A method for improving the scope and efficiency of e. coli prime editing

Abstract

The application discloses a method for improving the range and efficiency of E. coli lead editing, and belongs to the technical field of bioengineering. The method comprises the following steps: constructing a RecJ enhanced repair plasmid SpPE-RecJ, constructing a counter-selection plasmid pB-MAD7-CcdB or pS-MAD7-CcdB through ccdB_L96P, constructing an editing plasmid pegRNA by using epegRNA, gRNA and sgRNA, and transforming the RecJ enhanced repair plasmid, the counter-selection plasmid and the editing plasmid into an MG1655 strain in which sbcB, exoX and xseA genes are knocked out to construct a PE-STAR system. The PE-STAR system constructed in the application not only expands the editing range in the model bacteria E. coli, but also greatly improves the editing efficiency, and the improvement can further expand the application of the lead editing in E. coli.

Description

Technical Field

[0001] This invention relates to a method for improving the scope and efficiency of Escherichia coli lead editing, belonging to the field of bioengineering technology. Background Technology

[0002] Prime editing (PE) is a versatile genome engineering strategy based on CRISPR technology that enables precise DNA insertion, deletion, and replacement without introducing double-strand breaks (DSBs) or requiring a donor template.

[0003] Since Liu Ruqian's team first developed a lead editing method in mammalian cells in 2019, lead editing has demonstrated broad gene editing capabilities and exhibits lower cytotoxicity compared to gene editing methods that rely on double-strand breaks. Compared to cytosine and adenine base editing methods, lead editing provides a wider editing window and, unlike traditional CRISPR-Cas nucleases, exhibits higher transformation efficiency and is not limited by homologous recombination templates.

[0004] However, since the development of lead editing methods, extending lead editing technology to bacteria such as *E. coli* has always been challenging. Reports indicate that genetic screening of 129 transposon mutants in *E. coli* revealed that three 3'→5' exonucleases encoded by the *sbcB*, *exoX*, and *xseA* genes strongly inhibited lead editing. By using gene knockout or CRISPRi-based inhibition of these genes, BacPE was developed, increasing single-base editing efficiency to 50%-60%. However, its editing range remains limited, confined to small (≤4 bp) substitutions or insertions, and editing efficiency decreases sharply with increasing edit length.

[0005] Therefore, how to achieve efficient, DNA double-strand break-free lead editing and perform long-fragment insertion, deletion, and replacement in E. coli remains an unsolved problem. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method for improving the scope and efficiency of Escherichia coli lead editing.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A method for improving the scope and efficiency of E. coli lead editing, characterized by comprising the following steps: (1) Construction of RecJ enhancement repair plasmid SpPE-RecJ: The RecJ gene was amplified from the Escherichia coli genome and cloned into the SpPE plasmid to construct the RecJ enhancement repair plasmid SpPE-RecJ; (2) Constructing reverse selection plasmids pB-MAD7-CcdB or pS-MAD7-CcdB: The mutant ccdB_L96P of the reverse selection marker gene ccdB was amplified by PCR, and then ccdB_L96P and arabinose-inducible MAD7 were assembled into pBR322 or pSC101 vectors to construct reverse selection plasmids pB-MAD7-CcdB or pS-MAD7-CcdB; (3) Construction of editing plasmid pegRNA: epegRNA, gRNA and sgRNA were assembled into the pUC19 vector to construct the editing plasmid pegRNA; (4) Constructing the PE-STAR system: (i) The RecJ enhancement repair plasmid SpPE-RecJ and the reverse selection plasmid pB-MAD7-CcdB or pS-MAD7-CcdB were co-transformed into the MG1655 strain whose sbcB, exoX, and xseA genes were knocked out. The strain was then cultured overnight, and competent cells were prepared. The newly inoculated cultures were cultured to OD. 600 Reaching 0.5-0.6; (ii) Prepare the cells as electrocompetent cells; (iii) The edited plasmid pegRNA was mixed with electrocompetent cells in an electroporation dish for electroporation. SOB medium was added immediately after electroporation, and the cells were transferred to sterile culture tubes for resuscitation. (iv) After resuscitation, the resuscitation culture was inoculated into a culture medium for editing and extension of the edited chain; (v) After expansion culture, the cells were inoculated onto LB agar plates containing ampicillin, kanamycin and dehydrotetracycline and cultured until colonies formed.

[0008] Preferably, in step (3), the epigRNA is driven by the J23119 promoter, and its sequence structure, starting from the 5′ end, consists of a spacer sequence, a scaffold sequence, a reverse transcription template sequence, and a primer binding sequence. A structured RNA motif is introduced at the 3′ end and fused with a eukaryotic hammerhead ribozyme. A transcription terminator sequence is set at the end of the sequence. For insertion editing at xylB, galK, or lacZ editing sites, the sequences of the primer binding sequence region and the reverse transcription template sequence region of the epigRNA remain unchanged, while the required insertion sequence is introduced between the reverse transcription template sequence region and the primer binding sequence region. For knockout or replacement editing at xylB, galK, or lacZ editing sites, only the sequence of the reverse transcription template sequence region is modified accordingly.

[0009] Preferably, in step (3), the gRNA is driven by the LexA promoter, and the sequence structure from the 5′ end to the 3′ end is a DR sequence, a spacer sequence, and a transcription terminator sequence, wherein the spacer sequence region is used to mediate the editing of the chloramphenicol resistance gene on the reverse selection plasmid by the MAD7 nuclease.

[0010] Preferably, in step (3), the sgRNA is driven by the J23119 promoter, and the sequence structure from the 5′ end to the 3′ end consists of a spacer sequence, a scaffold sequence, and a transcription terminator sequence.

[0011] Preferably, in step (i), the culture is cultured in fresh LB medium supplemented with 0.2% L-arabinose, 34 μg / mL chloramphenicol and 100 μg / mL ampicillin.

[0012] Preferably, in step (iv), the resuscitation culture is cultured in LB medium supplemented with 100 μg / ml ampicillin, 50 μg / ml kanamycin and 0.2% L-arabinose.

[0013] Preferably, in step (v), the concentrations of ampicillin, kanamycin, and dehydrated tetracycline are 100 μg / ml, 50 μg / ml, and 40 μg / ml, respectively.

[0014] The advantages of this invention are: (1) The PE-STAR system constructed in this invention not only expands the editing range in the model bacterium Escherichia coli (the editing range of insertion, substitution and knockout is expanded to 46bp, while the previous editing length is generally less than 10bp), but also greatly improves the editing efficiency compared with traditional lead editing. Specifically, for editing at the xylB editing site, the gene editing efficiency is increased by 50%-60%, and for editing at the galK or lacZ editing site, the gene editing efficiency is increased by 16 times. This improvement can further expand the application of lead editing in Escherichia coli and establish a significantly enhanced lead editing strategy.

[0015] (2) The application of PASTE-like enzymes was first realized in E. coli by combining Bxb1 integrase, and successfully inserted a 3.2kb GFP expression cassette and an 8kb riboflavin pathway integration. Attached Figure Description

[0016] Figure 1 This is a map of the SpPE-RecJ plasmid; Figure 2 This is a map of the pB-MAD7-CcdB plasmid; Figure 3 This is a schematic diagram of the composition of the three key elements (epegRNA, gRNA, sgRNA) of a pegRNA plasmid; Figure 4 This is a schematic diagram of the working principle of the PE-STAR system constructed in this invention; Figure 5 This is a graph showing the calculated gene editing efficiency of the PE-STAR system at the xylB editing site for single-base insertion; Figure 6 This is a graph showing the gene editing efficiency calculation results of the PE-STAR system in various editing types. Columns A, B, and C represent editing performed at the xylB editing site, while column D represents editing performed at the galK and lacZ editing sites, respectively. Figure 7 This is a flowchart illustrating the workflow for implementing attB–attP recombination using the PE-STAR system. Figure 8 This is a diagram showing the phenotypic verification results of large-fragment genome integration. The left image shows strains that have integrated green fluorescent protein (GFP), and the right image shows strains that have not integrated GFP (control strains). Figure 9 This is a standard curve of riboflavin; Figure 10 This is a growth curve diagram of the strain carrying the integrated riboflavin pathway and the control strain; Figure 11 This is a graph showing the calculated riboflavin production results of strains carrying the integrated riboflavin pathway. Detailed Implementation

[0017] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0018] I. Methods to improve the scope and efficiency of E. coli lead editing

[0019] The method for improving the scope and efficiency of Escherichia coli lead editing provided by this invention includes the following steps:

[0020] 1. Constructing the RecJ enhancement and repair plasmid SpPE-RecJ The SpPE plasmid is based on the p15A origin of replication and encodes a Cas9 nickase (SpCas9_H840A) fused with an engineered Moloney mouse leukemia virus reverse transcriptase (M-MLV RT).

[0021] The RecJ gene was amplified from the *E. coli* genome and cloned into the SpPE plasmid to construct the RecJ enhancement and repair plasmid SpPE-RecJ. (See attached structure). Figure 1 .

[0022] The expression of all proteins encoded by the SpPE-RecJ plasmid is driven by an arabinose-inducible promoter.

[0023] The constructed SpPE-RecJ plasmid can increase the expression level of RecJ protein. Overexpression of RecJ can enhance the 5' DNA processing ability during nick repair and gap expansion, thereby increasing the probability of the reverse transcription editing strand being integrated during DNA repair and making it easier to introduce new editing strands.

[0024] 2. Construct the reverse selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB)

[0025] The reverse selection marker gene ccdB was obtained from the NCBI database. Codon optimization was performed on E. coli to obtain the point mutant ccdB_L96P, which was then synthesized by GENEWIZ. The ccdB_L96P toxin gene is controlled by anhydrotetracycline-inducible promoter.

[0026] ccdB_L96P was amplified by PCR using 2×Phanta Flash Master Mix (rapid high-fidelity enzyme premix). Then, using the ClonExpress Ultra One Step Cloning Kit V2 (compatible and efficient rapid cloning kit), ccdB_L96P and arabinose-inducible MAD7 (ErCas12a) were co-assembled into the pBR322 (or pSC101) vector via Gibson ligation to construct the reverse-selective plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB). The structure is shown below. Figure 2 .

[0027] 3. Constructing the editing plasmid pegRNA

[0028] All editing plasmids used in this invention are collectively referred to as pegRNAs and are named according to the functional elements they contain.

[0029] In this invention, such as Figure 3 As shown, the components used to construct the edited plasmid pegRNA include: (1) EpigRNA: Driven by the J23119 promoter, the sequence structure from the 5′ end consists of a spacer, a scaffold, a reverse transcription template (RTT), and a primer binding sequence (PBS). A structured RNA motif (evopreQ1 or tevopreQ1) is introduced at the 3′ end and fused with a eukaryotic hammerhead ribozyme (HDV) to improve RNA molecule stability and inhibit 3′ end degradation. A transcription terminator (T7 terminator) is placed at the end of the sequence. For insertions (1 base, 10 bases, 30 bases, 46 bases) at xylB, galK, or lacZ editing sites, the sequences of the PBS and RTT regions of the epigRNA remain unchanged, while the desired insertion sequence is introduced between the RTT and PBS regions. For knockout (1 base, 10 bases, 30 bases, 46 bases) or substitution (1 base, 10 bases, 30 bases, 46 bases) edits at xylB, galK, or lacZ editing sites, only the sequence in the RTT region is modified accordingly.

[0030] Spacer sequences are target-specific; the corresponding epigRNA sequences differ for different loci and different editing types. For example: (i) An epigRNA with a 1-base (e.g., +6T) insertion at the xylB editing site, wherein the required insert sequence is introduced between the RTT and PBS regions, is designated as epigRNA_6Tins, and its nucleotide sequence is shown in SEQ ID NO: 24. An epigRNA with a 10-base (e.g., AAGCTTGGAC) or 30-base (e.g., AAGCTTGGACAGGACCAACTCGACTGCAGT) insertion at the xylB editing site, wherein the required insert sequence is still introduced between the RTT and PBS regions, and its nucleotide sequence is shown in SEQ ID NO: 25 and SEQ ID NO: 26. For epegRNAs that insert 46 bases (e.g., CCGGATGATCCTGACGACGGAGACCGCCGTCGTCGACAAGCCGGCC) into the xylB editing site, the required insertion sequence is still introduced between the RTT region and the PBS region. The nucleotide sequence of the epegRNA containing 15 RTT is shown in SEQ ID NO: 27, and the nucleotide sequence of the epegRNA containing 26 RTT is shown in SEQ ID NO: 28.

[0031] (ii) For epigRNAs that knock out one base (e.g., T) at the xylB editing site, the desired base is directly knocked out in the RTT region. The resulting epigRNA is denoted as epigRNA_de_1bp, and its nucleotide sequence is shown in SEQ ID NO: 29. For epigRNAs that knock out 10 bases (e.g., GTTACCTGAA), 30 bases (e.g., AGCGAAATTACTGGTGCTTTGTTACCTGAA), or 46 bases (e.g., CGCATTATACGAAGGCAGCGAAATTACTGGTGCTTTGTTACCTGAA) at the xylB editing site, the desired base is also directly knocked out in the RTT region. The nucleotide sequences of the epigRNAs are shown in SEQ ID NO: 30, SEQ ID NO: 31, and SEQ ID NO: 32.

[0032] (iii) An epigRNA that performs a one-base substitution (e.g., +5G) at the xylB editing site (T) replaces the base to be replaced with the target base (T) in the RTT region. The resulting epigRNA is denoted as epigRNA_5GtoT. The nucleotide sequence of the epigRNA is shown in SEQ ID NO: 33. The epegRNAs that replace 10 bases (e.g., replacing GTTACCTGAA with AAGCTTGGAC), 30 bases (e.g., replacing AGCGAAATTACTGGTGCTTTGTTACCTGAA with AAGCTTGGACAGGACCAACTCGACTGCAGT), or 46 bases (e.g., replacing CGCATTATACGAAGGCAGCGAAATTACTGGTGCTTTGTTACCTGAA with CCGGATGATCCTGACGACGGAGACCGCCGTCGTCGACAAGCCGGCC) at the xylB editing site, or those that replace the bases to be replaced with the target bases in the RTT region, are shown in SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36.

[0033] For epiegRNAs that knock out 10 bases (e.g., GTTTCCATGC) at the galK editing site, the desired knockout bases are directly knocked out in the RTT region. The nucleotide sequence of the epiegRNA is shown in SEQ ID NO: 37. For epiegRNAs that insert 30 bases (e.g., AAGCTTAGACAGAGCACCAACTCGACTGCAGT) at the galK editing site, the desired insert sequence is introduced between the RTT and PBS regions. The nucleotide sequence of the epiegRNA is shown in SEQ ID NO: 38.

[0034] For epiegRNAs that knock out 10 bases (e.g., ACCACCGCAC) at the lacZ editing site, the desired knockout bases are directly knocked out in the RTT region. The nucleotide sequence of the epiegRNA is shown in SEQ ID NO: 39. For epiegRNAs that insert 30 bases (e.g., AAGCTTAGACAGGACCAACTCGACTGCAGT) at the galK editing site, the desired insertion sequence is introduced between the RTT and PBS regions. The nucleotide sequence of the epiegRNA is shown in SEQ ID NO: 40.

[0035] (2) gRNA: driven by the LexA promoter, the sequence structure from the 5′ end to the 3′ end is the DR sequence, the spacer sequence, and the T7te terminator sequence. In the spacer region, the MAD7 (Ercas12a) nuclease is mediated to edit the chloramphenicol (Chl) resistance gene on the reverse selection plasmid. The resulting gRNA is denoted as LexA_gRNA_Chl, and the nucleotide sequence is shown in SEQ ID NO: 41.

[0036] (3) sgRNA: driven by the J23119 promoter, the sequence structure from the 5′ end to the 3′ end is the nicking spacer, scaffold, and artificial terminator.

[0037] The sgRNA sequences differ for different gene loci. For example: (i) For the xylB locus, the nucleotide sequence of the -59nick sgRNA adjacent to the xylB editing site is shown in SEQ ID NO: 42, and the nucleotide sequence of the +80nick sgRNA adjacent to the xylB editing site is shown in SEQ ID NO: 43; (ii) For the galK locus, the nucleotide sequence of the +68nick sgRNA adjacent to the galK editing site is shown in SEQ ID NO: 44; (iii) For the lacZ locus, the nucleotide sequence of the sgRNA adjacent to the lacZ editing site at +57nick is shown in SEQ ID NO: 45.

[0038] This invention involves three types of editing plasmids: editing plasmids containing only one functional element, epigRNA (e.g., xylB pegRNA2_6Tins), editing plasmids containing two functional elements, epigRNA and LexA_gRNA_Chl (e.g., xylB pegRNA2_6Tins_lexA), and editing plasmids containing three functional elements, epigRNA, LexA_gRNA_Chl, and sgRNA (e.g., xylB pegRNA3_6Tins-59nick_lexA, xylB pegRNA3_6Tins+80nick_lexA, galKpegRNA3_ins30bp+68nick_lexA, galK pegRNA3_de10bp+68nick_lexA, lacZ pegRNA3_ins30bp+57nick_lexA, lacZ pegRNA3_de10bp+57nick_lexA).

[0039] (1) xylB pegRNA2_6Tins The editing plasmid xylB pegRNA2_6Tins was constructed in the pUC19 vector and contains an epegRNA_6Tins (SEQ ID NO: 24) with a 1-base (+6T) insertion at the xylB editing site.

[0040] (2) xylB pegRNA2_6Tins_lexA To achieve SOS-responsive reverse selection, an additional gRNA (LexA_gRNA_Chl, SEQ ID NO: 41) was introduced into the edit plasmid xylB pegRNA2_6Tins, thereby generating pegRNA2_6Tins_lexA.

[0041] (3) xylB pegRNA3_6Tins-59nick_lexA, xylB pegRNA3_6Tins+80nick_lexA Integrating sgRNAs (SEQ ID NO: 42, SEQ ID NO: 43) targeting the -59 or +80 nick adjacent to the xylB editing site into the editing plasmid xylB pegRNA2_6Tins_lexA generates xylB pegRNA3_6Tins-59nick_lexA and xylB pegRNA3_6Tins+80nick_lexA.

[0042] (4) galK pegRNA3_ins30bp+68nick_lexA, galK pegRNA3_de10bp+68nick_lexA Constructed in the pUC19 vector, it contains either an epigRNA_ins30bp (SEQ ID NO: 38) with a 30-base insertion at the galK editing site or an epigRNA_de10bp (SEQ ID NO: 37) with a 10-base knockout, a gRNA (LexA_gRNA_Chl, SEQ ID NO: 41), and an sgRNA (SEQ ID NO: 44) targeting the +68 nick adjacent to the galK editing site.

[0043] (5) lacZ pegRNA3_ins30bp+57nick_lexA, lacZ pegRNA3_de10bp+57nick_lexA Constructed in the pUC19 vector, it contains either an epigRNA_ins30bp (SEQ ID NO: 40) that inserts 30 bases into the lacZ editing site or an epigRNA_de10bp (SEQ ID NO: 39) that knocks out 10 bases, gRNA (LexA_gRNA_Chl, SEQ ID NO: 41), and an sgRNA (SEQ ID NO: 45) targeting the +57nick site adjacent to the lacZ editing site.

[0044] 4. Construct the PE-STAR system The RecJ enhancement repair plasmid SpPE-RecJ and the reverse selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB) were co-transformed into the MG1655 strain, which had the sbcB, exoX, and xseA genes knocked out. The strain was then cultured overnight for competent cell preparation. The culture (denoted as Culture A) was inoculated into 50 mL of fresh LB medium supplemented with 0.2% (w / v) L-arabinose, 34 μg / mL chloramphenicol (Chl), and 100 μg / mL ampicillin (Amp), and cultured on a shaker at 30°C and 200 rpm. When OD... 600 When the expression level reaches 0.5-0.6, it is considered that the expression of the Cas9-deficient enzyme (SpCas9_H840A) is sufficient for subsequent editing steps.

[0045] Cells were cooled on ice for 15 min, then centrifuged at 6000 rpm for 4 min, and the pellet was collected. The cell pellet was washed twice with ice-cold 10% (v / v) glycerol, each wash volume being 50% of the initial culture volume, and then centrifuged at 6000 rpm for 3 min, and the pellet was collected. The washed cell pellet was resuspended in ice-cold 10% (v / v) glycerol, with the final cell suspension volume being 1% of the initial culture volume, to obtain electrocompetent cells.

[0046] Edited plasmid pegRNAs (e.g., xylB pegRNA2_6Tins, xylB pegRNA2_6Tins_lexA, xylB pegRNA3_6Tins-59nick_lexA, xylB pegRNA3_6Tins+80nick_lexA, galK pegRNA3_ins30bp+68nick_lexA, galK pegRNA3_de10bp+68nick_lexA, lacZ pegRNA3_ins30bp+57nick_lexA, lacZ pegRNA3_de10bp+57nick_lexA) were mixed with 50 μL of freshly prepared electrocompetent cells in an electroporation dish with a 0.1 cm gap. The mixture was incubated on ice for 5 min, followed by electroporation at 1.8 kV. Immediately after electroporation, 950 μL of SOB medium was added, and the cells were transferred to sterile culture tubes and cultured in a shaker at 30°C and 200 r / min for 2 h for recovery.

[0047] After resuscitation, 100 μL of the resuscitation culture was inoculated into 10 mL of LB medium supplemented with 100 μg / ml ampicillin (Amp), 50 μg / ml kanamycin (Kan) and 0.2% (v / v) L-arabinose, and cultured at 30 °C for 16 h to allow for editing and extension of the edited strands.

[0048] After 16 hours of expansion culture, cells were seeded onto LB agar plates supplemented with 100 μg / ml ampicillin (Amp) and 50 μg / ml kanamycin (Kan) to maintain the RecJ enhancement repair plasmid SpPE-RecJ and the editing plasmid pegRNA. To induce the expression of the toxin gene ccdB_L96P, controlled by the tetracycline-inducible promoter, on the reverse selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB), a tetracycline (aTc) at a concentration of 40 μg / ml was added to the agar plates. The induced ccdB protein acted as a reverse selection agent, reducing unedited colonies. Before subsequent analysis, the culture dishes were incubated at 30°C for 28 hours to allow colony formation.

[0049] After colony formation, 1 ml of sterile double-distilled water (ddH2O) was added to each culture dish, and the colonies were then gently scraped off with a sterile cell scraper to obtain a mixed cell suspension (ensuring it represents the entire edited microbial community). Genomic DNA was extracted from the mixed cells, and the gene editing efficiency was quantified by deep amplicon sequencing.

[0050] II. Working Principle of the PE-STAR System

[0051] Reference Figure 4 The working principle of the PE-STAR system constructed in this invention is as follows: Gene editing was performed on MG1655 strains carrying the RecJ enhancement repair plasmid SpPE-RecJ (with the sbcB, exoX, and xseA genes knocked out), and these strains were supplemented with the anti-selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB). In this host bacterium, the deletion of sbcB, exoX, and xseA inhibited 3′ end degradation, while RecJ enhanced the processing of the 5′ end of the reverse transcription DNA intermediate. Simultaneously, the DNA nick generated by PE3 was recognized by the cells and triggered an SOS response, leading to RecA-dependent LexA cleavage and the induction of LexA-inducible gRNA expression. This gRNA targeted the anti-selection plasmid, causing its elimination, and activated aTc-induced CcdB toxin, thereby selectively killing unedited cells.

[0052] III. Amplicon Sequencing Preparation and Data Analysis

[0053] Genomic DNA extracted from mixed cells was purified using the Ezup Fungal Genomic DNA Purification Kit manufactured by Sangon Biotech Co. Ltd. (Shanghai, China) according to the manufacturer's instructions.

[0054] Design primers for Illumina that contain sample-specific barcodes to amplify target loci.

[0055] The designed primer sequences are as follows: Primer Name Primer Sequence Next ge Seq-xylB+6Tins-F1 AGTGCTAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F2 GTCTAAAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F3 ACAGAGAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F4 AGACTGAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-R1 GAATACAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R2 GTAAGGAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R3 CGTCTAAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R4 AGACTGAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R5 ATTACTAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R6 GAGATTAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R7 AGTGCTAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R8 GTCTAAAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-R9 ACAGAGAGCGATAACATTGCCTGATTAGC Next ge Seq-xylB+6Tins-F5 GAATACAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F6 GTAAGGAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F7 CGTCTAAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F8 ATTACTAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F9 GAGATTAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-F10 ATTCAGAAAGCGTGACTGGAGTGAC Next ge Seq-xylB+6Tins-R10 GAATTCGCCATACCCCACGCTTTC Next ge Seq-xylB+6Tins-R11 ATTCAGGCCATACCCCACGCTTTC Next ge Seq-xylB+6Tins-R12 CTGAAGGCCATACCCCACGCTTTC Next ge Seq-xylB+6Tins-R13 AGTGCTGCCATACCCCACGCTTTC For each sample, 1 μg of genomic DNA was used as a PCR template, and the target region was amplified using a 2×Magic Green Taq Supermixer manufactured by Tolo Biotech Co. Ltd. (Shanghai, China). PCR products were validated by 2% (w / v) agarose gel electrophoresis, then cut and purified using the Hipure Gel Pure DNA Mini Kit manufactured by Magen Biotechnology Co. Ltd. (Guangzhou, China). The purified amplified products (100 ng per sample) were mixed in equimolar proportions and submitted for next-generation sequencing (NGS).

[0056] The original NGS data consisted of paired short-read sequences, which were processed using an internal analysis workflow. In short, reads were split based on the barcode sequence, connector sequences were removed, and read quality was evaluated to ensure suitability for subsequent analysis. A custom fastq_merge algorithm was used to merge the paired short-read sequences, discarding sequences that could not be effectively paired. Then, the merged reads were categorized and statistically analyzed based on the barcode and target sequence to obtain sequence readings corresponding to different editing results.

[0057] Gene editing efficiency is defined as the proportion of sequencing reads containing the target edited sequence to the total effective sequencing reads in a given sample.

[0058] Gene editing efficiency is calculated using the following formula:

[0059] Where E represents the editing efficiency of the target site, and C i This indicates a sequencing read containing the target edited sequence, and C represents all valid sequencing reads in the sample.

[0060] After introducing different editing plasmids pegRNA (xylB pegRNA2_6Tins, xylB pegRNA2_6Tins_lexA, xylB pegRNA3_6Tins-59nick_lexA, or xylB pegRNA3_6Tins+80nick_lexA), the gene editing efficiency of ES95 strains expressing the RecJ enhancement repair plasmid SpPE-RecJ and the reverse selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB) is calculated as follows: Figure 5 .

[0061] Depend on Figure 5It can be seen that, for single-base insertion editing at the xylB editing site, the PE-STAR system, which increases the expression level of recJ protein and adds the reverse selection plasmid pB-MAD7-CcdB (or pS-MAD7-CcdB), improves the gene editing efficiency to 80%.

[0062] IV. Gene Editing Effects of the PE-STAR System The PE-STAR system constructed in this invention (the editing plasmid pegRNA contains three functional elements: epigRNA, LexA_gRNA_Chl, and sgRNA) was used for gene editing at different loci, with different lengths and types. The calculated gene editing efficiency results are shown in [the table below]. Figure 6 .Depend on Figure 6 It can be known that: (1) For different lengths of insertion editing at the xylB editing site: for 10 base insertion, the gene editing efficiency increased from 0.44% to 6.78%; for 30 base insertion, the gene editing efficiency increased from 11.76% to 27.40%, with the most significant improvement when the reverse selection plasmid used pBR322 as the replication origin; for 46 base insertion, the gene editing efficiency for strains carrying the pSC101 replication origin increased from 11.22% to 12.97%, showing a moderate improvement, while for strains with optimized RTT length, the gene editing efficiency increased from 20.12% to 24.56%, also showing a moderate improvement.

[0063] (2) For knockout edits of different lengths at the xylB editing site: a knockout of 1 base has a gene editing efficiency of nearly 60%; a knockout of 10 bases has a gene editing efficiency of nearly 90%; a knockout of 30 bases has a gene editing efficiency of about 80%; and a knockout of 46 bases has a gene editing efficiency of nearly 55%, while the gene editing efficiency of traditional lead editing technology is less than 20%.

[0064] (3) For substitutions of different lengths at the xylB editing site: substitutions of 1 base, 10 bases, and 30 bases, the gene editing efficiencies reached 84.60% (1 base), 50.36% (10 bases), and 17.19% (30 bases), respectively, which are comparable to the gene editing efficiencies achieved by standard prokaryotic editing techniques. This indicates that short-fragment substitutions can be well achieved by the traditional PE system. For substitutions of 46 bases, the gene editing efficiency reached nearly 50%, while the traditional lead editing technique can only reach about 10%. This indicates that the PE-STAR system constructed in this invention has significantly improved tolerance to longer and more complex repair templates.

[0065] (4) For 30-base insertion editing at the galK or lacZ editing sites: at the galK site, the gene editing efficiency increased from undetectable to 9.78%; at the lacZ editing site, the gene editing efficiency increased from 0.66% to 7.90%. (5) For 10-base knockout editing at the galK or lacZ editing sites: at the galK editing site, the gene editing efficiency increased from 2.53% to 39.64%; at the lacZ editing site, the gene editing efficiency increased from 9.95% to 24.06%.

[0066] The above results show that the PE-STAR system provided by this invention has good universality.

[0067] V. Application Cases of the PE-STAR System

[0068] The PE-STAR system constructed in this invention will be described in more detail below using the integrase Bxb1 to integrate long fragments of attB and attP.

[0069] 1. Principle Reference Figure 7 In the first stage, the PE-STAR system-mediated leader editing installs a 46-base attB site at the xylB site on the chromosome. In the second stage, the Bxb1 fusion enzyme catalyzes specific recombination between the attB site in the genome and the attP site from the donor plasmid, thereby achieving targeted chromosome integration of large DNA fragments (including a 3.2kb GFP expression cassette and an 8.0kb riboflavin biosynthesis pathway).

[0070] 2. Plasmid construction and fermentation of bacterial strains in the editing process Using the PE-STAR system described above, an attB site was inserted into the xylB site of the chromosome of strain MG1655 (with the sbcB, exoX, and xseA genes knocked out), thereby generating the ES95-attB strain. This strain carried the SpPE-recJ plasmid and the corresponding pegRNA plasmid. Subsequently, the riboflavin biosynthesis pathway in the R6Kγ-attP-riboflavin donor plasmid was integrated into the attB site of the chromosome via site-directed recombination mediated by the Bxb1 fusion enzyme expressed by the pS-Bxb1-Cre-Chl plasmid. Correct integrators were screened on LB agar plates supplemented with 25 μg / mL gentamicin (Gent), resulting in strains carrying GFP expression cassettes or riboflavin-producing strains.

[0071] like Figure 8As shown, strains carrying GFP expression cassettes can be clearly observed to exhibit green fluorescence under a fluorescence confocal microscope.

[0072] Strains carrying the integrated riboflavin pathway were revived on LB agar plates at 30°C and then inoculated into liquid medium for overnight culture. OD was measured... 600 To monitor cell growth, seed cultures and corresponding control strains (lacking the integrated riboflavin pathway) were transferred to 500 mL Erlenmeyer flasks containing 100 mL LB medium, with initial OD... 600 The concentration was adjusted to approximately 0.1, with an initial glucose concentration of 15 g / L. All cultures were incubated at 30 °C with shaking at 200 r / min.

[0073] Samples were collected at 4h, 8h, 12h, 24h, 36h, 48h, 60h, 72h, 84h, and 96h post-inoculation to determine OD. 600 At each time point, 1 mL of culture was collected and centrifuged at 12000 rpm for 8 min. The supernatant was collected for residual glucose analysis, and the remaining supernatant was stored at -20°C for subsequent riboflavin quantification. Growth curves of the strain carrying the integrated riboflavin pathway and the control strain during the 96 h fermentation process are shown in the figure. Figure 10 .

[0074] For calibration, 20 mg of riboflavin standard (product number B21290; Shanghai Yuanye Biotechnology Co., Ltd., China) was dissolved in 0.01 mol / L hydrochloric acid and diluted to a final volume of 200 mL to obtain a stock solution with a concentration of 0.1 mg / mL. Standard curves were generated using injection volumes of 2 μL, 4 μL, 6 μL, 8 μL, and 10 μL. The generated standard curves are shown in [Figure number missing]. Figure 9 The calibration equation is y = 15777x + 0.1002, R 2 =1.

[0075] The frozen supernatant was thawed and filtered through a 0.22 μm membrane. Riboflavin concentration was determined using high-performance liquid chromatography (HPLC; Agilent 1260 Infinity system equipped with a UV-Vis detector, Agilent Technologies, Santa Clara, USA) with an Agilent TC-C18(2) column (250 × 4.6 mm). The mobile phase consisted of ultrapure water, methanol, acetonitrile, and 2 mM phosphate buffer in a volume ratio of 6:1:2:1, delivered at a constant flow rate of 0.8 mL / min. The column temperature was maintained at 30 °C, the injection volume was 15 μL, and the run time for each sample was 40 min. Riboflavin was detected at 370 nm with a retention time of approximately 5 min.

[0076] The riboflavin production calculation results for strains carrying the integrated riboflavin pathway are shown in [link to relevant documentation]. Figure 11 .Depend on Figure 11 It can be seen that the highest yield of riboflavin by shake-flask fermentation is 3.23 mg / L.

[0077] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. A method for improving the scope and efficiency of Escherichia coli lead editing, characterized in that, Includes the following steps: (1) Construction of RecJ enhancement repair plasmid SpPE-RecJ: The RecJ gene was amplified from the Escherichia coli genome and cloned into the SpPE plasmid to construct the RecJ enhancement repair plasmid SpPE-RecJ; (2) Constructing reverse selection plasmids pB-MAD7-CcdB or pS-MAD7-CcdB: The point mutant ccdB_L96P of the reverse selection marker gene ccdB was amplified by PCR, and then ccdB_L96P and arabinose-inducible MAD7 were assembled together into the pBR322 or pSC101 vector to construct the reverse selection plasmids pB-MAD7-CcdB or pS-MAD7-CcdB; (3) Construction of editing plasmid pegRNA: epegRNA, gRNA and sgRNA were assembled into the pUC19 vector to construct the editing plasmid pegRNA; (4) Constructing the PE-STAR system: (i) The RecJ enhancement repair plasmid SpPE-RecJ and the reverse selection plasmid pB-MAD7-CcdB or pS-MAD7-CcdB were co-transformed into the MG1655 strain with the sbcB, exoX and xseA genes knocked out. The strain was then cultured overnight, and competent cells were prepared. The newly inoculated cultures were cultured to OD. 600 Reaching 0.5-0.6; (ii) Prepare the cells as electrocompetent cells; (iii) The edited plasmid pegRNA was mixed with electrocompetent cells in an electroporation dish for electroporation. SOB medium was added immediately after electroporation, and the cells were transferred to sterile culture tubes for resuscitation. (iv) After resuscitation, the resuscitation culture was inoculated into a culture medium for editing and extension of the edited chain; (v) After expansion culture, the cells were inoculated onto LB agar plates containing ampicillin, kanamycin and dehydrotetracycline and cultured until colonies formed.

2. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (3), the epigRNA is driven by the J23119 promoter. The sequence structure, starting from the 5′ end, consists of a spacer sequence, a scaffold sequence, a reverse transcription template sequence, and a primer binding sequence. A structured RNA motif is introduced at the 3′ end and fused with a eukaryotic hammerhead ribozyme. A transcription terminator sequence is set at the end of the sequence. For insertion editing at xylB, galK, or lacZ editing sites, the sequences of the primer binding sequence region and the reverse transcription template sequence region of the epigRNA remain unchanged, while the required insertion sequence is introduced between the reverse transcription template sequence region and the primer binding sequence region. For knockout or replacement editing at xylB, galK, or lacZ editing sites, only the sequence of the reverse transcription template sequence region is modified accordingly.

3. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (3), the gRNA is driven by the LexA promoter, and the sequence structure from the 5′ end to the 3′ end is the DR sequence, the spacer sequence, and the transcription terminator sequence, wherein the MAD7 nuclease is mediated to edit the chloramphenicol resistance gene on the reverse selection plasmid in the spacer sequence region.

4. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (3), the sgRNA is driven by the J23119 promoter, and the sequence structure from the 5′ end to the 3′ end consists of a spacer sequence, a scaffold sequence, and a transcription terminator sequence.

5. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (i), the culture was cultured in fresh LB medium supplemented with 0.2% L-arabinose, 34 μg / mL chloramphenicol and 100 μg / mL ampicillin.

6. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (iv), the resuscitation culture was cultured in LB medium supplemented with 100 μg / ml ampicillin, 50 μg / ml kanamycin and 0.2% L-arabinose.

7. The method for improving the scope and efficiency of Escherichia coli lead editing according to claim 1, characterized in that, In step (v), the concentrations of ampicillin, kanamycin, and dehydrated tetracycline are 100 μg / ml, 50 μg / ml, and 40 μg / ml, respectively.

Images