Method for detecting multiple pathogenic bacteria by using magnetic separation time difference
By combining magnetically encoded nanoparticles with fluorescent-ultraviolet dual-mode probes, rapid and accurate detection of a variety of pathogens is achieved, solving the problems of low detection efficiency and poor scalability in existing technologies, and improving the specificity and accuracy of detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHEJIANG JUNENG ENVIRONMENTAL ENG CO LTD
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-15
AI Technical Summary
Existing technologies struggle to achieve rapid, accurate, and low-cost detection of multiple pathogens, especially in complex samples where the separation efficiency of low-concentration targets is low. Furthermore, existing methods are susceptible to interference and have difficulty expanding the number of analytes that can be detected.
By employing magnetically encoded nanoparticles combined with a fluorescence-UV dual-mode probe, multiple pathogens can be detected through magnetic separation time differences. Targeted identification and separation of various pathogens can be achieved by utilizing fluorescence signal recovery and UV absorption synergistic detection.
It improves the specificity and accuracy of detection, enhances the separation efficiency of low-concentration targets in complex samples, supports high-throughput multi-target detection, and avoids the risk of misjudgment based on a single signal.
Smart Images

Figure CN122042964A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial analysis and detection technology, and in particular to a method for detecting multiple pathogens using magnetic separation time differences. Background Technology
[0002] Bacterial contamination poses a core threat to public health and safety, and is a significant factor leading to outbreaks of infectious diseases, foodborne illnesses, and environmental biohazards. In clinical settings (e.g., ICU infections with multidrug-resistant bacteria), the environment (e.g., the coexistence of multiple bacterial species in polluted water), and food safety (e.g., a single food item carrying multiple pathogens), scenarios of mixed infections and complex contamination frequently occur. Traditional technologies that can only detect a single target bacterium in a single test are no longer sufficient to meet the needs of "rapid identification and precise control." Therefore, developing technologies capable of simultaneously, efficiently, and accurately detecting multiple target bacteria has become an urgent need to ensure public health and safety, and is key to overcoming current bottlenecks in pollution control.
[0003] Despite the development of various traditional pathogen detection technologies—such as time-consuming culture methods (typically requiring 3-7 days) and their inability to detect unculturable species; enzyme-linked immunosorbent assays (ELISA) prone to false positive / false negative results, especially at low analyte concentrations; and polymerase chain reaction (PCR), while highly accurate, limited by complex sample preparation procedures—each method has significant limitations. Therefore, there is an urgent need to develop a technology that enables highly sensitive, easy-to-use, and cost-effective real-time multiplex pathogen detection in the field.
[0004] Magnetic nanosphere (MNS) encoding technology, developed based on cell magnetic separation technology, provides a highly innovative solution for multiplex bioanalysis. These magnetic nanospheres can be modified with various biorecognition elements such as antibodies, aptamers, or phage-derived proteins on their surface, combined with their inherent magnetic labeling function, to achieve sequential or simultaneous capture of multiple target molecules in a single detection reaction. This lays the foundation for subsequent simultaneous quantification of multiple components using fluorescence or other analytical techniques. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a method for detecting multiple pathogens using magnetic separation time differences. Specifically, it is a method for simultaneous dual-mode detection of multiple pathogens based on a magnetically encoded time separation system. This system integrates a dual-mode aptamer sensor, enabling rapid and accurate detection of multiple pathogens. The core of this invention's magnetically encoded time separation system includes fluorescent magnetically encoded nanoparticles, gold nanoparticle-aptamer, and a fluorescent-UV dual-mode probe. The preparation process of the fluorescent-UV dual-mode probe involves: sequentially anchoring quantum dots and specific cDNA onto the surface of magnetically encoded nanospheres, then functionalizing them with aptamer-modified gold nanoparticles, ultimately synthesizing a dual-mode probe with both fluorescence signal response and UV absorption response. This probe can achieve targeted recognition and separation detection of multiple pathogens through the specific binding of the surface aptamer to the target pathogen.
[0006] This invention is achieved through the following technical solution:
[0007] The purpose of this invention is to provide a method for detecting multiple pathogens using magnetic separation time differences, comprising the following steps:
[0008] S1. Weakly magnetic magnetic coding materials W-MNSs and strongly magnetic magnetic coding materials S-MNSs loaded with Fe3O4 were prepared by reverse microemulsion method; after amino modification, amino-modified W-MNSs and amino-modified S-MNSs were obtained.
[0009] S2. The obtained amino-modified W-MNSs and amino-modified S-MNSs are coupled with activated carbon dots to obtain W-MNSs-CDs and S-MNSs-CDs, respectively; then the obtained W-MNSs-CDs and S-MNSs-CDs are coupled with the cDNA of pathogens to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA, respectively.
[0010] S3. Gold nanoparticles AuNPs are coupled with the aptamer Apt of pathogenic bacteria to obtain AuNPs-Apt.
[0011] S4. The obtained S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA are hybridized with the corresponding AuNPs-Apt to form fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and fluorescent-UV dual-mode probes W-MNSs-CDs-cDNA-AuNPs-Apt, respectively.
[0012] S5. The fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt obtained in step S4 are incubated with the test solution containing pathogens and placed on a magnetic rack. The precipitates separated by magnetic separation at different times are taken, resuspended, and the fluorescence intensity and UV absorbance are detected.
[0013] Further, in step S1, the weakly magnetic encoded material W-MNSs is prepared by the following method:
[0014] Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution.
[0015] Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 240 s-250 s to obtain the weakly magnetic magnetic coding material W-MNSs.
[0016] Further, in step S1, the strongly magnetic encoded material S-MNSs is prepared by the following method:
[0017] Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution.
[0018] Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 40-50 s to obtain the strongly magnetic magnetic coding material S-MNSs.
[0019] Further, in step S1, the amino modification is performed by using a silane coupling agent to modify the weakly magnetic magnetic coding material W-MNSs and the strongly magnetic magnetic coding material S-MNSs respectively.
[0020] Further, in step S2, the activated carbon dots are obtained by mixing the carbon dots with EDC / NHS in a buffer solution and then sonicating.
[0021] Furthermore, in step S2, the pathogens are Staphylococcus aureus and Escherichia coli;
[0022] And / or, the cDNA of the pathogen includes cDNA of Staphylococcus aureus and cDNA of Escherichia coli;
[0023] The cDNA of the Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′ (SEQ ID NO.1);
[0024] The cDNA of the *E. coli* is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′ (SEQ ID NO.2).
[0025] Furthermore, in step S3, the aptamer Apt of the pathogen includes Ap of Staphylococcus aureus and Apt of Escherichia coli;
[0026] The Apt sequence of the Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-SH-3′ (SEQ ID NO.3);
[0027] The Apt sequence of the *E. coli* is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG – SH- 3′ (SEQ ID NO.4).
[0028] Furthermore, in step S4, the hybridization conditions are 37°C for 6 hours.
[0029] Furthermore, in step S5, the incubation conditions are 37°C for 1 hour.
[0030] Further, in step S5, the concentration of pathogens in the test solution is 10. 1 CFU·mL −1 -10 7 CFU·mL −1 .
[0031] Further, in step S3, the gold nanoparticles (AuNPs) are obtained by heating a chloroauric acid solution and then adding a sodium citrate solution to react.
[0032] The detection principle of this invention is as follows: First, a multi-magnetically encoded Fe3O4@SiO2 composite material (MNSs) loaded with Fe3O4 is prepared using the reverse microemulsion method. Utilizing its differentiated magnetic properties, the target component can be continuously and accurately separated from the mixed sample. Subsequently, blue fluorescent carbon dots (CDs) prepared by the hydrothermal method are modified onto the surface of the MNSs to form a CDs-MNSs composite. When this composite interacts with aptamer-modified gold nanoparticles (Apt-AuNPs), the fluorescence of the CDs is quenched through the fluorescence resonance energy transfer (FRET) effect.
[0033] When the target pathogen is present in the detection system, Apt can specifically recognize and bind to the pathogen, forming an Apt-AuNPs / pathogen complex, leading to a weakening of the FRET effect and recovery of CDs fluorescence. Furthermore, the fluorescence intensity of CDs in the system is positively correlated with the concentration of the target pathogen, while the UV absorbance is negatively correlated. Based on these characteristics, under the influence of a magnetic field, by controlling the interaction time, quantitative capture of the CDs-MNSs composite material with specific magnetic properties can be achieved. Subsequently, the fluorescence intensity and UV absorbance of the CDs-MNSs are detected using an ELISA reader. Through data analysis, the specific concentration of the target pathogen is finally obtained.
[0034] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:
[0035] (1) Enhanced detection specificity through magnetic separation technology: This invention uses "SiO2-coated MNSs with different Fe3O4 contents" (magnetic nanospheres) to achieve differentiated magnetic response. By precisely controlling the Fe3O4 content, different functionalized nanoparticles exhibit gradient separation characteristics in a magnetic field, which can efficiently enrich the target and eliminate non-specific adsorption interference. Compared with traditional single magnetic beads, this design significantly improves the separation efficiency of low-concentration targets in complex samples (such as blood and environmental samples), providing a high-purity sample basis for subsequent detection. (2) Superior dual-mode sensing performance: Existing detection methods mostly use a single signal (such as only fluorescence or only ultraviolet), which is easily affected by interference; This invention combines "CDs fluorescent labeling + AuNPs aptamer recognition" to construct a fluorescence recovery-ultraviolet absorption dual-mode sensing mechanism, and the dual signals work together to improve the detection specificity and accuracy, avoiding the risk of misjudgment by a single signal.
[0036] (3) High scalability and support for high-throughput detection: Existing multiple detection technologies are mostly limited to a few targets (2-3 types); This invention can expand the number of analytes to be detected by increasing the number of "magnetically encoded probes". Theoretically, it is only necessary to change the amount of Fe3O4 added in MNSs to achieve high-throughput detection of multiple targets, thus solving the bottleneck of "difficult expansion and low throughput" of existing technologies. Attached Figure Description
[0037] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0038] Figure 1 This is a schematic diagram illustrating the principle of multi-pathogen detection using the magnetic separation time difference of Fe3O4@SiO2 composite particles in this invention.
[0039] Figure 2 These are the magnetic separation and detection results of Staphylococcus aureus in this invention; wherein, A is the magnetic separation fluorescence spectroscopy detection result; B is the magnetic separation fluorescence spectroscopy standard curve; C is the magnetic separation ultraviolet-visible absorption spectroscopy detection result; and D is the magnetic separation ultraviolet-visible absorption spectroscopy standard curve.
[0040] Figure 3 These are the magnetic separation detection results of Escherichia coli in this invention; wherein, A is the magnetic separation fluorescence spectroscopy detection result; B is the magnetic separation fluorescence spectroscopy standard curve; C is the magnetic separation ultraviolet-visible absorption spectroscopy detection result; and D is the magnetic separation ultraviolet-visible absorption spectroscopy standard curve. Detailed Implementation
[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0042] The purpose of this invention is to provide a method for detecting multiple pathogens using magnetic separation time differences (see schematic diagram). Figure 1 As shown in the figure, it can achieve rapid and accurate detection of various pathogens such as Staphylococcus aureus and Escherichia coli, including the following steps:
[0043] S1. Preparation of Fe3O4@SiO2 magnetically encoded nanospheres (MNSs) with different magnetic intensities: First, an inverse microemulsion system was constructed, and then silicon coating on the Fe3O4 surface was achieved by TEOS hydrolysis. After purification and magnetic screening, weakly magnetic MNSs (W-MNSs) and strongly magnetic MNSs (S-MNSs) were obtained.
[0044] S2. Synthesis of MNSC-cDNA magnetic / fluorescent nanocomposite materials: First, MNSs are modified with amino groups to obtain AMNSs. Then, CDs are activated and coupled with EDC / NHS to prepare MNSs-CDs. Finally, specific cDNA is coupled to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA.
[0045] S3. Synthesis of gold nanoparticles (AuNPs) and coupling with -SH-modified aptamers: AuNPs were synthesized using a modified sodium citrate reduction method. After centrifugation purification, the -SH aptamers were activated by TCEP and then formed AuNPs-Apt complexes with AuNPs.
[0046] S4. Simultaneous detection of multiple pathogens: MNSs-CDs-cDNA is hybridized with AuNPs-Apt to construct FRET aptamer pairs. After incubation with a sample containing the target pathogen, the magnetically encoded complex is specifically separated by an external magnetic field, and the fluorescence intensity is measured to quantify the pathogen.
[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available.
[0048] Example 1: Preparation of Fe3O4@SiO2 MNSs with different magnetic strengths.
[0049] Under mechanical stirring, 7.5 mL of cyclohexane, 1.8 mL of Triton X-100, and 1.6 mL of n-hexanol were added sequentially to a flask. After stirring for 30 min, 0.8 mL of Fe3O4NPs, 0.1 mL of PDDA solution, and 0.1 mL of TEOS (tetraethyl orthosilicate) were added. After stirring for 20 min, 0.12 mL of ammonia solution was added and the reaction was carried out for 24 h. After the reaction was completed, 20 mL of acetone was added to disrupt the microemulsion system. The precipitate was collected by centrifugation at 5000 rpm for 10 min. By controlling the duration of the external magnetic field (40 s and 240 s), MNSs complexes that did not meet the required magnetic field strength range were separated and removed, finally yielding weakly magnetically encoded materials W-MNSs and strongly magnetically encoded materials S-MNSs.
[0050] Example 2: Synthesis of MNSs-CDs-cDNA magnetic / fluorescent nanocomposite material.
[0051] Take 30 mg of S-MNSs or W-MNS and dissolve 15 μL of APTES (3-aminopropyltriethoxysilane) in 30 mL of anhydrous ethanol, stir the reaction for 24 h, and dry under vacuum at 50 °C for 12 h to obtain amino-modified S-MNSs or amino-modified W-MNS.
[0052] Dissolve 5 mg of EDC / NHS in 1 mL of PBS buffer (10 mM, pH 7.4). Mix 100 μL of CDs (carbon dots) solution with 100 μL of the EDC / NHS solution and sonicate for 30 min. Add 20 μL of the reaction solution to PBS buffer containing 80 μL of amino-modified S-MNSs or amino-modified W-MNSs. Incubate at 25 °C for 24 h. Collect the product with a magnet to obtain S-MNSs-CDs and W-MNSs-CDs.
[0053] Mix 100 μL of S-MNSs-CDs solution or W-MNSs-CDs solution with 100 μL of EDC / NHS solution and sonicate for 30 min. Take 80 μL of this reaction solution and add PBS buffer containing 20 μL of 5 μM specific cDNA (W-MNSs-CDs ligated with Staphylococcus aureus cDNA, and S-MNSs-CDs ligated with Escherichia coli cDNA). Incubate at 37°C for 12 h and collect the product with a magnet to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA.
[0054] The cDNA sequence of Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′ (SEQ ID NO.1).
[0055] The cDNA sequence of Escherichia coli is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′ (SEQ ID NO.2).
[0056] Example 3: Synthesis of gold nanoparticles (AuNPs) and coupling with SH-modified aptamers.
[0057] AuNPs synthesis: 100 mL of chloroauric acid solution (0.01%, w / v) was added to a round-bottom flask, stirred and heated to boiling at 300 rpm, and 1 mL of trisodium citrate solution (2%, w / v) was quickly added. The mixture was stirred and heated for 15 min until the solution turned wine-red. The AuNPs solution was centrifuged at 10000 rpm for 15 min, and the precipitate was resuspended in 10 mM PBS solution. 0.01% PVP was added to prevent AuNPs aggregation. 12 μL of -SH modified ssDNA (37.5 μM) was added to 24 μL TCEP solution (2 mM) and incubated for 1 h to reduce disulfide bonds. Subsequently, 252 μL of purified AuNPs and 12 μL of NaCl solution (1 M) were added, and the mixture was incubated at -20℃ for 2 h, then transferred to a 25℃ dark environment for 12 h. The AuNPs-Apt complex was collected by centrifugation at 12000 rpm for 15 min, and the precipitate was resuspended in 300 μL of PBS solution. In Tris-HCl buffer (pH 7.4).
[0058] The Apt sequence of Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-SH-3′ (SEQ ID NO.3);
[0059] The Apt sequence of Escherichia coli is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG– SH- 3′ (SEQ ID NO.4).
[0060] Example 4: Construction of standard curves for the concentrations of Escherichia coli and Staphylococcus aureus
[0061] (1) Co-incubation of target and detection probe: 100 μL of S-MNSs-CDs-cDNA, 100 μL of W-MNSs-CDs-cDNA and 100 μL of the corresponding AuNPs-Apt were hybridized at 37℃ for 6 h to form S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt FRET aptamer pairs, and the initial fluorescence and ultraviolet absorption spectra were recorded respectively;
[0062] (2) Subsequently, 200 μL of Staphylococcus aureus and Escherichia coli at equal concentration gradients (10 μL / mL) were added to the system described in (1) above. 1 CFU·mL −1 10 2 CFU·mL−1 10 3 CFU·mL −1 10 4 CFU·mL −1 10 5 CFU·mL −1 10 6 CFU·mL −1 10 7 CFU·mL −1 The mixture of 1,000 MNSs-CDs and 2,000 W-MNSs-CDs was incubated at 37°C for 60 min to allow the aptamers to specifically bind to the pathogens, resulting in increased fluorescence intensity and decreased UV absorption. Subsequently, an external magnetic field was applied, and the separation time of the S-MNSs-CDs complex was 40 s, while that of the W-MNSs-CDs complex was 240 s. After each separation, the collected materials were resuspended in 200 μL of PBS, and the fluorescence intensity and UV absorption intensity were measured using a microplate reader. All experiments were independently repeated three times, and the data are expressed as mean ± standard deviation (SD).
[0063] (3) The linear relationship between fluorescence and ultraviolet absorption spectral response in the solution was calculated and plotted. For example... Figure 2 and Figure 3 As shown, in solution, the linear regression equations are y = 809x – 672 (R²). 2 = 0.9912), y = 891x − 800 (R 2 = 0.9915). The UV absorption intensity increased linearly with increasing concentrations of Staphylococcus aureus and Escherichia coli, with linear regression equations of y = 0.03331x – 0.03327 (R = 0.9915). 2 = 0.9908), y =0.0226x − 0.01185 (R 2 = 0.9969).
[0064] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
[0065] Example 6: Determination of the concentrations of Escherichia coli and Staphylococcus aureus in actual samples.
[0066] To further verify the practical application and analytical reliability of the method for detecting multiple pathogens using the magnetic separation time difference of Fe3O4@SiO2 composite particles, actual pond water samples were selected for analysis. The analytical capability of the aptamer sensor for the actual samples was evaluated using the standard sample addition method, with each sample tested three times. The results are shown in Table 1:
[0067] Table 1
[0068]
[0069] According to the results in Table 1, the recovery rate of samples detected based on fluorescence signals was 97%–103%, with an RSD of 0.27%–3.22%, while the recovery rate of samples detected based on ultraviolet signals was 93%–106%, with an RSD of 1.74%–5.63%. These results indicate that the biosensor utilizing the difference in magnetic separation time of Fe3O4@SiO2 composite particles has great potential for the detection of Escherichia coli and Staphylococcus aureus.
[0070] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A method for detecting multiple pathogens using magnetic separation time difference, characterized in that, Includes the following steps: S1. Weakly magnetic magnetic coding materials W-MNSs and strongly magnetic magnetic coding materials S-MNSs loaded with Fe3O4 were prepared by reverse microemulsion method; after amino modification, amino-modified W-MNSs and amino-modified S-MNSs were obtained. S2. The obtained amino-modified W-MNSs and amino-modified S-MNSs are coupled with activated carbon dots to obtain W-MNSs-CDs and S-MNSs-CDs, respectively; then the obtained W-MNSs-CDs and S-MNSs-CDs are coupled with the cDNA of pathogens to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA, respectively. S3. Gold nanoparticles AuNPs are coupled with the aptamer Apt of pathogenic bacteria to obtain AuNPs-Apt. S4. The obtained S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA are hybridized with the corresponding AuNPs-Apt to form fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and fluorescent-UV dual-mode probes W-MNSs-CDs-cDNA-AuNPs-Apt, respectively. S5. The fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt obtained in step S4 are incubated with the test solution containing pathogens and placed on a magnetic rack. The precipitates separated by magnetic separation at different times are taken, resuspended, and the fluorescence intensity and UV absorbance are detected.
2. The method according to claim 1, characterized in that, In step S1, the weakly magnetic encoded material W-MNSs is prepared by the following method: Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution. Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 240 s-250 s to obtain the weakly magnetic magnetic coding material W-MNSs.
3. The method according to claim 1, characterized in that, In step S1, the strongly magnetic encoded material S-MNSs is prepared by the following method: Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution. Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 40-50 s to obtain the strongly magnetic magnetic coding material S-MNSs.
4. The method according to claim 1, characterized in that, In step S1, the amino modification is performed by using a silane coupling agent to modify the weakly magnetic magnetic coding material W-MNSs and the strongly magnetic magnetic coding material S-MNSs, respectively.
5. The method according to claim 1, characterized in that, In step S2, the activated carbon dots are obtained by mixing carbon dots with EDC / NHS in a buffer solution and then sonicating.
6. The method according to claim 1, characterized in that, In step S2, the pathogens are Staphylococcus aureus and Escherichia coli; And / or, the cDNA of the pathogen includes cDNA of Staphylococcus aureus and cDNA of Escherichia coli; The cDNA of the Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′; The cDNA of the *E. coli* is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′.
7. The method according to claim 1, characterized in that, In step S3, the aptamer Apt of the pathogen includes Ap of Staphylococcus aureus and Apt of Escherichia coli; The Apt sequence of the Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA -SH- 3′; The Apt sequence of the *E. coli* is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG– SH- 3′.
8. The method according to claim 1, characterized in that, In step S4, the hybridization conditions are 37°C for 6 hours.
9. The method according to claim 1, characterized in that, In step S5, the incubation conditions are 37°C for 1 hour.
10. The method according to claim 1, characterized in that, In step S5, the concentration of pathogens in the test solution is 10. 1 CFU·mL −1 -10 7 CFU·mL −1 .