A highly efficient serine protease for degrading α-keratin, its degradation method and application

Abstract

This invention discloses a highly efficient serine protease for degrading α-keratin, its degradation method, and its applications. The serine protease is named PliKerS, and its full-length amino acid sequence is shown in SEQ ID No. 2, with the corresponding coding gene sequence shown in SEQ ID No. 1. The amino acid sequence of the recombinant serine protease rPliKerS, which has its N-terminal signal peptide removed and a purification tag attached to its C-terminus, is shown in SEQ ID No. 4, with the corresponding coding gene sequence shown in SEQ ID No. 3. The recombinant serine protease rPliKerS degrades α-keratin under mild conditions, avoiding the environmental burden of strong alkaline treatment. It is particularly suitable for applications involving pet hair, hair waste, and leather pretreatment. The degradation products are soluble proteins and peptides, which can be used as high-value-added amino acid raw materials, functional peptide raw materials, biodegradable materials, bio-based material precursors, bio-feed proteins, fertilizers, etc., exhibiting high resource utilization value and promising industrial application prospects.

Description

Technical Field

[0001] This invention belongs to the field of industrial biotechnology and biological resource recycling technology, specifically relating to a highly efficient serine protease for degrading α-keratin, its degradation method, and its application. Background Technology

[0002] Alpha-keratin is widely found in mammalian hair, wool, pet fur, and scraps generated during the processing of fur products. Its secondary structure is mainly composed of α-helices, and its internal structure is rich in disulfide bonds and hydrophobic interactions, forming a highly stable and insoluble protein network structure. Due to the high density of this structure, conventional proteases are unable to effectively hydrolyze α-keratin.

[0003] Currently, the main methods for treating hair keratin waste include incineration, landfill, and treatment with strong alkalis or oxidants. However, these methods generally suffer from high energy consumption, severe environmental pollution, and significant damage to protein nutrients. In contrast, enzymatic degradation offers advantages such as mild reaction conditions, environmental friendliness, and high added value of the products. However, existing keratinases are mostly targeted at the discovery and development of β-keratin, and their degradation efficiency for α-keratin is limited, making it difficult to meet practical application needs.

[0004] Therefore, developing a serine protease capable of efficiently degrading α-keratin and its application method is of great significance for the green treatment and resource utilization of hair waste. Summary of the Invention

[0005] The purpose of this invention is to provide a highly efficient serine protease derived from *Purpureocillium lilacinum* GZAC18-2JMP that degrades α-keratin (dog hair), along with its degradation method and application, to achieve efficient and bio-friendly conversion and utilization of hair-related α-keratin waste.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A highly efficient serine protease for degrading α-keratin, PliKerS, has its full-length amino acid sequence as shown in SEQ ID No. 2. The amino acid sequence of the recombinant serine protease rPliKerS, which has had its soluble expression portion removed from the N-terminal signal peptide and has a purification tag at the C-terminus, is shown in SEQ ID No. 4.

[0008] A gene encoding the above-mentioned highly efficient serine protease PliKerS that degrades α-keratin has a full-length nucleotide sequence as shown in SEQ ID No. 1.

[0009] A gene encoding the recombinant serine protease rPliKerS, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0010] A mutant protease, which is any one of the following:

[0011] (a) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the serine protease PliKerS, having at least 90% sequence identity with the sequence shown in SEQ ID No. 2, and having the activity of the serine protease PliKerS.

[0012] (b) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the recombinant serine protease rPliKerS, having at least 90% sequence identity with the sequence shown in SEQ ID No. 4, and having recombinant serine protease rPliKerS activity.

[0013] An expression vector containing a nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No. 3. Preferably, the expression vector is a pPIC series expression vector.

[0014] A recombinant engineered bacterial strain, wherein the recombinant engineered bacterial strain is *Pichia pastoris* containing the expression vector. Preferably, the genetically engineered recombinant bacterial strain is *Pichia pastoris* GS115.

[0015] A method for constructing a recombinant Pichia pastoris engineered strain involves linking a gene with the sequence shown in SEQ ID No. 1 or SEQ ID No. 3 to an expression vector, linearizing it with SacI, and then electroporating it into Pichia pastoris cells.

[0016] An enzyme preparation comprising the serine protease PliKerS or the recombinant serine protease rPliKerS, wherein the enzyme preparation is enzyme powder or enzyme solution.

[0017] A method for producing serine protease, wherein the recombinant Pichia pastoris engineered strain is inoculated into a culture medium for culture, and the serine protease is collected after methanol-induced secretion expression.

[0018] A method for producing serine protease, wherein the method involves collecting the supernatant from cell culture medium induced to express serine protease in BMMY medium to obtain a crude enzyme solution of serine protease, which is then concentrated and purified by nickel column chromatography to obtain a purified recombinant serine protease rPliKerS enzyme solution.

[0019] A method for preparing a recombinant protein of a serine protease that efficiently degrades α-keratin includes the following steps:

[0020] (1) Based on the mass spectrometry identification results of the secretory keratinase of α-keratin-induced Purpureocillium lilacinum GZAC18-2JMP, combined with genome sequencing analysis, the amino acid sequence and coding gene sequence of the keratinase were confirmed. It belongs to the serine protease family and is named PliKerS. The amino acid sequence is shown in SEQ ID No. 2 and the coding gene sequence is shown in SEQ ID No. 1.

[0021] (2) A Pichia pastoris eukaryotic expression vector containing a recombinant serine protease with the N-terminal signal peptide removed and a purification tag at the C-terminus was constructed to express the recombinant serine protease rPliKerS. The recombinant serine protease rPliKerS protein, which can efficiently degrade α-keratin, was isolated and purified. The amino acid sequence of the recombinant serine protease rPliKerS is shown in SEQ ID No. 4, and the coding gene sequence of the recombinant serine protease rPliKerS is shown in SEQ ID No. 3.

[0022] This invention also provides the application of the aforementioned serine protease PliKerS or recombinant serine protease rPliKerS or the aforementioned enzyme preparation in the degradation of α-keratin. The application includes the degradation of α-keratin in dog hair. The aforementioned serine protease PliKerS or recombinant serine protease rPliKerS efficiently degrades α-keratin under the following conditions: glycine-sodium hydroxide buffer (pH 8.0), a reducing agent DTT concentration of 35 mM, a temperature of 45°C, and a rotation speed of 200 rpm.

[0023] The beneficial effects of this invention are as follows: The serine protease provided by this invention can efficiently degrade α-keratin under neutral or weakly alkaline conditions, avoiding the environmental burden caused by strong alkaline treatment. It is particularly suitable for applications such as pet hair, hair waste, and leather pretreatment. The reaction conditions are mild, requiring no high temperature, high pressure, or complex pretreatment, and it is compatible with existing biological treatment processes. The degradation rate of dog hair reaches 92.67% within 15 hours. The degradation products are soluble proteins and peptides, which can be used as high-value-added amino acid raw materials, functional peptide raw materials, biodegradable materials, precursors for bio-based materials, biological feed proteins, fertilizers, etc., and have high resource utilization value and promising industrial application prospects. Attached Figure Description

[0024] Figure 1 This describes the activity of crude enzyme solution expressed by the recombinant serine protease rPliKerS Pichia pastoris engineered strain in degrading α-keratin in the presence or absence of DTT.

[0025] Figure 2The pH of the degradation reaction system for α-keratin was optimized using the recombinant serine protease rPliKerS.

[0026] Figure 3 The final DTT concentration of the degradation reaction system for α-keratin degradation by recombinant serine protease rPliKerS was optimized.

[0027] Figure 4 The degradation temperature of the degradation reaction system for α-keratin degradation by recombinant serine protease rPliKerS is optimized.

[0028] Figure 5 The oscillation rate of the degradation reaction system for α-keratin by recombinant serine protease rPliKerS was optimized.

[0029] Figure 6 The degradation time of the degradation reaction system for α-keratin degradation by recombinant serine protease rPliKerS is optimized.

[0030] Figure 7 The images show scanning electron microscopy analysis of dog hair morphology after degradation by recombinant serine protease rPliKerS; A and B: control group of dog hair without degradation treatment; C and D: experimental group of dog hair after degradation by Purpureocillium lilacinum GZAC18-2JMP; E and F: experimental group of dog hair after degradation by recombinant serine protease rPliKerS. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The following embodiments are implemented based on the technical solution of the present invention, providing detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments, and the embodiments do not limit the present invention in any way.

[0032] The reagents, methods, and equipment used in the following embodiments are conventional reagents, methods, and equipment in this technical field.

[0033] SEQ ID No. 1: Full-length nucleotide sequence of PliKerS, a serine protease derived from *Purpureocillium lilacinum* GZAC18-2JMP.

[0034] SEQ ID No. 2: Full-length amino acid sequence of PliKerS, a serine protease derived from *Purpureocillium lilacinum* GZAC18-2JMP.

[0035] SEQ ID No. 3: Nucleotide sequence of rPliKerS, a recombinant serine protease protein derived from *Purpureocillium lilacinum* GZAC18-2JMP with the N-terminal signal peptide removed and a purified tag attached to the C-terminus.

[0036] SEQ ID No. 4: Amino acid sequence of rPliKerS, a recombinant serine protease protein derived from *Purpureocillium lilacinum* GZAC18-2JMP with the N-terminal signal peptide removed and a purified tag attached to the C-terminus.

[0037] The strain GZAC18-2JMP, classified as *Purpureocillium lilacinum*, is deposited at the China General Microbiological Culture Collection Center (CGMCC) on August 27, 2020, with accession number CGMCC No. 20249. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0038] Example 1: Confirmation and Acquisition of the α-keratinase Gene

[0039] PDA solid medium: Boil 200 g of potatoes (peeled and diced) in water for 20-30 minutes, filter the liquid through gauze, add 20 g of glucose and 15-20 g of agar, heat until completely dissolved, add water to 1 L, and sterilize at 121°C for 20 minutes.

[0040] Basic medium for α-keratin degradation: 0.12 g NaCl, 0.05 g KH2PO3, 0.005 g ZnSO4 and 0.02 g CaCl2, add double-distilled water to a final volume of 100 mL, adjust pH to 7.0, sterilize, and then add 1 g α-keratin (dog hair).

[0041] *Purpureocillium lilacinum* GZAC18-2JMP (China General Microbiological Culture Collection Center, accession number: CGMCC No. 20249) was inoculated onto PDA solid medium and activated by static culture at 25°C for 7 days. Then, hyphae were picked and inoculated onto α-keratin degradation basal medium for liquid culture to induce α-keratinase expression. The culture was carried out at 25°C and 120 rpm with shaking for 7 days. The fermentation broth was centrifuged at 4°C and 12000 rpm for 30 min, filtered through a 0.22 μm microporous membrane, and dialyzed. Then, it was concentrated by centrifugation at 4°C and 4000 rpm using an ultrafiltration tube with a molecular weight cutoff of 3 kDa (Millipore, catalog number: UFC9003) to obtain a concentrated cell-free crude enzyme solution. Cell-free supernatant crude enzyme solution was separated on an SDS-PAGE gel. After staining and destaining, the highly expressed protein band on the SDS-PAGE gel was cleaved. Its molecular weight was approximately 40 kDa, and it was sent to Sangon Biotech (Shanghai) Co., Ltd. for mass spectrometry identification. Based on the peptide fragment identified by mass spectrometry, combined with the genome sequencing data of *Purpureocillium lilacinum* GZAC18-2JMP and comparative analysis with the theoretical molecular weight of the protein, it was confirmed that the highly expressed protein is the expression product of the subtilisin-like serine protease gene located in contig7l of the genome, belonging to the serine protease family. Its full-length amino acid sequence is SEQ ID No. 2, and the coding gene sequence is SEQ ID NO. 1, named PliKerS.

[0042] The amino acid sequence of the serine protease PliKerS was predicted using SignalP 5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ), and the first 23 amino acids were identified as the signal peptide. A recombinant protein rPliKerS (amino acid sequence SEQ ID No. 4) was constructed with the signal peptide truncated and a his6 tag purification label at the C-terminus. First, total RNA was extracted from *Purpureocillium lilacinum* GZAC18-2JMP using a fungal total RNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd., catalog number: B518629). Then, reverse transcription was performed using a reverse transcription kit (QIAGEN, catalog number: 205113) with Oligo-dT Primer and Random Primer as primers, respectively. The two cDNA products were mixed and used as a template. PCR amplification was then performed using primers rPliKerS_F and rPliKerS_R to obtain the rPliKerS gene sequence (corresponding nucleotide sequence is SEQ ID No. 3), which was then ligated into *Pichia pastoris* GS115. The recombinant plasmid pPIC9K-rPliKerS was obtained by dividing the EcoRI and NotI restriction sites of the secretory expression vector pPIC9K (Invitrogen, V17520) using GS115 (Invitrogen, catalog number: C18100). After verification by colony PCR and sequencing, it was used for secretory expression. The recombinant plasmid pPIC9K-rPliKerS was linearized using SacI restriction endonuclease (New England Biolabs, catalog number: R0156S). The linearized product was purified by 1% agarose gel electrophoresis and then recovered using a gel extraction kit (Nanjing Novozymes Biotechnology Co., Ltd., catalog number: DC301).

[0043] Primer name Primer sequence (5'-3') rPliKerS_F <![CDATA[A GAATTC AAGCGTTCCTCGCCCGCC]]> rPliKerS_R <![CDATA[ATTAATTC GCGGCCGC TCAATGGTGATGATGATGGTGTGCAACCCCATGCCGCGC]]>

[0044] Note: Underlined areas are enzyme cleavage sites.

[0045] Example 2 Heterologous expression of α-keratinase

[0046] YPD medium: yeast extract 10.0 g / L, peptone 20.0 g / L, glucose 20.0 g / L, adjust pH to 6.0-6.5, sterilize at 115℃ for 15 min.

[0047] MD medium: Sterilize 15.0 g / L agar at 121℃ for 15 min, cool to medium temperature, add filtered sterilized YNB 6.7 g / L and glucose 20.0 g / L solution adjusted to pH 5.6, mix well and pour into plates.

[0048] BMGY medium: 20.0 g / L peptone, 10.0 g / L yeast extract, 3.9 g / L K2HPO4, 11.8 g / L KH2PO4, 10 mL glycerol, adjust pH to 6.0 and bring volume to 898 mL. Sterilize at 121℃ for 15 min and cool. Add 100 mL of filtered and sterilized 13.4% YNB solution and 2 mL of 500× biotin solution.

[0049] BMMY medium: (peptone 20.0 g / L, yeast extract 10.0 g / L, sterilized at 121℃ for 15 min, cooled and then added with filtered sterilized YNB 13.4 g / L, biotin 0.4 mg / L, 1 M potassium phosphate buffer (pH 6.0) 100 mL / L, and filtered sterilized methanol solution 5 mL / L).

[0050] Preparation of Pichia pastoris GS115 electrocompetent cells: Single colonies of Pichia pastoris GS115 were picked and inoculated into 3 mL of YPD medium and cultured at 30℃ with shaking at 250 rpm until OD. 600 The concentration was 2.0, and the culture was transferred to 100 mL of YPD medium at a ratio of 1:100 and continued to culture until OD200. 600 When the pH reaches 1.2~1.5, the cells are collected by centrifugation at 4℃ and 6000 rpm for 5 min. The cells are resuspended and washed three times with 50 mL of pre-cooled sterile water, then washed once with 20 mL of pre-cooled sterile 1 M sorbitol solution, and finally resuspended with 1 mL of pre-cooled sterile 1 M sorbitol solution. The cells are then aliquoted into 80 μL / tube of Pichia pastoris GS115 electrotransfer competent cells.

[0051] Two μg of the linearized plasmid pPIC9K-rPliKerS, purified by gel extraction, was electroporated into Pichia pastoris GS115 competent cells. The electroporation parameters were: voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω, and electroporation time 5 ms. Immediately after electroporation, 1 mL of pre-chilled sterile 1 M sorbitol solution was added, and after incubation for 1 h, 200 μL was plated on MD agar plates for screening. Colony PCR identification and sequencing verification of the transformed single clones were performed using universal primers α-factor (5'-TACTATTGCCAGCATTGCTGC-3') and 3'AOX1 (5'-GCAAATGGCATTCTGACATCC-3'). Positive clones with correct sequencing were expressed in shake flasks and inoculated into 100 mL of BMGY medium and cultured until OD600. 600 When the culture temperature reaches approximately 2.0, the cells are collected by centrifugation at 6000 rpm for 15 min at 4°C. The cells are then resuspended in BMMY medium and induced for 5 days with methanol at a final concentration of 0.5% (v / v) (replenished every 24 h). After induction, the supernatant is collected by centrifugation to obtain the crude enzyme solution.

[0052] Example 3 Purification of α-keratin-degrading enzyme

[0053] The Pichia pastoris recombinant protein expression engineered strain obtained in Example 2 was cultured on a large scale and induced to express with methanol. After preliminary concentration of the fermentation supernatant through a hollow fiber membrane, the protein was enriched by ammonium sulfate fractionation (70% saturation). The precipitated protein was resuspended in Tris-HCl, pH 8.0 buffer and dialyzed. Then, affinity chromatography was performed using a nickel column (Ni-NTA resin, GE, catalog number: 17-5318-02) for purification. Gradient elution was performed using Tris-HCl, pH 8.0 buffer containing 5 mM, 150 mM, and 500 mM imidazole as elution buffers. The eluent containing the target protein was collected as the purified recombinant serine protease rPliKerS.

[0054] Example 4: Assay of the activity of recombinantly expressed α-keratin-degrading enzyme

[0055] To confirm the biological activity of the recombinant expressed serine protease, its degradation function was verified using dog hair, a natural substrate of α-keratin. Since keratin is rich in disulfide bonds and structurally stable, the reducing agent may be crucial for degradation efficiency. Two parallel reactions were set up for the degradation activity assay: a reducing environment containing 25 mM dithiothreitol (DTT, Sangon Biotech (Shanghai) Co., Ltd., catalog number: A620058) and a control system without DTT. The degradation reaction system (1 mL) of the purified recombinant serine protease rPliKerS obtained in Example 3 included: 5 mg dog hair, an appropriate amount of 0.05 M PBS pH 8.0 buffer, 25 μL 1 M DTT, and 100 μg of purified recombinant serine protease rPliKerS. The reaction system was placed in a shaker at 30°C and 150 rpm for 15 h. After the reaction, the reaction was terminated by centrifugation at 12000 rpm for 5 min, and insoluble matter was removed. The soluble protein content in the supernatant was determined using the Bradford Protein Quantitative Kit (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: PP103-03).

[0056] One unit of enzyme activity (1 U) is defined as the amount of enzyme required to increase the soluble protein by 1 μg by hydrolyzing α-keratin substrate (dog hair) for 15 h under the experimental reaction conditions.

[0057] In the formula, 100 μg and 0.1 mg are the amounts of purified recombinant serine protease rPliKerS added.

[0058] Example 5: Determination of α-keratin degradation rate

[0059] The α-keratin degradation solution was filtered through filter paper to recover undegraded α-keratin (dog hair), which was then washed with distilled water to remove as many cells as possible. The dog hair residue was dried at 55°C to constant weight.

[0060]

[0061] The recombinant serine protease rPliKerS was determined to be highly efficient and rapid in degrading the natural substrate of α-keratin—dog hair—with the assistance of DTT, and also showed some degradation activity against dog hair in the absence of DTT. Figure 1 ).

[0062] Example 6 Optimization of degradation reaction conditions for recombinantly expressed α-keratin degrading enzyme

[0063] Using natural α-keratin (dog hair) as a substrate, the activity of recombinant serine protease rPliKerS was evaluated by measuring the total content of soluble protein in the supernatant after the reaction, as in Example 4. Based on the standard reaction system (1 mL containing 5 mg dog hair, 100 μg purified recombinant serine protease rPliKerS, 25 μL 1 M DTT, PBS buffer, pH 8.0), the following parameters were optimized: pH (4-12, with citrate buffer for pH 4-6, PBS buffer for pH 6-8, Glycine-NaOH buffer for pH 8-10, Na2CO3-NaOH buffer for pH 10-11, and Na2HPO4-NaOH buffer for pH 11-12), DTT concentration (final concentrations of 15, 25, 35, 45, and 55 mM), degradation temperature (25-50℃), oscillation speed (0, 50, 100, 150, 200, 250, and 300 rpm), and degradation time (5, 10, 15, 20, and 25 h). Except for the parameters to be optimized, all other conditions were set according to the initial reaction settings (temperature 30℃, 0.05M PBS buffer, pH 8.0, final DTT concentration 25 mM, 150 rpm, reaction time 15 h); and the ability of recombinant serine protease to degrade dog hair was verified under optimal conditions, with the initial reaction serving as a control. All experiments were performed in triplicate.

[0064] Experimental results showed that the optimal pH for the degradation of α-keratin (dog hair) by recombinant serine protease rPliKerS was 8.0, with an enzyme activity of 9304.33±70.87 U / mg. Furthermore, the enzyme activity of recombinant serine protease rPliKerS remained relatively high within the pH range of 7.0-9.0. Figure 2 The optimal final concentration of the reducing agent DTT is 35 mM. Figure 3 The optimal degradation temperature is 45℃, and it maintains high degradation activity at 30-50℃, demonstrating its ability to adapt to high-temperature environments and perform degradation. However, enzyme activity decreases significantly below 30℃. Figure 4 The optimal oscillation speed is 200 rpm; enzyme activity decreases significantly below 100 rpm. Figure 5 The optimal degradation time is 15-20 h, and the relative enzyme activity hardly changes within 15-20 h. Therefore, 15 h, which offers better cost-effectiveness, was chosen as the final degradation time. Figure 6). The degradation reaction under the optimal degradation conditions (Glycine-NaOH buffer, pH 8.0, 35 mM DTT, 45 °C, 200 rpm, degradation time 15 h) was compared with the initial reaction conditions. The degradation rate of dog hair in the optimal condition group reached 92.67%, which was significantly increased by 9.34% compared with the initial control group (degradation rate of 83.33%), indicating that the recombinant serine protease rPliKerS had a high degradation activity towards dog hair substrates.

[0065] Example 7 Characterization of Dog Hair Degradation by Recombinant α-Keratinase

[0066] After the α-keratin (dog hair) residue degraded by the recombinant serine protease rPliKerS obtained in Example 6 for 15 h was rinsed several times with distilled water and dried at 60 °C for 48 h, the dog hair residue sample to be observed was glued to the sample stage with conductive glue, and gold was sprayed for about 30 s. It was tested by a field emission scanning electron microscope (Hitachi, HITACHI SU8600), the acceleration voltage was 3 kV, the working distance was 7.4 - 9.6 mm, the shooting magnification range was 1 μm - 100 μm, and the test mode was the secondary electron mode. The scanning electron microscope observation results showed that the surface of the undegraded dog hair presented a typical scaly cuticle structure, the scales were arranged in a tiled manner, the edges were clear and had certain serrated features ( Figure 7 A, 7B); while for the dog hair degraded by Purpureocillium lilacinum GZAC18-2JMP, the翘起 and shedding of the surface scale structure could be observed ( Figure 7 C), the surface of the dog hair changed from smooth to rough, and there were degradation products attached to the surface ( Figure 7 D); while for the dog hair degraded by the recombinant serine protease rPliKerS, the surface structure was significantly damaged, the scale structure was peeled off and eroded, a large number of irregular holes and grooves were formed on the surface, the cortical keratin fibers were loosely disintegrated, the medulla structure collapsed, and the hair shaft showed overall fragmentation and erosion, presenting typical characteristics of keratin degradation ( Figure 7 E); the scale structure on the surface of the dog hair was damaged, the edges were blurred,翘起 and shed, the hair surface changed from smooth to rough, showing a superficial pit and groove structure ( Figure 7 F). The scanning electron microscope observation results indicated that the recombinant serine protease rPliKerS could efficiently destroy the compact structure of α-keratin in dog hair and achieve deep degradation of dog hair.

[0067] It should be noted that although the above embodiments have been described herein, this does not limit the scope of protection of the present invention. Therefore, any changes and modifications made to the embodiments described herein based on the innovative concept of the present invention, or equivalent structural or procedural transformations made using the content of the present invention's specification and drawings, directly or indirectly applying the above technical solutions to other related technical fields, are all included within the scope of protection of the present invention.

Claims

1. A highly efficient serine protease PliKerS for degrading α-keratin, characterized in that, The amino acid sequence of the serine protease PliKerS is shown in SEQ ID No.

2.

2. The highly efficient serine protease PliKerS for degrading α-keratin according to claim 1, characterized in that, The serine protease PliKerS is derived from *Purpureocillium lilacinum* GZAC18-2JMP.

3. A recombinant serine protease rPliKerS, characterized in that, The amino acid sequence of the recombinant serine protease rPliKerS is shown in SEQ ID No.

4.

4. A gene encoding the serine protease PliKerS as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID No.

1.

5. A gene encoding the recombinant serine protease rPliKerS as described in claim 3, characterized in that, Its nucleotide sequence is shown in SEQ ID No.

3.

6. A mutant protease, characterized in that, The mutant protease is any one of the following: (a) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the serine protease PliKerS as described in claim 1, having at least 90% sequence identity with the sequence shown in SEQ ID No. 2, and having the activity of the serine protease PliKerS. (b) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the recombinant serine protease rPliKerS as described in claim 3, having at least 90% sequence identity with the sequence shown in SEQ ID No. 4, and having recombinant serine protease rPliKerS activity.

7. A recombinant engineered bacterium, characterized in that, The recombinant engineered bacteria is Pichia pastoris containing an expression vector, the expression vector containing a nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No.

3.

8. An enzyme preparation, characterized in that, It contains the serine protease PliKerS as described in claim 1 or the recombinant serine protease rPliKerS as described in claim 3.

9. The use of the serine protease PliKerS as described in claim 1, the recombinant serine protease rPliKerS as described in claim 3, or the enzyme preparation as described in claim 8 in the degradation of α-keratin.

10. A method for preparing a recombinant protein of a serine protease that efficiently degrades α-keratin, characterized in that, Includes the following steps: (1) Based on the mass spectrometry identification results of the secretory keratinase of α-keratin-induced Purpureocillium lilacinum GZAC18-2JMP, combined with genome sequencing analysis, the amino acid sequence and coding gene sequence of the keratinase were confirmed. It belongs to the serine protease family and is named PliKerS. The amino acid sequence is shown in SEQ ID No. 2 and the coding gene sequence is shown in SEQ ID No.

1. (2) A Pichia pastoris eukaryotic expression vector containing a recombinant serine protease with the N-terminal signal peptide removed and a purification tag at the C-terminus was constructed to express the recombinant serine protease rPliKerS. The recombinant serine protease rPliKerS protein, which can efficiently degrade α-keratin, was isolated and purified. The amino acid sequence of the recombinant serine protease rPliKerS is shown in SEQ ID No. 4, and the coding gene sequence of the recombinant serine protease rPliKerS is shown in SEQ ID No. 3.

Images