Rapid shrimp iridovirus detection primer group based on RPA-CRISPR / Cas12a system, application and kit

By using the RPA-CRISPR/Cas12a system's rapid detection primer set and kit for shrimp iridovirus, combined with isothermal amplification and immunoassay strip technology, the problems of instrument dependence and complex operation in existing technologies have been solved, enabling rapid, simple, and sensitive detection of shrimp iridovirus, suitable for on-site diagnosis in aquaculture.

CN121992152APending Publication Date: 2026-05-08INST OF OCEANOLOGY - CHINESE ACAD OF SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Filing Date
2026-02-11
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies are insufficient for rapid, convenient, and sensitive detection of shrimp iridovirus at aquaculture sites, and require large instruments and specialized technicians to operate, which cannot meet the rapid detection needs of the aquaculture industry.

Method used

A rapid detection primer set and kit for shrimp iridovirus based on the RPA-CRISPR/Cas12a system was developed, including isothermal amplification primers, a CRISPR/Cas12a system, and immunoassay strips. The target gene was amplified using isothermal amplification technology, and CrRNA guided Cas12a to accurately recognize and activate the trans-cutting reporter probe. The results were visualized using the immunoassay strips.

Benefits of technology

It enables rapid detection of shrimp iridovirus within 30 minutes without the need for large instruments, is easy to operate, and is inexpensive, improving detection sensitivity and accuracy, and is suitable for rapid on-site diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, in particular to a rapid shrimp iridovirus detection primer group based on an RPA-CRISPR / Cas12a system, application and a kit. The primer group comprises an iridovirus constant-temperature gene amplification primer and a specific recognition amplification product target sequence probe; wherein the iridovirus constant-temperature gene amplification primer, the specific recognition amplification product target sequence CRISPR probe and the ssDNA reporter probe are recorded in the specification. An isothermal amplification primer and CrRNA are designed based on the shrimp red color virus gene, the target gene is amplified through the isothermal amplification technology, Cas12a is guided by the CrRNA to accurately recognize and activate trans-cleavage, a test strip report probe is synchronously split, and the result is interpreted by naked eyes within 30 min by virtue of the visual advantage of an immune test strip. The whole process does not need large instruments, the operation is simplified, the cost is low, and a visual and efficient solution is provided for on-site rapid diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, specifically a rapid detection primer set, application, and kit for shrimp iridovirus based on the RPA-CRISPR / Cas12a system. Background Technology

[0002] Shrimp irisvirus (SHIV) is a large double-stranded DNA virus belonging to the Iridoviridae family. It is one of the most important pathogens threatening the global shrimp farming industry. This virus is characterized by its wide host range, high infectivity, and high mortality rate. It can infect various commercially valuable shrimp species, with mortality rates reaching 50%-100% in infected shrimp populations, causing huge economic losses to aquaculture. Currently, the main detection methods for shrimp irisvirus include virus isolation and culture, PCR, and quantitative real-time PCR. However, these methods all have certain limitations. Virus isolation and culture are cumbersome, have long culture cycles, and require stringent laboratory conditions, making them difficult to meet the needs of rapid detection. While conventional PCR and real-time quantitative PCR have high specificity and sensitivity, they require large, sophisticated instruments such as PCR machines and quantitative real-time PCR instruments, and require specialized technicians to operate, resulting in high detection costs and hindering their widespread application in scenarios lacking specialized equipment, such as aquaculture sites and grassroots testing points.

[0003] In recent years, recombinase polymerase amplification (RPA) combined with CRISPR / Cas12a detection technology has emerged as a novel nucleic acid detection platform. While this technology has been reported in other virus detection applications, its detection performance is highly dependent on primers and crRNA designed for specific targets due to significant differences in the genomic sequences, conserved regions, and optimal targets of different viruses. The genome of *Litopenaeus vannamei* iridovirus (SHIV) belongs to an independent evolutionary branch of the Iridoviridae family, with a GC content of only 34.6%, significantly lower than the ideal range of 40-60% used in the optimization of the conventional RPA-Cas12a system. This low GC content may lead to decreased RPA amplification efficiency. Furthermore, the core conserved genes of *Litopenaeus vannamei* SHIV share less than 50% homology with known members of the *Iridoviridae* genus. Although it shares 99% sequence similarity with *C. q. vetch* iridovirus (CQIV), a member of the same genus, their host tissue tropisms are drastically different. Directly reusing CQIV targets may result in insufficient sensitivity due to a mismatch between viral load in the sample and the detection signal. Therefore, developing a simple, rapid, sensitive, instrument-free, and visually identifiable shrimp iridovirus detection technology is of great significance for early warning, timely prevention and control of the virus, and ensuring the healthy development of the aquaculture industry. Summary of the Invention

[0004] The purpose of this invention is to provide a rapid detection primer set for shrimp iridovirus based on the RPA-CRISPR / Cas12a system, its application, and a reagent kit.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A primer set for rapid detection of shrimp iridovirus based on the RPA-CRISPR / Cas12a system. The primer set consists of iridovirus isothermal gene amplification primers and probes that specifically recognize the target sequence of the amplification product. The iridovirus isothermal gene amplification primers are as follows: DRPA1-F:5'-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3' (SEQ ID No.1) DRPA1-R:5'-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3' (SEQ ID No.2) CRISPR probes that specifically recognize the target sequence of the amplification product: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU (SEQ ID No. 3); ssDNA reporter probe: 5′-FAM-NNNNNNNNNN-3′-Biotin.

[0006] An application of the primer set described above, specifically its application in the detection of shrimp iridovirus based on the RPA-CRISPR / Cas12a system.

[0007] A rapid detection kit for shrimp iridovirus, the kit containing the aforementioned primer set.

[0008] The kit comprises an isothermal amplification system, a CRISPR / Cas12a system, and an immunoassay strip; wherein, the isothermal amplification system comprises isothermal amplification system reagents and isothermal gene amplification primers for iridovirus; the CRISPR / Cas12a system comprises CRISPR / Cas12a system reagents, isothermal amplification products, and CRISPR probes that specifically recognize the target sequence of the amplification products.

[0009] The isothermal amplification method of the reagents in the isothermal amplification system is selected from any one of recombinase-mediated isothermal nucleic acid amplification (RPA), loop-mediated isothermal amplification (LAMP), and high-branch rolling circle amplification (HRCA) isothermal amplification methods; The chromogenic substance in the immunoassay strip is selected from any one of colloidal gold, iron oxide, carbon dots, nano selenium, quantum dots, and fluorescent molecules. The CRISPR / Cas12 reagent contains a CrRNA primer of the shrimp iridovirus gene and the Cas12a protein; the CrRNA synthesized by the CRISPR / Cas12a reagent contains a sequence that specifically recognizes the target sequence of the amplification product by binding to the Cas12a protein. The immunochromatographic test strip consists of a sample pad, a conjugate pad, a backed NC membrane detection pad, and an absorbent pad stacked on a transparent adhesive plate. The conjugate pad contains a gold-labeled antibody and a gold-labeled streptavidin. The NC membrane has a detection line (T line) and a control line (C line). The T line is immobilized with an anti-FAM / FITC antibody to capture intact reporter probes that have not been cleaved by CRISPR-Cas. The C line contains an anti-gold-labeled antibody to collect excess gold-labeled complexes to verify the effectiveness of the test strip.

[0010] The T-line is immobilized with an antibody against FAM / FITC.

[0011] The C line contains an antibody against gold-labeled mouse antibodies.

[0012] The immunochromatographic test strip analysis method is the line disappearance method. If both T and C lines are colored, the result is negative; if only C line is colored, the result is positive; if no C line is colored or no C line and T line are colored, the test strip is invalid.

[0013] A method for using the kit in the rapid detection of shrimp iridovirus involves amplifying the shrimp iridovirus gene in a isothermal amplification system to obtain an amplification product with a PAM site; co-incubating the Cas12a protein with the amplification product carrying the PAM site and the corresponding crRNA to form a Cas12a-crRNA-target gene ternary complex, which activates and cleaves the reporter probe in the reaction system; reacting the above reaction product with an immunoassay strip, and determining whether the sample contains shrimp iridovirus through the colorimetric reaction of the test strip.

[0014] One application of the primer pair or the kit described herein is the diagnosis of shrimp iridovirus infection or the prevention and control of diseases in aquaculture farms.

[0015] The present invention has the following beneficial technical effects: This invention designs isothermal amplification primers and CrRNA based on the shrimp red color virus gene. The target gene is amplified using isothermal amplification technology. CrRNA guides Cas12a to accurately recognize and activate trans-cleavage, simultaneously lysing the reporter probe on the test strip. Leveraging the visualization advantages of the immunoassay strip, results can be visually interpreted within 30 minutes. The entire process requires no large instruments, is simplified, and is low-cost, providing an intuitive and efficient solution for rapid on-site diagnosis. Attached Figure Description

[0016] Figure 1 This is a diagram showing the construction results of the shrimp iris virus plasmid of this invention; Figure 2 This is a diagram showing the optimization results of the RPA reaction conditions of this invention; Figure 3 This is a graph showing the reaction optimization results of the CRISPR / Cas12A system of this invention; Figure 4 This is a sensitivity detection diagram of the detection method of the present invention; Figure 5 This is a specific detection diagram of the detection method of the present invention. Detailed Implementation

[0017] The following is in conjunction with the appendix Figure 1-5 This application provides further details.

[0018] The primer pairs designed in this invention with MCP as the target can maintain binding stability, significantly reduce false negatives caused by sequence variations, and thus improve detection sensitivity and accuracy. Furthermore, through systematic primer combination screening and reaction condition optimization, the RPA-CRISPR / Cas12a system achieves ideal detection sensitivity and specificity.

[0019] This invention relates to a shrimp iridovirus detection kit based on RPA-CRISPR / Cas12a, comprising: an isothermal amplification system (RPA), a CRISPR / Cas12a system, and an immunoassay strip.

[0020] The immunochromatographic test strip of the present invention comprises a sample pad, a conjugate pad, a backed NC membrane detection pad, and an absorbent pad stacked on a transparent adhesive plate; the conjugate pad contains a gold-labeled antibody and a gold-labeled streptavidin; the NC membrane has a detection line (T line) and a control line (C line); the T line is immobilized with an anti-FAM / FITC antibody to capture intact reporter probes that have not been cleaved by CRISPR-Cas; the C line contains an anti-gold-labeled mouse antibody to collect excess gold-labeled complexes to verify the effectiveness of the test strip.

[0021] The probe used in the report was selected from 5′-FAM-NNNNNNNNNN-3′-Biotin.

[0022] Example 1 The isothermal amplification system reagents include: amplification primer pairs targeting the shrimp iridovirus gene; the isothermal amplification product contains the PAM site required for recognition by CRISPR / Cas12a reagents; An isothermal amplification method using RPA as the reagent in the isothermal amplification system.

[0023] RPA reaction conditions optimization Highly conserved regions of the DIV1 genome were selected from the NCBI database (GenBank accession number: KY681040.1). Based on the conserved sequence of the D1V1 gene, specific amplification primers with PAM sites were designed. Three upstream primers and three downstream primers were designed according to RPA primer design standards, for a total of three primer pairs. The primer sequences are as follows: Primer pair 1: DRPA1-F:5'-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3' (SEQ ID No.1) DRPA1-R:5'-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3' (SEQ ID No.2) Primer pair 2: DRPA2-F:5'-GGCCAGTTTTGTATTCGTTGGGTGGAAATCAC-3' (SEQ ID No.6) DRPA2-R:5'-CCCGCCCTGGCCAATTCGGGACTTGCAGCTC-3' (SEQ ID No.7) Primer pair 3: DRPA3-F: 5'-TCCCAATCGATTACATTGACTACGGCACGATTG-3' (SEQ ID No.8) DRPA3-R: 5'-ATTGCAAACTTTCCCAACATTTTCTCAAATAAC-3' (SEQ ID No.9) The shrimp iridovirus gene was amplified using RPA amplification system reagents (EZassay Biotechnology, RPA DNA isothermal amplification kit), while shrimp iridovirus positive plasmid and ddH2O were used as positive and negative controls, respectively. Single-tube RPA reaction system (20 μL): 1 tube of reaction powder, 10 μL of Rehydration Buffer, 1 μL each of forward and reverse primers (10 μM), 2 μL of DNA sample, 9 μL of enzyme-free water, 1 μL of UDG buffer, and 2 μL of Starter. Mix all components except UDG buffer and add them to the reaction tube. Then add UDG buffer to the tube cap, tighten the cap, invert and mix 3 times, centrifuge at low speed for 10 seconds, and incubate at 37°C for 30 min to obtain the shrimp iridovirus gene amplification product. The amplification result was confirmed by agarose gel electrophoresis.

[0024] RPA primer screening: The primers were screened using DNA extracted from tissues as templates for RPA amplification, wherein DRPA1F / R was 260 bp in length; DRPA2F / R was 198 bp in length; and DRPA3F / R was 238 bp in length. After the reaction, the amplification results were analyzed by 2% agarose gel electrophoresis, and the results are as follows: Figure 2 As shown in a, primer pair 1 showed a bright specific band at 260 pb, therefore primer pair 1 was selected as the primer pair for subsequent RPA amplification.

[0025] Reaction conditions optimization: Based on the screened primer pair 1, subsequent RPA time and temperature were optimized. Five different incubation times (5 min, 10 min, 15 min, 20 min, 25 min, 30 min) and five different reaction temperatures (38℃, 39℃, 40℃, 41℃, 42℃) were set. Negative control N and positive control P were also included in the experiment. After the reaction, 2% agarose gel electrophoresis and the immunochromatographic test strips prepared above were analyzed. The reaction results are as follows: Figure 2 As shown in d and e, a specific band was produced and the immunoassay strip showed a positive result at a reaction time of 10 min; Figure 2 As shown in b and c, a specific band was produced at a reaction temperature of 38℃ and the immunoassay strip showed a positive result.

[0026] Based on the optimization results of the reaction conditions, primer pair 1 was selected, and the RPA reaction conditions were set to 38℃ and 10min for subsequent experiments.

[0027] Example 2 CRISPR / Cas12a system in shrimp iridovirus detection kit 1) Design of CrRNA Based on the characteristics of the CAS12a protein, the isothermal amplification product sequence of primer pair 1 obtained in the above examples was selected to contain the PAM site. Twenty bases upstream of the PAM sequence were selected as CrRNA. After the CrRNA-Cas12a complex recognizes the PAM site, it binds to the target DNA and activates the trans-cleavage activity of Cas12a. The activated Cas12a continuously cleaves the ssDNA reporter probe in the system, separating FAM from Biotin. The results are presented by color development using an immunochromatographic test strip. When the target nucleic acid is absent in the sample, the Cas12a protein's trans-cleavage ability is inactive, and it cannot cleave the Reporter molecule simultaneously labeled with FAM and Biotin tags. After the intact Reporter molecule is chromatographyd with the sample to the gold-labeled region, its Biotin tag binds to the gold-labeled mouse antibody to form a complex. This complex continues to diffuse to the T-line, where the Reporter's FAM tag binds to the anti-FAM / FITC antibody immobilized at the T-line, resulting in a clear band enriched by the gold label at the T-line. The unbound gold-labeled mouse antibody binds to the anti-gold-labeled mouse antibody at the C-line, verifying the effectiveness of the chromatography system. When the target nucleic acid is present in the sample, the target binds to the Cas protein, activating its nuclease activity and cleaving the Reporter molecule, separating its FAM and Biotin tags. The complex formed by the cleaved Biotin fragment and the gold-labeled mouse antibody lacks the FAM tag and cannot bind to the anti-FAM / FITC antibody at the T-line, resulting in no gold label enrichment at the T-line and the disappearance of the band. Simultaneously, the C-line still shows normal color development, confirming the effectiveness of the system. In this embodiment, a CrRNA primer was designed, with the following sequence: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU (SEQ ID No. 3) 2) Optimization of the CRISPR / Cas12a reaction system Reaction system (20 μL): 2 μL 10×Cas12a buffer, 1 μL Cas12a protein (1 μM), 1 μL crRNA (1 μM), 1 μL reporter probe (1 μM), 2 μL amplification product obtained by primer pair 1 in Example 1 above, 13 μL enzyme-free water; incubated at 37℃ for 45 min.

[0028] The immunochromatographic test strip consists of a sample pad, a conjugate pad, a backed NC membrane detection pad, and an absorbent pad stacked on a transparent adhesive plate. The conjugate pad contains a gold-labeled antibody and a gold-labeled streptavidin. The NC membrane has a detection line (T line) and a control line (C line). The T line is immobilized with an anti-FAM / FITC antibody to capture intact reporter probes that have not been cleaved by CRISPR-Cas. The C line contains an anti-gold-labeled antibody to collect excess gold-labeled complexes to verify the effectiveness of the test strip.

[0029] The probe used in the report was selected from 5′-FAM-NNNNNNNNNN-3′-Biotin.

[0030] Take 2 μl of the CRISPR / Cas12a reaction product and dilute it with 78 μl of Diluent. Take 70 μl of the reaction product and add it to the sample pad of the immunochromatographic test strip. Let it stand at room temperature for 5-10 min and observe the color development results. The result interpretation criteria are: both T and C lines are colored, indicating a negative result; only C line is colored, indicating a positive result; no C line or no C and T lines are colored, indicating that the test strip is invalid.

[0031] Reaction time optimization: Five different incubation times were set (5 min, 10 min, 15 min, 20 min, 25 min, 30 min), and the results are as follows. Figure 3 As shown in Figure a, only the C line showed color at 15 minutes, while the T line did not, indicating a positive result. Therefore, a reaction time of 15 minutes was selected as the optimized reaction time.

[0032] Cas12a protein concentration optimization: Five reaction concentrations (200nm, 400nm, 600nm, 800nm, and 1000nm) were set, and the different concentrations were reacted simultaneously at 37℃ for 15 min. The results are as follows. Figure 3 As shown in b, when the Cas12a protein concentration is 1000nm, only the C line shows color and the T line does not show color, indicating a positive result. Therefore, a Cas12a concentration of 1000nm was selected as the optimized result.

[0033] CrRNA concentration optimization: Five reaction concentrations (200nm, 400nm, 600nm, 800nm, and 1000nm) were set, and the reactions were carried out simultaneously at 37℃ for 15 min. The results are as follows. Figure 3 As shown in c, when the CrRNA protein concentration is 200nm, 400nm, and 1000nm, only the C line is colored and the T line is not colored, indicating a positive result. Considering the stability of the results, the CrRNA concentration of 1000nm was selected as the optimized result.

[0034] Probe concentration optimization report: Five reaction concentrations were set (200nm, 400nm, 600nm, 800nm, 1000nm), and the different concentrations were reacted simultaneously at 37℃ for 15 min. The results are as follows. Figure 3 As shown in d, the report indicates a positive result when only the C line is colored and the T line is not colored at 400nm and 600nm. However, false positives are likely to occur when the probe concentration is too high. Therefore, the report with a probe concentration of 400nm is selected as the optimized result.

[0035] Based on the optimization results of the reaction conditions, a reaction time of 15 min, a Cas12a concentration of 1000 nm, a CrRNA concentration of 1000 nm, and a reporter probe concentration of 400 nm were selected as the optimal conditions for this example.

[0036] In summary, the RPA-CRISPR / Cas12a shrimp iridovirus detection kit includes: an isothermal amplification system (RPA), a CRISPR / Cas12a system, and an immunoassay strip.

[0037] The isothermal amplification system (RPA) included primer pair 1 used in Example 1, synthesized by Qingke Biotechnology Co., Ltd.; the RPA isothermal amplification kit was purchased from Shenzhen Yizhi Biotechnology Co., Ltd.; the reaction conditions were as described in Example 1, incubating at 38℃ for 10 min to obtain the shrimp iridovirus target sequence with PAM site.

[0038] The CRISPR / Cas12a system included the CrRNA primers used in Example 2, synthesized by Qingke Biotechnology Co., Ltd.; the CRISPR / Cas12a DNA detection kit was purchased from Shenzhen Yizhi Biotechnology Co., Ltd.; the reaction conditions were as described in Example 2, incubating at 37°C for 15 min, with Cas12a concentration of 1000 nm, CrRNA concentration of 1000 nm, and reporter probe concentration of 400 nm as the optimal conditions for this example.

[0039] The immunochromatographic test strip consists of a sample pad, a conjugate pad, a backed NC membrane detection pad, and an absorbent pad stacked on a transparent adhesive plate. The conjugate pad contains a gold-labeled antibody and a gold-labeled streptavidin. The NC membrane has a detection line (T line) and a control line (C line). The T line is immobilized with an anti-FAM / FITC antibody to capture intact reporter probes that have not been cleaved by CRISPR-Cas. The C line contains an anti-gold-labeled antibody to collect excess gold-labeled complexes to verify the effectiveness of the test strip. The immunochromatographic test strip used in this invention was purchased from Shenzhen Yizhi Biotechnology Co., Ltd.

[0040] Example 3 The method for using the RPA-CRISPR / Cas12a shrimp iridovirus detection kit described above includes the following steps: Step S1: Sample collection and nucleic acid extraction Two samples of Litopenaeus vannamei infected with iridovirus were collected from Yantai Sanliwan Co., Ltd. in Shandong Province. Iridovirus DNA was extracted from the samples (using the SteadyPure kit, AG21009). The obtained DNA from the clinical samples was stored at -80℃.

[0041] Step S2: RPA reaction amplifies the target gene The DNA from step S1 was amplified at an isothermal temperature using the RPA reaction system of Example 1 to obtain a gene sequence with PAM sites.

[0042] Step S3: CRISPR / Cas12a system detects iris virus The preferred CRISPR / Cas12a system described in Example 2 was used for the cleavage reaction. The trans-cleavage activity of the Cas12a protein was activated by incubation at 37°C for 15 min, and the reporter probe in the cleavage system was used.

[0043] Step S4: Immunochromatographic test strip detection and result interpretation Take 2 μL of the reaction product from step S3 and dilute it with 78 μL of Diluent. Take 70 μL of the reaction product and add it dropwise to the sample pad of the immunochromatographic test strip described in Example 2. Let it stand at room temperature for 5 min-10 min and observe the color development results. When both T and C lines are colored, the result is negative; when only C line is colored, the result is positive; when no C line is colored or no C line and T line are colored, the test strip is invalid.

[0044] The immunoassay strip contains a chromogenic substance, as well as a test line and a control line; the chromogenic substance is selected from any one of colloidal gold, iron oxide, carbon dots, nano selenium, quantum dots, and fluorescent molecules; The labeled probe is selected from any one of cy3, cy5, cy7, FITC, FAM, Alexa Fluor, Bio, Dig, and Methylene Blue.

[0045] In this embodiment, the chromogenic molecule is colloidal gold; the labeling probe is selected from FAM and Bio.

[0046] In this embodiment, the specific recognition substance that binds to the probe is selected from an antibody against FAM / FITC.

[0047] The isothermal amplification primer pairs for the shrimp iridovirus gene were selected from the following: DRPA1-F:5'-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3' (SEQ ID No.1) DRPA1-R:5'-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3' (SEQ ID No.2) The crRNA of the shrimp iridovirus gene was selected from the following: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU (SEQ ID No. 3) The immunoassay strip contains: a sample pad, a conjugate pad, an NC membrane, and an absorbent pad; The sample pad is used to receive the sample to be tested; The conjugate pad is pre-coated with gold-labeled mouse antibiotic and gold-labeled streptavidin to capture reporter probes released after cleavage by the CRISPR / Cas12a system. The NC membrane contains detection lines and quality control lines; The detection line is coated with an anti-FAM / FITC antibody for capturing reporter probes; The reporter probe is a single-stranded DNA in the form of 5′-FAM-NNNNNNNNNN-3′-Biotin, whose sequence is not complementary to the target nucleic acid and serves only as a universal substrate for Cas12a trans-cleavage.

[0048] Example 4 The performance of the RPA-CRISPR / Cas12a shrimp iridovirus detection kit obtained using the above embodiments was verified, including sensitivity and specificity experiments.

[0049] 1) Sensitivity performance verification Construction of positive plasmid standards: Shrimp iridovirus positive plasmid standards were constructed using seamless cloning technology. The shrimp iridovirus DNA extracted in Example 3 was used as a template, and the pUC57EVL Seamless cloning kit was selected as the cloning vector. The inserted vector fragment needed to contain the PAM site of the shrimp iridovirus gene described in Example 1. Upstream and downstream primers were designed according to the conditions to prepare the required positive plasmids. The primer pair sequences are as follows: DEVL-F:5'-CCTCGCGAATGCATCTAGATCGATTACATTGACTACGGCACGAT-3' (SEQ IDNo.4) DEVL-R:5'-CGACGGGCCCGGGATCCGATGGTTCATCCATGACTGCCCATC-3' (SEQ ID No.5) PCR was performed using a high-fidelity enzyme, the amplified fragments were verified by agarose gel electrophoresis, and the amplified products were purified by gel extraction. Figure 1 a and b will use the purified insert fragments in the next experiment.

[0050] The purified fragment and vector were mixed at a molar ratio of 1:3, and the ligation product was transformed into E. coli DH5α competent cells. The cells were plated on LB agar plates containing antibiotics and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium, following the instructions. Figure 1 c. After shaking culture, plasmids were extracted and PCR amplified, verified by agarose gel electrophoresis, as per [reference]. Figure 1 d.

[0051] The plasmid concentration was determined and sequenced using an ultra-micro spectrophotometer, and its copy number was calculated using the following formula.

[0052] Copy number (copy / μL) = 6.02 × 10 23 ×10 -9 × (concentration ng / μL) / (DNA length × 660) Sensitivity test: The copy number of the shrimp iridovirus positive plasmid standard in step S1 was calculated to be 2.3 × 10⁻⁶ according to the formula. 10 And it was serially diluted tenfold (2.3 × 10⁻⁶). 10 -2.3×10 1 This method was used to detect it, and its lower limit of detection was determined. The reaction results are as follows: Figure 4 As shown, at a copy number of 2.3 × 10 1 At this point, only line C of the test strip showed color, while line T remained unchanged, indicating a positive result. Therefore, the lower limit of detection for this method is 2.3 x 10⁻⁶. 1 .

[0053] 2) Specificity Experiment: DNA from shrimp white spot syndrome virus (WSSV), enterocytozoon hepatopenaei (EHP), infectious hypodermal and hematopoietic necrosis virus (IHHNV), and Vibrio parahaemolyticus were selected as templates for detection. Simultaneously, the shrimp iridovirus positive plasmid standard from Example 4 served as a positive control, and ddH2O as a negative control. The detection method from Example 3 was used to detect the above viruses and evaluate the specificity of the established method. The reaction results are as follows: Figure 5 As shown, only the iridovirus positive plasmid standard showed C-line color development but no T-line color development, indicating a positive result. In contrast, other pathogens and the negative control showed both C-line and T-line color development, resulting in a negative result. This demonstrates the specificity of the detection method.

Claims

1. A rapid detection primer set for shrimp iridovirus based on the RPA-CRISPR / Cas12a system, characterized in that: The primer set consists of primers for isothermal gene amplification of iridovirus and probes that specifically recognize the target sequence of the amplification product; among them, the primers for isothermal gene amplification of iridovirus are: DRPA1-F:5'-TATTTTCTAGATCAGGCCAGTTTTGTATTCG-3' (SEQ ID No.1) DRPA1-R:5'-ATTTCGTCAGCATTTGGTTCATCCATGACTGC-3' (SEQ ID No.2) CRISPR probes that specifically recognize the target sequence of the amplification product: crRNA: UAAUUUCUACUAAGUGUAGAUCCCGUAAUCAGAGAUGUGUU (SEQ ID No. 3); ssDNA reporter probe: 5′-FAM-NNNNNNNNNN-3′-Biotin.

2. An application of the primer set according to claim 1, characterized in that: Application of the primer set in the detection of shrimp iridovirus based on the RPA-CRISPR / Cas12a system.

3. A rapid detection kit for shrimp iridovirus, characterized in that: The kit contains the primer set as described in claim 1.

4. The rapid detection kit for shrimp iridovirus according to claim 3, characterized in that: The kit comprises an isothermal amplification system, a CRISPR / Cas12a system, and an immunoassay strip; wherein, the isothermal amplification system comprises isothermal amplification system reagents and isothermal gene amplification primers for iridovirus; the CRISPR / Cas12a system comprises CRISPR / Cas12a system reagents, isothermal amplification products, and CRISPR probes that specifically recognize the target sequence of the amplification products.

5. The rapid detection kit for shrimp iridovirus according to claim 4, characterized in that: The immunochromatographic test strip consists of a sample pad, a conjugate pad, a backed NC membrane detection pad, and an absorbent pad stacked on a transparent adhesive plate. The conjugate pad contains a gold-labeled antibody and a gold-labeled streptavidin. The NC membrane has a detection line (T line) and a control line (C line). The T line is immobilized with an anti-FAM / FITC antibody to capture intact reporter probes that have not been cleaved by CRISPR-Cas. The C line contains an anti-gold-labeled antibody to collect excess gold-labeled complexes to verify the effectiveness of the test strip.

6. The rapid detection kit for shrimp iridovirus according to claim 5, characterized in that: The immunochromatographic test strip analysis method is the line disappearance method. If both T and C lines are colored, the result is negative; if only C line is colored, the result is positive; if no C line is colored or no C line and T line are colored, the test strip is invalid.

7. A method of using the kit of claim 3 for rapid detection of shrimp iridovirus, characterized in that, The shrimp iridovirus gene was amplified using an isothermal amplification system reagent to obtain an amplification product with PAM sites. The Cas12a protein was co-incubated with the amplification product carrying the PAM site and the corresponding crRNA to form a Cas12a-crRNA-target gene ternary complex. The complex activated the gene probe in the cleavage reaction system. The above reaction products are reacted with an immunoassay strip, and the presence of shrimp iridovirus in the sample is determined by the colorimetric reaction of the strip.

8. An application according to claim 1 or 3, characterized in that: The primer pair of claim 1 or the kit of claim 3 are used in the diagnosis of shrimp iridovirus infection or in the prevention and control of diseases in aquaculture farms.