A nucleic acid detection composition, kit and method for detecting cryptococcus neoformans
The RPA-CRISPR/Cas12a detection system utilizes specific RPA primers and gRNA to perform isothermal nucleic acid amplification and specific recognition of Cryptococcus neoformans, solving the problem of poor sensitivity in the detection of Cryptococcus neoformans in existing technologies and achieving rapid, sensitive, and specific detection results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 粤北人民医院
- Filing Date
- 2026-02-11
- Publication Date
- 2026-06-12
AI Technical Summary
Existing methods for detecting Cryptococcus neoformans have poor sensitivity, and conventional detection methods are prone to false positives or require invasive procedures, making it impossible to detect pathogens in cerebrospinal fluid quickly and sensitively.
The RPA-CRISPR/Cas12a detection system was used to perform isothermal nucleic acid amplification using specific RPA primers and gRNA, combined with the trans-cleavage activity of CRISPR/Cas12a to specifically recognize Cryptococcus neoformans, and detected by a fluorescent reporter group.
It enables rapid, sensitive, and specific detection of novel Cryptococcus neoformans, is suitable for on-site testing in resource-limited areas, reduces the risk of aerosol contamination, and improves the accuracy of detection.
Smart Images

Figure CN122189223A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial detection technology, and in particular to a nucleic acid detection composition, kit, and method for detecting novel Cryptococcus neoformans. Background Technology
[0002] Cryptococcus neoformans is an opportunistic pathogen that primarily causes fatal central nervous system infections in immunocompromised individuals such as organ transplant recipients and HIV / AIDS patients. Clinical methods for detecting Cryptococcus neoformans mainly include India ink staining, microbial culture, antigen immunological detection, and histopathological examination. However, India ink staining and microbial fluid culture have poor sensitivity, and histopathological examination is often invasive, limiting its clinical application. While antigen immunological detection offers improved sensitivity compared to traditional laboratory tests, it is prone to cross-reactivity with other infections, leading to false positives. Therefore, rapid and sensitive detection of pathogens in cerebrospinal fluid is urgently needed.
[0003] Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technique. Compared to PCR, RPA has milder reaction conditions, requires no complex equipment, and has a rapid amplification speed, completing amplification in as little as 10 minutes. CRISPR / Cas12a is a CRISPR-related endonuclease system that, guided by gRNA, recognizes and binds to a specific DNA sequence (PAM sequence) and activates its trans-cleaving activity to cleave non-target single-stranded DNA (ssDNA). The RPA-CRISPR / Cas12a detection method involves amplifying the target DNA via RPA, followed by specific recognition by CRISPR / Cas12a, which activates its trans-cleaving activity to cleave an ssDNA probe carrying a fluorescent reporter group. This allows for fluorescence detection or immunochromatographic detection.
[0004] In summary, the one-pot RPA-Cas12a novel Cryptococcus detection system can rapidly, sensitively, and specifically detect Cryptococcus neoformans in cerebrospinal fluid, which is of great value in detecting central nervous system pathogens and can also meet the requirements for rapid detection in resource-limited areas. Summary of the Invention
[0005] To address the problems existing in the prior art, the present invention provides a nucleic acid detection composition, kit, and method for detecting novel Cryptococcus neoformans.
[0006] In a first aspect, the present invention provides a nucleic acid detection composition comprising: an RPA primer pair and gRNA; The RPA primer pair includes: F:TCCGTAGGTGAACCTGCGGAAGGATCAGTA, R: CGAGAACCAAGAGATCCGTTGTTGAAAGTT; The gRNA includes: UAAUUUCUACUAAGUGUAGAUGGCACGUUUUACACAAACUUCUA.
[0007] Furthermore, it also includes: ssDNA; Preferably, the ssDNA includes: TTATTATT.
[0008] Furthermore, the upstream or downstream portion of the ssDNA carries a signal generation portion; More preferably, the signal generating portion includes one or more of the following: a fluorescent group and / or a quenching group, a signal molecule and / or a capture molecule, a redox probe, or an enzyme.
[0009] For example, ssDNA can be selected: ssDNA qp reporter: FAM-TTATTATT-BHQ1, ssDNA la reporter: FAM-TTATTATT-Biotin.
[0010] Secondly, the present invention provides a kit comprising the aforementioned nucleic acid detection composition.
[0011] Furthermore, it also includes: RPA amplification reagents and CRISPR / Cas12a detection reagents; Preferably, the RPA amplification reagent comprises one or more of RPA enzyme, rehydration buffer, or MgOAC; and / or, The CRISPR / Cas12a detection reagent includes: NE Buffer and / or Cas12a enzyme.
[0012] Thirdly, the present invention provides a method for detecting novel Cryptococcus neoformans, characterized in that it comprises: The nucleic acid detection composition according to any one of claims 1-3, or the kit according to claim 4 or 5, is used to detect the sample to be tested, and the results are interpreted.
[0013] Further, the reaction system for detection, in 20 μL, comprises: 4–8 μL RPA enzyme solution, 0.5–2 μL 240–320 mM MgOAC, 0.1–0.3 μL each of 5–20 μM forward and reverse primers, 1–3 μL 5–15 × NE Buffer, 0.5–2 μL 1–3 μM Lba Cas12a, 0.5–2 μL 0.5–2 μM gRNA, 1–3 μL 10–30 μM ssDNA Reporter, 2–3 μL template DNA, and the remainder is water.
[0014] Furthermore, the detection reaction procedure includes: React at 35-40℃ for 20-50 minutes.
[0015] Furthermore, the interpretation based on the detection results includes: Based on the detection results corresponding to the type of signal generation, determine whether the sample to be tested contains Cryptococcus neoformans; Preferably, the sample to be tested does not contain components of human or animal origin.
[0016] The method provided by this invention may optionally not involve disease diagnosis or treatment methods, such as detecting Cryptococcus neoformans in food or cosmetics.
[0017] Fourthly, the present invention provides the use of the aforementioned nucleic acid detection composition, or the aforementioned kit, in the preparation of a drug for detecting Cryptococcus neoformans.
[0018] The present invention has the following beneficial effects: This invention designs isothermal amplification primers and gRNA for Cryptococcus neoformans, a common fungus causing central nervous system infections. Rapid and visual detection of Cryptococcus neoformans is achieved through RPA amplification and CRISPR / Cas12a detection technology. The method based on these specific RPA primers and gRNA exhibits high specificity and sensitivity. Furthermore, the method provided by this invention is rapid and gentle, allowing detection even in harsh environments. The one-pot method also reduces aerosol contamination caused by repeated opening of the container, providing an efficient, sensitive, and specific solution for the on-site detection of Cryptococcus neoformans. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0020] Figure 1The results are agarose gel electrophoresis of the amplification products of novel Cryptococcus neoformans using different RPA primer pairs provided in Example 1 of this invention.
[0021] Figure 2 These are the fluorescence signal intensity detection results of different gRNAs provided in Example 1 of the present invention; wherein A is the detection result of different gRNAs on the RPA amplification products of Cryptococcus neoformans using a non-one-pot method; and B is the detection result of different gRNAs on the RPA amplification products of Cryptococcus neoformans using a one-pot method.
[0022] Figure 3 These are the optimized results of the concentrations of each component provided in Example 1 of the present invention; wherein A is the optimized result of the Cas12a concentration in the one-pot RPA-CRISPR / Cas12a reaction system; B is the optimized result of the gRNA concentration in the one-pot RPA-CRISPR / Cas12a reaction system; C is the optimized result of the ssDNA probe concentration in the one-pot RPA-CRISPR / Cas12a reaction system; and D is the detection results of the negative control and Cryptococcus neoformans lateral flow in the optimized one-pot RPA-CRISPR / Cas12a system.
[0023] Figure 4 The results are the sensitivity detection results of the one-pot RPA-CRISPR / Cas12a detection system provided in Embodiment 2 of the present invention.
[0024] Figure 5 The specific detection results provided in Example 2 of this invention; wherein, A is the specific fluorescence detection result of the one-pot RPA-CRISPR / Cas12a detection system; and B is the specific lateral flow detection result of the one-pot RPA-CRISPR / Cas12a detection system.
[0025] Figure 6 The results of one-pot RPA-CRISPR / Cas12a detection of artificial cerebrospinal fluid fluorescence provided in Embodiment 3 of the present invention are as follows.
[0026] Figure 7 This is the result of a sensitivity comparison between the primers provided in Embodiment 4 of the present invention and those in the prior art. Detailed Implementation
[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0028] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0029] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0030] Example 1: Establishment of the RPA-CRISPR / Cas12a detection system 1. Fungal strains Cryptococcus neoformans, Candida albicans, Candida parapsilosis, Candida tropicalis, Candida krusei, Candida auris, Candida glabrata, and Aspergillus fumigatus were all commercially available.
[0031] 2. Design of novel Cryptococcus RPA primers and gRNA ITS sequences of Cryptococcus neoformans and other fungi were downloaded from NCBI, and multiple alignments were performed on the downloaded sequences using DNAMAN. RPA primers were designed to make the amplicon size between 200-300 bp, containing both classic PAM sequences and suboptimal PAM sequences for CRISPR cleavage. Furthermore, gRNAs (CL gRNA1 and CL gRNA2) targeting the classic PAM sequences were designed.
[0032] Simultaneously, gRNAs (SU gRNA1 and SU gRNA2) targeting suboptimal PAM sequences were designed, and the length of the gRNAs was adjusted.
[0033] The obtained RPA primers (SEQ ID NO.1-6): ITS-F1: TCCGTAAGGGGAACCTGCGGAAGGATCATT, ITS-F2: CTTCCGTAAGGGGAACCTGCGGAAGGATCA; ITS-F3:TCCGTAGGTGAACCTGCGGAAGGATCAGTA, ITS-R1: AAAACTTTCAACAACGGATCTCTTGGCTTC; ITS-R2: AGAACCAAGAGATCCGTTGTTGAAAGTTTT, ITS-R3: CGAGAACCAAGAGATCCGTTGTTGAAAGTT.
[0034] The gRNAs obtained are shown below (SEQ ID NO. 7 and 8): CL gRNA1:UAAUUUCUACUAAGUGUAGAUCACAAACUUCUAAAUGUAAUGAA, CL gRNA2:UAAUUUCUACUAAGUGUAGAUCUACCCAUCUACACCUGUGAACU.
[0035] The gRNAs targeting the suboptimal PAM sequence are shown below (SEQ ID NO. 9 and 10): SU gRNA1: UAAUUUCUACUAAGUGUAGAUGGCACGUUUUACACAAACUUCUA, SU gRNA2:UAAUUUCUACUAAGUGUAGAUGACUUCGGUCCAUUUAUCUACCC.
[0036] The designed ssDNA includes ssDNA qp reporter and ssDNA la reporter, as shown below: ssDNA qp reporter: FAM-TTATTATT-BHQ1, ssDNA la reporter: FAM-TTATTATT-Biotin.
[0037] 3. Screening RPA primers (1) Genome extraction The genome of a novel Cryptococcus was extracted using a yeast genomic DNA extraction kit according to the instructions. The DNA concentration was detected using Nanodrop, and the sample was frozen at -20°C for later use.
[0038] (2) RPA amplification RPA amplification was performed using the TwistDX Basic RPA kit (UK). The total amplification volume was 25 μL, as shown below: 0.5 μL each of 10 μM forward and reverse primers, 15 μL of Rehydration Buffer, RPA enzyme lyophilized powder, 1.25 μL of 280 mM MgOAC, 2.5 μL of template DNA, and 5.25 μL of ddH2O.
[0039] After mixing the above amplification system, place it in a 37℃ metal bath for 20 min. Take 5 μL of sample and 1 μL of 6× loading buffer, mix well, and add to the sample wells. Perform gel electrophoresis to screen for the most sensitive RPA primer pairs. The results are as follows: Figure 1 As shown.
[0040] 4. Screening for gRNA (1) Non-one-pot screening of gRNA The amplification products from step 1.3 were analyzed using the EnGen Lba Cas12a kit from New England Biolabs for CRISPR / Cas12a detection. The total detection volume was 20 μL, as shown below: 2 μL of 10×NEBuffer r2.1, 1 μL of 1 μM LbaCas12a, 1 μL of 1 μM gRNA, 10 μL of RPA amplification product, 1 μL of 10 μM ssDNA Reporter, and 5 μL of ddH2O.
[0041] After mixing the above detection system, it was placed in a real-time fluorescence PCR instrument at 37°C for 20 min. The fluorescence signal intensity was used for detection to screen for the gRNA with the highest sensitivity. The results are as follows: Figure 2 As shown.
[0042] (2) One-pot screening of gRNA A preliminary one-pot RPA-CRISPR / Cas12a detection system was established, with a total detection volume of 20 μL, as shown below: Rehydration Buffer 6 μL, RPA enzyme lyophilized powder, 280 mM MgOAC 1 μL, 10 μM forward and reverse primers 0.2 μL each, 10×NEBuffer r2.1 2 μL, 1 μM Lba Cas12a 1 μL, 1 μM gRNA 1 μL, 10 μM ssDNA Reporter 1 μL, template DNA 2.5 μL, and ddH2O 5.1 μL.
[0043] After mixing the above detection system, incubate it in a real-time fluorescence PCR instrument or metal bath at 37°C for 30 min. Detection is performed by fluorescence signal intensity to screen for the gRNA with the highest sensitivity. The results are as follows: Figure 2 As shown.
[0044] 5. Optimize the concentrations of Cas12a, gRNA, and ssDNA probes. (1) Optimize Cas12a concentration The Cas12a concentration in the one-pot RPA-CRISPR / Cas12a detection system was adjusted to 50nm, 100nm, 150nm, 200nm, and 300nm, respectively. Detection was performed using fluorescence signal intensity, and the Cas12a concentration with the highest sensitivity was selected. The results are as follows: Figure 3 As shown.
[0045] (2) Optimize gRNA concentration The gRNA concentrations in the one-pot RPA-CRISPR / Cas12a detection system were adjusted to 50nm, 100nm, 150nm, and 200nm, respectively. Detection was performed using fluorescence signal intensity, and the gRNA concentration with the highest sensitivity was selected. The results are as follows: Figure 3 As shown.
[0046] (3) Optimize ssDNA probe concentration The ssDNA probe in the one-pot RPA-CRISPR / Cas12a detection system was adjusted to 50nm, 100nm, 150nm, 200nm, and 300nm, respectively, and detected by fluorescence signal intensity. The concentration of the ssDNA probe with the highest sensitivity was screened, and the results are as follows. Figure 3 As shown.
[0047] 6. Establish a one-pot RPA-CRISPR / Cas12a detection system The one-pot RPA-CRISPR / Cas12a detection system included: 6 μL Rehydration Buffer, RPA enzyme lyophilized powder, 1 μL 280 mM MgOAC, 0.2 μL each of 10 μM forward and reverse primers, 2 μL 10×NEBuffer r2.1, 1 μL 2 μM Lba Cas12a, 1 μL 1 μM gRNA, 2 μL 20 μM ssDNA Reporter, 2.5 μL template DNA, and 4.1 μL ddH2O. After mixing the PCR tubes, incubate them at 37°C for 30 min using a real-time PCR instrument or a metal bath. Detect fluorescence intensity or add 80 μL GenLine Dipstick buffer equilibrated to room temperature, react for 5 min, and then insert a test strip to observe for band appearance. Results are as follows: Figure 3 As shown.
[0048] Example 2 Sensitivity and Specificity Analysis of RPA-CRISPR / Cas12a Detection System 1. Sensitivity analysis of the RPA-CRISPR / Cas12a detection system The Cryptococcus neoformans ITS plasmid was extracted and diluted to 10. 0 10 1 10 2 10 3 10 4 10 5 10 6 The samples were diluted to 7 concentrations (copies / μL) and the fluorescence intensity was detected using a one-pot RPA-CRISPR / Cas12a assay. Results are as follows: Figure 4 As shown.
[0049] 2. Specificity analysis of the RPA-CRISPR / Cas12a detection system Genomic DNA was extracted from *Cryptococcus neoformans*, *Candida albicans*, *Candida parapsilosis*, *Candida tropicalis*, *Candida krusei*, *Candida auris*, and *Aspergillus fumigatus*, and specifically detected using a one-pot RPA-CRISPR / Cas12a method, measuring fluorescence intensity or the presence of bands on the test strip. Results are as follows: Figure 5 As shown.
[0050] Example 3: Artificial Cerebrospinal Fluid Detection Add 10g of artificial cerebrospinal fluid respectively. 3 10 4 10 5 10 6 A novel Cryptococcus neoformans strain was sampled at a concentration of CFU / mL, and genomic DNA was extracted. Specificity was detected using a one-pot RPA-CRISPR / Cas12a assay, with fluorescence intensity measured. Results are as follows: Figure 6 As shown.
[0051] Example 4: Comparison of existing primer sensitivity According to literature reports, ITS-F4 and ITS-R4 were selected and synthesized for sensitivity comparison with ITS-F3 and ITS-R3 (SEQ ID NO.11-12).
[0052] ITS-F4: TGAACTGTTTATGTGCTTCGGCACGTTTTAC; ITS-R4:TCGATGTGGAAGCCAAGAGATCCGTTGTTG.
[0053] The same artificial cerebrospinal fluid detection method as in the previous embodiments was performed, and the fluorescence intensity was measured. The results are as follows: Figure 7 As shown: The ITS-F3 and ITS-R3 provided by this invention have significantly better sensitivity than ITS-F4 and ITS-R4 (ITS-F4 and ITS-R4 have almost no signal).
[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A nucleic acid detection composition, characterized in that, include: RPA primer pairs and gRNA; The RPA primer pair includes: F:TCCGTAGGTGAACCTGCGGAAGGATCAGTA, R: CGAGAACCAAGAGATCCGTTGTTGAAAGTT; The gRNA includes: UAAUUUCUACUAAGUGUAGAUGGCACGUUUUACACAAACUUCUA.
2. The nucleic acid detection composition according to claim 1, characterized in that, Also includes: ssDNA; Preferably, the ssDNA includes: TTATTATT.
3. The nucleic acid detection composition according to claim 2, characterized in that, The upstream or downstream of the ssDNA carries the signal generation portion; More preferably, the signal generating portion includes one or more of the following: a fluorescent group and / or a quenching group, a signal molecule and / or a capture molecule, a redox probe, or an enzyme.
4. A reagent kit, characterized in that, Includes the nucleic acid detection composition according to any one of claims 1-3.
5. The reagent kit according to claim 4, characterized in that, It also includes: RPA amplification reagents and CRISPR / Cas12a detection reagents; Preferably, the RPA amplification reagent comprises one or more of RPA enzyme, rehydration buffer, or MgOAC; and / or, The CRISPR / Cas12a detection reagent includes: NE Buffer and / or Cas12a enzyme.
6. A method for detecting Cryptococcus neoformans, characterized in that, include: The nucleic acid detection composition according to any one of claims 1-3, or the kit according to claim 4 or 5, is used to detect the sample to be tested, and the results are interpreted.
7. The method according to claim 6, characterized in that, The reaction system for detection, in 20 μL, comprises: 4-8 μL RPA enzyme solution, 0.5-2 μL 240-320 mM MgOAC, 0.1-0.3 μL each of 5-20 μM forward and reverse primers, 1-3 μL 5-15×NEBuffer, 0.5-2 μL 1-3 μM Lba Cas12a, 0.5-2 μL 0.5-2 μM gRNA, 1-3 μL 10-30 μM ssDNAReporter, 2-3 μL template DNA, and the remainder is water.
8. The method according to claim 6 or 7, characterized in that, The detection reaction procedure includes: React at 35-40℃ for 20-50 minutes.
9. The method according to any one of claims 6-8, characterized in that, The interpretation based on the detection results includes: Based on the detection results corresponding to the type of signal generation, determine whether the sample to be tested contains Cryptococcus neoformans; Preferably, the sample to be tested does not contain components of human or animal origin.
10. The use of the nucleic acid detection composition according to any one of claims 1-3, or the kit according to claim 4 or 5, in the preparation of a medicament for detecting Cryptococcus neoformans.