Salt-regulated high-activity beta-glucosidase mutant e146g and application thereof
By developing the salt-regulated β-glucosidase mutant E146G, the problem of activity inhibition of traditional β-glucosidase in high-salt environments has been solved, achieving controllability and high efficiency of enzymatic reactions, which is applicable to the fields of bioenergy, food processing and medicine.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YUNNAN NORMAL UNIV
- Filing Date
- 2026-04-27
- Publication Date
- 2026-05-29
AI Technical Summary
Traditional β-glucosidases are inhibited in high-salt environments, resulting in low production efficiency and high costs, making them unsuitable for the enzymatic reaction requirements of high-salt environments in industrial applications.
A salt-regulated, highly active β-glucosidase mutant, E146G, was developed to activate enzyme activity by regulating salt concentration, thereby enabling controllable start-stop and process regulation of the enzymatic reaction.
The mutant E146G exhibits significant activity enhancement in high-salt environments, with pNPG hydrolysis activity reaching 3.7 to 57.3 times that of the wild-type enzyme and hydrolysis activity of the natural substrate gastrodin increased by 16.1 times, making it suitable for various industrial applications.
Smart Images

Figure CN122104645A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, specifically to a salt-regulated, highly active β-glucosidase mutant E146G and its applications. Background Technology
[0002] Cellulose degradation relies on the synergistic action of a cellulase system composed of endoglucanase (EC 3.2.1.4), exoglucanase (EC 3.2.1.91), and β-glucosidase (EC 3.2.1.21). As a key component of this cellulase system, β-glucosidase not only completely breaks down intermediate oligosaccharides such as cellobiose into glucose, completing the conversion of cellulose to monosaccharides, but also possesses broad-spectrum activity in hydrolyzing various natural substrates—it can act on glycoside compounds in natural products (such as gastrodin) to generate corresponding aglycones through targeted hydrolysis of glycosidic bonds. β-glucosidase has been widely used in bioenergy, food, and pharmaceutical fields.
[0003] Enzymes possess excellent properties such as high efficiency, specificity, and mild reaction conditions, but they also suffer from poor stability. For example, salt is widely present in industrial applications. High concentrations of salt can prevent microbial contamination, but they can also inhibit the activity of traditional β-glucosidases, disrupt their spatial structure, or interfere with the binding of the active site to the substrate. Simultaneously, they can accelerate enzyme degradation and inactivation, ultimately leading to low production efficiency and high costs. To address this problem, transforming the high-salt environment from an enzyme "inhibitor" into an "activator," and developing salt-dependent β-glucosidases, would be an ideal solution. These enzymes can achieve precise initiation, process control, and termination of enzymatic reactions through the addition and concentration adjustment of salt ions, providing a novel means for reaction regulation.
[0004] The application of β-glucosidase in high-salt environments has covered several core fields: in the bioenergy field, it can directly degrade saline biomass such as straw from saline-alkali land; in the pharmaceutical and health care field, it can directionally convert ginsenoside Rb1 into a highly active product; in the food processing field, it can synergistically treat high-salt soy sauce residue with halophilic proteases, achieving resource utilization of by-products without desalination. Furthermore, β-glucosidase, with its salt-activating properties, not only adapts to the aforementioned high-salt application environments but also significantly improves the precision and economy of production processes in various fields through its controllable activity regulation mechanism.
[0005] Therefore, developing a β-glucosidase that can exhibit higher activity in salt solutions, with its activity strictly regulated by salt or even dependent on salt activation, would not only enable controllable start-stop and process regulation of enzymatic reactions but also be suitable for industrial applications under high salt concentrations. This would be of great significance for reducing costs, improving efficiency, and promoting the development of related industries.
[0006] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention
[0007] The purpose of this invention is to provide a salt-regulated, highly active β-glucosidase mutant that, by adjusting the salt concentration, can be applied to various technical application scenarios that require adjusting or increasing the rate of enzyme-catalyzed reactions through salt solution concentration.
[0008] To achieve the above objectives, the present invention provides a salt-regulated, highly active β-glucosidase mutant E146G, the amino acid sequence of which is shown in SEQ ID NO.1.
[0009] The present invention also provides a gene encoding the above-mentioned mutant E146G, the nucleotide sequence of which is shown in SEQ ID NO.2.
[0010] The present invention also provides a recombinant expression vector containing the above-mentioned genes.
[0011] The present invention also provides a recombinant strain containing the above-mentioned gene or recombinant expression vector.
[0012] The mutant E146G provided by this invention can be applied to salt-regulated enzymatic reactions to improve enzyme activity in these reactions.
[0013] Preferably, the salt controlled by salt in the above applications is at least one of NaCl, KCl, NaNO3, KNO3, NaBr, or KBr.
[0014] Furthermore, in the salt regulation, the concentrations of NaCl and KCl are 0.1~3.0M, the concentrations of NaNO3 and KNO3 are 0.05~0.7M, and the concentrations of NaBr and KBr are 0.05~1.0M.
[0015] The mutant E146G provided by this invention can be applied in the fields of bioenergy, food processing, or medicine.
[0016] The present invention also provides the application of mutant E146G in hydrolyzing β-glucosinolate substrates, wherein the substrates include hydrolyzed p-nitrophenyl-β-D-glucopyranoside or gastrodin.
[0017] The present invention also provides a method for regulating enzyme-catalyzed reactions, wherein the reaction system is prepared using the above-mentioned mutant E146G, and the enzyme activity is regulated by adjusting the concentration of salt in the reaction system, wherein the salt is at least one of NaCl, KCl, NaNO3, KNO3, NaBr or KBr.
[0018] The present invention has the following advantages: This invention provides a salt-regulated, highly active β-glucosidase mutant, enriching the β-glucosidase resource library.
[0019] The salt-regulated, highly active β-glucosidase mutant provided by this invention exhibits a p-nitrophenyl-β-D-glucopyranoside (pNPG) hydrolytic activity of only 0.9 U / mg without salt, but it is activated by salt solutions. In 0.1–3.0 M NaCl and KCl solutions, 0.05–0.7 M NaNO3 and KNO3 solutions, and 0.05–1.0 M NaBr and KBr solutions, the recombinant wild-type enzyme BglPcC1 shows weak activation, with pNPG hydrolytic activity increasing to a maximum of only 3.4 times that without salt. In contrast, the mutant E146G shows a high degree of activation in all of the above solutions, with pNPG hydrolytic activity reaching 3.7–57.3 times that without salt. In 0.3 M NaBr solution, the hydrolytic activity of E146G against pNPG reached a maximum of 50.8 U / mg. Under the same conditions, the wild-type enzyme also reached its maximum pNPG hydrolytic activity, but only 33.8 U / mg. Furthermore, in 0.3 M NaBr solution, the hydrolytic activity of the mutant E146G against the natural substrate gastrodin was 16.1 times higher than that of the unsalted control group; while the hydrolytic activity of the wild-type enzyme against this natural substrate showed a slight decreasing trend compared to its unsalted control group. Attached Figure Description
[0020] Figure 1 The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in NaCl solutions with final concentrations of 0.1–3.0 M.
[0021] Figure 2 The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in MKCl solutions with final concentrations ranging from 0.1 to 3.0.
[0022] Figure 3 The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in solutions with final concentrations of 0.05–2.0 M NaNO3.
[0023] Figure 4 The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in solutions with final concentrations of 0.05-2.0 MKNO3.
[0024] Figure 5The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in NaBr solutions with final concentrations of 0.05–2.0 M.
[0025] Figure 6 The diagram shows the changes in activity of the recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in solutions with final concentrations of 0.05–2.0 MKBr.
[0026] Figure 7 This paper shows the difference in the hydrolytic activity of recombinant wild-type enzyme BglPcC1 (a) and mutant E146G (b) in NaBr without salt and at a final concentration of 0.3 M. Detailed Implementation
[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0029] Some of the experimental materials and reagents used in this invention: (1) Strains and vectors: Escherichia coli BL21(DE3) was purchased from Beijing Qingke Biotechnology Co., Ltd.; pET-28a(+) expression vector was obtained from Jiangsu Suzhou Hongxun Biotechnology Co., Ltd.
[0030] (2) Enzymes and other biochemical reagents: p-nitrophenyl-β-D-glucopyranoside (pNPG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; QuickMutation TM The gene site-directed mutagenesis kit was purchased from Beyotime Biotechnology Co., Ltd.; DpnI digestive enzyme was purchased from Beyotime Biotechnology Co., Ltd.; gastrodin was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; the glucose assay kit was purchased from Nanjing Jiancheng Bioengineering Institute; all other reagents were of analytical grade.
[0031] (3) LB medium: Accurately weigh 10 g of Trypone, 5 g of Yeast extract, and 10 g of NaCl and dissolve them in 1000 mL of distilled water, with a natural pH (approximately 7.0). For solid medium, add 2.0% (w / v) agar powder.
[0032] Example 1: Preparation of mutant E146G and construction and transformation of expression vector 1) The modified wild-type β-glucosidase BglPcC1 targeted in this invention was previously mined from human fecal metagenomics in the laboratory (see patent application number 202310198967.4). The amino acid sequence of BglPcC1 is shown in SEQ ID NO.3, and its encoding gene... bglPcC1 As shown in SEQ ID NO.4. The coding gene is removed while retaining the start codon. bglPcC1 The sequence encoding the signal peptide (IKQLLVSSCVLFSATFVVQA (SEQ ID NO.10)) and the stop codon (expressed termination-dependent vector sequence) was commissioned to Suzhou Hongxun Biotechnology Co., Ltd. for analysis. bglPcC1 The sequence encoding the mature peptide was optimized by modifying the codons and GC content to obtain the desired sequence. bglPcC1-opt As shown in SEQ ID NO.5. Meanwhile, to reduce the potential impact of the sequence in the expression vector pET-28a(+) on the activity of β-glucosidase BglPcC1, the vector was appropriately modified. The modification of the vector pET-28a(+) was completed by Jiangsu Suzhou Hongxun Biotechnology Co., Ltd., by mutating the sequence TATACCATGGGC (SEQ ID NO.11) containing the NcoI site in pET-28a(+) to the sequence TATAAAGCTTCG (SEQ ID NO.12) containing the HindIII site.
[0033] The amino acid sequence of wild-type β-glucosidase BglPcC1 (SEQ ID NO.3): MIKQLLVSSCVLFSATFVVQAQNPKLGVSPIQDVINAMTLDEKIQLVVGSSGKYESQMEATIGNQGQLVQGAAGQVNGIERLGIPATVVADGPAGLRIDPKRKNTDKTFYCTHFPVATVMSSTWNKDLVYSVGTSMGDEVKHYGVDVLLAPATNIMRNPLCGRNFEYYSEDPLLAGTICAAMVNGIESNDVGTSLKHFALNNQETNRTRNNVIGNPRTFREIYLKPFEIVIKEAQPWTVMTSYNLINGTMSSERCDLITEILRHEWGFKGMVMTDWFGGISAAAQMEAGNDLLMPGKADQVKEIRKAVLNGRLSMEILDRNVRHILEYIMQTPRFKQYVADNNPDLKGHALVARNAATEGMVLLKNNKNVLPLVQKIKNIALFGNTSYDFIAGGTGSGNVNHAYVVSLLDGLKNAGYQVDGDIQKSYIEYAPKAKANLPKPKNPLEAFLPGHFIPEMSLAELNMSAAVKNNDLAIITIGKSSGEFLDRKISDSFNLTKEEKDMISGVCNAFHKAGKKVVVILNVCGVIETKSWIGGPDAVLLSWLPGQEGGNCVADILTGKENPSGRLPMTWPVSYNDVPSKADFPNPETVKVDDVLGMFMGKGIGSKGDVKNVDYTEYNDGVYVGYRYYQTKNVPVSFPFGYGMSYTTFKYGKPVVTKDAQGNIKVLVTVKNAGKVAGKEVVQVYVAAPGKDMDKPAKELRGFAKTKKLQPGESETVTIDIPYKNLASFNEVDSQWQVEAGNYKVMVAKNAADLKPLTTVITEEAGVTEKVRPCLLKEVK。
[0034] Nucleotide sequence encoding wild-type β-glucosidase BglPcC1 (SEQ ID NO.4):
[0035] Optimized sequence bglPcC1-opt (SEQ ID NO.5):
[0036] 2) In bglPcC1-opt Sequences containing HindIII restriction sites (5'AAGCTTCG 3') and XhoI restriction sites (5'CTCGAG 3') were introduced into the 5' and 3' ends, respectively, to obtain the sequence. nxbglPcC1-opt Its nucleotide sequence is shown in SEQ ID NO.6, and it was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. The synthesized gene and the modified expression vector pET-28a(+) were digested with HindIII and XhoI restriction enzymes to... nxbglPcC1-opt The enzyme digestion product of the modified pET-28a(+) was ligated with a ligase to obtain the product carrying the enzyme digestion product. nxbglPcC1-opt recombinant plasmid nxbglPcC1-opt- p ET-28a(+).
[0037] sequence nxbglPcC1-opt (SEQ ID NO.6):
[0038] 3) Recombinant plasmid nxbglPcC1-opt-p ET-28a(+) was transformed into E. coli BL21(DE3) via conventional heat shock to obtain cells capable of expressing... nxbglPcC1-opt E. coli strain BL21(DE3) / nxbglPcC1- opt This bacterium can express the recombinant wild-type enzyme BglPcC1, whose amino acid sequence is shown in SEQ ID NO.7 (the 6×His tag at the C-terminus of this sequence is expressed by the corresponding coding sequence on the vector).
[0039] Recombinant wild-type enzyme BglPcC1 (SEQ ID NO.7): .
[0040] 4) The recombinant plasmid obtained above nxbglPcC1-opt-p ET-28a(+) strain BL21(DE3) / nxbglPcC1-opt The plasmid was inoculated at a concentration of 0.1% into LB medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C and 180 rpm. Plasmids were then extracted using a plasmid mini-prep kit. nxbglPcC1-opt -pET-28a(+).
[0041] 5) Using recombinant expression plasmids nxbglPcC1-opt -p Using ET-28a(+) as a template, mutant primers were designed using the Novizan online primer design website (https: / / crm.vazyme.com / cetool / singlepoint.html). The specific sequences are shown below. The designed primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0042] Forward primer F (SEQ ID NO.8): GCAACTTTGGATATTATAGCGAA; Reverse primer R (SEQ ID NO.9): TATCCAAAGTTGCGACCACA.
[0043] Using QuickMutation TM Mutation was performed using a site-directed mutagenesis kit. The PCR reaction parameters were: 95°C pre-denaturation for 3 min; followed by 95°C denaturation for 30 sec, 60°C annealing for 30 sec, and 68°C extension for 8 min, repeated 20 times; 68°C extension completion for 15 min; and finally, cooling at 4°C for 30 min. PCR amplification yielded [the desired result]. e146g Recombinant plasmids of sequences e146g -pET-28a(+), this plasmid can express the mutant E146G in the host bacteria.
[0044] 6) Digest the PCR product with DpnI enzyme at 37 °C for 3 h to remove the template DNA that has not undergone mutation.
[0045] 7) Transformation and Identification: The digestion products were transformed into E. coli BL21(DE3) competent cells using a heat shock transformation method to obtain cells carrying the digestion products. e146g Recombinant strain BL21(DE3) encoding the gene e146g Subsequently, sequencing was performed by Kunming Sangon Biotech Co., Ltd., and the sequencing results confirmed that the nucleotide sequence of the mutant E146G is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.1. Compared with the amino acid sequence of the recombinant wild-type enzyme (SEQ ID NO.7), the mutant E146G has a glutamic acid mutation at position 146, which is glycine, that is, the glutamic acid at position 146 of the wild-type enzyme BglPcC1 has been mutated to glycine.
[0046] The amino acid sequence of mutant E146G (SEQ ID NO.1): MQNPKLGVSPIQDVINAMTLDEKIQLVVGSSGKYESQMEATIGNQGQLVQGAAGQVNGIERLGIPATVVADGPAGLRIDPKRKNTDKTFYCTHFPVATVMSSTWNKDLVYSVGTSMGDEVKHYGVDVLLAPATNIMRNPLCGRNFGYYSEDPLLAGTICAAMVNGIESNDVGTSLKHFALNNQETNRTRNNVIGNPRTFREIYLKPFEIVIKEAQPWTVMTSYNLINGTMSSERCDLITEILRHEWGFKGMVMTDWFGGISAAAQMEAGNDLLMPGKADQVKEIRKAVLNGRLSMEILDRNVRHILEYIMQTPRFKQYVADNNPDLKGHALVARNAATEGMVLLKNNKNVLPLVQKIKNIALFGNTSYDFIAGGTGSGNVNHAYVVSLLDGLKNAGYQVDGDIQKSYIEYAPKAKANLPKPKNPLEAFLPGHFIPEMSLAELNMSAAVKNNDLAIITIGKSSGEFLDRKISDSFNLTKEEKDMISGVCNAFHKAGKKVVVILNVCGVIETKSWIGGPDAVLLSWLPGQEGGNCVADILTGKENPSGRLPMTWPVSYNDVPSKADFPNPETVKVDDVLGMFMGKGIGSKGDVKNVDYTEYNDGVYVGYRYYQTKNVPVSFPFGYGMSYTTFKYGKPVVTKDAQGNIKVLVTVKNAGKVAGKEVVQVYVAAPGKDMDKPAKELRGFAKTKKLQPGESETVTIDIPYKNLASFNEVDSQWQVEAGNYKVMVAKNAADLKPLTTVITEEAGVTEKVRPCLLKEVKLEHHHHHH Nucleotide sequence encoding mutant E146G (SEQ ID NO.2):
[0047] Note: E146 refers to glutamic acid at position 146 of recombinant wild-type enzyme BglPcC1 (SEQ ID NO.7); E146G refers to the mutation of glutamic acid at position 146 of recombinant wild-type enzyme BglPcC1 (SEQ ID NO.7) to glycine, and the amino acid sequence after mutation is shown in SEQ ID NO.1.
[0048] Example 2 Preparation of recombinant wild-type β-glucosidase BglPcC1 and mutant E146G 1) The two recombinant bacteria obtained in Example 1 were inoculated into LB (containing a final concentration of 50 μg / mL kanamycin) culture medium at an inoculation amount of 0.1% and activated by shaking in a shaker at 37 ℃ and 180 rpm / min for 16 h.
[0049] 2) The activated bacterial culture was inoculated at a 1% inoculum into fresh LB broth (containing 50 μg / mL kanamycin sulfate) and cultured at 37 ℃ and 180 rpm for about 2-3 h until OD was reached. 600 The concentration was increased to 0.6-0.8, and then IPTG was added to a final concentration of 0.7 mM for induction. The mixture was then cultured in a shaker at 20 ℃ and 160 rpm for about 20 h to induce recombinant protein expression.
[0050] 3) After induction culture, the cells were collected by centrifugation at 4 ℃ and 6000 rpm for 8 min. The cells were then resuspended in an appropriate amount of 0.2 M McIlvaine buffer (pH=7.0) and sonicated under low-temperature water bath conditions. The homogenized cells were centrifuged at 12000 rpm for 30 min, and the supernatant was collected as the crude enzyme solution. The target protein was purified using a Nickel-NTAAgarose affinity chromatography column with an imidazole gradient elution from 0 to 500 mM.
[0051] 4) Add the protein sample obtained above to McIlvaine buffer (pH=7.0) at a volume ratio of 1:100 for dialysis. Cut the dialysis bag (mw: 14000) into appropriate length segments, boil in boiling water for 30 min, and then thoroughly wash with double-distilled water. Place the purified recombinant wild-type enzyme BglPcC1 and mutant E146G obtained in 3) into the dialysis bags respectively, leaving a certain length at both ends of the dialysis bag and sealing them with dialysis clips. Place the dialysis sample in the dialysis buffer and dialyze at 4 ℃. Change the dialysis buffer every 2 hours for a total of 3 times.
[0052] Example 3: Determination of the properties of recombinant wild-type enzyme BglPcC1 and mutant E146G The enzyme activity was determined using the pNP method, employing p-nitrophenyl-β-D-glucopyranoside (pNPG) as the substrate to measure the activities of recombinant wild-type enzymes BglPcC1 and the mutant E146G. First, a 5 mM pNPG solution was prepared and adjusted to the desired pH using buffer. The reaction system consisted of 10 μL of enzyme solution and 290 μL of substrate-containing buffer. The substrate was preheated at the reaction temperature for 5 min, followed by the addition of the enzyme solution and a further 10 min of reaction. The reaction was then terminated by adding 300 μL of 1 M Na₂CO₃. After cooling to room temperature, the released pNPs were measured at 410 nm.
[0053] One enzyme activity unit (U) is defined as the amount of enzyme required to break down a substrate to produce 1 μmol of pNP per minute.
[0054] Methods for determining specific enzyme activity: The formulas for calculating enzyme activity (A) and specific enzyme activity (B) are as follows: A(U / mL)=c×N / (t×V); B (U / mg) = A / C; In the formula: c is the amount of p-nitrophenol after the enzyme reaction (μmol) calculated from the standard equation for p-nitrophenol; N is the enzyme dilution factor; t is the reaction time between the enzyme and the substrate (min); V is the volume of enzyme solution involved in the reaction (mL); C is the protein mass concentration (mg / mL, measured using the YARN BCA protein quantification kit).
[0055] 1) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaCl 0.1–3.0 M NaCl was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.1–3.0 M) of NaCl on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0056] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaCl are as follows: Figure 1 As shown, where, Figure 1 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 1In the figure, b represents the measurement results of mutant E146G. The results show that the specific activity of E146G mutant under no-salt conditions (0.9 U / mg) is significantly lower than that of wild type (9.9 U / mg), only 9% of the latter. However, with the increase of NaCl concentration, mutant E146G exhibits strong salt-dependent activation: at 0.1 M NaCl, its specific activity increases to 22.0 U / mg, which is 24.7 times that under no-salt conditions, and reaches 1.8 times that of wild enzyme BglPcC1 under the same conditions; when 0.5 M NaCl is added to the system, the specific activity of mutant E146G reaches a peak of 46.7 U / mg, which is 52.7 times that under no-salt conditions, and 1.8 times that of wild enzyme BglPcC1 specific activity peak (25.4 U / mg). Crucially, after adding 3M NaCl solution to the reaction system, E146G maintained a high activity of 27.1 U / mg, while the specific activity of wild-type enzyme BglPcC1 dropped to 7.3 U / mg, lower than its specific activity without salt. At this point, the specific activity of E416G was 3.7 times that of wild-type enzyme BglPcC1.
[0057] 2) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant E146G in KCl 0.1–3.0 M KCl was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.1–3.0 M) of KCl on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0058] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in KCl are as follows: Figure 2 As shown, where, Figure 2 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 2 In the figure, b represents the measurement results of mutant E146G. The results show that the specific activities of both wild-type enzyme BglPcC1 and mutant E146G increased after adding 0.1–3.0 M KCl to the reaction system, but the increase in mutant E146G was more significant. Except at KCl concentrations of 0.1 and 0.3 M, the specific activity of mutant E146G was consistently higher than that of wild-type enzyme BglPcC1 in KCl solutions of the same concentration. Wild-type enzyme BglPcC1 reached a peak specific activity of 31.0 U / mg in 0.5 M KCl, while mutant E146G reached a peak specific activity of 42.2 U / mg in 0.9 M KCl, which is 11.1 U / mg higher than that of wild-type enzyme.
[0059] 3) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaNO3 0.05–2.0 M NaNO3 was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.05–2.0 M) of NaNO3 on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0060] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaNO3 are as follows: Figure 3 As shown, where, Figure 3 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 3 In the figure, b represents the measurement results of mutant E146G. The results show that the specific activities of both wild-type enzyme BglPcC1 and mutant E146G were increased after adding 0.05–1.0 M NaNO3 to the reaction system. The former increased only to 1.1–2.6 times its activity without salt, while the latter increased to 1.9–14.7 times its activity without salt. However, the activities of both were inhibited when 1.5–2.0 M NaNO3 was added to the system.
[0061] 4) Activity assay of recombinant wild-type enzyme BglPcC1 and mutant E146G in KNO3 0.05–2.0 M KNO3 was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.05–2.0 M) of KNO3 on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0062] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in KNO3 are as follows: Figure 4 As shown, where, Figure 4 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 4 In the figure, b represents the measurement results for mutant E146G. The results show that adding 0.05–0.9 M NaNO3 to the reaction system increases the specific activity of wild-type enzyme BglPcC1 to 1.4–2.7 times that of its unsalted form, while its activity is inhibited in 1.0–2.0 M KNO3. For mutant E146G, adding 0.05–1.0 M KNO3 to the system increases its specific activity to 1.4–15 times that of its unsalted form, while its activity is similarly inhibited in 1.5–2.0 M KNO3.
[0063] 5) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaBr 0.05–2.0 M NaBr was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.05–2.0 M) of NaBr on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0064] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in NaBr are as follows: Figure 5 As shown, where, Figure 5 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 5 In the figure, b represents the measurement results of mutant E146G. The results show that adding 0.05–2.0 M NaBr solution to the system increases the specific activity of mutant E146G, especially when the final NaBr concentration is in the range of 0.05–1.0 M, where the specific activity of mutant E146G increases to 16.6–57.3 times that without salt, reaching a maximum of 50.8 U / mg in 0.3 M NaBr solution. For wild-type enzyme BglPcC1, when the system contains 0.05–1.0 M NaBr solution, the specific activity only increases to 2.2–11.5 times that without salt, also reaching a maximum of 33.8 U / mg in 0.3 M NaBr solution; when the NaBr concentration in the reaction system is 1.5–2.0 M, its activity increase is not significant or is inhibited.
[0065] 6) Activity assay of recombinant wild-type enzyme BglPcC1 and mutant E146G in KBr 0.05–2.0 M KBr was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out with pNPG as substrate under the conditions of pH 5 and 37 °C for 10 min. The effect of different concentrations (0.05–2.0 M) of KBr on the enzyme activity of purified recombinant wild-type enzyme BglPcC1 and mutant E146G was determined.
[0066] The activity assay results of recombinant wild-type enzyme BglPcC1 and mutant E146G in KBr are as follows: Figure 6 As shown, where, Figure 6 In this figure, 'a' represents the result of the assay for recombinant wild-type enzyme BglPcC1. Figure 6In the figure, b represents the measurement results of mutant E146G. The results showed that the specific activities of both wild-type enzyme BglPcC1 and mutant E146G were increased after adding 0.05–1.0 M KBr to the reaction system. The increase in the former was not significant, only reaching 1.6–2.5 times that of its unsalted state, while the specific activity of the latter increased to 6.2–38.5 times that of its unsalted state. However, when 1.5–2.0 M KBr was added to the system, the activity increases of both were not significant or were inhibited.
[0067] Example 4: Effect of NaBr on the hydrolytic activity of recombinant wild-type enzyme BglPcC1 and mutant E146G on gastrodin. The hydrolytic activity of gastrodin was detected using the glucose oxidase-peroxidase (GOD-POD) method. The specific procedure was as follows: A 2% (g / mL) gastrodin solution was prepared, with a total reaction volume of 250 μL, containing 50 μL of substrate solution, 150 μL of pH 5 buffer or salt solution, and 50 μL of enzyme solution. Two groups were set up in the reaction system: a no-salt group and a 0.3M NaBr treatment group. The reaction was carried out at pH 5 and 37 ℃ for 10 min. After terminating the reaction by boiling in a water bath for 5 min, 2.5 μL of the reaction solution was taken and glucose was quantitatively detected using a GOD-POD kit. The experiment was performed in triplicate, with an enzyme-free reaction system as a blank control to exclude non-specific degradation. Enzyme activity units were defined as the amount of enzyme required per minute to catalyze the hydrolysis of gastrodin to produce 1 μmol of glucose.
[0068] The results are as follows Figure 7 As shown, where, Figure 7 In the figure, 'a' represents the hydrolytic activity of recombinant wild-type enzyme BglPcC1 in NaBr without salt and at a final concentration of 0.3 M, in the hydrolysis of gastrodin. Figure 7 In the figure, b represents the hydrolytic activity of the mutant E146G in gastrodin without salt and in NaBr at a final concentration of 0.3 M. It can be seen that in 0.3 M NaBr, the hydrolytic activity of the mutant E146G in gastrodin is significantly increased by 16.1 times compared to the unsalted state, with a specific activity reaching 26.1 U / mg. In contrast, the hydrolytic activity of the wild-type enzyme is inhibited after salt is added, and the specific activity decreases to 18.1 U / mg.
[0069] In summary, the salt-regulated, highly active β-glucosidase mutant E146G provided by this invention exhibits a hydrolytic activity of only 0.9 U / mg for p-nitrophenyl-β-D-glucopyranoside (pNPG) without salt, but it is activated by salt solutions. In 0.1–3.0 M NaCl and KCl solutions, 0.05–0.7 M NaNO3 and KNO3 solutions, and 0.05–1.0 M NaBr and KBr solutions, the recombinant wild-type enzyme BglPcC1 shows weak activation, with pNPG hydrolytic activity increasing only to a maximum of 3.4 times that without salt. In contrast, mutant E146G shows a high degree of activation in all of these solutions, with pNPG hydrolytic activity reaching 3.7–57.3 times that without salt. The activation effects of NaCl, KCl, NaBr, and KBr are the most significant. In solutions of 0.3–3.0 M NaCl, 0.5–2.0 M KCl, 0.05–0.5 M NaBr, and 0.1–0.3 M KBr, the pNPG hydrolytic activity of E146G was significantly enhanced, ranging from 26.3 to 50.8 U / mg, which is 6.7–17.8 U / mg higher than that of the recombinant wild-type enzyme under the same conditions, and 29.7–57.3 times higher than that without added salt. Its activity significantly increased with changing salt concentration, exhibiting a clear salt dependence. At relatively high salt concentrations, such as in 1.0 M KNO3 solution, 1.5–2.0 M KBr solution, and 2.0 M NaBr, the activity of the wild-type enzyme BglPcC1 was inhibited, while the activity of the mutant E146G was still higher than that without added salt. Salt activation was also observed in the hydrolysis experiment of gastrodin. Under 0.3 M NaBr conditions, the mutant enzyme E146G exhibited a 16.1-fold increased activity in hydrolyzing gastrodin compared to its salt-free state; furthermore, this activity level exceeded the maximum specific activity of the wild-type enzyme for this natural substrate. In contrast, the recombinant wild-type enzyme showed a slight decrease in its hydrolytic activity towards gastrodin under the same conditions.
[0070] Given the significant salt-activation properties exhibited by the E146G mutant, in practical applications, the rate of enzymatic reactions can be enhanced and controlled by adjusting the concentration of the salt solution in its reaction environment. This property shows broad application prospects in food processing, agriculture and environment, medicine and biotechnology, and other fields.
[0071] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A salt-regulated, highly active β-glucosidase mutant E146G, characterized in that, The amino acid sequence of the mutant E146G is shown in SEQ ID NO.
1.
2. The gene encoding the mutant E146G of claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
3. A recombinant expression vector containing the gene as described in claim 2.
4. A recombinant strain containing the recombinant expression vector as described in claim 3.
5. The application of the mutant E146G as described in claim 1 in salt-regulated enzymatic reactions.
6. The application according to claim 5, characterized in that, The salt is at least one of NaCl, KCl, NaNO3, KNO3, NaBr, or KBr.
7. The application according to claim 6, characterized in that, The concentrations of NaCl and KCl are 0.1–3.0 M, the concentrations of NaNO3 and KNO3 are 0.05–0.7 M, and the concentrations of NaBr and KBr are 0.05–1.0 M.
8. The application of the mutant E146G as described in claim 1 in the fields of bioenergy, food processing or medicine.
9. The application of the mutant E146G according to claim 1 in the hydrolysis of β-glucosinolate substrates, characterized in that, The substrates include p-nitrophenyl-β-D-glucopyranoside or gastrodin.
10. A method for regulating an enzyme-catalyzed reaction, characterized in that, The reaction system was prepared using the mutant E146G as described in claim 1. The enzyme activity was regulated by adjusting the concentration of salt in the reaction system, wherein the salt is at least one of NaCl, KCl, NaNO3, KNO3, NaBr, or KBr.