Cytokines affecting production of recombinant aav

Abstract

The present invention provides methods for producing adeno-associated virus (AAV) vectors, wherein the host cell used for virus production is modified to display reduced or increased expression of one or more genes as compared to an unmodified host cell. The present invention also relates to host cells that are modified to display reduced or increased expression of one or more genes as compared to an unmodified host cell.

Description

Technical Field

[0001] This invention relates to a method for producing adeno-associated virus (AAV) vectors, wherein host cells for virus production are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells. The invention also relates to host cells modified to exhibit reduced or increased expression of one or more genes compared to unmodified host cells. Background Technology

[0002] The development of gene therapy drugs has offered significant opportunities to treat or even permanently cure some previously untreatable diseases. One of the most promising gene delivery systems for in vivo gene therapy is the adeno-associated virus (AAV) vector, which shows great potential due to its lack of pathogenicity, low immunogenicity, and ability to mediate long-term free expression. The capabilities of these viral vectors have been well-established and tested in numerous preclinical and clinical studies. Furthermore, AAV-based gene therapies (e.g., Glybera, Luxturna, and Zolgensma) are, to date, the only in vivo gene therapies approved in the Western world. This highlights the enormous potential of this type of vector for future applications.

[0003] Despite this promising potential, there are limitations in existing production systems for the scalable production of large quantities of AAV carriers. Instantaneous rAAV production typically yields at most 1x10⁻¹⁰. 14 A titer of vg / L. However, depending on the indication, each patient requires 1 x 10. 14 Vg / kg or more. Furthermore, the use of gene therapy for treating common diseases has become increasingly prevalent, resulting in a significant need to treat a large number of patients. Consequently, the titers currently available in production processes cannot meet the demands of these applications, posing a serious challenge to most manufacturers.

[0004] This production gap is caused by poor reproducibility due to transient methods, limited scalability due to the use of adherent production systems, and poor yield (infectious titer) of intact virus particles relative to empty virus particles during production. To date, the most commonly used production systems are based on transient transfection of adherent human embryonic kidney (HEK) cells or on transduction of fall armyworm cells with baculoviruses. Spodoptera frugiperda Sf9 cells.

[0005] To overcome this production gap, the inventors were able to identify cytokines that strongly influence rAAV titers by supporting or inhibiting AAV production. Knockout or overexpression of genes encoding these cytokines leads to enhanced rAAV production and higher rAAV titers, enabling rAAV-based gene therapy approaches.

[0006] The inventors were surprisingly able to identify cytokines that strongly influence rAAV titers and whose function was previously unknown. Summary of the Invention

[0007] One of the greatest challenges to overcome in the large-scale production of rAAV gene therapy is increasing the rAAV titer yield. The inventors have discovered that reducing or increasing the expression of specific cytokines in rAAV-producing cell lines improves the rAAV titer yield. In particular, the present invention has been able to enhance rAAV titers by knocking out one or more genes.

[0008] Therefore, in a first aspect, the present invention provides a method for producing an adeno-associated virus (AAV) vector, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culture the host cells to produce recombinant AAV (rAAV); The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APPIL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8.

[0009] In a second aspect, the present invention also provides a host cell that, compared with an unmodified host cell, has been modified or otherwise caused to exhibit reduced or increased expression of one or more genes, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APPIL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0010] In another aspect, the present invention provides a host cell comprising the knockout of one or more genes selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, HCBP1, ENGASE, NELFCD, FBXL14, and BRD4.

[0011] In another aspect, the present invention provides a host cell comprising a non-endogenous nucleic acid encoding one of TRIAP, APP, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C. Attached Figure Description

[0012] Figure 1 A novel whole-genome CRISPR / Cas9 screening method using lentiviral-AAV-sgRNA libraries A: A schematic procedure for screening a lentiviral-AAV-CRISPR library containing 70,948 different guide RNAs, which are packaged into a lentiviral vector via transfection of a CAP-T packaging cell line. The resulting lentiviral library is then used to screen stable and inducible AAV-Cas9 packaging cell lines (CAP-T). AAV-Cas9Low MOI transduction was performed to deliver a single integration of an AAV expression cassette carrying the guide RNA to each cell. Stable production of the rAAV vector with a genome carrying the guide RNA was induced by doxycycline, resulting in the inactivation of the relevant genes in the producing cells. NGS sequencing of the guide RNA (barcode) allowed for identification and frequency determination between the guide RNA integrated into the genome and the guide RNA packaged in the AAV vector. This allowed for prediction of changes in production capacity due to Cas9-mediated inactivation of individual cellular genes. B: CAP treated with and untreated with doxycycline. AAV-Cas9 Western blot analysis of cell lysates revealed the induced expression of AAV packaging and accessory proteins VP1, VP2, VP3, Rep70, and E2. Furthermore, the analysis showed constitutive expression of the Cas9 protein. GAPDH was used as a loading control.

[0013] Figure 2 LAC screening identifies host cytokines that support or inhibit AAV production in stable rAAV-producing cell lines. A: Box plot showing the distribution of LAC library guide RNA frequencies during LAC library generation and screening. The distribution indicates strong frequency changes due to CRISPR / Cas9-mediated gene inactivation during the screening process. Line: Median; Boxes: 25th and 75th percentiles; Whiskers: 2.5th and 97.5th percentiles. B: Sorted fold change values ​​for all identified sgRNAs assigned to the relevant genes in the screening process. Fold change is calculated as the difference between the read count of integrated genome reads and the number of AAV package reads (the average sgRNA count per gene).

[0014] Figure 3 Altering rAAV yield through gene knockout In host cells modified by knockout of ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, and APP, the relative abundance of rAAV genome in the supernatant compared to the stably integrated rAAV genome was measured; luciferase, EGFP, and LacZ were knocked out as controls.

[0015] Figure 4 Altering rAAV yield through gene knockout Quantitative PCR of the rAAV genome was performed on the supernatant of host cells transiently transfected with the rAAV genome, obtained by knocking out ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, and APP. Luciferase, EGFP, and LacZ were knocked out as controls.

[0016] Figure 5 Increase rAAV titer in stable CAP cell lines using inhibitors In fully stable CAP-producing cell lines, titers were significantly increased by two concentrations of the inhibitor JQ1 compared to the control without JQ1. Detailed Implementation

[0017] definition Before describing the invention in detail with respect to some preferred embodiments, the following general definitions are provided.

[0018] The invention will be described with reference to specific embodiments and certain accompanying drawings, but the invention is not limited thereto, but is defined only by the claims.

[0019] When the term "comprising" is used in this specification and claims, it does not exclude other elements. For the purposes of this invention, the term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood as disclosing a group preferably consisting only of those embodiments.

[0020] For the purposes of this invention, the term "obtained" is considered to be a preferred embodiment of the term "available". If, for example, a compound is defined below as being available from a particular source, this should also be understood as disclosing a compound obtained from that source.

[0021] When referring to singular nouns, the use of indefinite or definite articles such as "a," "an," or "the" includes the plural nouns unless otherwise specified. In the context of this invention, the terms "about" or "approximately" indicate a range of accuracy that, as will be understood by those skilled in the art, still ensures the technical effect of the features involved. This term typically indicates a deviation from the indicated value of ±10%, and preferably ±5%.

[0022] Technical terms are used according to their common meaning. If certain terms convey a specific meaning, a term definition will be provided in the context in which the term is used, as follows.

[0023] As used herein, the term "adeno-associated virus" or "AAV" refers to viruses belonging to the family Parvoviridae, subfamily Parvovirinae, and genus Parvovirus. "AAV" can also refer to the naturally occurring wild-type virus itself or its derivatives. The term encompasses all subtypes, serotypes, and pseudotypes, as well as both naturally occurring and recombinant forms, unless otherwise requested. Furthermore, "AAV" refers to the genetic components of the virus, such as the genome (positive or negative strand) and its RNA transcripts (sense or antisense strand), the proteins encoded by the genome (including structural and non-structural proteins), and the viral particle.

[0024] Adeno-associated virus (AAV) is a nonpathogenic, helper virus-dependent member of the Parvoviridae family. One of the recognizing characteristics of this group of viruses is the capsidation of a single-stranded DNA (ssDNA) genome, which can be either sense or antisense. In the case of AAV, separate positive or negative strands are packaged at the same frequency and are both infectious. The small (approximately 4.8 kilobases) ssDNA genome consists of two open reading frames, Rep and Cap, flanked by two 145-base ITRs (inverted terminal repeat sequences). Rep and Cap are translated to produce a variety of different proteins (e.g., Rep78, Rep68, Rep52, and Rep40 required for the AAV life cycle; and capsid proteins VP1, VP2, and VP3). When constructing nucleic acids using AAV delivery, a foreign nucleic acid (e.g., an immunogenic polypeptide transgene) is placed between the two ITRs, and Rep and Cap are typically provided in trans form. Due to its helper virus dependence, adeno-associated virus typically requires a helper virus for productive infection.

[0025] "Recombinant AAV" or "rAAV" refers to the lack of rep Aviral genes are used as vectors for gene delivery in vitro or in vivo. rAAV typically contains a capsidized genome carrying a therapeutic gene expression cassette that replaces genes necessary for viral production. The AAV genome has two terminal ITRs flanking its ends, which serve as origins of viral replication and packaging signals. In an rAAV vector, the only viral-derived sequence is the ITR, which is essential for directing genome replication and packaging during vector production. The ITR-flanked rAAV genome can be cloned into plasmids and manipulated using standard molecular cloning techniques.

[0026] As used herein, the term "serotype" refers to a virus identified by the reactivity of its capsid protein with a defined antiserum and distinguished from other viruses of the same genus based on the reactivity of the capsid protein with a defined antiserum. For example, serotype AAV2 is used to refer to an AAV containing a capsid protein encoded by the cap gene from AAV2 and a genome containing 5' and 3' ITR sequences from the same AAV2 serotype.

[0027] As used herein, the term "capsid protein" refers to the protein product of an open reading frame (ORF) (commonly referred to as the "cap" ORF) encoded by the ssDNA genome of parvoviruses. The cap ORF encodes three capsid proteins, viral proteins 1 (VP1), VP2, and VP3, which are produced through differential splicing of mRNA and the use of alternating translation start codons. All VPs share a common C-terminal VP3 amino acid sequence, also known as the VP3 common region or VP3 domain. The N-terminal region in VP2 that does not overlap with VP3 is called the VP1 / VP2 common region or VP1 / VP2 domain. The N-terminal region in VP1 that does not overlap with either VP2 or VP3 is called the VP1 unique (VP1u) region or VP1u domain.

[0028] As used herein, "packaging" refers to a series of subcellular events that lead to the assembly and capsidation of cargo (e.g., viral genome, recombinant viral genome, or transgene). Thus, when a suitable polynucleotide is introduced into a packaging cell line under appropriate conditions, it can assemble into a viral particle. The capsidated protein coat is called the capsid. The capsid, or outer shell, has an inner surface and an outer surface. The outer surface of the capsid is the portion of the shell that comes into contact with the environment.

[0029] The terms “viral vector” or “vector” as used interchangeably herein refer to a virus that has been engineered to deliver genetic material into cells in a process known as “transduction” or “transducing.” Transduction is the process of introducing a foreign polynucleotide (e.g., a transgene) from a viral vector into a host cell, resulting in the expression of the polynucleotide (e.g., the transgene) in the cell. The expression or persistent alteration of the polynucleotide introduced by a virus can be determined by methods well known in the art, including but not limited to protein expression, such as by ELISA, flow cytometry, and Western blotting; and the measurement of DNA and RNA production by hybridization assays, such as RNA blotting, DNA blotting, and gel mobility shift assays. Other methods for introducing foreign polynucleotides include well-known techniques such as transfection, lipid transfection, viral infection, transformation, and electroporation, as well as non-viral gene delivery techniques. The introduced polynucleotide may be stably or transiently retained in the host cell. Viral vectors may also be referred to as “virions” or “viral particles.”

[0030] "Gene expression" or "expression" refers to the process of gene transcription, translation, and post-translational modification.

[0031] "Helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type or recombinant AAV) to replicate and be packaged in mammalian cells. Various such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses, and poxviruses, such as vaccinia virus. Adenoviruses include many different subgroups, but subgroup C, adenovirus type 5, is most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from collections such as the ATCC. An "infectious" virus or virus particle is a virus or virus particle containing a polynucleotide component that is capable of delivering that polynucleotide component to cells to which the viral species has a tropism. This term does not necessarily imply any viral replication capacity.

[0032] The terms "host cell," "host cells," "cell line," "cell culture," "packaging cell line," and other such terms are used interchangeably herein to refer to higher eukaryotic cells, such as mammalian cells, like human cells, that can be used in this invention. These cells can be used as recipients of recombinant vectors, viruses, or other transfer polynucleotides and include progeny of the transduced initial cell. It should be understood that progeny cells from a single parent cell may not necessarily be identical to the initial parent cell (in morphology or genomic composition).

[0033] As used herein, "plasmid" or "expression vector" refers to an expression construct used for cloning and gene expression, containing a region encoding a target polypeptide or RNA. A "plasmid" is a type of vector that refers to a circular double-stranded DNA loop to which additional DNA segments can be attached. In this specification, "plasmid," "plasmid vector," and "expression vector" are used interchangeably because plasmids are the most commonly used form of vector. The term "expression vector" means a vector capable of directing the expression of a specific nucleotide sequence in a suitable host cell. An expression vector contains a regulatory nucleic acid element operatively linked to a target nucleic acid, optionally operatively linked to a termination signal and / or other regulatory elements. Control elements and combinations of one or more genes operatively linked to control elements for expression are sometimes referred to as "expression cassettes." Many expression cassettes are known and available in the art, or can be readily constructed from components available in the art.

[0034] As used interchangeably in this document, "recombinant" polynucleotide or amino acid sequence can refer to the nucleotide or amino acid sequence of a product of various combinations of procedures, including cloning, restriction, and / or ligation steps, and other procedures that produce constructs with polynucleotide or amino acid sequences different from those naturally occurring. Recombinant viruses are viral particles containing recombinant polynucleotides.

[0035] As used herein, the term “exogenous” means any entity introduced or already introduced into an organism or cell. For example, a “exogenous nucleic acid” is a nucleic acid derived from outside an organism or cell. In some embodiments, the exogenous nucleic acid in a mammalian cell has been introduced across the cell membrane (e.g., artificially). In some embodiments, the exogenous nucleic acid may be or comprise a nucleotide sequence present in the natural genome in a non-natural context (e.g., at a different location and / or under the control of a non-natural expression element). In some embodiments, the exogenous nucleic acid may be or comprise a nucleotide sequence not previously present in the genome of an organism or cell (e.g., from a different organism). Exogenous nucleic acids include exogenous genes. A “exogenous gene” is a nucleic acid or its sequence that has been introduced into an organism or cell (e.g., through transformation / transfection) that encodes the expression of RNA and / or proteins, and is also referred to herein as a “transgenic gene.”

[0036] As used herein, the term "extrachromosomal" refers to genetic material not contained within chromosomes. In the context of mammalian cells, chromosomes include nuclear chromosomes and mitochondrial chromosomes. Extrachromosomal genetic material includes free-floating genetic material.

[0037] As used herein, the term "gene" or "genes" refers to a DNA sequence in a chromosome that encodes a gene product (e.g., an RNA product, or a polypeptide product). In some embodiments, a gene includes a coding sequence (i.e., a sequence that encodes a specific product). In some embodiments, a gene includes a non-coding sequence. In some specific embodiments, a gene may include both coding (e.g., exons) and non-coding (e.g., introns) sequences. In some embodiments, a gene may include one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences that, for example, control or influence one or more aspects of gene expression (e.g., cell type-specific expression, inducible expression, etc.). As used herein, the term "gene" generally refers to a portion of a nucleic acid that encodes a polypeptide or a fragment thereof; the term may optionally include regulatory sequences, as will be apparent from the context to those skilled in the art. This definition is not intended to exclude the application of the term "gene" to non-protein-coding expression units, but rather to clarify that, in most cases, the term as used herein refers to a nucleic acid that encodes a polypeptide. In some implementations, the gene may encode a polypeptide, but the polypeptide may not be functional; for example, a gene variant may encode a polypeptide that does not function in the same way or does not function at all, relative to the wild-type gene.

[0038] As used in this article, the term "genome" refers to all the genetic information carried by an organism or cell, represented by the complete nucleic acid sequence of its chromosomes.

[0039] As used herein, the term "guide sequence" refers to the nucleic acid sequence corresponding to a guide RNA used for nuclease-mediated editing (e.g., with an RNA-guided nuclease). The terms "guide RNA," "gRNA," and "single guide RNA" or "sgRNA" refer to any nucleic acid in a cell that promotes the specific binding (or "targeting") of RNA-guided nucleases (e.g., Cas9 or Cpfl) to a target sequence (e.g., a genome or free sequence). gRNAs can be single-molecule (containing a single RNA molecule and also referred to as sgRNA) or modular (containing more than one, and often two separate RNA molecules, such as crRNA and tracrRNA, which are typically bound together, for example, by a double helix). Guide RNAs, whether single-molecule or modular, include "guide sequences" that are fully or partially complementary to a sequence within the target (e.g., a DNA sequence in the genome of the cell to be edited). Guide sequences are referred to in the literature by various names, including but not limited to “targeting domain,” “complementary region” (e.g., WO 2016 / 073990 by Cotta-Ramusino et al.), “spacer region” (e.g., Briner et al., Molecular Cell 56(2), 333-339, October 23, 2014), and generally referred to as “crRNA” (e.g., Jiang et al., Nat Biotechnol. 2013 Mar; 31(3):233-239). Regardless of the name given to them, guide sequences are typically about 10 to 30 nucleotides long. In some embodiments, guide sequences are 15 to 25 nucleotides long. In some embodiments, guide sequences are 16 to 24 nucleotides long (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides long). In some embodiments, the guide sequence is located at or near the 5' end of the gRNA (e.g., for Cas9 or nucleases derived from or obtained therefrom). In some embodiments, the guide sequence is located at or near the 3' end of the gRNA (e.g., for Cpfl or nucleases derived from or obtained therefrom).

[0040] As used herein, “identifier” or “barcode” refers to an element that is (i) detectable (e.g., by next-generation sequencing) and (ii) capable of identifying mammalian cells or cloned cell lines from which viral vectors are produced and / or obtained. This disclosure provides identifiers for sharing and / or transfer between mammalian cells and viral vectors. In some embodiments, the identifier comprises a nucleic acid sequence. In some embodiments, the identifier comprises one or more barcodes, one or more library variants, or a combination thereof. In some embodiments, the identifier comprises a detectable sequence, for example, by PCR (e.g., quantitative PCR), hybridization (e.g., using probes), and / or sequencing (e.g., next-generation sequencing and / or Sanger sequencing). In some embodiments, the identifier is or is contained in a nucleic acid sequence shared and / or transferred between mammalian cells and viral vectors. In some embodiments, the identifier is included in a library construct (e.g., for introduction into mammalian cells). In some embodiments, the identifier is included in a library construct between genetic structures (e.g., viral repetitive sequences, such as AAV ITR sequences) suitable for packaging the identifier into a viral vector. In some embodiments, the identifier is present in the genome of the viral vector (e.g., between viral repetitive sequences). In some embodiments, the detection of identifiers in the genome of a viral vector (e.g., between viral repetitive sequences) is associated with mammalian cells or clonal cell lines from which the viral vector was produced or obtained. In some embodiments, the detection of identifiers in the genome of a viral vector (e.g., between viral repetitive sequences) is associated with the presence of one or more library constructs and / or one or more library variants, said library constructs and / or library variants, which are associated with mammalian cells or clonal cell lines from which the viral vector was produced or obtained. In some embodiments, the provided method may include the step of sequencing the identifiers (e.g., using next-generation sequencing methods) to determine the relative abundance of a particular viral vector in a viral vector pool or sample.

[0041] As used herein, the term "RNA-guided nuclease" refers to a polypeptide that binds to a specific target nucleotide sequence in a sequence-specific manner and is guided to the target nucleotide sequence by a guide RNA molecule that is complexed with the polypeptide and hybridizes to the target sequence. While RNA-guided nucleases can cleave the target sequence upon binding, the term RNA-guided nuclease also includes nuclease-inactivated RNA-guided nucleases that can bind but not cleave the target sequence. Cleavage of the target sequence by an RNA-guided nuclease can create a single-stranded or double-stranded nick. RNA-guided nucleases capable only of cleaving single-stranded double-stranded nucleic acid molecules are referred to herein as nickases. In some embodiments, the RNA-guided nuclease is or is derived from Cas9, CasZ, Cpfl, and / or Fokl.

[0042] As used herein, the terms “transformation” or “transfection” refer to any process that introduces foreign DNA into a host cell (e.g., a mammalian host cell). Transformation can be performed under natural or artificial conditions using a variety of methods well known in the art. Transformation can rely on any known method for inserting a foreign nucleic acid sequence into a prokaryotic or eukaryotic host cell. In some embodiments, a specific transformation method is selected based on the host cell being transformed, and may include, but is not limited to, viral infection or transduction, electroporation, and lipid transfection. In some embodiments, the “transformed” cells are stably transformed because the inserted DNA is capable of replicating as an autonomously replicating plasmid or as part of the host chromosome. In some embodiments, the transformed cells transiently express the introduced nucleic acid for a defined time period.

[0043] The method of the present invention This invention provides a method for producing adeno-associated virus (AAV) vectors, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culture the host cells to produce recombinant AAV (rAAV); The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0044] This invention provides a method for producing adeno-associated virus (AAV) vectors, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culturing the host cells to produce recombinant AAV (rAAV); wherein the host cells are host cells as described herein.

[0045] Unmodified cells can be cells of the same cell type as modified host cells but without any additional modifications.

[0046] The method may further include a step of harvesting rAAV. Therefore, in one embodiment, the present invention relates to a method for producing adeno-associated virus (AAV) vectors, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culturing the host cells to produce recombinant AAV (rAAV); and c) Harvest rAAV; The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0047] The method may further include a step of determining the yield of rAAV. Therefore, in one embodiment, the present invention relates to a method for producing an adeno-associated virus (AAV) vector, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culture the host cells to produce recombinant AAV (rAAV); c) Harvesting rAAV; and d) Determine the yield of rAAV; The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0048] The method may further include the step of providing a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production. Therefore, in one embodiment, the present invention relates to a method for producing an adeno-associated virus (AAV) vector, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Add a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production; c) Culture the host cells to produce recombinant AAV (rAAV); d) Harvest rAAV; and e) Determine the yield of rAAV; The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0049] Therefore, in one embodiment, the present invention relates to a method for producing an adeno-associated virus (AAV) vector, the method comprising the following steps in sequence: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Add a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production; c) Culture the host cells to produce recombinant AAV (rAAV); d) Harvest rAAV; and e) Determine the yield of rAAV; The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0050] In another embodiment, the present invention relates to a method for producing an adeno-associated virus (AAV) vector, the method comprising the following steps in sequence: a) Add a nucleic acid construct containing AAV helper and packaging elements required for AAV production to the host cell; b) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR); c) Culture the host cells to produce recombinant AAV (rAAV); d) Harvest rAAV; and e) Determine the yield of rAAV; The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0051] In one embodiment, the present invention relates to a method for producing an adeno-associated virus (AAV) vector, the method comprising: a) Provide host cells as described herein; b) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; c) Optionally, add a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production; d) Culture the host cells to produce recombinant AAV (rAAV); e) Harvest rAAV; and f) Determine the yield of rAAV.

[0052] In one embodiment of the method described above in this invention, the gene is selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, and APP.

[0053] In one embodiment of the method described above in this invention, the gene is selected from CASP8, CAPN11, NELFCD, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, and PAF1.

[0054] In one embodiment of the method described above in this invention, the gene is selected from IL6, FGF2, NELFE, NELFB, PAF1, and CAPN2.

[0055] In one embodiment of the method described above in this invention, the gene is selected from PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, L3HYPDH, VPS26B and TPM3.

[0056] In a further embodiment of the method described above, the host cell has been modified or otherwise caused to exhibit reduced or increased expression of any two genes selected from IL6, CAPN2, FGF2, CASP8, CAPN11, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, NELFCD, BRD4, and PAF1. Preferably, the two genes are selected from the following pairs: IL6 and CAPN2, FGF2 and CASP8, CAPN11 and CASP8, PLEKHA1 and ABHD6, NR2C2 and TAF11, HSPBP1 and TAF11, LSM10 and TPM3, VSP26B and L3HYPDH, NELFE and NELFB, NELFCD and BRD4, NELFCD and PAF1, or NELFCD and CASP8.

[0057] In other embodiments of the method of the present invention, the host cell has been modified in any other manner as described herein with respect to the host cell of the present invention.

[0058] In one embodiment of the invention, the host cells exhibiting reduced or increased gene expression do not contain any structural modifications. Instead, the reduction or increase in gene expression is caused by the addition of one or more inhibitors or stimulants of gene expression, respectively, to the cell culture. The selected inhibitor or stimulant may depend on the specific gene for which altered expression is sought. For each gene described herein, those skilled in the art will understand the various inhibitors and stimulants that can be applied in the methods of the invention.

[0059] Nucleic acid constructs Nucleic acid constructs can be added to host cells using any suitable method. Those skilled in the art understand methods for transferring nucleic acids into cultured cells. In one embodiment, the nucleic acid construct is added using transfection, transduction, or electroporation. Preferably, transfection or transduction is used to add the nucleic acid construct.

[0060] In one implementation, the nucleic acid construct is a viral vector. In a specific implementation, the nucleic acid construct is a recombinant viral vector.

[0061] The nucleic acid construct contains an AAV inverted terminal repeat (ITR). In one embodiment, the ITR is a naturally occurring AAV ITR. In another embodiment, the ITR is a synthetic AAV ITR. In one embodiment, the AAV ITR is derived from an AAV selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13. In one embodiment, the AAV ITR is derived from an AAV selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13, or a synthetic variant thereof.

[0062] In one embodiment, the ITR is located on the flank of the gene expression cassette. In one embodiment, the gene expression cassette contains a transgene and a regulatory element. In one embodiment, the transgene is a therapeutic transgene.

[0063] In one embodiment, a nucleic acid construct containing an AAV inverted terminal repeat (ITR) is added using a method selected from transfection, transduction, or electroporation. In a preferred embodiment, transfection is used to add the nucleic acid construct containing the AAV inverted terminal repeat (ITR). The nucleic acid construct containing the AAV inverted terminal repeat (ITR) can be stably integrated into the host cell.

[0064] In one embodiment, a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production is added using a method selected from transfection, transduction, or electroporation. In a preferred embodiment, transfection is used to add the nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production. The nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production can be stably integrated into host cells.

[0065] host cell culture In one embodiment, the host cell is a mammalian cell. In one embodiment, the host cell is a recombinant mammalian cell. In one embodiment, the host cell is a recombinant human cell. In one embodiment, the host cell is an isolated host cell.

[0066] The AAV helper and packaging elements required for AAV production can be stably integrated into the host cell. In one embodiment, the host cell contains stably integrated AAV cap and rep genes.

[0067] The host cell may further contain a stably integrated Cas9 nuclease. Therefore, in one embodiment, the host cell contains stably integrated AAV cap and rep genes, as well as a stably integrated Cas9 nuclease.

[0068] In the context of this disclosure, any suitable host cell known in the art may be modified. The host cell used to express the viral vector may include any host cell type known in the art. Representative host cell types include, but are not limited to, human embryonic kidney (HEK) cells (e.g., HEK 293 cells, HEK 293T cells, Expi293 cells), Chinese hamster ovary (CHO) cells, HeLa cells (e.g., HeLa S3 cells), PER.C6 cells, HKB11 cells, CAP cells, young hamster kidney fibroblasts (BHK cells) (e.g., BHK-21 cells), mouse myeloma cells (e.g., Sp2 / 0 cells and NSO cells), African green monkey kidney cells (e.g., COS cells and Vero cells), A549 cells, rhesus monkey fetal lung cells (e.g., FRhL-2 cells), and any derivatives thereof. In some embodiments, the host cell may support the rAAV lifecycle.

[0069] Host cells used for rAAV production are known in the art. Representative examples of such cells include, but are not limited to, human embryonic kidney (HEK) 293 cells and their derivatives (e.g., 293T strain, 293SF-3F6 strain), HeLa cells, A549 cells, KB cells, CKT1 cells, NIH / sT3 cells, Vero cells, Chinese hamster ovary (CHO) cells, or any eukaryotic cell that supports the rAAV life cycle.

[0070] In some embodiments, the host cell is a CHO cell. CHO cells have different lineages, including CHO-K1, CHO-S, CHO-DG44, and CHO-DXB1. In some embodiments, the host cell is a HEK 293 cell. In some embodiments, the host cell is a HEK 293 T cell. In some embodiments, the host cell is a HeLa cell.

[0071] In some embodiments, the host cells of this disclosure are suitable for adherent cell culture. In some embodiments, the host cells are cultured in an adherent cell culture medium. In some embodiments, the host cells can be grown under serum-free conditions.

[0072] In some embodiments, the host cells of this disclosure are suitable for suspension cell culture. In some embodiments, host cells suitable for suspension cell culture are CHO cells (e.g., CHO-K1, CHO-S, CHO-DG44, and / or CHO-DXB11 cells), HEK 293 cells (e.g., 293SF, 3F6, 293T), HeLa cells, and their derivatives. In some embodiments, the host cells can be cultured in suspension under serum-free conditions. In some embodiments, HEK293 cells have the ability to grow in suspension under serum-free conditions.

[0073] In some embodiments, the host cells are cultured in a suspension cell culture manner. In some embodiments, the host cells used for suspension cell culture are suitable for large-scale culture (e.g., >1 L, >2 L, >3 L, >4 L, >5 L, >10 L, >20 L, >30 L, >40 L, >50 L, >60 L, >70 L, >80 L, >90 L, >100 L, >200 L, >300 L, >400 L, or >500 L).

[0074] In some embodiments, the host cells of this disclosure are suitable for the preparation of biological agents (e.g., viral vectors). In some embodiments, the host cells are suitable for the industrial-scale preparation of biological products. In some embodiments, the host cells are suitable for preparation methods that comply with local regulatory standards (e.g., FDA and / or EMA regulatory standards). In some embodiments, the host cells are suitable for the preparation of biological agents (e.g., viral vectors) using current Good Manufacturing Practices (cGMP). In some embodiments, the host cells are suitable for the preparation of biological agents (e.g., viral vectors) using Good Manufacturing Practices (GMP). In some embodiments, the host cells are suitable for the preparation of biological agents (e.g., viral vectors) using non-Good Manufacturing Practices (non-GMP).

[0075] Harvesting of viral vectors Use any suitable method known in the art to culture host cells expressing the viral vector and to produce and harvest the viral vector.

[0076] Host cells expressing viral vectors can be cultured in batch, fed-batch, or continuous manner. Host cells expressing viral vectors can be cultured in suspension in shake flasks, fermenters, or bioreactors, or attached to solid vectors. After culture, host cells and / or supernatants can be harvested using methods known in the art, and nucleic acids can be isolated and purified from suitable fractions.

[0077] In some embodiments, the viral vector is harvested from the host cell. In some embodiments, the viral vector is harvested after a sufficient period of expression in the host cell, the time of which may be varied depending on the host cell type and culture conditions.

[0078] In some implementations, all viral vectors produced by the host cells are harvested. In other implementations, viral vectors produced by the host cells are harvested at time intervals. For example, viral vectors may be harvested daily, every two days, every three days, or at longer intervals to evaluate viral vector yield over time.

[0079] In some embodiments, the viral vector is harvested when the host cells reach a cell density within a specific range. In some embodiments, the viral vector is harvested after a specific time period. In some embodiments, the viral vector is harvested between 12 hours or 24 hours and 2 weeks post-transfection. In some embodiments, the viral vector is harvested from cell culture medium. In some embodiments, the host cells are lysed during the harvesting of the viral vector. In some embodiments, the viral vector is harvested when the host cells produce at least a threshold level of viral vector. In some embodiments, the host cells may be washed and the viral vector harvested after an extended time period (e.g., to evaluate sustained production of the viral vector). In some embodiments, the viral vector nucleic acid (e.g., which includes an identifier) ​​is isolated from the viral vector.

[0080] rAAV yield In one implementation, when compared with the rAAV yield obtained from unmodified host cells, reducing or increasing the expression of one or more genes leads to an increase in rAAV yield.

[0081] Methods for determining rAAV yield are known in the art. In one embodiment, rAAV yield is determined by measuring the rAAV titer.

[0082] In one implementation, the rAAV yield is increased to at least 1.2-fold, at least 1.5-fold, at least 1.7-fold, at least 2-fold, at least 2.2-fold, at least 2.5-fold, at least 2.7-fold, or at least 3-fold when compared to the rAAV yield obtained from unmodified host cells.

[0083] In one implementation, the rAAV yield is increased to at least 2-fold when compared to the rAAV yield obtained from unmodified host cells.

[0084] In one embodiment, the rAAV yield increases to between 1.2 and 3 times when compared to the rAAV yield obtained from unmodified host cells. In another embodiment, the rAAV yield increases to between 1.2 and 3 times, between 1.2 and 2.5 times, between 1.2 and 2 times, between 1.2 and 1.5 times, between 2 and 2.5 times, and between 2 and 3 times when compared to the rAAV yield obtained from unmodified host cells.

[0085] In some embodiments, the provided methods and techniques include sequencing of the rAAV vector nucleic acid. In some embodiments, the rAAV vector nucleic acid is quantified prior to sequencing. In some embodiments, the rAAV vector nucleic acid is not quantified prior to sequencing. Any suitable sequencing method in the art can be used.

[0086] In some embodiments, the titer of the purified rAAV vector is determined. In some embodiments, quantitative PCR is used to determine the titer. In some embodiments, a TaqMan probe specific to the construct is used to determine the construct level. In various embodiments, the methods and techniques provided include an amplification step in which the rAAV vector nucleic acid material (or a portion thereof, such as an identifier) ​​is amplified. While any amplification reaction suitable for application is considered compatible with some embodiments, by way of specific examples, in some embodiments the amplification step may be or include polymerase chain reaction (PCR), rolling circle amplification (RCA), multiplex displacement amplification (MDA), isothermal amplification, and any combination thereof.

[0087] Gene The gene symbols used in this article refer to the following genes and Human Genome Organization Gene Nomenclature Committee (HGNC) identification numbers: ARCN1, archain 1, HGNC:649 CAPN11, Calpain 11, HGNC:1478 TAF7, TATA box-binding protein-associated factor 7, HGNC:11541 CASP8, Cystatin 8, HGNC:1509 DNAJA1, A1 (a member of the DNAJ heat shock protein family Hsp40), HGNC:5229 GFRA1, GDNF family receptor α1, HGNC:4243 PROL1, opiorphin precursor / proline enriched protein 1, HGNC:17279 RCN1, Reticulocalcium-binding protein 1, HGNC:9934 SLC25A35, member 35 of the solute carrier family 25, HGNC:31921 SETD8, lysine methyltransferase 5A / lysine methyltransferase 8 containing the SET domain, HGNC:29489 ERAP1, endoplasmic reticulum aminopeptidase 1, HGNC:18173 TINF2, TERF1 interacting nuclear factor 2, HGNC:11824 ATP6V0E2 ATPase H+ transport V0 subunit e2, HGNC:21723 PRICKLE3, spiky plana cell polar protein 3, HGNC:6645 MTHFD1, methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthase 1, HGNC:7432 SHCBP1, SHC-binding and spindle-associated protein 1, HGNC:29547 ENGASE, endo-β-N-acetylglucosidase, HGNC:24622 NELFCD, negative elongation factor complex member C / D, HGNC:15934 FBXL14, F box and leucine-enriched repeat protein 14, HGNC:28624 BRD4, Bromine-containing domain protein 4, HGNC:13575 TRIAP1 and TP53 regulate apoptosis inhibitory factor 1, HGNC:26937 APP, amyloid-β precursor protein, HGNC:620 IL6, Interleukin-6, HGNC:6018 CAPN2, Calpain 2, HGNC:1479 FGF2, fibroblast growth factor 2, HGNC:3676 PLEKHA1, protein A1 containing the Plekk substrate homology domain, HGNC:14335 ABHD6, protein 6 containing AB hydrolase domain, HGNC:21398 NR2C2, nuclear receptor subfamily 2, group C member 2, HGNC:7972 TAF11, TATA box-binding protein-associated factor 11, HGNC:11544 HSPBP1, HSPA (Hsp70) binding protein 1, HGNC:24989 LSM10, LSM10 U7 small nuclear RNA-associated protein, HGNC:17562 TPM3, Tropomyosin 3, HGNC:12012 VPS26B, VPS26 Reverse Transport Complex Component B, HGNC:28119 L3HYPDH, L-3-hydroxyproline dehydratase, HGNC:33854 NELFE, Negative Elongation Factor Complex Member E, HGNC:13974 NELFB, Negative Elongation Factor Complex Member B, HGNC:24324 PAF1, PAF1 homolog, Paf1 / RNA polymerase II complex component, HGNC:25459 TRIAP1 and TP53 regulate apoptosis inhibitory factor 1, HGNC:26937 DDX52, DEAD box helicase 52, HGNC:21700 RECQL5, RecQ-like helicase 5, HGNC:9950 DAP3, death-associated protein 3, HGNC:2673 CUL2, cullin 2, HGNC:2552 WIBG, within bgcn homologs, HGNC:30258 ACVR1C, activin A receptor type 1C, HGNC:18123 host cells In another aspect, the present invention provides a host cell that, compared with an unmodified host cell, has been modified to exhibit reduced or increased expression of one or more genes, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0088] Therefore, in one embodiment, compared with unmodified host cells, the host cells have been modified to show reduced or increased expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all genes, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6VOE2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1 APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG and ACVR1C.

[0089] In one embodiment, the host cell has been modified to exhibit reduced expression of one or more genes compared to the unmodified host cell, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8.

[0090] In one embodiment, the host cell has been modified to exhibit reduced expression of one or more genes compared to the unmodified host cell, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8.

[0091] In one embodiment, the host cell has been modified to show reduced expression of one or more genes, selected from ARCN1, CAPN11, TAF7, CASP8, and DNAJA1, compared to an unmodified host cell.

[0092] In one embodiment, the host cell has been modified to show reduced expression of one or more genes compared to the unmodified host cell, said genes being selected from IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8.

[0093] In one implementation, the host cells have been modified to show reduced expression of ARCN1 or CAPN11 compared to unmodified host cells.

[0094] In one implementation, the host cells have been modified to show increased expression of TRIAP1, APP, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and / or ACVR1C compared to unmodified cells.

[0095] In another embodiment, the host cells are modified to exhibit reduced expression of one or more genes selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6VOE2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, and BRD4; and / or increased expression of TRIAP1 and / or APP, compared to unmodified cells.

[0096] In one embodiment, the host cell is modified to exhibit reduced or increased expression of one or more genes selected from CASP8, CAPN11, NELFCD, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

[0097] In one embodiment, the host cell is modified to show reduced or increased expression of one or more genes selected from IL6, FGF2, NELFE, NELFB, PAF1, and CAPN2.

[0098] In one embodiment, the host cell is modified to exhibit reduced or increased expression of one or more genes selected from PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, L3HYPDH, VPS26B, and TPM3.

[0099] In one embodiment, the host cell is modified to show reduced or increased expression of any two genes selected from IL6, CAPN2, FGF2, CASP8, CAPN11, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, NELFCD, BRD4, and PAF1. Most preferably, the two genes are selected from the following pairs: IL6 and CAPN2, FGF2 and CASP8, CAPN11 and CASP8, PLEKHA1 and ABHD6, NR2C2 and TAF11, HSPBP1 and TAF11, LSM10 and TPM3, VSP26B and L3HYPDH, NELFE and NELFB, NELFCD and BRD4, NELFCD and PAF1, or NELFCD and CASP8.

[0100] Different genetic engineering methods for reducing the expression of one or more genes are known to technicians.

[0101] In one embodiment, the reduction in expression of one or more genes is caused by gene knockout. Therefore, the modified host cell contains the knockout of the genes or combinations of genes indicated above. In one embodiment, the knockout is a complete knockout. Knockout can be achieved via CRISPR / Cas, TALEN, or zinc finger techniques, or via random mutagenesis. Preferably, complete knockout is achieved via CRISPR / Cas.

[0102] In another embodiment, the reduction in the expression of one or more genes is caused by downregulating gene expression through RNA interference (also known as knockdown). Therefore, in one embodiment, the reduction in the expression of one or more genes is caused by siRNA knockdown.

[0103] In one embodiment, increased expression of one or more genes is caused by the presence of non-endogenous nucleic acid sequences. Therefore, the modified host cell contains non-endogenous nucleic acid sequences of the genes or gene combinations indicated above. In one embodiment, the modified host cell contains extrachromosomal nucleic acid sequences of the genes or gene combinations indicated above.

[0104] Technicians understand methods of genetic engineering that lead to increased gene expression. In one implementation, a nucleic acid sequence encoding the gene or combination of genes indicated above is inserted via random transgene insertion.

[0105] In one implementation, the increased expression of one or more genes is driven by a ubiquitous promoter. In another implementation, the increased expression of one or more genes is driven by a CMV promoter. Example

[0106] Materials and methods Lentiviral-AAV-CRISPR Library Design and Construction The aim of this study was to identify cellular genes that affect rAAV production capacity after inactivation in stable AAV-producing cell lines under examination. This effect was analyzed by observing the relative change in the number of AAV expression cassettes integrated into the genome to the number of AAV expression cassettes packaged. To achieve genome-wide inactivation, we inserted sgRNA libraries into AAV expression cassettes. We used an sgRNA library from the Toronto human knockout merged library (TKOv3) vector pLCKO2 [1] (addgene plasmid #125517), which contained approximately 70.948 sgRNAs for 18,503 genes. This enabled the inactivation of cellular genes after the expression cassettes were integrated into the genome of the producing cells, and also enabled the use of the sgRNAs as barcodes for subsequent identification of genes that lead to increased or decreased rAAV titers. However, for the purpose of this study, it was important that only one AAV expression cassette was integrated per cell to track the effect on individual genes, which was achieved by lentiviral transduction with a low MOI. For this purpose, we developed a lentiviral-AAV-CRISPR library vector (LAC library) for packaging AAV-sgRNA libraries into lentiviruses and subsequently transducing rAAV packaging cell lines to produce rAAV particles containing sgRNA. This vector contains all the necessary lentiviral elements, such as long terminal repeats (LTRs), HIV-1 packaging signals (Ψ), marmot hepatitis virus post-transcriptional response elements (WPREs), and rev response elements (RREs). Between the two LTRs, the library plasmid contains two inverted terminal repeats (ITRs), which are essential for rAAV genome replication and packaging. The expression cassette, located between all the lentiviral and AAV elements, consists of an sgRNA library controlled by the U6 promoter and a reporter gene (eGFP) controlled by the CMV promoter.

[0107] Carrier construction for stable Cas9 integration To enable genome-wide CRISPR-mediated inactivation in our AAV-producing cells, we stably integrated the Cas9 protein required for inactivation and generated a clonal stable Cas9-AAV-producing cell line (CAP). Cas9-AAV To ensure stable integration of the Cas9 coding gene, we developed an integration vector (pCas9_ZeoR) containing the Cas9 gene under CMV promoter control and the zeocin resistance (ZeoR) gene under ubiquitin C (UbC) promoter control.

[0108] Cell culture, transfection, and stable cell line production All CAP®-based cell lines used (CEVEC Pharmaceuticals GmbH) were grown in complete growth medium-protein expression medium (PEM, Gibco™) supplemented with 4 mM L-alanyl-L-glutamine (GlutaMAX™ Supplement, Gibco™) and cultured in 15 ml working volumes in 125 ml Erlenmeyer flasks (Corning) at 37°C and 5% CO2 in a shaking incubator at 120 rpm. Cells were passaged every 3–4 days. For stable integration of the transgenic cassette, cells were transfected using the Nucleofector Kit V (Lonza) as recommended by the manufacturer. 1 x 10 7 Each cell was transfected with a total of 5 µg of DNA. After transfection, cells were incubated in 12.5 ml of complete growth medium at 37°C, 5% CO2, and 120 rpm for 96 hours, followed by the selection process. To generate a stable cell pool, four days post-transfection, cells were selected with an appropriate selection antibiotic added to the complete growth medium at an initial concentration of 1 x 10⁻⁶ at maximum culture volume. 6 Seed cells at 100 cells / ml. Change the medium every 3–4 days during selection. To isolate single cells from the stable cell pool, apply a limiting dilution step in 96-well plates. A calculated cell concentration of 0.5 cells / 200 µl well is used to ensure single-cell isolation. Examine the resulting colonies under a microscope after 7 days. Only clones in wells with a single, round colony are further grown and used for downstream analysis.

[0109] Western blot assay In order to generate a stable CAP Cas9-AAV After cell production, successful expression of the Cas9 protein was verified through Western blotting experiments. For this purpose, CAP... Cas9-AAV and CAP AAV Cells were lysed using RIPA buffer (Santa Cruz Biotechnology), and protein concentrations were determined using the Bradford assay (Carl Roth). Samples were then denatured and separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad). The PVDF membranes were blocked with blocking buffer (5% skim milk / TBS-T) and incubated with anti-Cas9 (CellSignaling) and anti-GAPDH (Santa Cruz) antibodies.

[0110] Next, the membrane was washed with TBS-T and incubated with H-conjugated anti-mouse IgG (CellSignaling) diluted in 5% skim milk. Fluorescence images were obtained using Bio-Rad ChemiDoc (Bio-Rad).

[0111] Lentiviral AAV-CRISPR library preparation To facilitate the integration of an AAV-sgRNA library into CAP packaging cell lines via lentiviral transduction, a lentiviral AAV-sgRNA library was generated. CAP-T cells (CEVEC Pharmaceuticals GmbH) were transfected with the second-generation packaging plasmid psPAX2 (Addgene plasmid #12260), a plasmid encoding VSV-G (addgene plasmid #12259), and a pLAC plasmid library containing the AAV-sgRNA library. Lentiviral cells were harvested after incubation at 37°C, 5% CO2, and 185 rpm for 48 h. The cell supernatant was collected by centrifugation and filtration through a 0.45 µm PES filter. The clarified supernatant was incubated with 7.5 U / ml DENERASE® (c-LEcta GmbH) at 37°C for 2 h. Following this step, the lentivirus was concentrated by incubation with LentiFuge™ Virus Concentrator (Cellecta Inc.) for 2 h followed by centrifugation at 15,000 xg for 1 h. The precipitated virus was resuspended in complete growth medium and stored at -80°C. To determine the functional titer (TU / ml) of the lentiviral library, 5 x 10⁻⁶ ppm was added. 5 CAP Cas9-AAV Cells were transferred to 15 ml conical tubes and transduced with serially diluted lentiviral vector via centrifugation. For each transduction, 0.5 ml of a transduction mixture containing concentrated lentiviral vector, 12 µg / ml polybrene (Sigma), and complete growth medium was transferred to the cells. Infection was performed by centrifugation at 37°C and 800 xg for 1 h. After centrifugation, cells were resuspended in the transduction mixture, transferred to 24-well plates, and incubated statically for an additional 3 h. Three h after induction, the medium was replaced with fresh complete growth medium, and the cells were incubated statically for 48 h. The percentage of eGFP-positive cells was determined using a BD Accuri™ C6 flow cytometer (Becton Dickinson, BD, Franklin Lakes, NJ, USA). Functional titers were determined by multiplying the mean number of eGFP-positive cells by the number of transduced cells and dividing by the volume of lentivirus added.

[0112] Implementing whole-genome CRISPR / Cas9 screening methods CAP Cas9-AAVCells were transduced via centrifugation at a low MOI of 0.2–0.3. To ensure a minimum 200-fold coverage of the LAC-library, a total of 5 x 10⁻⁶ cells were used. 7 One cell was used for transduction. 5 x 10 cells were used in 5 ml of complete growth medium. 6 The number of transduction methods was calculated using a transduction mixture of cells, lentiviral vector, and 12 µg / ml polyglobulin (Sigma). Infection was performed by centrifugation at 37°C and 800 xg for 1 h. After centrifugation, cells were resuspended in the transduction mixture, and all methods were combined. The combined cells were transferred to 125 ml shake flasks and incubated for 3 h. After the incubation time, the medium was replaced with fresh complete growth medium. Cells were incubated at 37°C, 5% CO2, in a shaking incubator at 120 rpm. After 48 h, the percentage of eGFP-positive cells was determined using a BD Accuri™ C6 flow cytometer (Becton Dickinson, BD, Franklin Lakes, NJ, USA) to validate the target MOI. Nine days post-transduction, cells were harvested based on the percentage of eGFP-positive cells equal to 200-fold library coverage. A cell pellet (genomic sample at t0 before induction) was produced for genomic DNA extraction by harvesting, centrifugation, and storage at -80°C.

[0113] Adjust the remaining cells to 3 x 10 6 Cells / ml were induced with 1 µg / ml doxycycline. 96 h post-induction, the supernatant was collected by centrifugation, yielding the rAAV vector. The remaining cell pellet was lysed by three freeze / thaw cycles (80°C / 37°C). The lysate was centrifuged at 11,000 xg for 15 min at 4°C, and the supernatant was added to the previously collected viral supernatant. The supernatant containing rAAV was incubated with 25 U / ml DENERASE® (c-LEcta GmbH) at 37°C for 2 h and filtered through a 0.45 µm PES filter. The rAAV vector in the supernatant was precipitated using 8% v / v PEG and 0.4 mM NaCl. The mixture was incubated at 4°C for 24 h, and then the rAAV vector was precipitated by centrifugation at 3,000 xg, 4°C for 15 min. The viral pellet was resuspended in PBS + 0.01% Pluronic F-68 (Thermo Scientific) and stored at -80°C until further analysis.

[0114] rAAV titer determination Quantification of the rAAV vector titer containing the genome was performed using droplet digital PCR (ddPCR). rAAV samples were incubated with an additional DNase I treatment (60 U) at 37°C for 2 h to remove residual unpackaged DNA, followed by proteinase K treatment at 55°C for 1 h and enzyme inactivation at 95°C for 15 min to release the rAAV genome from the capsid. Samples were diluted in sample dilution buffer. Droplet generation, PCR, and droplet analysis were performed using the QX200™ droplet digital PCR system (Bio-Rad), and absolute quantification of the rAAV genome (copies / µl) was determined using Quantasoft analysis software (Bio-Rad). The genome was detected using a primer / probe mixture targeting the eGFP sequence of the rAAV expression cassette (eGFP_fw 5' TTCTTCAAGTCCGCCATGCC 3', eGFP_rv 5' AAGTCGATGCCCTTCAGCTC 3', eGFP_probe 5' CGCACCATCTTCTTCAAGGACGACGGCAACTACA 3'). Each condition was run in three replicates.

[0115] Genomic DNA extraction Genomic DNA was isolated using the NucleoSpin® Tissue Miniature Kit (Macherey-Nagel), according to the manufacturer's protocol. 5 x 10 6 CAP® cells were washed once with DPBS. Genomic DNA was eluted from the column with 5 mM Tris / HCl pH 8.5 and stored at -20°C. DNA concentration was determined using a NanoPhotometer® N60 (Implen).

[0116] For large-scale genomic DNA isolation, a modified protocol (Moffat CRISPR Screen Protocol) was used with the Wizard® Genomic DNA Purification Kit (Progen). For this purpose, 5 x 10 7One cell was resuspended in 1.4 ml DPBS and 5000 µl of nuclear lysis solution containing 100 µg / ml RNase A was added. The sample was incubated at 37°C for 15 min, followed by the addition of 1670 µl of protein precipitation solution. The sample was vortexed and centrifuged at 4.500 xg for 10 min. The supernatant was transferred to a new tube, and genomic DNA was precipitated by adding 5000 µl of isopropanol and inverting the sample. The genomic DNA was precipitated by centrifuging at 4.500 xg for 5 min, the supernatant was discarded, and the DNA precipitate was washed with 5000 µl of 70% ethanol. After centrifugation, the ethanol was removed, and the DNA precipitate was air-dried for 10 min. Finally, the genomic DNA was reconstituted in 1000 µl of DNA reconstituted solution and stored at -80°C for further analysis.

[0117] Next-generation sequencing library preparation and NextSeq Illumina sequencing To identify and quantify the distribution of the LAC library integrated into the genomic DNA and rAAV vector genome of the production cells (which allows for determination of the enrichment fold of each sgRNA), next-generation sequencing was used. We applied a two-step PCR amplification method to generate the sequencing library. The first step of PCR was performed using the following primer pair to amplify the guide RNA region (NGS_fw 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG). CGTGACGTAGAAAGTAATAA 3', NGS_rv 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GACTAGCCTTATTTTAACTTGCT 3').

[0118] Each primer contains a complementary sequence to the guide RNA region (already indicated) and a prominent sequence that serves as the primer binding site for the subsequent second-step PCR. For the second-step PCR, primers containing Illumina Nextera adapter i5 and i7 barcodes (IDTs) were used. After each PCR step, the resulting amplicon libraries were purified using NucleoMag beads (Macherey-Nagel) for purification and size selection. The barcoded amplicon libraries were merged and sequenced on an Illumina NextSeq 550 at the Genomics Core Facility (IZKF) of RWTH Aachen University. The FASTQ files were uncoded, adapter sequences were removed, and the resulting sequences were analyzed using a Python script to identify and quantify the individual sgRNAs.

[0119] Knockout target gene verification To verify potential target genes that lead to sgRNA barcoding enrichment in the genome of the studied rAAV vector through inactivation, CAPAAV Packaging cells were transfected with pCas9-ZeoR-dual-sgRNA vectors (addgene plasmids #48138 (modified) and #118152) [2], each carrying two guide RNAs for potential target genes. After transfection, cells carrying inactivated target genes were enriched by selection with 0.1 µg / ml Zeocin™ (Invitrogen).

[0120] CAP AAV-KO Cells were then infected with a lentiviral AAV-GFP construct at a high MOI for AAV expression cassette integration. Successful infection was validated after transduction by determining the percentage of eGFP-positive cells using a BD Accuri™ C6 flow cytometer (Becton Dickinson, BD, Franklin Lakes, NJ, USA), and cell pellets were separated to determine the mean copy number of the integrated AAV expression cassette. The remaining cells were induced with 1 µg / ml doxycycline and incubated for 96 h for rAAV production. The rAAV vector was harvested and quantified.

[0121] Copy number determination To determine the average copy number of the integrated AAV expression cassette, each generated target KO CAP was harvested. AAV Genomic DNA from cell lines. Multiplexed droplet digital PCR (ddPCR) was performed on a QX200 droplet digital PCR system (Bio-Rad Laboratories, Inc., Hercules, CA) using ddPCR Supermix for Probes (Bio-Rad Laboratories, Inc., Hercules, CA). In the first step, 1 µg of genomic DNA from each sample was digested at 37°C for 1 h with FastDigest NcoI (ThermoScientific™), followed by heat inactivation at 65°C for 15 min. A reaction mixture containing ddPCR Supermix for Probes, 100 nM forward and reverse primers, 25 nM probe, and 50 ng of digested genomic DNA was used, and the following PCR protocol was applied: 95°C for 10 min; 95°C for 30 s and 60°C for 60 s, 40 cycles; 98°C for 10 min. For eGFP transgenes, the same primer and probe mixture as described above was used. Each PCR experiment was performed in triplicate, including a template-free control. The absolute copy number of the target gene in the clones under study was determined compared to a known reference gene in wild-type CAP cells (an undisclosed internal reference gene with a known copy number of 2).

[0122] Statistical analysis Data are expressed as mean ± standard error of mean. Unpaired Student's t-test is used to test for statistical significance. The significance level is expressed as *. P <0.05、** P <0.01、*** P <0.001.

[0123] Example 1: Screening method for identifying guide RNAs affecting rAAV titers We developed and implemented a genome-wide CRISPR / Cas9 screening method using a novel lentiviral-AAV CRISPR library (LAC-library) to identify host cytokines that lead to enhanced or reduced rAAV production capacity when inactivated. The resulting LAC-library was based on the Toronto human knockout merge library (TKOv3) and contained 70.948 single guide RNAs (sgRNAs) for inactivating 18.503 human genes [1]. This sgRNA library was inserted into a recombinant heterozygous lentiviral-AAV vector plasmid, which, in addition to the long terminal repeat (LTR) sequence for lentiviral packaging, also contained the inverted terminal repeat (ITR) sequence for rAAV vector production and the GFP reporter gene ( Figure 1 a) Lentiviral LAC libraries can be packaged into lentiviral vector libraries by co-transfecting packaging cell lines with lentiviral packaging plasmids. In stable Cas9-expressing inducible AAV-producing cell lines (CAP... AAV-Cas9 The screening was conducted in ) . Therefore, the Cas9 expression vector was transfected into AAV auxiliary and packaging elements ( ) containing the elements required for stable integration of AAV production under the control of the tet-inducible promoter. cap and rep genes ) of CAP AAV In packaging cell lines. Single-clone selection of suitable production clones with favorable Cas9 expression ( Figure 1 b) After CAP AAV-Cas9 The packaging cell line was able to induce the production of the rAAV vector after the introduction of an AAV expression cassette with ITR flanking structures (data not shown).

[0124] The lentiviral AAV-sgRNA library was then used to transduce inducible CAP at low MOI (0.2–0.3). AAV-Cas9Packaging cell lines were used to ensure single-copy integration of the AAV transfer vector. Transduced cells were cultured for 9 days to achieve maximum knockout efficiency. Cell pellets with at least 200-fold library size coverage were harvested before initiating rAAV production via doxycycline induction for genomic DNA isolation at t0 post-induction. Additionally, rAAV vectors were harvested 4 days post-induction for isolating the packaged AAV genome. Next-generation sequencing (NGS) was used to identify and quantify the sgRNA sequences integrated into the genome and those packaged within the AAV vector. Subsequent analysis of the relative changes in sgRNA abundance between genome integration and packaging allowed for the identification of cellular targets associated with increased or decreased rAAV production due to CRISPR / Cas9-mediated inactivation. Figure 1 a).

[0125] NGS analysis identified 43,801 guide RNAs integrated into and packaged into the rAAV vector. Figure 2 a) For further quality control and to obtain information on the transfer efficiency and distribution of the sgRNA library, we performed further NGS experiments to analyze the generated LAC-plasmid library and its transfer to CAP. AAV-Cas9 Genomic integration in cells. This allows for the evaluation of guide RNA distribution between the initial TKOv3 plasmid library and the LAC plasmid library on one hand, and between the LAC-plasmid library and the cell library generated by transduction on the other. Data showed that guide RNAs were efficiently transferred into the LAC library backbone (96.6%) and into the cell library generated by transduction (94.6%). Another useful quality feature of the library and screening procedure is the loss rate of sgRNAs targeting essential genes [1]. For this purpose, the distribution changes of sgRNAs targeting essential and non-essential genes between the LAC-plasmid library and the cell LAC-library were examined. As expected, the distribution curve of the log-fold change of essential genes showed a shift toward negative log-fold values, indicating that for essential genes, the number of guide RNAs integrated into the genome decreased after 9 days compared with the distribution in the initial LAC-plasmid library (data not shown).

[0126] Overall, inactivation of 2035 genes during screening resulted in a ≥2-fold increase in rAAV titers. Furthermore, knockout of 3904 genes was associated with a ≥2-fold decrease in rAAV production. When more stringent filtering criteria were applied to identify head targets—that is, considering only genes with ≥2 guide RNAs and setting the fold-down cutoff for increase or decrease at ≥4-fold—the number decreased to 216 potential targets for increasing rAAV production and 294 potential targets for decreasing rAAV production, respectively. Figure 2b). We selected 19 targets with the highest log-fold change and 2 targets with the lowest log-fold change for further analysis. Figure 3 ).

[0127] Example 2: Validation of cell targets by knockout in stable rAAV production cell lines To further validate some of the most promising candidate genes, we selected 19 targets with the highest log-fold change and 2 targets with the lowest log-fold change, and used CRISPR / Cas9 to generate CAPs with corresponding KO values. AAV Cell lines. Also produce CAP cells expressing sgRNAs targeting lacZ, eGFP, and luciferase. AAV Cell lines served as controls. These KO cell lines were then transiently transfected with the AAV-CAG-GFP plasmid to investigate the effect of target gene inactivation on rAAV production, where the transgenic cassette was transiently present in the cells. After doxycycline induction of rAAV production, rAAV titers were compared between different KO cell lines to evaluate the effect of target gene inactivation on rAAV production capacity. Figure 4 ).

[0128] Example 3: Validation of the cell target BRD4 using the inhibitor JQ1 in a stable rAAV production cell line Gene therapy was performed using the inhibitory effect of small molecule JQ1 (an inhibitor of the BET family, to which BRD4 belongs). BRD4 Further verification of (log2 = 2,96). For this purpose, use a fully production CAP. AAV Cell lines providing all the necessary components for AAV production upon doxycycline induction. Different concentrations of JQ1 were used to compare the effect of JQ1 on rAAV production. JQ1 inhibitors were added concurrently with induction. Figure 5 The data obtained show that, compared with the control without JQ1, the titers were significantly increased at both inhibitor concentrations.

[0129] References 1. Mair, B., Tomic, J., Masud, S. N., et al. (2019).Essential GeneProfiles for Human Pluripotent Stem Cells Identify Uncharacterized Genes andSubstrate Dependencies. Cell Reports, 27(2),599-615.e12. https: / / doi.org / 10.1016 / j.celrep.2019.02.041。 2. Beucher, A.,&Cebola, I. (2019). One-step dual CRISPR / Cas9 guideRNA cloning protocol. Protocol Exchange,doi: 10.21203 / rs.2.1831 / v1. https: / / doi.org / 10.21203 / rs.2.1831 / v1。

Claims

1. A method for producing an adeno-associated virus (AAV) vector, the method comprising: a) Add a nucleic acid construct containing an AAV inverted terminal repeat (ITR) to the host cell; b) Culture the isolated host cells to produce recombinant AAV (rAAV); The host cells are modified or otherwise caused to exhibit reduced or increased expression of one or more genes compared to unmodified host cells, the genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

2. The method according to claim 1, wherein the gene is selected from CASP8, CAPN11, NELFCD, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, and PAF1.

3. The method according to claim 2, wherein the gene is selected from IL6, FGF2, NELFE, NELFB, PAF1, and CAPN2.

4. The method according to claim 1, wherein the gene is selected from PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, L3HYPDH, VPS26B and TPM3.

5. The method of claim 1, wherein the host cell has been modified or otherwise caused to show reduced or increased expression of any two genes selected from IL6, CAPN2, FGF2, CASP8, CAPN11, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, NELFBCD, BRD4, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

6. The method of claim 5, wherein the two genes are IL6 and CAPN2, FGF2 and CASP8, CAPN11 and CASP8, PLEKHA1 and ABHD6, NR2C2 and TAF11, HSPBP1 and TAF11, LSM10 and TPM3, VSP26B and L3HYPDH, NELFE and NELFB, NELFCD and BRD4, NELFCD and PAF1 or NELFCD and CASP8.

7. The method according to any one of the preceding claims, wherein the host cell is modified or otherwise caused to exhibit reduced expression of one or more genes compared to unmodified cells, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6VOE2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NE Increased expression of LFCD, FBXL14, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8; and / or one or more genes selected from TRIAP, APP, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

8. The method according to any one of the preceding claims, wherein the host cell comprises the knockout of one or more genes selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6VOE2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, and CASP8.

9. The method of claim 8, wherein the knockout is a CRISPR-CAS9 mediated knockout.

10. The method according to any one of the preceding claims, wherein the host cell comprises additional non-endogenous nucleic acid sequences encoding TRIAP1 and / or TRIAP, DDX52, RECQL5, DAP3, CUL2, WIBG, ACVR1C and / or APP.

11. The method according to any one of the preceding claims, wherein the method further comprises the step of providing a nucleic acid construct containing AAV auxiliary and packaging elements required for AAV production.

12. The method of claim 11, wherein the AAV auxiliary and packaging elements required for AAV production comprise AAV cap and rep genes.

13. The method according to any one of the preceding claims, wherein the host cell contains stably integrated AAVcap and rep genes.

14. The method according to any one of the preceding claims, wherein the host cell is a recombinant cell.

15. A host cell for producing rAAV, which, compared with an unmodified host cell, is modified to show reduced or increased expression of one or more genes, said genes being selected from ARCN1, CAPN11, TAF7, CASP8, DNAJA1, GFRA1, PROL1, RCN1, SLC25A35, SETD8, ERAP1, TINF2, ATP6V0E2, PRICKLE3, MTHFD1, SHCBP1, ENGASE, NELFCD, FBXL14, BRD4, TRIAP1, and APP, IL6, CAPN2, FGF2, PLEKHA1, ABHD6, NR2C2, TAF11, HSPBP1, LSM10, TPM3, VSP26B, L3HYPDH, NELFE, NELFB, PAF1, TRIAP1, DDX52, RECQL5, DAP3, CUL2, WIBG, and ACVR1C.

Images