the female ear in the inbred line indicates the cause of the lack of axillary buds in Ye 478. CE Heye 478 NE The difference in the clustered / single female ear trait is due to the difference in the maintenance of activity of the axillary meristems between the internodes of the female ear peduncle. (Ye 478) CE The incidence of clustered female ears over the years was 96.69%, with 2.86 secondary female ears per plant; Ye 478 NE The incidence of clustered female ears over the years was 3.39%, with 0.04 secondary female ears per plant. Most of the secondary female ears were undeveloped axillary buds. Figure 3 ).
[0038] In 2019, a 56K SNP chip marked with Zhongyu gold was used to test 478. CE Heye 478 NE Genotyping revealed only 1648 SNP differences between the two groups, with the differential SNPs concentrated in a limited region. Figure 4 These results indicate that Ye 478 CE Heye 478 NE They may be closely isomorphic lines or sister inbred lines, and these differences may lead to the existence of lines 478. CE Heye 478 NE The reasons for the production of clustered and solitary female ears, respectively.
[0039] Example 2 BSA Analysis and Candidate Gene Prediction This invention is based on another set of 166 copies of materials from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, containing 478 copies. CEChromosomal Segment Substitution Lines (CSSLs) populations using Qi 319 as the donor also commonly exhibit the trait of clustered female ears. Among these CSSL lines, there is a unique variant belonging to Ye 478. NE The SSR / Indel tag type indicates that some strains were infiltrated with Ye 478 during the creation of the CSSL population. NE Chromosomal segments ( Figure 5 Seventeen CSSL lines with almost no clustered female ears and 20 CSSL lines with severe clustered female ear phenotypes were selected to conduct a study on 478 CSSL lines. CE Heye 478 NE BSA analysis of the parents revealed a QTL locus on the short arm of chromosome 1, named qCE1 Located on chromosome 1, between 9.79 and 31.1 Mb, this region contains 12,971 variant sites, of which 1,908 are InDel sites, containing 1,117 candidate genes. It is speculated that this site regulates the activity and maintenance of the axillary meristem in the internode of the spikelet peduncle.
[0040] It is worth noting that, qCE1 The positioning range includes those previously reported. Prol1.1 site and Gt1 Genes, for exploring qCE1 Regarding the relationship between these two sites / genes, this invention first uses the previously reported primer combination gt1-CR to target 478. NE 、Ye 478 CE The test results for Heqi 319 showed that Ye 478 NE 、Ye 478 CE Haplotypes of Heqi 319 belong to M1, M2, and M2 types within the M type, with no T-type haplotype, indicating... Prol1.1 The site is not the cause of 478 CE Heye 478 NE The reason for the difference in female ear clustering / single growth traits is... qCE1 and Prol1.1 The locus is not an allele. Then, 63 publicly available genome sequences of teosinte and maize inbred lines were downloaded from the MaizeGDB website. Gt1 No non-synonymous mutations were found in the exons after alignment of the gene's coding region, indicating that... qCE1 The site is not Gt1 Alleles of a gene. These were discovered during sequence alignment. Gt1Within the upstream 2611-1817 bp region, there are two sequence deletions of different sizes: DEL795 (795 bp deletion) at 2611-1817 and DEL115 (115 bp deletion) at 2596-2482. The overlapping region contains numerous TATA and TGTG repeat sequences and a transcription factor binding site, the G4 strand. These cis-structure elements are transcription factor binding sites, indicating that sequence variations in this region may lead to downstream... Gt1 Changes in gene expression patterns may be due to qCE1 destination section ( Figure 6 ).
[0041] To verify this hypothesis, the present invention first examined the 478mm diameter. NE 、Ye 478 CE Sequencing analysis of the sequence of Qi 319 showed that Ye 478 NE 、Ye 478 CE Heqi 319 belongs to three haplotypes in this interval: Ye 478 NE HAP1 (no sequence deletion), Qi319 is HAP2 (DEL115), Ye478 CE For HAP3 (DEL795); Figure 7 The haplotypes of inbred lines W22 and NC358 are HAP2 and HAP3, respectively. Previous studies have reported that both W22 and NC358 exhibit clustered ear traits. The haplotype of KN5585 is HAP3, and it also exhibits clustered ear traits.
[0042] The above results suggest that the aforementioned interval may be... qCE1 The destination section qCE1 Different haplotypes may affect Gt1 The expression has different effects.
[0043] Example 3: Analysis of gene expression patterns related to leaf axillary meristems To verify qCE1 Different haplotypes may affect Gt1 In order to influence the expression of other axillary meristem-related genes, this invention uses qPCR to... Gt1 , Ba1 and Tb1 The expression patterns of female panicles, young panicles, and pedicels at different developmental stages were analyzed. Ba1 and Tb1 These are two important genes that regulate the maintenance of leaf axillary meristem activity. Ba1 Encoding an atypical basic helical-loop-helical protein, ba1 The mutant lacks axillary buds on its main stem and cannot produce tillers, female ears, or normal terminal tassels, indicating that... Ba1Maintaining the activity of leaf axillary meristems plays an important role in the initiation of axillary buds (Gallavotti A, Zhao Q, Kyozuka J, Meeley RB, Ritter MK, Doebley JF, Enrico Pè M, Schmidt RJ (2004) The role of barren stalk1 in the architecture of maize. Nature, 432: 630-635.). ba1 The mutant exhibits strong apical dominance, while tb1 The mutants exhibit the opposite effect, namely a severe loss of apical dominance. The balance between these two genes may have played an important role in the domestication and improvement of maize (Gallavotti A, Zhao Q, Kyozuka J, Meeley RB, Ritter MK, Doebley JF, EnricoPè M, Schmidt RJ (2004) The role of barren stalk1 in the architecture of maize. Nature, 432: 630-635.). Tb1 It was the first gene identified as being associated with the domestication of fodder into modern maize, and is a major factor in the increased apical dominance of modern maize (Doebley JF, Stec A, Hubbard L (1997) The evolution of apical dominance in maize. Nature, 386: 485-488.; Studer A, Zhao Q, Ross-Ibarra J, Doebley J (2011) Identification of a functional transposon insertion in the maize domestication gene). tb1 . Nature Genetics, 43:1160-1163.). Tb1 It is a member of the TCP family of transcriptional regulatory factors. tb1-refThe mutant exhibits characteristics similar to *Tegus maize*, with a significantly increased number of tillers, increased length of lateral branches arising from the internodes in the upper and middle parts of the stem, and the presence of tassels at the apex (Doebley JF, Stec A, Hubbard L (1997) The evolution of apical dominance in maize. Nature, 386:485-488.), indicating... Tb1 It controls the dormancy of axillary buds. During the domestication process, in Tb1 A transducer element was inserted approximately 60 kb upstream, resulting in Tb1 Increased transcription levels inhibit axillary bud growth (Doebley JF, Stec A, Hubbard L (1997) The evolution of apical dominance in maize. Nature, 386: 485-488.).
[0044] The results showed that in the pedicel tissue of 2 mm young spikelets, Gt1 and Tb1 478 NE The expression level is approximately 478. CE twice that of the middle, and Ba1 478 CE The expression level in [the sample] was much higher than that in [the sample] 478. NE Explanation: 478 CE The axillary meristem in the 2 mm spikelet peduncle is activated, which is conducive to the emergence of axillary buds (secondary female spikes). Figure 8 ),Right now Gt1 The upstream range of 2611-1817 is qCE1 The destination section qCE1 Different haplotypes led to Gt1 The expression patterns of genes that maintain the activity of other leaf axillary meristems are altered, thereby determining whether the leaf axillary meristems at the internodes of the ear peduncle are activated or inhibited, ultimately resulting in a clustered / single ear phenotype.
[0045] Example 4, 478 NE Yu Ye 478 CE The derived pedigrees of the parental populations and qCE1 Haplotype correlation analysis To achieve accurate identification of the clustered / single female ear trait in maize, this invention is based on qCE1Two closely linked InDel molecular markers were developed for the three haplotypes at the locus. These markers share one forward primer and two reverse primers (major and auxiliary). qCE1-del F and qCE1-del R1 are the major markers, fully capable of identifying and screening germplasm with clustered / single ear traits. qCE1-del F and qCE1-del R2 are auxiliary markers. Because the products of qCE1-del F and qCE1-del R1 show a large difference between HAP1 and HAP2 and HAP3, while the difference between HAP1 and HAP2 is small, if qCE1-del F and qCE1-del R1 alone cannot effectively distinguish the three haplotypes, qCE1-del F and qCE1-del R2 can be used to assist in the determination. Figure 9 Germplasm with haplotype HAP1 is less likely to exhibit the clustered ear phenotype, while germplasm with haplotypes HAP2 and HAP3 is highly likely to exhibit the clustered ear phenotype. The InDel molecular marker developed in this invention can effectively distinguish the three haplotypes, enabling marker-assisted breeding for the clustered / single ear phenotype. The primer sequences and physical locations of the molecular markers are shown in Table 1, and the sizes of the PCR amplification products corresponding to different haplotypes are shown in Table 2.
[0046] Table 1 Molecular marker sequences and physical locations
[0047] Table 2 Information on Molecular Marker Products
[0048] In the summer of 2025, in Shijiazhuang City, 478 NE Yu Ye 478 CE Using homozygous lines derived from the parent population as materials, DNA was extracted from three leaves of each line using the CTAB method. Haplotypes were performed using designed molecular markers and agarose gel electrophoresis. At the same time, the number of superior ears, inferior ears, total ears, number of individual plants with clustered female ears, and total number of plants in each line were investigated. The average number of superior ears, average number of inferior ears, average total ears, and clustered ear occurrence rate were calculated.
[0049] The results are shown in Table 2. The average number of superior ears, inferior ears, total ears, and clustered ear ratio of HAP1 were 1.01%, 1.02%, 2.03%, and 2.10%, respectively. For HAP3, these figures were 3.35%, 3.49%, 6.84%, and 100%, respectively (Table 3). All values for HAP3 were significantly higher than those for HAP1, indicating that… qCE1Different haplotypes are significantly correlated with the clustering trait of female ears, and the molecular markers developed in this invention have a significant role in identifying the clustering trait of female ears.
[0050] In addition, DNA extraction was performed using the standard CTAB extraction method with KOD FX (TOYOBO) reagent. Amplification was performed using a standard PCR instrument. The PCR amplification system consisted of 10 μL containing 5 μL of 2×PCR buffer for KOD FX, 2 μL of 2mM dNTPs, 1 μL of 10pmol / μL Primer F, 1 μL of 10pmol / μL Primer R, 1 μL of Template DNA, and 0.2 μL of KOD FX (1.0U / μL). The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 57℃ annealing for 30 sec, 68℃ extension for 2 min, for a total of 35-40 cycles; 68℃ extension for 10 min.
[0051] Table 3. Traits of female ear clustering in parental populations and qCE1 Haplotype analysis
[0052] Example 5: CSSL family pedigrees and ear clustering traits qCE1 Haplotype analysis 166 CSSL families were planted in 2020 at the Dishang Experimental Station of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. Summer sowing was used, with at least two rows sown per family, each row 5 m long and 0.6 m apart. Open pollination was employed. Thirty days after pollination, the number of superior and inferior ears per plant, the total number of ears, the number of plants exhibiting the clustered female ear phenotype, and the total number of plants in each family were investigated. The average number of superior, inferior, and total ears, and the clustered ear occurrence rate were calculated, and the clustered / single ear phenotype was determined. Simultaneously, three leaves from each family were collected and DNA was extracted using the CTAB method. Haplotype typing of the CSSL families was performed using the principal molecular markers developed in this invention and agarose gel electrophoresis (detection method same as in Example 4). Table 4 shows the haplotype and ear clustering characteristics of each family in the CSSL population. There are 28 haplotypes HAP1, with average number of superior ears, average number of inferior ears, average total number of ears, and clustering rate of 1.04, 1.02, 2.06, and 4.78%, respectively. There are 8 haplotypes HAP2, with average number of superior ears, average number of inferior ears, average total number of ears, and clustering rate of 1.85, 2.15, 4.00, and 73.14%, respectively. There are 130 haplotypes HAP3, with average number of superior ears, average number of inferior ears, average total number of ears, and clustering rate of 2.28, 2.62, 4.90, and 93.99%, respectively (Table 4).
[0053] Table 4. Traits of female ear clustering in CSSL population lines qCE1 Haplotype analysis
[0054] Furthermore, to evaluate the effectiveness of the molecular markers developed in this invention in predicting the clustered / single ear trait in maize, ROC curves (Receiver Operating Characteristic Curves) were constructed based on the clustered / single ear trait and corresponding haplotypes from 166 families, and AUC values were calculated. The results showed an AUC value of 0.944, indicating that the major-effect QTL for identifying clones in this invention is valid. qCE1 The sequence deletion resulted in 478. CE The clustered female ear phenotype, based on qCE1 The molecular markers developed from three haplotypes can efficiently and accurately predict the clustered / single ear trait in maize. Figure 10 ).
[0055] The above results show that qCE1 Different haplotypes at the locus were significantly correlated with the clustered ear trait in maize female ears. This invention is based on... qCE1 Molecular markers developed from different haplotypes can effectively distinguish between clustered / single female ears in the early stages, which has significant application value for marker-assisted breeding.
[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A major QTL locus associated with the clustered / single ear trait in maize qCE1 Closely linked InDel molecular markers, characterized by, Major QTL site qCE1 Located on chromosome 1 of the maize Zm-B73-REFERENCE-NAM-5.0 reference genome, marked by the interval Chr.01_23431188-23431982, corresponding to... Gt1 The upstream region of the gene is 2611-1817 bp; the InDel molecular markers include the master molecular marker, which consists of qCE1-del F and qCE1-del R1. The position of qCE1-del F is Chr.01:23430548-23430570, and the position of qCE1-del R1 is Chr.01:23432472-23432493.
2. The InDel molecular marker according to claim 1, characterized in that, InDel molecular markers also include co-molecular markers, which consist of qCE1-del F and qCE1-del R2. The position of qCE1-del R2 is Chr.01:23431554-23431573.
3. A primer combination for detecting the InDel molecular marker of claim 1, characterized in that: Including the forward primer qCE1-del F and the first reverse primer qCE1-del R1; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; First reverse primer qCE1-del R1:ACCATTCAGGTCCAAACATTAC.
4. A primer combination for detecting the InDel molecular marker of claim 2, characterized in that: This includes the forward primer qCE1-del F and the second reverse primer qCE1-del R2; Forward primer qCE1-del F: TTATCAAACATCACACGAGAGAA; The second reverse primer qCE1-del R2: CGAGCTGAGTGAAGTTGTAC.
5. A method for identifying the clustered / single female ear trait in maize, characterized in that, Includes the following steps: (1) Extract genomic DNA from the maize sample to be tested; (2) Using the genomic DNA as a template, perform PCR amplification using the primer combination described in claim 3 or 4; (3) Perform gel electrophoresis on the amplification products; (4) Result determination; When using the primer combination described in claim 3 for PCR amplification, if the size of the amplification product is 1833 bp or 1138 bp, the female ear is determined to be clustered; if the size of the amplification product is 1946 bp, the female ear is determined to be solitary. When performing PCR amplification using the primer combination described in claim 4, if the amplification product size is 910 bp or 0 bp, the female ear is determined to be clustered; if the amplification product size is 1026 bp, the female ear is determined to be solitary.
6. Use of the InDel molecular marker of claim 1 or 2 or the primer combination of claim 3 or 4 in any of the following applications: (1) To identify or assist in screening the clustered / single female ear trait of maize; (2) Marker-assisted breeding of maize; (3) Prepare detection products for identifying the clustered / single female ear trait of maize; (4) Prepare maize breeding-related products.
7. A kit for assisted breeding of maize female ear clustering / single trait, characterized in that: The kit contains the primer combination as described in claim 3 or 4, or equivalent molecular marker primers redesigned based on the sequence variation of the Chr.01_23431188-23431982 interval.
8. A method for breeding maize, characterized in that: The detection method described in claim 5 is used to test corn materials. qCE1 Haplotype testing was conducted, and maize materials with clustered / single female ears were selected as parents for hybridization breeding to cultivate maize germplasm or varieties with clustered / single female ears.
Citation Information
Patent Citations
Method for improving corn haploid female ear fertility restorability and special primer thereof
CN111808981A
Genetic Markers Associated with Increased Fertility in Maize
US20170166983A1