CRISPR / Cas12a-based detection kit and detection method for detecting bovine pasteurella multocida

Abstract

The invention relates to the technical field of microbiological detection, in particular to a CRISPR / Cas12a-based detection kit and a CRISPR / Cas12a-based detection method for detecting bovine pasteurella multocida. An isothermal amplification primer pair is designed on the basis of a conserved kmt gene of bovine pasteurella multocida, the kmt gene is subjected to amplification marking by virtue of an isothermal amplification technology, and the detection kit for detecting bovine pasteurella multocida is constructed by virtue of the high-specificity recognition capability of CRISPR / Cas12a and the visualization advantage of an immune test strip. By utilizing the detection kit and the detection method provided by the invention, the bovine pasteurella multocida can be rapidly detected under normal-temperature and constant-temperature conditions, and the detection kit and the detection method have the advantages that the result is visual and accurate, the sensitivity is high, the operation steps are simple and convenient, and large precise instruments are not needed. The kit provided by the invention is suitable for various field detection scenes such as farms and grassroots veterinary stations, and an efficient tool is provided for early prevention and control of cattle pasteurellosis.

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and in particular to a detection kit and method for detecting Pasteurella multocida based on CRISPR / Cas12a. Background Technology

[0002] Bovine pasteurellosis, also known as bovine hemorrhagic septicemia, is caused by Pasteurella multocida (… Pasteurella multocida This disease, caused by Pasteurella multocida, can lead to symptoms such as high fever, difficulty breathing, and acute death in cattle, causing severe losses to the cattle farming industry. Currently, detecting Pasteurella multocida has become a key link in disease prevention and control, and rapid and accurate detection is an important support for epidemic control and cost reduction and efficiency improvement.

[0003] Traditional detection methods mainly include bacterial isolation and culture, serological testing, and routine molecular biological detection. However, these methods are time-consuming, require laboratory operations, and necessitate specialized technicians, thus failing to meet the needs of rapid, real-time testing at the grassroots level.

[0004] Recombinase polymerase-mediated isothermal amplification (RPA) is a rapid nucleic acid isothermal amplification technique. Compared to traditional polymerase chain reaction (PCR), it achieves rapid nucleic acid amplification without the need for specialized instruments and high reaction temperatures. However, relying solely on RPA for detection carries the risk of sample contamination, resulting in low sensitivity and specificity. The CRISPR / Cas12a system is a next-generation detection technology that leverages precise target recognition and specific cleavage, offering advantages such as high specificity, high sensitivity, and mild reaction conditions. It has shown promising application prospects in the detection of human and plant pathogens. However, its application in the detection of *Pasteurella multocida* is still in its early stages. Existing research still relies on complex nucleic acid extraction procedures or specialized fluorescence detection equipment, failing to fully utilize its "rapid, simple, and low-cost" technical characteristics. This has prevented the technology from being widely applied in practical *Pasteurella multocida* detection scenarios. This method combines both approaches, achieving both massive nucleic acid amplification for accurate identification and precise target cleavage, resulting in more accurate and rapid detection and reducing costs and increasing efficiency for the cattle farming industry.

[0005] Regarding the aforementioned technologies, existing methods for detecting Pasteurella multocida in cattle either suffer from long detection cycles and poor specificity, or rely on large-scale equipment and specialized operations. While CRISPR / Cas12a-based detection technologies have potential, they still suffer from complex procedures and insufficient field applicability. There is an urgent need to develop a CRISPR / Cas12a detection product and solution that is more suitable for the actual testing needs of animal husbandry. Summary of the Invention

[0006] To address the technical shortcomings of existing detection products for Pasteurella multocida, which rely on specialized equipment and personnel, are time-consuming, and fail to meet the needs of immediate detection, this invention provides a detection kit and method for detecting Pasteurella multocida based on CRISPR / Cas12a.

[0007] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of this invention provides a CRISPR / Cas12a-based detection kit for Pasteurella multocida, the detection kit comprising: isothermal amplification reagent, CRISPR / Cas12a reagent, and nucleic acid detection test strip; The isothermal amplification system reagents include: amplification of conserved genes of Pasteurella multocida (Bacillus subtilis). kmt The primer pair of the gene; the amplification product obtained by isothermal amplification of the primer pair contains the PAM site (TTTN sequence) required for recognition by the CRISPR / Cas12a reagent. The isothermal amplification system reagents are used in any one of the recombinase polymerase-mediated isothermal nucleic acid amplification (RPA), RT-LAMP, and HRCA isothermal amplification methods. The isothermal amplification system reagents are used for recombinase polymerase-mediated isothermal nucleic acid amplification (RPA) technology. The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; The CRISPR / Cas12a reagent contains crRNA of the Pasteurella multocida kmt gene, Cas12a protein, and a reporter probe. The crRNA can specifically recognize the target sequence of the amplification product and activate the cleavage ability of the Cas12a protein. First, it cleaves the double strand at the binding site of the crRNA, and then activates the trans-cleavage ability of the Cas12a protein to cleave the single strand, that is, to cleave the reporter probe.

[0008] The nucleotide sequence of the crRNA is shown in SEQ ID NO.17.

[0009] The labeling of the reporting probe is selected from any one of cy3, cy5, FITC, FAM, Alexa Fluor, biotin, Dig, and Methylene Blue.

[0010] The nucleic acid test strip includes a chromogenic substance, a T-line, and a C-line.

[0011] Furthermore, the color-developing substance is selected from any one of colloidal gold, iron oxide, carbon dots, nano-selenium, quantum dots, and fluorescent molecules.

[0012] Furthermore, the reporter probe is selected from FAM-biotin-labeled ssDNA, that is, the reporter probe is a single-stranded nucleotide sequence with FAM labeling at the 5' end and biotin labeling at the 3' end.

[0013] Furthermore, the nucleotide sequence of the reporter probe is 5'-TTATT-3'.

[0014] Furthermore, the chromogenic substance is colloidal gold; the T-line detection line is immobilized with an anti-FAM antibody, and the C-line detection line is immobilized with an anti-gold-labeled mouse antibody.

[0015] Furthermore, the nucleic acid test strip also contains: a sample pad, a conjugate pad, an NC membrane, and an absorbent pad; The sample pad is used to receive the sample to be tested; The conjugation pad contains colloidal gold-labeled anti-FAM antibodies and colloidal gold-labeled streptavidin; The NC film contains the T-line detection line and the C-line detection line.

[0016] A second aspect of the present invention provides the application of the above-described detection kit in the visual detection of Pasteurella multocida.

[0017] A third aspect of the present invention provides a method for detecting Pasteurella multocida bovis using the detection kit described above, comprising the following steps: Obtain the genomic DNA of the sample to be tested; Using the genomic DNA as a template, an isothermal amplification reaction was performed using the primer pair to obtain an amplification product with a crRNA recognition site; The amplification product was mixed with CRISPR / Cas12a reagent and subjected to a CRISPR / Cas12a cleavage reaction at 37°C for 5 to 30 minutes to obtain the reaction product. In this CRISPR / Cas12a cleavage reaction, the Cas12a protein, the amplification product with the crRNA recognition site, and the crRNA were mixed to form a complex, which activated the non-specific cleavage activity of Cas12a and cleaved the reporter probe in the system.

[0018] Add the reaction product to the sample pad of the nucleic acid test strip, let it stand at room temperature for 5 to 10 minutes, and observe the color development results: if both the T line and the C line show color, the test result is negative and the sample does not contain Pasteurella multocida; if only the C line shows color, the test result is positive and the sample contains Pasteurella multocida.

[0019] Furthermore, the cutting reaction time is preferably 20 minutes.

[0020] Furthermore, each 20 μL isothermal amplification reaction system contains: 1 tube of reaction powder, 10 μL of rehydration buffer, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 2 μL of DNA, 9 μL of enzyme-free water, and 1 μL of UDG buffer.

[0021] Further, each 20 μL of the cleavage reaction system contains: 2 μL of 10×Cas12a buffer, 1 μL of 1 μM Cas12a protein, 1 μL of 600 nM~1 μM crRNA, 1 μL of 1 μM reporter probe, 2 μL of amplification product, and 13 μL of enzyme-free water.

[0022] Furthermore, the concentration of crRNA in the system is preferably 600 nM.

[0023] Furthermore, the isothermal amplification reaction is carried out at a temperature of 37℃~39℃ for a time of 15min~25min.

[0024] Furthermore, the isothermal amplification reaction is carried out at a temperature of 37°C for 15 minutes.

[0025] A fourth aspect of the present invention provides a detection reagent for Pasteurella multocida, wherein the detection reagent is the primer pair described above.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discloses a detection kit and method for detecting *Pasteurella multocida* based on CRISPR / Cas12a. This invention is based on the conserved... kmt The gene was designed using isothermal amplification primer pairs with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4. The target gene was amplified and labeled using isothermal amplification technology. A detection platform—a detection kit for *Pasteurella multocida*—was constructed leveraging the high specificity of CRISPR / Cas12a and the visualization advantages of immunoassay strips. Using the detection kit and method provided by this invention, *Pasteurella multocida* can be rapidly detected under ambient temperature and isothermal conditions. It offers advantages such as intuitive and accurate results, high sensitivity, simple operation, and no need for large, sophisticated instruments. The kit provided by this invention is suitable for various on-site testing scenarios, including farms and grassroots veterinary stations, providing an efficient tool for the early prevention and control of *Pasteurella multocida* infection in cattle. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Bovine Pasteurella multocida provided as an exemplary embodiment of the present invention kmt Electrophoresis image of the product synthesized by conventional PCR and the constructed plasmid. Figure 1 Image A is an electrophoresis image of the whole genome DNA of Pasteurella multocida. Figure 1 In the image, B is the electrophoresis diagram of the product from a standard PCR amplification. Figure 1 C in the image represents the gel recovery electrophoresis result. Figure 1 In this context, D represents the verification of the amplified products after gel recovery. Figure 1 In the figure, E represents the result of amplification and culture after ligation of the target fragment and the pUC57 cloning vector.

[0029] Figure 2 The sequencing results for constructing the plasmid show the insert fragment and *Pasteurella multocida*. kmt The gene-specific fragment alignment was correct.

[0030] Figure 3 To verify the colony PCR results for constructing the positive plasmid. Figure 3 In the diagram, A represents the first batch of colony amplification results, with the colonies corresponding to lanes 10 and 11 being positive. Figure 3 B in the diagram represents the second batch of colony amplification results, with colonies corresponding to lanes 3, 13, and 19 being positive.

[0031] Figure 4 To determine the concentration of the obtained positive plasmid. Figure 4 In the image, A represents a plasmid electrophoresis result. Figure 4 In this context, B represents the concentration of the plasmid corresponding to lanes 1-7.

[0032] Figure 5 Agarose gel electrophoresis image and immunoassay strip image for RPA primer validation. Figure 5 Image (A) shows an agarose gel electrophoresis image of the amplification products from 5 pairs of RPA primers (kmt-F1 / R1 to kmt-F5 / R5). Figure 5 (B) in the table represents the detection result of the immunoassay strip with the corresponding primer combination.

[0033] Figure 6 Images of test strips for RPA reaction temperature screening. Figure 6The temperatures corresponding to (A), (B), (C), (D), and (E) are 35℃, 36℃, 37℃, 38℃, and 39℃, respectively.

[0034] Figure 7 Screening test strip images for RPA reaction time Figure 7 The reaction times corresponding to (A), (B), (C), (D), and (E) are 5 min, 10 min, 15 min, 20 min, and 25 min, respectively.

[0035] Figure 8 Optimize test strip images for the CRISPR / Cas12a system. Figure 8 (A) is an image of a CRISPR / Cas cutting process 5-pair crRNA screening strip; (B) is an image of a CRISPR / Cas cutting time optimization strip.

[0036] Figure 9 Image of test strip optimized for component concentration in CRISPR / Cas12a reaction system. Figure 9 (A) in the diagram represents the optimized concentration of the reporter probe. Figure 9 (B) in the figure represents the optimized concentration of Cas12a. Figure 9 (C) in the figure represents the optimized concentration of crRNA.

[0037] Figure 10 The results are for the sensitivity verification of the detection method. Figure 10 (A) in the image represents the electrophoresis results obtained using standard PCR. Figure 10 (B) in the figure represents the sensitivity verification result of the detection method of the present invention.

[0038] Figure 11 To verify the specificity of the detection method, lane N was the negative control, lane Y was the positive control, lane 1 was the target bacteria, and lanes 2 to 9 contained 9 non-target bacteria.

[0039] Figure 12 For the repeatability verification of the detection method, lane N is the negative control and lane Y is the positive control.

[0040] Figure 13 The test results are for the practical application of the detection method. Figure 13 (A) in the figure represents the detection result of the kit of the present invention. Figure 13 (B) in the table represents the result of a standard PCR test. Detailed Implementation

[0041] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0042] This invention discloses a detection kit for Pasteurella multocida based on CRISPR / Cas12a, comprising: isothermal amplification system reagent, CRISPR / Cas12a reagent, and nucleic acid detection test strip.

[0043] 1) The isothermal amplification system reagents include: specific amplification of Pasteurella multocida bovis. kmt The primer pair for gene amplification; the product of isothermal amplification contains the PAM site (TTTN sequence) required for recognition by CRISPR / Cas12a reagents.

[0044] The isothermal amplification method for the reagents in the isothermal amplification system is selected from any one of the isothermal amplification methods: RPA, RT-LAMP, and HRCA.

[0045] In some embodiments of the present invention, the RPA isothermal amplification method is used as the isothermal amplification method for the isothermal amplification system reagents.

[0046] The primer pairs for amplifying the KMT gene of Pasteurella multocida were selected from the following (primer lengths meet the 30nt-35nt design requirements for RPA technology): kmt-F1: ACCGATTGCCGCGAAATTGAGTTTTATGCC, SEQ ID NO.3; kmt-R1:ACTGACACGATCAAACCGTTGAACACGAAG, SEQ ID NO.4.

[0047] 2) The CRISPR / Cas12a reagent contains crRNA of the KMT gene of Pasteurella multocida, Cas12a protein and reporter probe; the crRNA synthesized by the CRISPR / Cas12a reagent can specifically recognize the target sequence of the corresponding amplification product, activate the cleavage ability of Cas12a and thus cleave the reporter probe.

[0048] Pasteurella multocida kmt The nucleotide sequence of the crRNA of the gene is shown in SEQ ID NO.17.

[0049] The labeling of the reporting probe is selected from any one of cy3, cy5, cy7, FITC, FAM, Alexa Fluor, biotin, Dig, and Methylene Blue.

[0050] The reporting probe is a single-stranded nucleotide sequence with a 5' FAM label and a 3' biotin label.

[0051] The reported probe is: 5'-FAM-TTATT-Biotin-3'.

[0052] The CRISPR / Cas12a reagent also contains DNA purification reagents, RNA purification reagents, and T7 polymerase.

[0053] 3) Nucleic acid test strips include a chromogenic substance, a T-line, and a C-line.

[0054] The color-developing substance is selected from any one of colloidal gold, iron oxide, carbon dots, nano selenium, quantum dots, and fluorescent molecules.

[0055] The color-developing substance is preferably colloidal gold.

[0056] The detection line is fixed with a specific recognition substance that binds to the probe.

[0057] The specific recognition substance that binds to the probe is selected from streptavidin.

[0058] The nucleic acid test strip also contains: a sample pad, a conjugate pad, an NC membrane, and an absorbent pad.

[0059] The sample pad is used to receive the sample to be tested.

[0060] The conjugate pad contains gold-labeled antibodies and gold-labeled streptavidin.

[0061] The NC film contains the T-line detection line and the C-line detection line.

[0062] The quality control line contains antibodies against the gold standard antibody.

[0063] Application of a CRISPR / Cas12a-based detection kit for Pasteurella multocida in the visual detection of Pasteurella multocida.

[0064] A method for detecting *Pasteurella multocida* in bovine bacteria using a CRISPR / Cas12a-based detection kit includes the following steps: Obtain the genomic DNA of the sample to be tested.

[0065] Using the genomic DNA as a template, an isothermal amplification reaction was performed using the primer pair to obtain an amplification product with a crRNA recognition site; the isothermal amplification reaction was performed at a temperature of 37℃~39℃ for 15min~25min.

[0066] The amplification product was mixed with CRISPR / Cas12a reagent and subjected to a CRISPR / Cas12a cleavage reaction at 37°C for 5 to 30 minutes to obtain the reaction product. In this CRISPR / Cas12a cleavage reaction, the Cas12a protein, the amplification product with the crRNA recognition site, and the crRNA were mixed to form a complex, which activated the non-specific cleavage activity of Cas12a and cleaved the reporter probe in the system.

[0067] Add the reaction product to the sample pad of the nucleic acid test strip, let it stand at room temperature for 5 to 10 minutes, and observe the color development results: if both the T line and the C line show color, the test result is negative and the sample does not contain Pasteurella multocida; if only the C line shows color, the test result is positive and the sample contains Pasteurella multocida.

[0068] Each 20 μL cleavage reaction system contains: 2 μL 10×Cas12a buffer, 1 μL 1 μM Cas12a protein, 1 μL 600 nM~1 μM crRNA, 1 μL 1 μM reporter probe, 2 μL amplification product, and 13 μL enzyme-free water.

[0069] Example 1: Primer design, screening, and amplification system determination 1. Construction and validation of positive plasmids Using seamless cloning technology, a structure containing *Pasteurella multocida* was constructed. kmt Positive plasmids of the gene target sequence are used as standards for subsequent experiments.

[0070] 1.1 Target sequence amplification Using the whole genome DNA of Pasteurella multocida as a template, PCR amplification was performed using high-fidelity DNA polymerase. The amplification primers were designed as follows:

[0071] Upstream primer F1: 5'-CCTCGCGAATGCATCTAGATATCCGCTATTTACCCAG-3', SEQ ID NO.1; Downstream primer R1: 5'-CGACGGGCCCGGGATCCGATACGAACTCGCCACTTTT-3', SEQ ID NO. 2.

[0072] PCR reaction system (50μL): 1U / μL Apex HF HS DNA Polymerase CL 1μL, 2×Apex HFCL Buffer 25μL, 10μM upstream primer 1μL, 10μM downstream primer 1μL, template DNA 5μL, enzyme-free water 17μL.

[0073] PCR reaction conditions: 94℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 30 s, for a total of 30 cycles.

[0074] The obtained PCR products were verified by agarose gel electrophoresis, and the target fragment was extracted and purified. The purified fragment was ligated with the pUC57 cloning vector at a molar ratio of 3:1. The ligation product was transformed into competent cells, cultured and amplified, and single colonies were picked for colony PCR verification. Positive clones were selected for sequencing verification.

[0075] Figure 1 The images show electrophoresis diagrams of the routine PCR amplification products of the Pasteurella multocida gene and images of the constructed plasmids. Figure 1 Image A is an electrophoresis image of the whole genome DNA of Pasteurella multocida, image B is an electrophoresis image of the product of conventional PCR amplification, image C is an electrophoresis image of gel recovery, image D is the verification of the amplified product after gel recovery, and image E is the result of amplification and culture after ligation of the target fragment recovered from the gel with the pUC57 cloning vector.

[0076] Figure 2 The sequencing alignment results of the ligation product show no errors compared to the target gene. Figure 3 This is the result of plasmid construction verification. The constructed colonies were amplified, and the results show... Figure 3 Positive bands were amplified in lanes 10 and 11 of sample A. Figure 3 Positive bands were amplified in lanes 3, 13, and 19 of swim bladder B.

[0077] DNA from positive plasmids was extracted, and after determining the plasmid concentration, it was aliquoted and stored at -20°C for later use as a standard. Figure 4 ).

[0078] 2. Design and screening of RPA isothermal amplification primers 2.1 Sample Pretreatment and Nucleic Acid Extraction: Take bovine nasal swabs and use a rapid nucleic acid release agent (EZassay Biotechnology) to release nucleic acids. The specific procedure is as follows: add the bovine nasal swab sample to the rapid nucleic acid release agent, mix thoroughly, let stand for 5 minutes, and then use it directly for the next step of the experiment.

[0079] 2.2 Primer Design Conserved against Pasteurella multocida kmtGene sequence was used to design 5 pairs of RPA amplification primers using Primer Premier 5.0 software. Primer lengths were controlled to 30-35 nt, and each primer must contain the PAM sequence (TTTN) required for Cas12a recognition. Primer sequences are shown in Table 1.

[0080] Table 1 Primer sequence information 2.3 RPA Amplification Reaction The RPA isothermal amplification kit (EZassay Biotechnology, RPA DNA isothermal amplification kit) was used to... kmt Genes are amplified.

[0081] The 20μL single-tube RPA reaction system contains: 1 tube of reaction powder, 10μL of Rehydration Buffer, 1μL of 10μM kmt-F, 1μL of 10μM kmt-R, 2μL of DNA, 9μL of enzyme-free water, and 1μL of UDG buffer; Procedure: Mix all components except UDG buffer and add them to the reaction tube. Then add UDG buffer to the tube cap, tighten the cap, invert and mix three times, centrifuge at low speed for 10 seconds, and incubate at 37°C in a PCR instrument for 30 minutes to obtain the kmt gene amplification product.

[0082] 2.4 Primer screening results RPA amplification was performed using five primer pairs on the same template, and the products were detected by agarose gel electrophoresis. The results showed that the kmt-F1 / kmt-R1 primer pair amplified… kmt A specific band (456 bp) was observed, exhibiting the highest amplification efficiency. The band was single and bright, with no primer dimers produced (see [link]). Figure 5 Therefore, kmt-F1 / kmt-R1 was determined to be the optimal primer pair for RPA amplification.

[0083] 3. Optimization of RPA reaction conditions 3.1 Optimization of reaction temperature Using the optimal primer pair kmt-F1 / kmt-R1 determined above, RPA amplification was performed at temperatures of 35℃, 36℃, 37℃, 38℃, 39℃, 40℃, and a negative control (N), with a fixed reaction time of 15 min. The products were detected using immunoassay strips. The results showed that the T line was most vibrant, the C line was clear, and the background was clean at 37℃, thus determining this as the optimal reaction temperature (see [link to test results]). Figure 6 ).

[0084] 3.2 Optimization of reaction time Under 37℃ conditions, time optimization was performed with 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, and negative control N, respectively; temperature optimization was performed with 35℃, 36℃, 37℃, 38℃, 39℃, 40℃, and negative control N, respectively.

[0085] The results showed that the optimal amplification effect could be achieved within 15 minutes (see...). Figure 7 ).

[0086] Taking into account both detection efficiency and signal strength, primer pair kmt-F1 / kmt-R1, RPA reaction temperature of 37℃, and reaction time of 15min were selected for subsequent experiments.

[0087] Example 2: Design of crRNA and optimization of CRISPR / Cas12a reaction system 1. Design and screening of crRNA 1.1 crRNA Design Using the optimal primer pair kmt-F1 / kmt-R1 determined above, the PAM sequence (TTTN) was searched. A 20-base sequence was selected upstream of the PAM sequence as the spacer for the crRNA, and ligated to the crRNA backbone sequence (DR sequence: 5'-UAAUUUCUACUAAGUGUAGAU-3') to form a complete crRNA. A total of 5 crRNAs were designed, as shown in Table 2.

[0088] Table 2. crRNA primer information Note: crRNA consists of a DR sequence and a spacer sequence; the underlined region is the spacer sequence.

[0089] 1.2 crRNA screening The product obtained under the optimized RPA reaction conditions in Example 1 was used as a template and subjected to CRISPR / Cas12a cleavage reaction with 5 crRNAs respectively. The reaction was then detected by immunoassay strips.

[0090] The results showed that crRNA5 had the highest cleavage efficiency, the T-line completely disappeared in positive samples, and the T-line was clear in negative controls, demonstrating the most significant difference between positive and negative results (see [link to results]). Figure 8 Therefore, crRNA5 was determined to be the optimal crRNA.

[0091] 2. Optimization of reaction time CRISPR / Cas12a cleavage reaction was carried out at 37℃ for 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively.

[0092] The results showed that the cutting effect was optimal at 20 minutes, with the T-line completely disappearing in positive samples and the C-line showing normal color development (see...). Figure 8 The optimal cutting time was determined to be 20 minutes.

[0093] 2.2 Optimization of reaction component concentration Concentration gradient optimization was performed on key components in the CRISPR / Cas12a reaction system, setting concentrations of 200 nM, 400 nM, 600 nM, 800 nM, and 1000 nM. The results are as follows: Figure 9 As shown.

[0094] Report probe optimization: At a concentration of 1000 nM, the positive sample signal is the strongest and the T line disappears most completely.

[0095] Cas12a protein optimization: The highest cleavage efficiency was achieved at a concentration of 1000 nM.

[0096] crRNA optimization: The concentration of 600 nM provides the best positive / negative result discrimination and the lowest background.

[0097] The optimal CRISPR / Cas12a reaction system was determined to be: 2 μL of 10×Cas12a buffer, 1 μL of Cas12a protein (1 μM), 1 μL of crRNA5 (600 nM), 1 μL of reporter probe (1 μM), 2 μL of RPA amplification product, 13 μL of enzyme-free water, and a total volume of 20 μL; the reaction conditions were incubation at 37℃ for 20 min.

[0098] Example 3: Assembly and usage of the detection kit 1. Kit Components The detection kit for Pasteurella multocida provided by this invention includes isothermal amplification reagent, CRISPR / Cas12a reagent, and nucleic acid detection test strip.

[0099] 1) The isothermal amplification reagent includes the following components: RPA reaction dry powder (containing recombinase, single-stranded DNA binding protein, and DNA polymerase). Rehydration Buffer; UDG Buffer; RPA amplification primer pairs: kmt-F1 (SEQ ID NO.3) and kmt-R1 (SEQ ID NO.4), both at a concentration of 10 μM.

[0100] 2) The CRISPR / Cas12a reagent comprises the following components: Cas12a protein (1 μM); crRNA5 (SEQ ID NO. 17, 600nM); Reporting probe: FAM-TTATT-Biotin (1μM); 10×Cas12a buffer; Enzyme-free water.

[0101] 3) Nucleic acid test strips include the following components: Sample pad; Conjugation pad (containing gold-labeled anti-FAM antibody and gold-labeled streptavidin); NC membrane (including T-line detection line, immobilized with anti-FAM antibody; including C-line control line, immobilized with anti-gold-labeled antibody secondary antibody); Absorbent mat.

[0102] 2. Instructions for use Step 1: Sample Pretreatment The sample to be tested can be a sample collected in any environment. In this embodiment, a bovine nasal swab sample is used as the sample to be tested: take a bovine nasal swab sample, add 200 μL of nucleic acid rapid release agent (EZassay Bio), mix thoroughly, let stand at room temperature for 5 min, and use it directly for subsequent detection.

[0103] Step 2: RPA isothermal amplification Following the optimized RPA reaction conditions in Example 1, a 20 μL RPA reaction system was prepared and incubated at 37 °C for 15 min to obtain the RPA amplification product.

[0104] Step 3: CRISPR / Cas12a cleavage reaction Take 2 μL of RPA amplification product, add 18 μL of CRISPR / Cas12a reagent (prepared according to the optimized system in Example 2), and incubate at 37°C for 20 min to obtain the reaction product.

[0105] Step 4: Immunoassay strip testing Take 2 μL of the reaction product obtained in step 3, dilute it with 78 μL of Diluent, and add 70 μL to the sample pad of the nucleic acid test strip. Let it stand at room temperature for 5 min to 10 min and observe the color development results.

[0106] 3. Result Determination Negative: Both the T and C lines show color (red bands), indicating that the sample does not contain Pasteurella multocida. Positive: Only the C line shows color, and the T line does not show color, indicating that the sample contains Pasteurella multocida. Invalid: If the C line does not develop color (regardless of whether the T line develops color), the test strip is invalid.

[0107] Example 4: Reagent Kit Performance Validation 1. Sensitivity Verification The positive plasmid constructed in Example 1 was serially diluted 10-fold (10... 10 copies / μL~10 1 (copies / μL) were detected using the kit of this invention and conventional PCR methods, respectively.

[0108] The results showed that the detection limit of the kit of the present invention was determined to be 10. 3 copies / μL (see copies / μL) Figure 10 ).

[0109] 2. Specificity verification One target bacterium (Bacterium malignancy) and nine non-target bacteria were collected for validation. The nine non-target bacteria were bovine coronavirus, bovine paratuberculosis, Staphylococcus aureus, bovine viral diarrhea virus, bovine parainfluenza virus type 3, bovine respiratory syncytial virus, bovine herpesvirus type 1, Escherichia coli, and Streptococcus. Both the target bacterium and the nine non-target bacteria were purchased from Qingdao Ruierweite Biotechnology Co., Ltd.

[0110] The results showed that all non-target strains tested negative, indicating that the kit provided by this invention has good specificity (see...). Figure 11 ).

[0111] 3. Repeatability verification Three concentration gradients of positive plasmids were selected, and each concentration was tested three times.

[0112] The results showed that repeated tests on the same sample yielded consistent results, indicating that the kit has good reproducibility (see [link]). Figure 12 ).

[0113] 4. Verification using real-world application samples The 15 nasal swab samples collected from diseased cattle were tested using the kit of this invention and the conventional PCR method, respectively.

[0114] The results showed that PCR detected 3 positive samples and 12 negative samples; the detection results of the kit of this invention were completely consistent with those of qPCR, with a concordance rate of 100% (see...). Figure 13 ).

[0115] The reagent kit and usage method provided by this invention do not require professional instruments or technical personnel. They are easy to operate and provide intuitive results. They are suitable for real-time on-site testing scenarios such as farms and grassroots veterinary stations where the purpose is not disease diagnosis. This invention provides an efficient tool for the early prevention and control of bovine pasteurellosis.

[0116] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0117] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A detection kit for detecting Pasteurella multocida bovis based on CRISPR / Cas12a, characterized in that, The detection kit includes: isothermal amplification reagent, CRISPR / Cas12a reagent, and nucleic acid detection test strips; The isothermal amplification reagent includes a primer pair for amplifying the KMT gene of Pasteurella multocida; the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; The CRISPR / Cas12a reagent comprises crRNA, Cas12a protein, and a reporter probe; the nucleotide sequence of the crRNA is shown in SEQ ID NO.

17. The nucleic acid test strip includes a chromogenic substance, a T-line, and a C-line.

2. The detection kit according to claim 1, characterized in that, The reporter probe is a single-stranded nucleotide sequence with a 5' end FAM label and a 3' end biotin label.

3. The detection kit according to claim 2, characterized in that, The single-stranded nucleotide sequence is 5'-TTATT-3'.

4. The detection kit according to claim 1, characterized in that, The chromogenic substance is colloidal gold; the T-line detection line is immobilized with an anti-FAM antibody, and the C-line detection line is immobilized with an anti-gold-labeled mouse antibody.

5. The detection kit according to claim 4, characterized in that, The nucleic acid test strip also contains: a sample pad, a conjugate pad, an NC membrane, and an absorbent pad; The sample pad is used to receive the sample to be tested; The conjugation pad contains colloidal gold-labeled anti-FAM antibodies and colloidal gold-labeled streptavidin; The NC film contains the T-line detection line and the C-line detection line.

6. The application of the detection kit according to claim 1 in the visual detection of Pasteurella multocida.

7. A method for detecting Pasteurella multocida bovis using the detection kit according to claim 1, characterized in that, Includes the following steps: Obtain the genomic DNA of the sample to be tested; Using the genomic DNA as a template, an isothermal amplification reaction was performed using the primer pair to obtain the amplification product; The amplification product was mixed with CRISPR / Cas12a reagent and subjected to CRISPR / Cas12a cleavage reaction at 37℃ for 5 min to 30 min to obtain the reaction product. Add the reaction product to the sample pad of the nucleic acid test strip, let it stand at room temperature for 5 to 10 minutes, and observe the color development results: if both the T line and the C line show color, the test result is negative and the sample does not contain Pasteurella multocida; if only the C line shows color, the test result is positive and the sample contains Pasteurella multocida.

8. The method of use according to claim 7, characterized in that, Each 20 μL cleavage reaction system contains: 2 μL 10×Cas12a buffer, 1 μL 1 μM Cas12a protein, 1 μL 600 nM~1 μM crRNA, 1 μL 1 μM reporter probe, 2 μL amplification product, and 13 μL enzyme-free water.

9. The method of use according to claim 7, characterized in that, The isothermal amplification reaction is carried out at a temperature of 37℃~39℃ for 15min~25min.

10. A detection reagent for Pasteurella multocida, characterized in that, The detection reagent is the primer pair in claim 1.

Images