Recombinant yarrowia lipolytica and methods of making same and methods of making trans-aconitic acid

By constructing a recombinant Yersinia lipolytica and introducing aconitine isomerase and mitochondrial tricarboxylic acid transporter genes, the problems of safety, high cost and low efficiency in the existing trans-aconitine production have been solved, and safe, low-cost and high-efficiency trans-aconitine preparation has been achieved.

CN122303055APending Publication Date: 2026-06-30SHANGHAI MICROINVASIVE GENERATION BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI MICROINVASIVE GENERATION BIOTECHNOLOGY CO LTD
Filing Date
2024-12-30
Publication Date
2026-06-30

Smart Images

  • Figure CN122303055A_ABST
    Figure CN122303055A_ABST
Patent Text Reader

Abstract

This invention provides a recombinant *Yarrowia lipolytica* strain, its construction method, and a method for preparing trans-aconitic acid. The provided recombinant *Yarrowia lipolytica* carries the following nucleotide fragments: a nucleotide fragment encoding aconitic acid isomerase and a nucleotide fragment encoding a mitochondrial tricarboxylic acid transporter. *Yarrowia lipolytica* is a biosafe strain, and the recombinant *Yarrowia lipolytica* strain constructed using it can synthesize trans-aconitic acid using common carbon sources such as glucose and glycerol as fermentation substrates, resulting in low production cost and high efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a recombinant Yersinia lipolytica yeast, its construction method, and a method for preparing trans-aconitic acid. Background Technology

[0002] Aconitic acid belongs to the unsaturated tricarboxylic acid family and has both cis and trans conformations. Trans-aconitic acid has wide applications in chemical, materials, pesticide, and food industries. In the chemical and materials fields, trans-aconitic acid is an important organic synthesis intermediate and a raw material used in the preparation of plasticizers and lubricants. Simultaneously, trans-aconitic acid is an important novel nematicidal biological pesticide with good nematode control activity, capable of inhibiting or killing various nematodes, including the sweet potato stem nematode, soybean cyst nematode, and southern root-knot nematode.

[0003] Currently, the production of trans-aconitic acid mainly relies on chemical synthesis. In nature, trans-aconitic acid is a defensive metabolite in plants such as sugarcane and corn. Its low abundance in plants makes extraction from them prohibitively expensive. Citric acid can be dehydrated to produce trans-aconitic acid under the action of concentrated sulfuric acid, but this reaction has several side reactions, making industrial-scale production difficult. Current industrial production of trans-aconitic acid uses 1,1,2,3-propanetetracarboxylic acid derivatives as starting materials, obtaining the final product through a series of reactions including saponification, dehydrochlorination, and acidification. This process still suffers from a series of problems, including the accumulation of byproducts such as isocitrate lactone, harsh reaction conditions, and the generation of large amounts of chemical waste.

[0004] Microbial fermentation, using renewable resources as raw materials and with mild reaction conditions, offers a potential solution for the low-cost, green, and efficient large-scale production of trans-aconitic acid. Although the biosynthetic pathway of trans-aconitic acid has been discovered and the genes responsible for its synthesis have been analyzed in various microorganisms, including bacteria such as Bacillus thuringiensis and Pseudomonas sp. WU-0701, and fungi such as Ustilagomaydis, these microorganisms do not accumulate this product in large quantities. While recombinant Aspergillus terreus can ferment to produce trans-aconitic acid, large-scale fungal fermentation faces inherent obstacles: the mycelium of fungi results in high fermentation viscosity, hindering oxygen transfer, and the mycelium is intolerant of high shear forces; fungal growth is polymorphic, making it difficult to effectively regulate spore formation. More seriously, Aspergillus terreus is a pathogenic fungus, and some strains can cause serious illness in operators. Currently, many methods for producing trans-aconitic acid have shortcomings and challenges, necessitating the development of a safe, efficient, and low-cost method for its preparation. Summary of the Invention

[0005] To address the issues of low safety, high cost, and low efficiency in the current production process of trans-aconitine, this paper provides a recombinant lipophilic yeast, its construction method, and a method for preparing trans-aconitine.

[0006] In some embodiments, a recombinant Yarrowia lipolytica is provided, which carries nucleotide fragments encoding aconitine isomerase and nucleotide fragments encoding mitochondrial tricarboxylic acid transporter.

[0007] In some embodiments, the nucleotide fragment encoding aconitine isomerase in the provided recombinant Yarrowia lipolytica is derived from Bacillus thuringiensis, Pseudomonas sp., or Ustilago maydis.

[0008] The nucleotide fragment encoding the mitochondrial tricarboxylic acid transporter was derived from Aspergillus terreus.

[0009] In some embodiments, the nucleotide sequence encoding aconitine isomerase in the provided recombinant Yarrowia lipolytica includes one or more of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3;

[0010] The nucleotide sequence encoding the mitochondrial tricarboxylic acid transporter is shown in SEQ ID NO:4.

[0011] In some embodiments, the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter in the provided recombinant Yarrowia lipolytica are single copies or multiple copies.

[0012] In some embodiments, the recombinant Yarrowia lipolytica contains a gene expression cassette, which includes the following elements:

[0013] promoter,

[0014] The nucleotide fragment encoding aconitine isomerase and / or the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter;

[0015] Optionally, the promoter includes P TEF1N promoter, PGMP promoter, P TEF promoters and P FBA1N One or more of the promoters.

[0016] In some embodiments, a method for constructing recombinant Yarrowia lipolytica is provided, comprising the following steps: introducing the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter into Yarrowia lipolytica to construct the recombinant Yarrowia lipolytica.

[0017] In some implementations, the construction method includes at least one of the following features:

[0018] The recombinant expression vector carrying the nucleotide fragments encoding aconitine isomerase and the nucleotide fragments encoding mitochondrial tricarboxylic acid transporter was transformed into the Yersinia lipolytica.

[0019] The chromosome of the yeast lipophilia contains the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter.

[0020] Optionally, the recombinant expression vector satisfies one or more of the following characteristics:

[0021] The recombinant expression vector is equipped with selective markers, including sequences for screening yeasts with uracil synthesis defects and / or sequences for screening yeasts with leucine synthesis defects.

[0022] The recombinant expression vector used includes the pUTinX plasmid.

[0023] In some embodiments, the Yersinia lipolytica in the construction method includes Yersinia lipolytica Po1f.

[0024] In some embodiments, at least one of the recombinant Yersinia lipolytica and the recombinant Yersinia lipolytica constructed by the construction method is provided for use in the preparation of trans-aconitic acid.

[0025] In some embodiments, a method for preparing trans-aconitic acid is provided, comprising the following steps: fermenting at least one of the recombinant Yersinia lipolytica and the recombinant Yersinia lipolytica constructed by the construction method, and separating trans-aconitic acid from the culture medium;

[0026] Optionally, the method for preparing trans-aconitic acid satisfies one or more of the following characteristics:

[0027] The culture medium used for the fermentation culture includes a carbon source, a nitrogen source, and a yeast extract. Optionally, the carbon source includes one or both of glucose and glycerol, and the nitrogen source includes peptone.

[0028] The fermentation culture consisted of culturing at 25°C~28°C and 150~230 rpm for 70h~120h.

[0029] Yarrowia lipolytica is a biosafe strain. Recombinant Yarrowia lipolytica constructed using it can synthesize trans-aconitic acid using common carbon sources such as glucose and glycerol as fermentation substrates, with low production cost and high efficiency. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the accompanying drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0031] Figure 1 This is a schematic diagram illustrating the design and construction of a biosynthetic pathway for trans-aconitic acid in one implementation method.

[0032] Figure 2 This is a schematic diagram of the pUTinX plasmid in Example 1;

[0033] Figure 3 This is a schematic diagram of the spectrum of plasmid pBtTbrA-mtt1 in Example 1;

[0034] Figure 4 This is a schematic diagram of the spectrum of plasmid pBtTbrA-mtt1-leu2 in Example 1;

[0035] Figure 5 This is a schematic diagram illustrating the construction process of different recombinant lipophilic Yeasts in Example 1;

[0036] Figure 6 The diagram shows the synthesis results of trans-aconitic acid in the culture medium containing 50 g / L glucose, 10 g / L yeast extract and 20 g / L peptone in Example 1.

[0037] Figure 7 The diagram shows the synthesis results of trans-aconitine in the culture medium containing 50 g / L glycerol, 10 g / L yeast extract and 20 g / L peptone in Example 1. Detailed Implementation

[0038] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0040] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0041] In this application, terms such as "multiple", "various", "multiple times", "multiple copies", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0042] The terms “combinations thereof,” “any combination thereof,” and “any combination thereof” as used in this application include all suitable combinations of any two or more of the listed items.

[0043] In this application, the term "suitable" as used in "suitable combination", "suitable method", "any suitable method", etc., refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0044] In this application, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or embodiments that achieve better results, and should be understood not to limit the scope of protection of this application.

[0045] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0046] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0047] In this invention, the terms "first aspect," "second aspect," "third aspect," and "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," and "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0048] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0049] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0050] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0051] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0052] In this application, "room temperature" generally refers to 5℃~30℃, and more preferably 25±5℃.

[0053] In this application, the term "vector" refers to a nucleic acid molecule capable of transporting or transferring foreign nucleic acid molecules. This term encompasses both expression vectors and transcription vectors. The term "expression vector" refers to a vector capable of expressing an insert in target cells and typically contains control sequences (such as enhancer, promoter, and terminator sequences) that drive the expression of the insert. The term "transcription vector" refers to a vector capable of being transcribed but not translated. Transcription vectors are used to amplify their inserts. Foreign nucleic acid molecules are referred to as "insertions" or "transgenic molecules." Vectors typically consist of an insert and a larger sequence that serves as the vector's backbone. Based on their structure or origin, major types of vectors include plasmid vectors, granular vectors, phage vectors (such as λ phage), viral vectors (such as adenovirus vectors), and artificial chromosomes.

[0054] In this application, the term "plasmid" refers to an extrachromosomal element that typically carries a gene that is not part of the core metabolic mechanisms of the cell and is usually in the form of a circular double-stranded DNA molecule. These elements can be autonomously replicating sequences, genome-integrated sequences, bacteriophage or nucleotide sequences from any source, and linear, circular or supercoiled single-stranded or double-stranded DNA or RNA. Typically, plasmids contain a functional origin of replication in the host cell (e.g., *E. coli*) and selection markers for detecting host cells containing the plasmid. In some embodiments, the plasmid is a closed circular DNA molecule. "Co-expression plasmid" refers to a plasmid of different types that can be expressed in the same host bacterium.

[0055] In this application, the term "nucleic acid" refers to any linearly or sequentially arranged nucleotides and nucleosides, such as cDNA, genomic DNA, mRNA, tRNA, oligonucleotides, oligonucleosides, and their derivatives. Nucleic acids may include bacterial plasmid vectors, including expression, cloning, granulation, and transformation vectors, and may include modified or derived nucleotides and nucleosides.

[0056] In this application, the term "nucleotide sequence" refers to oligonucleotides, nucleotides, or polynucleotides and fragments or portions thereof, and refers to DNA or RNA of genomic or synthetic origin, which may be single-stranded or double-stranded, and denotes the sense or antisense strand. The terms "polynucleotide," "oligonucleotide," "nucleotide sequence," and "nucleic acid" are used interchangeably herein and include, but are not limited to, coding sequences. That is, one or more polynucleotide or nucleic acid sequences that, when placed under the control of appropriate regulatory or control sequences, are transcribed and translated into polypeptides in vitro or in vivo; control sequences, such as translation start and stop codons, promoter sequences, ribosome binding sites, polyadenylation signals, transcription factor binding sites, transcription termination sequences, upstream and downstream regulatory domains, enhancers, silencers, and DNA sequences to which one or more transcription factors bind and positively (inducing) or negatively (inhibiting) alter the promoter activity of a gene, etc.

[0057] In this application, the term "expression" refers to the transformation of sequence information into a corresponding expression product, including direct transcription products (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozymes, structural RNA, or any other type of RNA) or proteins produced by translation of mRNA.

[0058] In this application, the term "coding" refers to a DNA polynucleotide sequence that can be transcribed into RNA (mRNA) that translates into proteins; or that can be transcribed into RNA that does not translate into proteins (tRNA, rRNA, or other non-coding RNA); or an RNA polynucleotide sequence that can be translated into proteins.

[0059] In this application, the terms “DNA,” “RNA,” “nucleic acid,” “nucleic acid fragment,” or “polynucleotide” refer to any one or more nucleic acid segments present in a polynucleotide or construct. Nucleic acids or fragments thereof may be provided in linear (e.g., mRNA) or circular (e.g., plasmid) form, and in double-stranded or single-stranded form. “Isolated” nucleic acid or polynucleotide means a nucleic acid molecule, DNA, or RNA that has been isolated from its natural environment. For example, in the context of this invention, the recombinant polynucleotide contained in the vector is isolated. Other examples of isolated polynucleotides include recombinant polynucleotides maintained in heterologous host cells or purified polynucleotides in solution.

[0060] In this application, "gene" refers to a polynucleotide containing nucleotides encoding a functional molecule, including functional molecules produced solely by transcription (biologically active RNA) or functional molecules produced through transcription and translation (e.g., polypeptides). The term "gene" includes cDNA and genomic DNA nucleic acids, and also refers to a nucleic acid fragment expressing a specific RNA, protein, or polypeptide, containing regulatory sequences preceding (5' non-coding) and following (3' non-coding) the coding sequence. "Natural gene" refers to any gene found in nature that has its own regulatory sequences. "Chimeric gene" refers to any non-natural gene containing non-naturally co-occurring regulatory and / or coding sequences. "Endogenous gene" refers to a naturally occurring gene located at its natural position in an organism's genome. "Exogenous gene" or "heterologous gene" refers to a gene that is not normally present in the host but is introduced into the host through gene transfer.

[0061] Trans aconitine has a wide range of applications, but current production methods face many challenges. Fermentation, as a green production method, provides a new approach for the large-scale production of trans aconitine with low cost and high efficiency.

[0062] Within fungal cells, trans-aconitic acid can be synthesized via the following pathway: citric acid is converted to cis-aconitic acid (another configuration of aconitic acid) by aconitase, and cis-aconitic acid is then converted to trans-aconitic acid by aconitase. In the tricarboxylic acid cycle, aconitase catalyzes the conversion of citric acid to isocitrate, with cis-aconitic acid serving as an intermediate product.

[0063] Yersinia lipolytica, as a synthetic biology platform strain, possesses unique advantages: well-developed molecular biology tools, strong ability to synthesize lipids and organic acids, tolerance to high acid and alkaline environments, and is recognized as a biosafety strain. Yersinia lipolytica exhibits outstanding organic acid synthesis capabilities. Despite these excellent characteristics, particularly its high citric acid production, prior to this invention, a technology for synthesizing trans-aconitic acid using Yersinia lipolytica as a chassis cell was not available.

[0064] Figure 1 This diagram illustrates the design and construction of the biosynthetic pathway for trans-aconitine. Cis-aconitine can be converted to trans-aconitine by aconitine isomerase. Cis-aconitine is an intermediate product of the tricarboxylic acid (TCA) cycle. The mitochondrial transporter Mtt1 transports cis-aconitine from the mitochondria to the cytoplasm. Aconitine isomerase uses cis-aconitine as a substrate to synthesize trans-aconitine, which is then expelled from the cell. The synthesis of trans-aconitine involves multiple cellular regions: the TCA cycle occurs within the mitochondria of yeast; the intermediate metabolite cis-aconitine needs to be transported to the cytoplasm; then it is converted to trans-aconitine by the expressed aconitine isomerase; finally, trans-aconitine can be secreted extracellularly. However, *Y. lipolytica* lacks both aconitine isomerase and the mitochondrial transporter Mtt1.

[0065] In some embodiments, a recombinant Yarrowia lipolytica is provided, which carries nucleotide fragments encoding aconitine isomerase and nucleotide fragments encoding mitochondrial tricarboxylic acid transporter.

[0066] In some embodiments, the nucleotide fragment encoding aconitine isomerase in the provided recombinant Yarrowia lipolytica is derived from Bacillus thuringiensis, Pseudomonas sp., or Ustilago maydis.

[0067] In some embodiments, the nucleotide fragment encoding the mitochondrial tricarboxylic acid transporter in the provided recombinant Yarrowia lipolytica is derived from Aspergillus terreus.

[0068] In some embodiments, the nucleotide sequence encoding aconitine isomerase in the provided recombinant Yarrowia lipolytica includes one or more of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0069] In some embodiments, the nucleotide sequence encoding the mitochondrial tricarboxylic acid transporter in the provided recombinant Yarrowia lipolytica is shown in SEQ ID NO:4.

[0070] In some embodiments, the provided recombinant Yarrowia lipolytica contains single or multiple copies of the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter.

[0071] In some embodiments, recombinant Yarrowia lipolytica contains a gene expression cassette, which includes the following elements:

[0072] promoter,

[0073] Nucleotide fragments encoding aconitine isomerase and / or nucleotide fragments encoding mitochondrial tricarboxylic acid transporters.

[0074] In some implementations, the promoter includes P TEF1N promoter, P GMP promoter, P TEF promoters and P FBA1N One or more of the promoters.

[0075] In some implementations, the gene expression cassette also includes a terminator.

[0076] In some implementations, the terminator includes T XPR2 Termination, T OCT1 Terminator and T LIP1 One or more of the terminators.

[0077] In some embodiments, a method for constructing recombinant Yarrowia lipolytica is provided, comprising the following steps: introducing a nucleotide fragment encoding aconitine isomerase and a nucleotide fragment encoding mitochondrial tricarboxylic acid transporter into Yarrowia lipolytica to construct recombinant Yarrowia lipolytica.

[0078] In some embodiments, the method of constructing recombinant Yarrowia lipolytica includes converting a recombinant expression vector carrying a nucleotide fragment encoding aconitine isomerase and a nucleotide fragment encoding a mitochondrial tricarboxylic acid transporter into Yarrowia lipolytica.

[0079] In some embodiments, the method of constructing recombinant Yarrowia lipolytica includes integrating nucleotide fragments encoding aconitate isomerase and nucleotide fragments encoding mitochondrial tricarboxylic acid transporter into the chromosome of Yarrowia lipolytica.

[0080] In some embodiments, in the method for constructing recombinant Yarrowia lipolytica, the recombinant expression vector is provided with selective markers, including sequences for screening yeasts with uracil synthesis defects and / or sequences for screening yeasts with leucine synthesis defects.

[0081] In some embodiments, the expression vector used in the construction of recombinant Yarrowia lipolytica includes the pUTinX plasmid.

[0082] In some embodiments, the method for constructing recombinant Yarrowia lipolytica includes Yarrowia lipolytica Po1f.

[0083] In some embodiments, at least one of recombinant Yersinia lipolytica and recombinant Yersinia lipolytica constructed by the aforementioned construction method is provided for use in the preparation of trans-aconitic acid.

[0084] In some embodiments, a method for preparing trans-aconitic acid is provided, comprising the following steps: fermenting at least one of the aforementioned recombinant Yersinia lipolytica and the recombinant Yersinia lipolytica constructed by the aforementioned construction method, and separating trans-aconitic acid from the culture medium.

[0085] In some embodiments, the culture medium used for fermentation culture in the preparation method of trans-aconitic acid includes a carbon source, a nitrogen source, and a yeast extract.

[0086] In some embodiments, the carbon source in the preparation method of trans-aconitic acid includes one or both of glucose and glycerol, and the nitrogen source includes peptone.

[0087] In some embodiments, the fermentation culture in the preparation method of trans-aconitic acid includes culturing at 25°C~28°C and 150~230 rpm for 70h~120h.

[0088] The recombinant Yarrowia lipolytica provided is a starter strain that expresses aconitine isomerase and mitochondrial tricarboxylic acid transporter Atmtt1 exogenously. The resulting recombinant Yarrowia lipolytica can synthesize trans-aconitine using common carbon sources such as glucose and glycerol as fermentation substrates. Fermentation culture of recombinant Yarrowia lipolytica can efficiently synthesize the target product trans-aconitine.

[0089] The following embodiments are provided for the purpose of illustrating various embodiments of the present invention and are not intended to limit the invention in any way. Those skilled in the art will understand that variations and other uses as defined in the claims are included within the spirit and scope of the invention. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available. The promoter and terminator sequences mentioned in the embodiments can also be downloaded from NCBI, and the specific sequence start positions can be determined from the primers in the primer table. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

[0090] YPD solid medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 18g / L.

[0091] YPD liquid culture medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L.

[0092] The present application will be further described below with reference to specific embodiments and comparative examples, but these should not be construed as limiting the scope of protection of the present application. Unless otherwise specified, the raw materials involved in the following specific embodiments are all commercially available, the instruments used are all commercially available, and the processes involved are conventionally selected by those skilled in the art unless otherwise specified.

[0093] Example 1

[0094] (1) Construction of expression vector for heteroaconitine isomerase gene

[0095] The nucleotide sequences of the aconitine isomerase gene BttbrA from *Bacillus thuringiensis* are shown in SEQ ID NO: 1; the nucleotide sequences of the aconitine isomerase gene ais from *Pseudomonas* sp. WU-0701 are shown in SEQ ID NO: 2; and the nucleotide sequences of the aconitine isomerase gene Umadi1 from *U. maydis* are shown in SEQ ID NO: 3. Based on the gene preference of *Y. lipolytica*, SEQ ID: 1–SEQ ID: 3 are codon-optimized nucleotide sequences. The aconitine isomerase genes BtTbrA, ais, and Umadi1 were directly synthesized into the restriction enzyme site HindIII / NdeI of the expression vector pUTinX, and the resulting expression plasmids were named pUTinX-BtTbrA, pUTinX-ais, and pUTinX-Umadi1, respectively. The expression vector pUTinX carries the yeast ura3 gene and can be used to transform yeast strains deficient in uracil synthesis. A map of the expression vector pUTinX is shown below. Figure 2 As shown. The promoter used in the expression system is the strong promoter P of Y. lipolytica. TEF1N (translation elongation factor, including the first intron), the termination sequence is Txpr2 (alkaline extracellular protease).

[0096] SEQ ID NO:1

[0097]

[0098] SEQ ID NO:2

[0099] ATGTTCCCCCGACTGCCCACACTAGCCCTTGGCGCCCTGCTGCTGGCTTCTACGCCACTGCTGGCCGCTCAACCCGTGACCACCCTGACCGTGCTGTCTTCTGGCGGCATCATGGGCACCATCCGAGAGGTGGCCCCCGCCTACGAGAAGGCCACCGGCGTGAAGCTGGACATCGCCGCCGCCCCCTCTATGGGCGACACCCCCCAAGCCATCCCCAACCGACTGGCCCGAAACGAGCCCGCCGACGTGGTGCTGATGGTGGGCTCTGCCCTGGACAAGCTGGTGGCCTCTGGCCAAGTGGCCAAGGACTCCCGAGTGGACCTGGGACAGTCTTTCATCGCCATGGCCGTGCGACAAGGCGCCCCCAAGCCCGACATCTCTAACATGGACGCCTTCAAGCAGACCCTGGAGAAGGCTCAGTCTGTGGCCTACTCTGACTCTGCCTCTGGCGTGTACCTGTCTCGAATCCTGTTCCCCCGAATGCAGCTGGACAAGTCTTTTATGGCGAAGGCGCGTATGATCCCCGCAGAACCGGTGGGCGCCGTTGTAGCGAGAGGCGAGGCTCAGCTGGGCTTTCAGCAGCTGTCTGAGCTGAAGGCCGTGCCCGGCATCGACATCGTGGGCCTGATCCCCGACCAAGCTCAGAAGATGACCCTGTACTCTGGCGCCATGGTGTCTAAGTCTCAGCACCCCGAGGCCGCCCGAGCCCTGCTTCAGTACCTGGCCTCTAAGGACGCCGCCAAGGCCATCGAGGACTCTGGCCTGAAGCCCGTGCCCGCTCAGCCCTAA。

[0100] SEQ ID NO:3

[0101] ATGGACTCTAAGATTCAGACCAACGTGCCCCTGCCCAAGGCCCCCCTGATTCAGAAGGCTCGAGGCAAGCGAACCAAAGGCATCCCCGCCCTGGTGGCCGGCGCCTGTGCCGGCGCCGTGGAGATCTCTATCACCTACCCCTTCGAGTCTGCCAAGACCCGAGCTCAGCTGAAGCGACGAAACCACGACGTGGCCGCCATCAAACCCGGCATCCGAGGCTGGTACGCCGGCTACGGCGCCACTCTGGTGGGCACCACCGTGAAGGCCTCTGTGCAGTTCGCCTCTTTCAACATCTACCGATCTGCCCTGTCTGGACCTAACGGCGAACTGTCTACCGGCGCCTCTGTGCTCGCCGGCTTCGGCGCCGGCGTGACCGAAGCCGTGCTCGCCGTGACCCCCGCCGAGGCCATCAAGACCAAGATCATCGACGCCCGAAAGGTGGGCAACGCCGAGCTCTCTACCACTTTCGGCGCCATCGCCGGCATCCTGCGAGACCGAGGCCCCCTGGGCTTCTTCTCTGCCGTCGGCCCCACCATCCTGCGACAGTCTTCTAACGCCGCCGTGAAGTTCACCGTGTACAACGAGCTGATCGGCCTGGCCCGAAAGTACTCTAAGAACGGCGAGGACGTGCACCCCCTGGCCTCTACCCTGGTGGGCTCTGTGACCGGCGTGTGTTGTGCCTGGTCTACTCAGCCCCTGGACGTGATCAAGACCCGAATGCAGTCTCTGCAAGCCCGACAGCTGTACGGCAACACCTTCAACTGTGTGAAGACCCTGCTGCGATCTGAGGGCATCGGCGTGTTCTGGTCTGGCGTGTGGTTCCGAACCGGCCGACTGTCTCTGACCTCTGCCATCATGTTCCCCGTGTACGAGAAGGTGTACAAGTTCCTGACTCAGCCCAACTAA。

[0102] (2) Construction of the expression vector of mitochondrial tricarboxylic acid transporter gene

[0103] The mitochondrial tricarboxylic acid transporter 1 (ATmtt1) gene from *A. terreus* was codon-optimized, and the optimized nucleotide sequence is shown in SEQ ID NO: 4. The codon-optimized Atmtt1 gene was synthesized into the restriction enzyme site HindIII / NdeI of the expression vector pUTinX, and the resulting expression plasmid was named pUTinX-Atmtt1. The aconitine isomerase expression plasmids pUTinX-BtTbrA, pUTinX-ais, and pUTinX-UmAdi1 were digested with restriction endonucleases XbaI and SpeI, respectively, and the digestion products were the expression cassettes of the aconitine isomerase gene. The plasmid pUTinX-Atmtt1 was digested with the restriction endonuclease SpeI (FastDigest Restriction Enzymes, Thermo Fisher Scientific), and the resulting aconitine isomerase gene expression cassette was cloned into the SpeI site of plasmid pUTinX-Atmtt1. This completed the co-expression of Atmtt1 and the aconitine isomerase gene (cloned on plasmids pUTinX-BtTbrA, pUTinX-ais, and pUTinX-UmAdi1), forming plasmids pBtTbrA-mtt1, pAIS-mtt1, and pUmAdi1-mtt1, with the yeast ura3 gene remaining as the selection marker.

[0104] SEQ ID NO:4

[0105] ATGGACTCTAAGATTCAGACCAACGTGCCCCTGCCCAAGGCCCCCCTGATTCAGAAGGCTCGAGGCAAGCGAACCAAAGGCATCCCCGCCCTGGTGGCCGGCGCCTGTGCCGGCGCCGTGGAGATCTCTATCACCTACCCCTTCGAGTCTGCCAAGACCCGAGCTCAGCTGAAGCGACGAAACCACGACGTGGCCGCCATCAAACCCGGCATCCGAGGCTGGTACGCCGGCTACGGCGCCACTCTGGTGGGCACCACCGTGAAGGCCTCTGTGCAGTTCGCCTCTTTCAACATCTACCGATCTGCCCTGTCTGGACCTAACGGCGAACTGTCTACCGGCGCCTCTGTGCTCGCCGGCTTCGGCGCCGGCGTGACCGAAGCCGTGCTCGCCGTGACCCCCGCCGAGGCCATCAAGACCAAGATCATCGACGCCCGAAAGGTGGGCAACGCCGAGCTCTCTACCACTTTCGGCGCCATCGCCGGCATCCTGCGAGACCGAGGCCCCCTGGGCTTCTTCTCTGCCGTCGGCCCCACCATCCTGCGACAGTCTTCTAACGCCGCCGTGAAGTTCACCGTGTACAACGAGCTGATCGGCCTGGCCCGAAAGTACTCTAAGAACGGCGAGGACGTGCACCCCCTGGCCTCTACCCTGGTGGGCTCTGTGACCGGCGTGTGTTGTGCCTGGTCTACTCAGCCCCTGGACGTGATCAAGACCCGAATGCAGTCTCTGCAAGCCCGACAGCTGTACGGCAACACCTTCAACTGTGTGAAGACCCTGCTGCGATCTGAGGGCATCGGCGTGTTCTGGTCTGGCGTGTGGTTCCGAACCGGCCGACTGTCTCTGACCTCTGCCATCATGTTCCCCGTGTACGAGAAGGTGTACAAGTTCCTGACTCAGCCCAACTAA。

[0106] The plasmid pBtTbrA-mtt1 was digested with the restriction endonuclease XbaI (Fast Digest Restriction Enzymes, Thermo Fisher Scientific), and the digested plasmid product with ura3 removed was recovered using a DNA agarose gel recovery kit (Thermo Fisher Scientific). Subsequently, the yeast leu2 gene was inserted into the original XbaI restriction site, thus replacing the original yeast ura3 gene in the pBtTbrA-mtt1 plasmid with the yeast leu2 gene. The resulting plasmid was named pBtTbrA-mtt1-leu2. Plasmid pBtTbrA-mtt1-leu2 carries both the Atmtt1 and BtTbrA genes, and their expression is mediated by independent promoters P. TEF1N The plasmid pBtTbrA-mtt1-leu2 contains the yeast leu2 gene, which can be used to transform leucine synthesis-deficient yeast. Figure 3 This is a schematic diagram of the spectrum of plasmid pBtTbrA-mtt1. Figure 4 This is a schematic diagram of plasmid pBtTbrA-mtt1-leu2. All plasmid construction was performed using E. coli DH5α. E. coli DH5α cells carrying the plasmids were cultured in LB medium supplemented with 100 μg / mL ampicillin at 37°C.

[0107] The information of the constructed gene recombination plasmid is shown in Table 1 below.

[0108] Table 1 Information on the constructed recombinant plasmids

[0109]

[0110] (3) Construction of recombinant trans-aconitine-containing Yersinia lipolytica

[0111] The starting strain, *Y. lipolytica* Po1f (ATCC MYA-2613), is a leucine and uracil double-deficient yeast. Plasmids pBtTbrA-mtt1, pAIS-mtt1, and pUmAdi1-mtt1 were extracted and linearized using the restriction endonuclease BamHI (Thermo Fisher Scientific), and the digestion products were recovered. *Y. lipolytica* Po1f was grown on YPD solid medium at 28°C. After 48 hours of culture, single colonies were picked and inoculated into YPD liquid medium at 28°C with a shaking speed of 200 rpm. After 48 hours of liquid culture, the cells were harvested. Competent cells were prepared using the Frozen-EZ Yeast Transformation II Kit (Zymo Research). Competent cells were mixed with linearized plasmids pUTinX-BtTbrA, pUTinX-ais, and pUTinX-UmAdi1, respectively, and after thawing at 28°C for 3 hours, they were plated on yeast nitrogen-based agar plates (YNB) without uracil. The cells were then incubated statically at 28°C for 72 hours until yeast colonies were observed on the agar plates. The recombinant yeasts transformed from plasmids pBtTbrA-mtt1 (containing a sequence for screening yeasts with uracil synthesis defects), pAIS-mtt1 (containing a sequence for screening yeasts with uracil synthesis defects), and pUmAdi1-mtt1 (containing a sequence for screening yeasts with uracil synthesis defects) were named Y. lipolytica TAA1, Y. lipolytica TAA2, and Y. lipolytica TAA3, respectively. After obtaining the *Y. lipolytica* TAA1 strain integrating pBtTbrA-mtt1 plasmid DNA, the pBtTbrA-mtt1-leu2 sequence (containing the sequence for screening leucine-synthesizing-deficient yeast) was linearized by enzyme digestion. The digested products were then recovered using a DNA recovery kit (Thermo Fisher Scientific) and transformed into *Y. lipolytica* TAA1 using the Frozen-EZ Yeast Transformation II Kit (Zymo Research). The culture medium used for screening the transformed colonies was a yeast-based nitrogen source medium lacking leucine. The resulting recombinant strain was named *Y. lipolytica* TAA4, which integrates two copies of the BttbrA and Atmtt1 genes. Figure 5The diagram shows the construction process of different recombinant Yersinia lipolytica. Y. lipolytica TAA1, Y. lipolytica TAA2 and Y. lipolytica TAA3 were constructed by transforming the starting strain Y. lipolytica Po1f with the pBtTbrA-mtt1 plasmid, pAIS-mtt1 plasmid and pUmAdi1-mtt1 plasmid, respectively. The DNA of the pBtTbrA-mtt1-leu2 plasmid was further integrated into the Y. lipolytica TAA1 chromosome to obtain Y. lipolytica TAA4.

[0112] (4) Synthesis of trans-aconitic acid by recombinant yeast

[0113] Recombinant yeast expressing aconitine isomerase genes from different sources and mitochondrial tricarboxylic acid transporter genes from *Aspergillus terreus* was cultured on YPD plates at 28°C. After 48 hours of static incubation, single colonies were obtained on the plates. Single colonies were picked and inoculated into YPD liquid medium for shake culture at 28°C and a shaker speed of 200 rpm. After 48 hours of incubation, the cultures were inoculated into media containing 50 g / L glucose and 50 g / L glycerol, respectively, with the media also containing 10 g / L yeast extract and 20 g / L peptone. After 96 hours of shake culture, the cultures in the shake flasks were analyzed. After centrifugation at 12,000 rpm for 5 minutes, the supernatant was filtered through a 0.22 μm filter, and the filtrate was used for high-performance liquid chromatography (HPLC). HPLC analysis was performed using a Shimadzu LC-2050C instrument equipped with a differential refractive index detector, and an Aminex column was selected. ® HPX-87H (Bio-Rad). Other chromatographic conditions were: injection volume 10 μL, 0.005 M sulfuric acid solution as mobile phase, mobile phase flow rate 0.6 mL / min, column temperature 55°C, and detection time 50 min. Standard curves were established using commercially available citric acid, succinic acid, and trans-succinic acid standards, and product quantification was performed based on the standard curves. HPLC analysis results are shown below. Figure 6 and Figure 7 As shown. Among them, Figure 6 The figure shows the results of trans-aconitine synthesis in a culture medium containing 50 g / L glucose, 10 g / L yeast extract and 20 g / L peptone. Figure 7The figure shows the synthesis results of trans-aconitic acid in a culture medium containing 50 g / L glycerol, 10 g / L yeast extract, and 20 g / L peptone. HPLC results showed that the starting strain Y. lipolytica Po1f could not synthesize trans-aconitic acid, while the target product was detectable in the supernatant of the constructed strains. Among them, strain Y. lipolytica TAA1, which expresses the aconitic acid isomerase gene tbrA and the transport protein mtt1, showed a stronger ability to produce trans-aconitic acid using glucose and glycerol than Y. lipolytica TAA2, while Y. lipolytica TAA3 showed the weakest ability. In addition to trans-aconitic acid, other organic acids, including citric acid and succinic acid, were also detected in the supernatant. When strain Y. lipolytica TAA1 was cultured with 50 g / L glucose and glycerol for 96 hours, the concentrations of trans-aconitic acid produced were 1.15 g / L and 1.45 g / L, respectively. By further increasing the copy number of the BtTbrA and Atmtt1 genes, strain Y. lipolytica TAA4, using glucose or glycerol, achieved a trans-aconitic acid yield of 1.8 g / L and 2.12 g / L after 96 hours of cultivation. Another significant advantage of Y. lipolytica is its tolerance to low pH; the entire cultivation process does not require pH adjustment, potentially further reducing production costs. Therefore, this invention constructs a novel, application-value-based recombinant yeast for the fermentation production of trans-aconitic acid.

[0114] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0115] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A recombinant Yarrowia lipolytica, characterized in that, The recombinant Yarrowia lipolytica carries the following nucleotide fragments: a nucleotide fragment encoding aconitine isomerase and a nucleotide fragment encoding mitochondrial tricarboxylic acid transporter.

2. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The nucleotide fragment encoding aconitine isomerase is derived from Bacillus thuringiensis, Pseudomonas sp., or Ustilago maydis. The nucleotide fragment encoding the mitochondrial tricarboxylic acid transporter was derived from Aspergillus terreus.

3. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, The nucleotide sequence encoding aconitine isomerase comprises one or more of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; The nucleotide sequence encoding the mitochondrial tricarboxylic acid transporter is shown in SEQ ID NO:

4.

4. The recombinant Yarrowia lipolytica according to claim 1, characterized in that, In the recombinant Yarrowia lipolytica, the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter are single or multiple copies.

5. The recombinant Yersinia lipolytica according to any one of claims 1 to 4, characterized in that, The recombinant Yarrowia lipolytica contains a gene expression cassette, which includes the following elements: promoter, and The nucleotide fragment encoding aconitine isomerase and / or the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter; Optionally, the promoter includes P TEF1N promoter, P GMP promoter, P TEF promoters and P FBA1N One or more of the promoters.

6. A method for constructing recombinant Yarrowia lipolytica, characterized in that, The method includes the following steps: introducing the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter into Yarrowia lipolytica to construct the recombinant Yarrowia lipolytica according to any one of claims 1 to 5.

7. The construction method according to claim 6, characterized in that, The construction method includes at least one of the following features: The recombinant expression vector carrying the nucleotide fragments encoding aconitine isomerase and the nucleotide fragments encoding mitochondrial tricarboxylic acid transporter was transformed into the Yersinia lipolytica. The chromosome of the yeast lipophilia contains the nucleotide fragment encoding aconitine isomerase and the nucleotide fragment encoding mitochondrial tricarboxylic acid transporter. Optionally, the recombinant expression vector satisfies one or more of the following characteristics: The recombinant expression vector is equipped with selective markers, including sequences for screening yeasts with uracil synthesis defects and / or sequences for screening yeasts with leucine synthesis defects; The recombinant expression vector used includes the pUTinX plasmid.

8. The construction method according to claim 6 or 7, characterized in that, The *Yersinia lipolytica* includes *Yersinia lipolytica* Po1f.

9. The use of at least one of the recombinant Yersinia lipolytica according to any one of claims 1 to 5 and the recombinant Yersinia lipolytica constructed by the construction method according to any one of claims 6 to 8 in the preparation of trans-aconitic acid.

10. A method for preparing trans-aconitic acid, characterized in that, The process includes the following steps: fermenting and culturing at least one of the recombinant Yersinia lipolytica according to any one of claims 1 to 5 and the recombinant Yersinia lipolytica constructed by the construction method according to any one of claims 6 to 8, and separating trans-aconitic acid from the culture medium; Optionally, the method for preparing trans-aconitic acid satisfies one or more of the following characteristics: The culture medium used for the fermentation culture includes a carbon source, a nitrogen source, and a yeast extract. Optionally, the carbon source includes one or both of glucose and glycerol, and the nitrogen source includes peptone. The fermentation culture consisted of culturing at 25°C~28°C and 150~230 rpm for 70h~120h.