A nucleic acid aptamer specifically recognizing procymatone and application thereof
By using Capture SELEX technology to screen for the nucleic acid aptamer PCM-A09, and combining it with magnetic materials and colloidal gold ultraviolet spectrophotometry, the problems of high cost and insufficient sensitivity in iprodione detection have been solved, achieving low-cost and highly sensitive iprodione detection.
Patent Information
- Application Number
- CN202610482202.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-13
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for detecting iprodione are costly, lack sensitivity and specificity, and require professional personnel to operate, making them difficult to meet real-time detection needs.
The Capture SELEX technique was used to screen for the nucleic acid aptamer PCM-A09, which specifically recognizes iprodione, and the aptamer was detected by colloidal gold ultraviolet spectrophotometry. Magnetic materials were used to improve the screening efficiency and detection sensitivity.
This invention provides a low-cost, highly sensitive, and highly specific method for detecting iprodione, which can rapidly and accurately detect the presence of iprodione and is suitable for the detection of fruits, vegetables, and water sources.
Smart Images

Figure CN122104716A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a nucleic acid aptamer and its application in the preparation of reagents or kits for detecting procymidone. Background Technology
[0002] Procymidone (PCM), also known as Shengdeling, is a low-toxicity fungicide. Its chemical name is N-(3,5-dichlorophenyl)-1,3-dimethylcyclopropane-1,2-dicarbonylimine. Its mechanism of action involves interfering with the synthesis of triglycerides in pathogen cells, thereby blocking cell membrane formation and inhibiting mycelial growth, ultimately suppressing or killing the pathogen. Due to its low cost and high fungicidal efficiency, it is widely used globally. However, in recent years, it has been found that procymidone has a high detection rate in fruits and vegetables, and it frequently ranks first in food pesticide residue and risk assessment reports. Although procymidone is classified as a low-toxicity pesticide, its half-life in soil is as long as 14.2 days, and its elimination rate only reaches over 90% after 42 days. Furthermore, at certain exposure concentrations, procymidone is irritating to the eyes and skin, and poses risks of endocrine disruption and developmental toxicity. Therefore, the monitoring of iprodione has become an environmental science problem faced by all countries, and the detection and regulation of iprodione use are urgently needed.
[0003] Currently, PCM detection methods include: (1) High-performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry (GC-MS), which are mainly instrumental analysis methods. These methods have certain sensitivity and specificity, but they are limited in real-time detection due to the limitations of large instruments, and require professional personnel to operate, resulting in high usage costs. The sample matrix has a significant impact on the detection results, limiting their use in real life; (2) Biochemical methods, mainly including enzyme-linked immunosorbent assay (ELISA), which detects iprodione based on the specific recognition of antigens and antibodies. However, due to the lack of standardized kits and high costs, the reliability of the detection results is reduced, limiting their practical use; (3) In recent years, sensors based on specific recognition elements have provided new methods for the detection of iprodione pesticides. Antibodies, as a common specific recognition element, have been widely used. However, due to the high cost of preparing recognition elements and large batch differences, their use in actual detection is still limited. Therefore, it is necessary to find a new molecular recognition element.
[0004] Nucleic acid aptamers are novel molecular recognition elements, often referred to as "chemical antibodies." They are single-stranded oligonucleotides that specifically bind to targets and are obtained through systematic evolution of ligands by exponential enrichment (SELEX). As a novel molecular recognition element, aptamers are similar to antibodies but possess advantages such as high specificity, high stability, ease of synthesis, and convenient modification, making them superior to antibodies in practical applications. Aptamers can recognize a variety of targets, including proteins, amino acids, small molecules, metal ions, and even cells and viruses. Aptamers can be linked to various functional groups, making modification convenient. Furthermore, aptamers have stable chemical structures, are not easily denatured, and can be directly synthesized chemically at a low cost.
[0005] Capture SELEX is a highly efficient technique specifically designed for screening aptamers for small molecule targets. Unlike traditional methods, it immobilizes oligonucleotide libraries on a solid support, keeping the target molecules in a free state and thus avoiding false positives caused by structural changes during immobilization. When the target and aptamer bind, the conformational change of the aptamer is released from the solid phase. Through collection, amplification, and successive enrichment, structurally stable aptamers are obtained. Capture SELEX technology is widely used in the detection of small molecules such as pesticide and veterinary drug residues, providing a powerful tool for food safety and environmental monitoring. Summary of the Invention
[0006] This invention provides a nucleic acid aptamer PCM-A09 that specifically recognizes iprodione. Its nucleotide sequence is shown in SEQ ID NO:1, and its Gibbs free energy is DG=-16.14. It can specifically bind to iprodione (PCM). This invention provides an aptamer that can be used for PCM detection, is low in cost, and has good stability, making it possible to detect PCM using biosensor detection methods, greatly improving the sensitivity and accuracy of PCM detection, and reducing detection costs.
[0007] Another object of the present invention is to apply the above-mentioned aptamer in the preparation of reagents or kits for detecting iprodione.
[0008] This invention is achieved through the following technical solution: 1. Use the Capture SELEX method with a fixed library to screen for nucleic acid aptamers that can specifically bind to iprodione; 2. The secondary structure of the single-stranded aptamer PCM-A09 bound to iprodione was predicted using the website (https: / / www.unafold.org / mfold / applications / dna-folding-form.php); the prediction results showed that it has a prominent stem-loop structure and a Gibbs free energy DG=-16.14. 3. The affinity, specificity, and sensitivity of the aptamer to iprodione were detected by colloidal gold ultraviolet spectrophotometry. The results showed that the dissociation constant of PCM-A09 was Kd=36.50±6.39nm / L, and it could specifically bind to iprodione. The lowest detectable concentration of iprodione was 0.425ng / mL.
[0009] The present invention has the following advantages: 1. The nucleic acid aptamers of the present invention can be screened in vitro, with a short screening cycle, convenient synthesis, easy labeling and modification, low price, and long-term storage and use; 2. This invention fills the gap in the lack of aptamers for the detection of iprodione. The provided aptamer can specifically bind to iprodione, and has good specificity, high detection sensitivity and good stability. It can be used for the detection of PCM, and thus for the prevention and control of PCM and scientific guidance on drug use. 3. The separation method using magnetic materials introduced in the screening process of this invention improves the separation efficiency of the screening process and shortens the screening cycle. By enriching the diversity of the initial library pool sequence structure through library design, aptamer sequences with good performance can be obtained. 4. This invention can convert the obtained aptamers into detection probes by fluorescent labeling, which can be used for the detection of fruits, vegetables and water sources to achieve rapid and accurate detection of PCM. Attached Figure Description
[0010] Figure 1 These are the UV absorption spectra of the library and magnetic beads before and after incubation; Figure 2 It is a summary analysis of the recovery rates of aptamer and target PCM binding in each round of screening; Figure 3 This is a schematic diagram of the predicted secondary structure of the nucleic acid aptamer PCM-A09; Figure 4 This is a transmission electron microscope (TEM) image of colloidal gold; Figure 5 The results are the affinity analysis of aptamer PCM-A09 by colloidal gold spectrophotometry. Figure 6 This is the result of specific analysis of aptamer PCM-A09 by colloidal gold spectrophotometry; Figure 7This is the result of sensitivity analysis of the nucleic acid aptamer PCM-A09 by colloidal gold spectrophotometry. Detailed Implementation
[0011] The following description, in conjunction with the accompanying drawings and embodiments, further illustrates the substantive content of the present invention. The embodiments are only for better understanding of the present invention and are not limited to the scope of the present invention. Unless otherwise specified, the methods used in the implementation are conventional methods, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods.
[0012] Example 1: Screening of nucleic acid aptamer PCM-A09 1. A random ssDNA library of 5'-ACCGACCGTGCTGGACTCT-N10-GTGCACCATGGCTAG-N25-AGTATGAGCGAGCGTTGCG-3' and a capture sequence 5'-CTAGCCATGGTGCAC-(CH2)6-bio-3' of 88 nt length were synthesized by Shanghai Sangon Biotech Co., Ltd. 2. All libraries used were centrifuged at 4500 rpm for 5 min before screening. Then, 1300 pmol of the synthesized ssDNA library and 2600 pmol of the capture sequence were placed in a 1.5 mL centrifuge tube, mixed, and binding buffer (pH 7.4 10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.01% Tween-20) was added to make up to 200 μL. The mixture was denatured at 95 °C for 10 min, and then incubated at a cooling rate of 60 °C for 5 min, 25 °C for 30 min, and 0.1 °C / s. 3. Take 250 μL of 10 mg / mL Streptavidin Magnetic Beads purchased from MCE, wash 5 times with 1 mL binding buffer, remove the waste liquid after washing using a magnetic rack, and quickly add the mixture from step 2 to the magnetic beads and mix thoroughly. Incubate at 30℃ and 180 r / min for 2 h, remove the supernatant by magnetic separation, and wash the magnetic beads several times with binding buffer to remove unfixed sequences on the surface of the magnetic beads. The fixation of the library and magnetic beads depends on the interaction between the biotin modified on the capture sequence and the streptavidin coated on the surface of the magnetic beads. The fixation is determined by measuring A in the supernatant. 260 The UV absorbance was used to determine the fixation status of the library. The nucleic acid concentration in the supernatant decreased significantly before and after incubation, indicating that a large number of nucleic acid sequences were fixed on the magnetic beads. Figure 1 As shown.
[0013] 4. Add PCM to the magnetic beads after the library is fixed in step 3, so that the final concentration of PCM is 200 µmol / L and the total volume is 200 μL. Incubate the mixture at 25 °C and 180 r / min for 2 h. The library bound to the target PCM will undergo a conformational change and fall off the magnetic beads. Obtain the supernatant after magnetic separation. 5. The supernatant collected in step 4 (ssDNA with affinity for PCM) was used as a PCR amplification template. PCR amplification was performed using the upstream primer F: 5'-FAM-ACCGACCGTGCTGGACTCT-3' and the downstream primer R: 5'-Biotin-CGCAACGCTCGCTCATACT-3'. The reaction mixture consisted of 2 µL of 10 mol / L forward primer, 2 µL of 10 mol / L reverse primer, 5 µL of 10×PCR Buffer, 2 µL of 25 mM MgSO4, 5 µL of 2 mM dNTPs, 1 µL of KOD-Plus-Neo, and 29 µL of ddH2O. The mixture was thoroughly mixed. The amplification conditions were: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 68℃ annealing for 30 s, and 68℃ annealing for 1 min, for a total of 20 cycles. An extension at 68℃ for 7 min was performed, followed by cooling at 4℃. PCR products were separated and identified by 3% agarose gel electrophoresis and verified under a gel imaging system to ensure that the PCR amplification reaction proceeded normally and no nonspecific amplification occurred.
[0014] 6. Incubate the PCR product and binding buffer at a ratio of 20 μL Streptavidin Magnetic Beads to 60 μL Streptavidin Magnetic Beads. Before incubation, wash the magnetic beads three times with 500 μL binding buffer. Then mix the mixture and incubate at 37°C and 180 rpm for 2 hours. After magnetic separation, discard the supernatant and wash the magnetic beads three times with 200 μL binding buffer to remove unfixed PCR product and reaction residue. Then add 20 μL 0.2 mol / L NaOH for alkaline lysis, incubate at 37°C for 30 minutes, and add 10 μL 0.2 mol / L HCl for neutralization. After magnetic separation, collect the supernatant as the single-stranded protein obtained for screening. Use the obtained single-stranded protein as a secondary library for the next round of screening, and repeat the above steps.
[0015] 7. Loop Filtering Screening was conducted in rounds 2-10 according to the screening conditions shown in Table 1. During the cyclic screening process, the target concentration, library concentration, forward screening time, and reverse screening material were reduced to provide screening pressure, which gradually increased. Before adding the target iprodione for incubation in rounds 7, 8, and 9, reverse screening materials (iprodione, dimethomorph) were added and incubated with aptamers. After the supernatant of the aptamer sequence bound to the reverse screening material was removed, the sequences remaining on the magnetic beads that did not bind to the reverse screening material continued to be incubated with PCM for enrichment. Because the upstream primers contained FAM groups, during the repeated screening process of rounds 2-10, the elution fluorescence values after binding of the secondary library and target were read using a multi-functional microplate reader when step 3 was repeated. The ssDNA enrichment rate for each round was calculated as: Fb / (Ff-Fi)×100%, where Ff is the initial fluorescence intensity value before library fixation in each round, Fi is the fluorescence intensity value of the supernatant after library fixation in step 3, and Fb is the fluorescence intensity value of the target elution supernatant in step 4. The results are shown in […]. Figure 2 As can be seen from the figure, with the increase of the number of screening rounds, the elution rate of ssDNA that specifically binds to iprodione increases. With the change of screening pressure, the enrichment rate first decreases and then increases, and finally stabilizes. Table 1 Aptamer Screening Criteria
[0016] 8. High-throughput sequencing The supernatant obtained from the 10th round of screening was used as a template for PCR. PCR amplification was performed using the forward primer F: 5'-ACCGACCGTGCTGGACTCT-3' and the reverse primer R: 5'-CGCAACGCTCGCTCATACT-3'. The reaction mixture consisted of 2 µL of 10 mol / L forward primer, 2 µL of 10 mol / L reverse primer, 5 µL of 10×PCR buffer, 2 µL of 25 mM MgSO4, 5 µL of 2 mM dNTPs, 1 µL of KOD-Plus-Neo, and 29 µL of ddH2O, mixed thoroughly. Amplification conditions included 20 cycles of pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 10 s, annealing at 68℃ for 30 s, and annealing at 68℃ for 1 min, followed by extension at 68℃ for 7 min, and finally cooling at 4℃. The PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for high-throughput sequencing to obtain the sequence information.
[0017] 9. Analysis of aptamer sequences The website (https: / / www.unafold.org / mfold / applications / dna-folding-form.php) was used to perform preliminary predictions of the secondary structure of the obtained sequences, with the temperature set at 25℃ and Na...+ and Mg 2+ The concentrations were 100 mM and 2 mM, respectively, with other parameters set to default values, resulting in the nucleic acid aptamer PCM-A09 with a low Gibbs free energy. The results are shown in [see attached table]. Figure 3 Gibbs free energy DG = -16.14.
[0018] The nucleic acid sequence of the aptamer PCM-A09 that specifically binds to PCM is: ACCGACCGTGCTGGACTCTAGCGGGCACGGTGCACTATGGCTAGCCGAGTACGAGTCATACGCGCGGCTCGCAACGCTCGCTCATACT, 88 bases, ssDNA.
[0019] Example 2: Affinity and Specificity Analysis of Nucleic Acid Aptamer PCM-A09 1. Characterization of affinity and specificity of nucleic acid aptamer PCM-A09 Colloidal gold aggregates in high-salt environments, causing a red shift in its wavelength and a rightward shift of its characteristic peak. The affinity of nucleic acid aptamers is determined by spectrophotometry at specific wavelengths of colloidal gold solutions.
[0020] A. Preparation of 25nm colloidal gold (1) Before use, the conical flask and magnetic rotor should be soaked in aqua regia (the volume ratio of hydrochloric acid to nitric acid is 3:1) and washed and dried. (2) Under light-protected conditions, 50% chloroauric acid was diluted 22.5 times to obtain an aqueous solution of chloroauric acid; (3) To prepare 1% sodium citrate, weigh 0.1g of sodium citrate and add it to 10mL of ultrapure water; (4) Take 98 mL of purified water, and filter the purified water, sodium citrate and chloroauric acid solution through a 0.45 µm aqueous filter membrane; (5) Add the purified water and 1 mL of chloroauric acid aqueous solution from step (4) into the conical flask, mix well, and then use an electric heating mantle to adjust the temperature to 80°C and heat to boiling. During this process, use a rotor to perform magnetic stirring. (6) When a large number of water droplets appear on the bottle wall and flow down in streams, adjust the temperature to 100°C, heat it to a complete boil, and after a large number of bubbles are generated, add 1700µL of the chloroauric acid aqueous solution in step (4); (7) Adjust the temperature to 0℃. The solution changes from colorless to gray, and finally from purplish-red to bright red. After the color stabilizes, adjust the heating mantle temperature to 70℃ and heat for 10 minutes. (8) After cooling to room temperature, transfer to 4°C for storage, and characterize the colloidal gold using transmission electron microscopy, such as... Figure 4 .
[0021] B. Affinity characterization of aptamer PCM-A09 (1) Concentrate the colloidal gold obtained in step A by 4 times, centrifuge 1 mL of colloidal gold at 4℃ and 800 rpm for 15 min, remove 750 µL of supernatant, and mix the remaining liquid by pipetting. (2) The aptamer PCM-A09 was diluted with ultrapure water to 25, 50, 100, 200, 300, 400 and 500 nmol / L, and 2.65 µL of 500 µmol / L PCM standard solution was added. After mixing, the mixture was incubated at room temperature for 30 min. At the same time, a blank control was set up with only ultrapure water and 2.65 µL of 500 µmol / L PCM standard solution without aptamer. Each experiment was repeated in triplicate. (3) Add 75µL of the colloidal gold obtained in step (1) to the mixture after the reaction in step (2). The total volume of the reaction system is 150µL. After mixing, place it at room temperature for 30min. (4) In step (3), add NaCl solution with a final concentration of 45 mmol / L, mix well, and stabilize for 10 min. Then, measure the absorbance of the solution at 520 nm. Calculate (A'-A0) / A0, where A' is the absorbance of the experimental group at 520 nm and A0 is the absorbance of the blank group at 520 nm. Plot the nucleic acid aptamer concentration on the x-axis and (A'-A0) / A0 on the y-axis. Use GraphPadPrism8 software to analyze and calculate the affinity constant Kd. The results show that the Kd of nucleic acid aptamer PCM-A09 is 36.50±6.39 nmol / L. See Figure 5 .
[0022] C. Specific characterization of aptamer PCM-A09 (1) Dilute iprodione to 2.5 µg / mL with ultrapure water. Using non-specific targets as controls, the final concentrations of pentachloronitrobenzene, dimethomorph, vinclozolin, and iprodione were all 2.5 µg / mL. (2) Dilute the aptamer to 10 µmol / L, add 3 µL to each tube, and incubate at room temperature for 30 min; (3) Add 4 times the concentration of colloidal gold to each tube, mix well and incubate at room temperature for 30 min; (4) Add NaCl solution to step (3) to a final concentration of 45 mmol / L, mix well, stabilize for 10 min, and then measure A using an ELISA reader. 520 and A 620 A' is experimental group A 620 With A 520 The ratio, A0 is the ratio of the blank group without the target. 620 With A 520The ratio is calculated as (A'-A0) / A0, and the result is shown in [the table]. Figure 6 As can be seen from the figure, the aptamer PCM-A09 specifically binds to iprodione.
[0023] Example 3: Sensitivity detection of nucleic acid aptamer PCM-A09 (1) Add 7.5 µL of 1 µmol / L nucleic acid aptamer PCM-A09 to a 200 µL centrifuge tube, heat at 95 °C for 5 min, and incubate on ice for 5 min. Add procymidone at final concentrations of 10 ng / mL, 25 ng / mL, 50 ng / mL, 100 ng / mL, 300 ng / mL, 1000 ng / mL, and 2000 ng / mL, respectively, and incubate at 37 °C for 30 min. Then add 75 µL of colloidal gold solution that has been concentrated 4 times, and incubate at room temperature for 30 min. Add NaCl solution with a final concentration of 45 mmol / L, mix well, and stabilize for 10 min. Observe the color change and measure the absorbance value A using an ELISA reader. 520 and A 620 Calculate A' / A0=A 620 / A 520 .
[0024] (2) Plot a standard curve with the logarithm of the target PCM concentration on the x-axis and A' / A0 on the y-axis, as shown in the figure. Figure 7 As shown, within the concentration range of 10-2000 ng / mL, a good linear relationship was observed with PCM concentration (R0). 2 =0.9759), the linear equation is Y=0.2159X+0.3443, and the lowest detectable concentration of PCM is 0.425ng / mL.
[0025] The aptamer PCM-A09 was successfully screened using the SELEX technique and showed good affinity and specificity. This aptamer has good sensitivity and can be used for subsequent applications.
[0026] Finally, it should be noted that the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A nucleic acid aptamer PCM-A09 that specifically recognizes iprodione, the nucleotide sequence of which is shown in SEQ ID NO:
1.
2. The use of the nucleic acid aptamer PCM-A09 according to claim 1 in the preparation of reagents or kits for detecting iprodione.