A Staphylococcus aureus with hangover-relieving effects and its preparation method

Abstract

This application relates to a Staphylococcus aureus strain with hangover-relieving and liver-protecting effects. This strain can maintain essentially normal growth in an environment containing 10% ethanol, exhibiting ethanol tolerance. This Staphylococcus aureus strain not only possesses high antioxidant capacity but also high acetaldehyde dehydrogenase activity. This application also relates to the use of the said Staphylococcus aureus strain for hangover-relieving and liver-protecting purposes. Furthermore, this application discloses compositions comprising the said Staphylococcus aureus strain.

Description

Technical Field

[0001] This application relates to a Staphylococcus aureus strain with hangover-relieving and liver-protecting effects. This strain can maintain essentially normal growth in an environment containing 10% ethanol, exhibiting ethanol tolerance. This Staphylococcus aureus strain not only possesses high antioxidant capacity but also high acetaldehyde dehydrogenase activity. This application also relates to the use of the said Staphylococcus aureus strain for hangover-relieving and liver-protecting purposes. Furthermore, this application discloses compositions comprising the said Staphylococcus aureus strain. Background Technology

[0002] Alcohol consumption is a common social behavior worldwide, but excessive or prolonged drinking is harmful to health. Alcohol is primarily absorbed into the bloodstream through the stomach (approximately 10%-20% absorption) and small intestine (approximately 80%-90% absorption), and subsequently metabolized in the liver by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH). The metabolic byproducts produced in this process, such as acetaldehyde, free radicals, and lactic acid, are key factors leading to symptoms like headaches, nausea, vomiting, and dizziness, as well as liver damage, oxidative stress, and inflammatory responses. Therefore, excessive drinking can not only cause acute poisoning but also significantly increase the risk of chronic diseases such as fatty liver, cirrhosis, cardiovascular disease, and nervous system damage.

[0003] Currently, hangover remedies on the market are mainly divided into three categories: chemical drugs, traditional Chinese medicine preparations, and biological agents. The mainstream hangover remedies are primarily traditional Chinese medicine preparations. The core function of these products is to reduce the harm caused by drinking by promoting gastrointestinal motility and reducing the damage of alcohol to the digestive tract mucosa and liver. Alternatively, they may work by increasing the body's metabolic level to accelerate alcohol absorption and breakdown. However, these products cannot fundamentally eliminate, share, or reverse the metabolic process of alcohol in the body.

[0004] In recent years, with the deepening of research on microorganisms, probiotics have shone brightly in the biotechnology industry, and correspondingly, hangover-relieving probiotics have gradually entered the public eye. Hangover-relieving probiotics improve the causes of intoxication from multiple aspects, such as sharing the metabolic burden on the liver and intestines, reducing alcohol and acetaldehyde levels, and regulating gut microbiota, providing new ideas and directions for solving the hangover problem. For example, Chinese patent CN117106616A developed Lactobacillus salivarius PLJK-0039, which is resistant to high concentrations of alcohol, and its hangover-relieving compressed tablets, solving the problem of insufficient tolerance of existing hangover-relieving probiotics in high-concentration alcohol environments. This achieved significant hangover-relieving effects and gastrointestinal relief, and also has the function of preventing alcoholic fatty liver. CN119685189A disclosed Lactobacillus plantarum LpA2, which has alcohol-degrading effects, and its preparations, solving the problem that existing technologies cannot effectively relieve hangover symptoms and shorten the duration of intoxication, achieving safe and non-toxic hangover prevention and relief effects. CN116622559B addresses the problem of acetaldehyde accumulation in the body by combining Lactobacillus casei FPHC0700 with plant extracts and corn oligopeptides, significantly accelerating alcohol metabolism, alleviating hangover symptoms and liver damage, and improving the sobering effect. However, the aforementioned patent applications mostly use Lactobacillus as a common alcohol-detoxifying bacterium, but Lactobacillus microorganisms have weaker robustness than cocci or yeast microorganisms, and these patent applications lack systematic in vitro experimental verification with a large amount of data. In addition, microorganisms will experience complex environmental systems such as low pH and low oxygen after entering the body, and the aforementioned patent applications do not provide data to prove whether the corresponding microorganisms are still effective in the real in vivo environment.

[0005] Faced with the urgent need to reduce the health hazards of alcohol, the inventors traced the origins of traditional fermentation environments, enriched and cultured microorganisms in cellar mud, and selectively screened them, successfully isolating a probiotic strain with highly effective hangover-relieving properties—Staphylococcus aureus (S. aerosol). Staphylococcus carnosus Staphylococcus carinatum (90658) belongs to the genus Staphylococcus and is a group of Gram-positive cocci widely used in the meat processing industry. Unlike pathogenic bacteria such as Staphylococcus aureus, Staphylococcus carinatum is recognized worldwide as a generally recognized safe (GRAS) food-grade strain because it does not produce any hemolysin proteins, toxin proteins, coagulants, or other harmful components. It is also listed as a Class 16 edible safe bacterium in the "List of Microbial Strains that Can Be Used in Food" by the National Health Commission of China. Staphylococcus carinatum was previously considered a key strain in the meat fermentation industry for developing the flavor of meat products. Although Staphylococcus carinatum has been widely used in food fermentation (such as sausage processing) and probiotics, no published patents or studies have clearly reported its potential role in hangover relief.

[0006] This application addresses, to some extent, the practical challenge of efficiently and safely detoxifying alcohol and reducing its health hazards by obtaining a strain of Staphylococcus aureus with high acetaldehyde dehydrogenase activity. Summary of the Invention

[0007] This application provides a novel Staphylococcus aureus strain with hangover-relieving and liver-protecting effects, which can survive in an environment containing 10% ethanol and has high acetaldehyde dehydrogenase activity.

[0008] In a first aspect, this application provides a novel Staphylococcus aureus strain whose 16S rDNA fragment contains the same as SEQ ID NO. The sequence shown in NO:1 is a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.65%, 99.7%, 99.75%, 99.76%, 99.77%, 99.78%, 99.79%, 99.80%, 99.81%, 99.82%, 99.83%, 99.84%, 99.85%, 99.86%, 99.87%, 99.88%, 99.89%, 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99% or higher sequence identity, or as shown in SEQ ID NO:1.

[0009] In one specific implementation, the Staphylococcus aureus strain provided in this application has ethanol resistance and can maintain essentially normal growth in a culture medium containing 10% ethanol.

[0010] In one specific embodiment, the Staphylococcus aureus strain provided in this application comprises a characteristic fragment, which contains elements related to SEQ ID NO. The sequence shown in NO: 9 is a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.65%, 99.7%, 99.75%, 99.76%, 99.77%, 99.78%, 99.79%, 99.80%, 99.81%, 99.82%, 99.83%, 99.84%, 99.85%, 99.86%, 99.87%, 99.88%, 99.89%, 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99% or higher sequence identity, or as shown in SEQ ID NO: 9.

[0011] In one specific embodiment, the Staphylococcus aureus strain provided in this application comprises a characteristic fragment, which contains elements related to SEQ ID NO. The sequence shown in NO:8 is a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.65%, 99.7%, 99.75%, 99.76%, 99.77%, 99.78%, 99.79%, 99.80%, 99.81%, 99.82%, 99.83%, 99.84%, 99.85%, 99.86%, 99.87%, 99.88%, 99.89%, 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99% or higher sequence identity, or as shown in SEQ ID NO:8.

[0012] In one specific implementation, the Staphylococcus aureus strain provided in this application has a diameter between 0.5 and 1.5 mm, the colonies are round with neat edges, milky white, moist, smooth and colored, do not produce pigment, and are Gram-positive.

[0013] In one specific embodiment, the *Staphylococcus aureus* strain provided in this application is tolerant to acidic environments, preferably, the strain is tolerant to an environment with a pH of 2.5-3.5. In one specific embodiment, the *Staphylococcus aureus* strain provided in this application is tolerant to neutral environments, preferably, the *Staphylococcus aureus* is tolerant to an environment with a pH of 6.5-7. In one specific embodiment, the *Staphylococcus aureus* strain provided in this application is tolerant to the gastrointestinal environment.

[0014] In one specific embodiment, the *Staphylococcus aureus* strain provided in this application possesses antioxidant capacity. In one specific embodiment, the *Staphylococcus aureus* strain provided in this application has a high content of reduced glutathione. In one specific embodiment, the *Staphylococcus aureus* strain provided in this application exhibits highly effective acetaldehyde scavenging efficacy due to its high content of reduced glutathione. In one specific embodiment, the 1.0 × 10⁻⁶ [unclear text - possibly a reference to a specific ingredient or ingredient] provided in this application... 9 The culture supernatant of the CFU / ml Staphylococcus aureus strain contains approximately 10-30 µmol / L of reduced glutathione, preferably approximately 12-30 µmol / L, and more preferably approximately 15-30 µmol / L. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml Staphylococcus aureus strain provided in this application... 9The intracellular extract of CFU / ml Staphylococcus aureus strain contains about 5-30 µmol / g of reduced glutathione of protein, preferably about 6-30 µmol / g of reduced glutathione of protein, preferably about 8-20 µmol / g of reduced glutathione of protein, and preferably about 10-20 µmol / g of reduced glutathione of protein.

[0015] In one specific embodiment, the Staphylococcus aureus strain provided in this application has a high total antioxidant capacity. In one specific embodiment, the 1.0 × 10⁻⁶ strain provided in this application… 8 -1.0×10 9 The culture supernatant of the CFU / ml Staphylococcus aureus strain has a >100% ABTS cationic radical scavenging rate, and the 6.7×10⁻⁶ CFU / ml strain provided in this application... 6 The culture supernatant of the CFU / mL Staphylococcus aureus strain has an ABTS cationic radical scavenging rate of >30%, preferably >35%. The 1.0 × 10⁻⁶ CFU / mL strain provided in this application... 9 The intracellular extract of CFU / ml Staphylococcus aureus strain has an ABTS cationic radical scavenging rate of about 10%-100%, preferably 20%-100%, and more preferably 30%-100%.

[0016] In one specific embodiment, the Staphylococcus aureus strain provided in this application has a high hydroxyl radical scavenging ability. In one specific embodiment, the 1.0 × 10⁻⁶ strain provided in this application… 9 The culture supernatant of the CFU / ml Staphylococcus aureus strain has a hydroxyl radical scavenging capacity of >100%. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml Staphylococcus aureus strain provided in this application... 9 The culture supernatant of *Staphylococcus aureus* strains with a CFU / ml concentration exhibits a hydroxyl radical scavenging capacity at least 2, 3, 4, or 5 times greater than that of 1 mM GSH. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml supernatant provided in this application... 9 A CFU / ml Staphylococcus aureus strain suspension exhibits approximately 50-100% hydroxyl radical scavenging capacity. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml Staphylococcus aureus strain provided in this application... 9 The CFU / ml Staphylococcus aureus strain suspension exhibits a hydroxyl radical scavenging capacity at least 1, 2, 3, 4, or 5 times greater than that of 1 mM GSH. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml Staphylococcus aureus strain provided in this application... 9 The intracellular extract of *Staphylococcus aureus* strains at CFU / ml exhibits a hydroxyl radical scavenging capacity of approximately 60-100%. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml strain provided in this application...9 The intracellular extract of CFU / ml Staphylococcus aureus strains has a hydroxyl radical scavenging capacity that is at least 1, 2, 3, 4, and 5 times greater than that of 1 mM GSH.

[0017] In one specific embodiment, the Staphylococcus aureus strain provided in this application has high alcohol dehydrogenase activity. In one specific embodiment, the 1.0 × 10⁻⁶ strain provided in this application… 9 Intracellular extracts of CFU / ml Staphylococcus aureus strains have an alcohol dehydrogenase activity of approximately 0.1-0.5 U / mL.

[0018] In one specific embodiment, the Staphylococcus aureus strain provided in this application has high acetaldehyde dehydrogenase activity. In one specific embodiment, the 1.0 × 10⁻⁶ strain provided in this application… 9 The intracellular extract of CFU / ml Staphylococcus aureus strain has an acetaldehyde dehydrogenase activity of about 0.1-15 U / mL, preferably about 0.5-15 U / mL, more preferably about 1-15 U / mL, and even more preferably about 2-15 U / mL.

[0019] In one specific implementation, the Staphylococcus aureus strain provided in this application is strain 90658, which has the accession number CGMCC No. 36688 and was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 19, 2025.

[0020] Those skilled in the art will understand that the progeny of Staphylococcus aureus strain 90658 will naturally undergo certain genetic variations with each culture and passage, resulting in differences in gene content or composition compared to the parent strain. In a specific embodiment, the Staphylococcus aureus strain 90658 provided in this application also includes progeny of Staphylococcus aureus strain 90658 containing genetic modifications, as long as the progeny retains properties unique to the parent strain, such as tolerance to high ethanol content environments or high acetaldehyde dehydrogenase activity.

[0021] In one specific implementation, this application provides a derivative of Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, the derivative having the identification characteristics of Staphylococcus aureus strain 90658.

[0022] In one specific implementation, the Staphylococcus aureus strain 90658 or a derivative thereof with accession number CGMCC No. 36688 contains the 16S rDNA fragment shown in SEQ ID NO: 1.

[0023] In one specific implementation, the Staphylococcus aureus strain 90658 or a derivative thereof with accession number CGMCC No. 36688 contains the characteristic fragment shown in SEQ ID NO: 9.

[0024] In one specific implementation, the Staphylococcus aureus strain 90658 or a derivative thereof with accession number CGMCC No. 36688 contains the characteristic fragment shown in SEQ ID NO: 8.

[0025] In one specific embodiment, this application provides a Staphylococcus aureus strain with at least 90% whole-genome sequence identity to Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688. In another specific embodiment, this application provides a Staphylococcus aureus strain with at least 90% whole-genome sequence identity to Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, and containing the sequence shown in SEQ ID NO: 1. In yet another specific embodiment, this application provides a Staphylococcus aureus strain with at least 90% whole-genome sequence identity to Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, and containing the sequence shown in SEQ ID NO: 9. In yet another specific embodiment, this application provides a Staphylococcus aureus strain with at least 90% whole-genome sequence identity to Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, and containing the sequence shown in SEQ ID NO: 8. In one specific embodiment, this application provides a Staphylococcus aureus strain that has at least 90% whole-genome sequence identity with Staphylococcus aureus strain 90658, with accession number CGMCC No. 36688, and contains the sequences shown in SEQ ID NO: 1 and 9. In another specific embodiment, this application provides a Staphylococcus aureus strain that has at least 90% whole-genome sequence identity with Staphylococcus aureus strain 90658, with accession number CGMCC No. 36688, and contains the sequences shown in SEQ ID NO: 1, 8, and 9. In one specific implementation, compared with Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, the Staphylococcus aureus strain has at least 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 98.7%, 98.8%, 99% or higher whole genome sequence identity, for example at least 99.0%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% or higher whole genome sequence identity.

[0026] In one specific implementation, the Staphylococcus aureus strain 90658 or its derivative with accession number CGMCC No. 36688 has ethanol resistance and can maintain essentially normal growth in a culture medium containing 10% ethanol.

[0027] In one specific implementation, the monoclonal colonies of Staphylococcus aureus strain 90658 or its derivatives with accession number CGMCC No. 36688 are between 0.5 and 1.5 mm in diameter, round in shape, with neat edges, milky white in color, moist, smooth and colored on the surface, do not produce pigment, and are Gram-positive.

[0028] In one specific implementation, the Staphylococcus aureus strain 90658 or its derivative with accession number CGMCC No. 36688 is tolerant to acidic environments, preferably, the strain is tolerant to an environment with a pH of 2.5-3.5.

[0029] In one specific implementation, the Staphylococcus aureus strain 90658 or its derivative with accession number CGMCC No. 36688 is tolerant to a neutral environment, preferably, the Staphylococcus aureus is tolerant to an environment with a pH of 6.5-7.

[0030] In one specific implementation, Staphylococcus aureus strain 90658 or its derivatives with accession number CGMCC No. 36688 are tolerant to the gastrointestinal environment.

[0031] In one specific embodiment, the *Staphylococcus aureus* strain 90658 or its derivative with accession number CGMCC No. 36688 possesses antioxidant capacity. In one specific embodiment, the *Staphylococcus aureus* strain 90658 or its derivative with accession number CGMCC No. 36688 contains a high content of reduced glutathione. In one specific embodiment, the *Staphylococcus aureus* strain 90658 or its derivative with accession number CGMCC No. 36688 exhibits highly effective acetaldehyde toxicity scavenging properties due to its high content of reduced glutathione. In one specific embodiment, the 1.0 × 10⁻⁶ ppm provided in this application… 9 The culture supernatant of Staphylococcus aureus strain 90658 or its derivative, with a CFU / ml concentration and accession number CGMCC No. 36688, contains approximately 12-30 µmol / L of reduced glutathione, preferably approximately 15-30 µmol / L. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml strain provided in this application contains... 9The intracellular extract of Staphylococcus aureus strain 90658 or its derivatives, with a CFU / ml concentration and accession number CGMCC No. 36688, contains approximately 6-30 µmol / g of reduced glutathione per unit of protein, preferably approximately 8-20 µmol / g, and more preferably approximately 10-20 µmol / g.

[0032] In one specific embodiment, Staphylococcus aureus strain 90658 or its derivative, with accession number CGMCC No. 36688, exhibits high total antioxidant capacity. In one specific embodiment, the 1.0 × 10⁻⁶ ppm provided in this application... 8 -1.0×10 9 The culture supernatant of Staphylococcus aureus strain 90658 or its derivative, with a CFU / ml concentration and accession number CGMCC No. 36688, has an ABTS cationic radical scavenging rate of >100%, and the 6.7 × 10⁻⁶ CFU / ml value provided in this application is [missing information]. 6 The culture supernatant of Staphylococcus aureus strain 90658 or its derivative, with a CFU / mL concentration and accession number CGMCC No. 36688, exhibits an ABTS cationic radical scavenging rate of >30%, preferably >35%. The 1.0 × 10⁻⁶ CFU / mL strain provided in this application... 9 Intracellular extracts of Staphylococcus aureus strain 90658 or its derivatives with a CFU / ml concentration and accession number CGMCC No. 36688 have an ABTS cationic radical scavenging rate of approximately 20%-100%, more preferably 30%-100%.

[0033] In one specific embodiment, Staphylococcus aureus strain 90658 or its derivative, with accession number CGMCC No. 36688, exhibits high hydroxyl radical scavenging ability. In one specific embodiment, the 1.0 × 10⁻⁶ hydroxyl radical scavenging capacity provided in this application... 9 The culture supernatant of Staphylococcus aureus strain 90658 or its derivative, with a CFU / ml concentration and accession number CGMCC No. 36688, exhibits a hydroxyl radical scavenging capacity of >100%. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml supernatant provided in this application... 9 The culture supernatant of Staphylococcus aureus strain 90658 or its derivative, with a CFU / ml concentration and accession number CGMCC No. 36688, exhibits a hydroxyl radical scavenging capacity at least 2, 3, 4, or 5 times greater than that of 1 mM GSH. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml supernatant provided in this application... 9A bacterial suspension of Staphylococcus aureus strain 90658 or its derivative, with a CFU / ml concentration and accession number CGMCC No. 36688, exhibits approximately 50-100% hydroxyl radical scavenging capacity. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml strain provided in this application... 9 A suspension of Staphylococcus aureus strain 90658 or its derivatives with a CFU / ml concentration and accession number CGMCC No. 36688 exhibits a hydroxyl radical scavenging capacity at least 1, 2, 3, 4, or 5 times greater than that of 1 mM GSH. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml suspension provided in this application... 9 Intracellular extracts of Staphylococcus aureus strain 90658 or its derivatives, with a CFU / ml concentration and accession number CGMCC No. 36688, possess approximately 60-100% hydroxyl radical scavenging capacity. In one specific embodiment, the 1.0 × 10⁻⁶ CFU / ml concentration provided in this application... 9 Intracellular extracts of Staphylococcus aureus strain 90658 or its derivatives with a CFU / ml concentration and accession number CGMCC No. 36688 have hydroxyl radical scavenging capabilities that are at least 1, 2, 3, 4, or 5 times greater than those of 1 mM GSH.

[0034] In one specific embodiment, Staphylococcus aureus strain 90658 or its derivative, with accession number CGMCC No. 36688, exhibits high alcohol dehydrogenase activity. In one specific embodiment, the 1.0 × 10⁻⁶ enzyme provided in this application... 9 Intracellular extracts of Staphylococcus aureus strain 90658 or its derivatives, with a CFU / ml concentration and accession number CGMCC No. 36688, have an alcohol dehydrogenase activity of approximately 0.1-0.5 U / mL.

[0035] In one specific embodiment, Staphylococcus aureus strain 90658 or its derivative, with accession number CGMCC No. 36688, exhibits high acetaldehyde dehydrogenase activity. In one specific embodiment, the 1.0 × 10⁻⁶ mcg enzyme provided in this application... 9 Intracellular extracts of Staphylococcus aureus strain 90658 or its derivatives, with a CFU / ml concentration and accession number CGMCC No. 36688, have an acetaldehyde dehydrogenase activity of about 0.5-15 U / mL, preferably about 1-15 U / mL, and more preferably about 2-15 U / mL.

[0036] In a second aspect, the present invention relates to a composition for reducing alcohol content or breaking down alcohol, comprising the Staphylococcus aureus strain of the first aspect.

[0037] In one specific embodiment, the composition comprises Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688.

[0038] Thirdly, the present invention relates to a composition for reducing acetaldehyde content or decomposing acetaldehyde, comprising the Staphylococcus aureus strain of the first aspect.

[0039] In one specific embodiment, the composition comprises Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688.

[0040] Fourthly, the present invention relates to the use of the Staphylococcus aureus strain of the first aspect in the decomposition of ethanol, or in the decomposition of acetaldehyde.

[0041] In one specific embodiment, the present invention relates to the use of the Staphylococcus aureus strain as a health supplement. In another specific embodiment, the present invention relates to the use of the Staphylococcus aureus strain to promote the breakdown of ethanol or acetaldehyde in a subject.

[0042] Fifthly, the present invention provides a method for relieving hangovers, comprising administering an effective amount of the Staphylococcus aureus strain of the first aspect, or the composition of the second aspect, or the composition of the third aspect to a subject in need.

[0043] In a sixth aspect, the present invention provides a method for reducing the toxicity of acetaldehyde to the body, comprising administering an effective amount of the Staphylococcus aureus strain of the first aspect, or the composition of the second aspect, or the composition of the third aspect to a subject in need. Attached Figure Description

[0044] Figure 1 shows the morphological characteristics of Staphylococcus aureus 90658, among which... Figure 1A The colony morphology characteristics of Staphylococcus aureus 90658 are shown. Figure 1B This image shows the microscopic morphology of Staphylococcus aureus 90658.

[0045] Figure 2 The results show the gastrointestinal fluid tolerance survival rate of Staphylococcus aureus 90658.

[0046] Figure 3 This demonstrates the ability of each component of Staphylococcus aureus 90658 to scavenge hydroxyl radicals.

[0047] Figure 4 This shows the change in breath alcohol concentration over time when volunteers consumed control / experimental group samples.

[0048] definition

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of this invention, the following terms are defined below.

[0050] When used in conjunction with a numerical value, the term "about" means to cover a range of numerical values ​​having a lower limit 10% smaller than the specified numerical value and an upper limit 10% larger than the specified numerical value, preferably a range of numerical values ​​having a lower limit 5% smaller than the specified numerical value and an upper limit 5% larger than the specified numerical value.

[0051] When the term “and / or” is used to connect two or more options, it should be understood to mean any one of the options or any two or more of the options.

[0052] As used herein, the terms “comprising” or “including” mean to include the stated elements, integers, or steps, but do not exclude any other elements, integers, or steps. In this document, when the terms “comprising” or “including” are used, unless otherwise specified, they also cover compositions consisting of the stated elements, integers, or steps. For example, when referring to a composition “comprising” components A, B, and C, it is also intended to cover compositions consisting of those specific components A, B, and C.

[0053] The metabolism of alcohol in the human body mainly involves three steps. Step 1: Alcohol dehydrogenase (ADH) oxidizes ethanol to form toxic acetaldehyde, the main factor causing hangover symptoms (facial flushing, rapid heartbeat, nausea, headache), and its toxicity is far greater than that of ethanol itself. Step 2 (this is the most crucial step): Acetaldehyde dehydrogenase oxidizes acetaldehyde to non-toxic acetic acid. If acetaldehyde dehydrogenase is deficient or its activity is insufficient, acetaldehyde will accumulate in large quantities. Step 3: Acetic acid enters the body's cellular energy metabolism cycle (tricarboxylic acid cycle), and is ultimately completely broken down into carbon dioxide, water, and energy (ATP).

[0054] In this application, the term "sobering up" refers to a process or method that regulates the metabolic process of alcohol in a living organism through microorganisms or their derivatives (such as enzymes, metabolites) to achieve one or more of the following effects: accelerating the metabolic breakdown of ethanol (alcohol) in the body, reducing the concentration of ethanol in the blood, reducing the accumulation of toxic intermediates such as acetaldehyde and free radicals, alleviating liver damage caused by ethanol metabolism, or relieving discomfort symptoms such as headache, nausea, vomiting, dizziness, and fatigue caused by alcohol intake.

[0055] In this application, the term "Staphylococcus carinatum" refers to an important Gram-positive bacterium belonging to the genus Staphylococcus, originating from animals and the environment, typically about 0.5-2.2 mm in diameter, non-spore-forming, and non-flagellated. In this application, the bacterial body of Staphylococcus carinatum is also referred to as Staphylococcus carinatum cells, which can be cultured in suspension.

[0056] In this application, the term "Staphylococcus carinatum strain" refers to different pure cultures of the same species of Staphylococcus carinatum isolated from a specific source and possessing stable genetic characteristics. The term "Staphylococcus carinatum strain" encompasses the first-generation Staphylococcus carinatum strain (parent or primary) isolated and cultured, as well as its progeny or offspring, regardless of the number of passages. Those skilled in the art know that during cultivation, the cultured strains / cells may undergo natural mutations or modifications, and thus, progeny cells may differ from parent cells in genomic sequence and composition, but such differences do not substantially affect the function and characteristics of Staphylococcus carinatum. In this application, progeny cells do not need to be completely identical to parent cells in nucleic acid content, but may contain mutations. In this application, the term "Staphylococcus carinatum strain" includes mutant progeny that possess the same function or biological activity as screened or selected in the parent cells.

[0057] The terms “nucleic acid,” “nucleic acid molecule,” or “polynucleotide” include any compound and / or substance comprising a polymer of nucleotides. Each nucleotide consists of a base, particularly a purine or pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T), or uracil (U)), a sugar (i.e., deoxyribose or ribose), and a phosphate ester group. Nucleic acid molecules are often described according to the sequence of bases, which represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is generally stated from 5' to 3'. In this application, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), such as complementary DNA (cDNA) and genomic DNA; ribonucleic acid (RNA), particularly messenger RNA (mRNA), 16S rDNA; synthetic forms of DNA or RNA; and mixed polymers comprising two or more of these molecules. Furthermore, the term nucleic acid molecule includes sense and antisense strands, and single-stranded and double-stranded forms. Additionally, nucleic acid molecules described herein may contain naturally occurring or non-naturally occurring nucleotides. Nucleic acids also include known types of modifications, such as methylation, where one or more naturally occurring nucleotides are replaced by an analog "cap".

[0058] 16S rDNA is the most commonly used "molecular clock" in bacterial taxonomy research. Its sequence contains 9 variable regions and 10 conserved regions. The variable regions vary from bacterium to bacterium, and the degree of variation is closely related to bacterial phylogeny. By detecting the sequence variation and abundance of 16S rDNA, information on community diversity in environmental samples can be obtained. 16S rDNA sequence analysis is a key step in microbial classification and identification.

[0059] To determine the percentage of identity between two nucleic acid sequences or nucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., vacancies may be introduced in one or both of the first and second nucleic acid sequences for optimal alignment, or non-homologous sequences may be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, or 100% of the reference sequence length. Nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide at the corresponding position in the second sequence, the molecules are identical at that position.

[0060] Mathematical algorithms can be used to perform sequence comparisons and calculate the percentage of identity between two sequences. In a preferred embodiment, the GAP program in the GCG software package (available at http: / / www.gcg.com) is used to determine the percentage of identity between two nucleotide sequences using the NWSgapdna.CMP matrix and vacancy weights of 40, 50, 60, 70, or 80 and length weights of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and one set of parameters that should be used unless otherwise specified) is a Blossum 62 scoring matrix with a vacancy penalty of 12, a vacancy extension penalty of 4, and a frameshift vacancy penalty of 5. In another preferred embodiment, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. 48:443-453) implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 6.6.0 or later) is used to determine the sequence identity between two nucleotide sequences, and the sequence identity between the two nucleotide sequences is determined as the output of “longest consistency”. Default parameters such as a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and EBLOSUM62 (the EMBOSS version of BLOSUM62) can be used to replace the matrix. Alternatively, the parameters used can be a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EDNAFULL (the EMBOSS version of NCBI NUC4.4) replacement matrix. To have the Needle program report the longest identity, specify the `-nobrief` option in the command line. The Needle program output marked "Longest Identity" is calculated as follows: (Number of identical residues × 100) / (Alignment length - Total number of vacancies in the alignment).

[0061] Alternatively, the PAM120 weighted remainder table, a gap length penalty of 12, and a gap penalty of 4 can be used to determine the percentage of identity between two nucleotide sequences using the E. Meyers and W. Miller algorithm ((1989) CABIOS, 4:11-17), which has been incorporated into the ALIGN program (version 2.0).

[0062] According to this application, the degree of identity between a given reference nucleotide sequence and a nucleotide sequence that is a homolog of the given nucleotide sequence is preferably at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. Preferably, the degree of identity is given for nucleic acid regions that constitute at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the total length of the reference nucleic acid sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is preferably given for at least 20, at least 40, at least 60, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, or 200 nucleotides, preferably consecutive nucleotides. In one specific implementation plan, the degree / percentage of similarity or identity to the full length of the reference nucleic acid sequence is given.

[0063] In this application, the term "culture" refers to bringing microbial cells into contact with a culture medium under conditions suitable for the survival and / or growth and / or proliferation of the microorganisms.

[0064] The term "batch culture" refers to a culture in which all components (including cells and all culture nutrients) used for microbial culture are supplied to the culture reactor at the beginning of the culture process.

[0065] As used herein, “feed-batch cell culture” refers to a batch culture in which microbial cells and culture medium are initially supplied to the culture reactor and additional culture nutrients are continuously or in discrete increments delivered to the culture during the culture period, while cells and / or products are harvested periodically or not before the culture is terminated.

[0066] The term "composition" refers to any kind of composition or formulation that provides benefit to an individual and is safe for consumption by humans or animals. Compositions can be in solid (e.g., powder), semi-solid, or liquid form. In one embodiment, the composition is a health supplement or food that may contain one or more macronutrients, micronutrients, food additives, water, etc. Macronutrients can be protein sources, lipid sources, carbohydrate sources, and any combination thereof. Micronutrients can be vitamins, minerals, fiber, phytochemicals, antioxidants, prebiotics, probiotics, bioactive agents, metabolites (e.g., butyrate, docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), gamma-linolenic acid (GLA)), and any combination thereof. The composition may also contain food additives, such as stabilizers (when provided in liquid or solid form) or emulsifiers (when provided in liquid form). The amounts of various ingredients are expressed in g / 100g composition on a dry weight basis when the composition is in solid form (e.g., powder), and in g / L composition concentration when the composition is in liquid form. Typically, the composition can be formulated for oral or gastrointestinal administration. Preferably, the composition is for oral use.

[0067] The term "effective amount" refers to the amount or dose of the strain or composition of the present invention, which, when administered to a subject in a single or multiple doses, produces the desired effect in the subject. The desired effect may be sobering up, alleviating one or more symptoms of intoxication, such as reducing the ethanol or acetaldehyde levels in the subject's body, relieving discomfort symptoms such as headache, nausea, vomiting, dizziness, and fatigue.

[0068] Example

[0069] The following embodiments further illustrate the present invention; however, it should be understood that the embodiments are described in an illustrative rather than limiting manner, and various modifications can be made by those skilled in the art.

[0070] Unless otherwise expressly stated, the present invention will be practiced using conventional chemical, biochemical, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, and cell biology methods within the art. Unless otherwise specified, all experimental materials used are commercially available products. Where specific techniques or conditions are not specified in the examples, they shall be performed according to the techniques or conditions described in the literature in the art, or according to the corresponding product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0071] Example 1. Isolation and identification of Staphylococcus aureus strain 90658

[0072] The inventors traced the traditional fermentation environment of baijiu (Chinese liquor) and screened microorganisms in the cellar mud to obtain microorganisms adapted to high ethanol content environments. Through enrichment culture and targeted screening, a probiotic strain with highly effective hangover-relieving properties was successfully isolated. 16S rDNA sequence and homology analysis identified this strain as a novel Staphylococcus aureus strain, which was named Staphylococcus aureus-90658.

[0073] 1. Culture medium used

[0074] MRS medium: Prepare 1L of MRS medium with sterile water, using the following concentrations: 10g / L peptone, 10g / L beef meal, 5g / L yeast extract, 20g / L glucose, 1ml Tween 80, 2g / L dipotassium hydrogen phosphate, 5g / L sodium acetate, 2g / L triammonium citrate, 0.2g / L magnesium sulfate, and 0.05g / L manganese sulfate. Adjust the pH of the medium to 6.5 with 10% hydrochloric acid or 30% sodium hydroxide.

[0075] Culture medium A: Prepare 1L of culture medium A with sterile water, containing 10g / L peptone, 5g / L beef meal, 4g / L yeast extract, 2g / L glucose, 1ml Tween 80, 2g / L dipotassium hydrogen phosphate, 5g / L sodium acetate, 2g / L triammonium citrate, 0.2g / L magnesium sulfate, and 0.05g / L manganese sulfate. Adjust the pH of the culture medium to 6.5 with 10% hydrochloric acid or 30% sodium hydroxide.

[0076] Culture medium B: Prepare 1L of culture medium B by adding sterile water with the following concentrations: 1g / L KH₂PO₄, 0.3g / L MgSO₄⁻ 7H₂O, 0.1g / L NaCl, 5.0g / L (NH₄)₂SO₄, and 0.01g / L FeSO₄⁻ H₂O. Adjust the pH of the culture medium to 6.5 using 10% hydrochloric acid or 30% sodium hydroxide.

[0077] After preparing the culture medium according to the above formula, autoclave it at 121℃ for 15 min. After the culture medium is cooled to room temperature, add 2.5%, 5%, 7.5%, and 10% (v / v) ethanol to culture medium A and culture medium B respectively to prepare culture media containing different ethanol concentrations.

[0078] 2. Isolation of Staphylococcus aureus strain 90658 from cellar mud

[0079] Soil was collected from the cellars of Jiangsu Yanghe Distillery Co., Ltd., and a soil solution of 0.1 g / mL was prepared with sterile water and then serially diluted to 10. -5 10 -4 10 -3Three gradients of ethanol concentration were used. 500 μL of each diluted soil solution was inoculated into 50 mL shake flasks containing different concentrations of ethanol (medium ethanol concentrations) of medium A and medium B, respectively. After 48 h of incubation, flasks with significant colony growth were selected, centrifuged, and 2 mL of the supernatant was collected and sealed for preservation. Growth was then measured, and the inoculum was inoculated into new shake flasks (containing the same ethanol concentration as the first round of medium) at a 2% inoculation rate. A third round of incubation was then performed based on the growth results. Subsequently, single colonies were isolated by streaking or serially diluted plating on solid plates of medium A and medium B containing the corresponding ethanol concentrations. Well-developed single colonies were selected for further incubation and strain identification. Finally, a new strain capable of tolerating 10% (v / v) ethanol concentration was obtained and named strain 90658.

[0080] 3. Culture and morphological identification of strain 90658

[0081] The *Staphylococcus aureus*-90658 single colonies obtained from the above screening were cultured for 24-48 hours on MRS solid medium that meets food safety production regulations and can be used for large-scale tank production. The colonies formed clearly on the MRS medium, with a diameter of 0.5-1.5 mm, were round, with neat edges, milky white, moist, smooth, and colored, and did not produce pigments. Figure 1A As shown.

[0082] Staphylococcus aureus 90658 was stained and examined under a microscope using a 100X oil immersion microscope for morphological observation. Figure 1B As shown, the bacteria exhibit a bluish-purple color (a characteristic of Gram-positive bacteria). The bacteria are primarily spherical or slightly elliptical in shape, with some cells scattered individually, others arranged in pairs or short chains. A notable feature is the aggregation of many bacteria into typical "grape-like" clusters, a key characteristic of the *Staphylococcus* genus. The above images clearly demonstrate the typical morphology, arrangement characteristics, and staining reaction of *Staphylococcus fleshyus*, serving as a valid basis for the morphological identification of this strain.

[0083] 4. Identification of 16S rDNA of Staphylococcus aureus strain-90658

[0084] Genomic DNA was extracted from the isolated strain according to conventional methods in the art. Using this extracted genomic DNA as a template, 16S rDNA amplification was performed using universal 16S rDNA primers (synthesized by GenScript, catalog number: C039A006G0). The primer sequences are shown below: 16S-27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No: 2); 16S-1492R: TACGGCTACCTTGTTACGACTT (SEQ ID No: 3).

[0085] The Dream Taq DNA polymerase used for amplification was Thermo Fisher Scientific™ Dream Taq™ DNA polymerase. The 50 μL PCR system was as follows:

[0086] The 16S rDNA fragment obtained by PCR amplification was sequenced and analyzed. The sequence of the obtained 16S rDNA is shown in SEQ ID NO: 1. Using public sequence resources in the National Center for Biotechnology Information (NCBI) database, a BLAST search tool (using NCBI default parameters: Database: Standard databases (nr etc.) — Core nucleotide database (core_nt); Program Selection: Highly similar sequences (megablast)) was used to perform sequence similarity searches on the sequencing results to analyze their homology. The results showed that this 16S rDNA fragment had extremely high similarity to the 16S rDNA of several Staphylococcus aureus strains: the highest similarity was with the 16S rDNA fragment of Staphylococcus aureus strain 1709, with a homology of 99.79%. Furthermore, similarities were found with other Staphylococcus aureus strains... Staphylococcus carnosus The 16S rDNA fragment of strain LTH 3730 showed 99.72% homology; it was similar to that of Staphylococcus aureus strain. Staphylococcus carnosus The 16S rDNA fragment of strain TMW 2.218 showed 99.72% homology; it was similar to that of Staphylococcus aureus strain. Staphylococcus carnosus subsp. carnosus The 16S rDNA fragment of TM300 showed 99.65% homology. Based on the above homology analysis results, the strain obtained in this application is confirmed to belong to Staphylococcus aureus (Staphylococcus aureus). Staphylococcus carnosus The strain was identified as "Staphylococcus aureus strain 90658". Strain 90658 was deposited on November 19, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 36688. The address of the depository is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0087] 5. Identification of specific fragments of Staphylococcus aureus strain 90658

[0088] To enable rapid differentiation and identification of Staphylococcus aureus strain-90658, the whole genome sequence of strain-90658 was analyzed and studied.

[0089] The genome of Staphylococcus aureus strain 90658 was extracted using a bacterial genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP302). The successfully extracted genome was sent to General Biosystems (Anhui) Co., Ltd. for third-generation sequencing analysis, and the strain sequence was annotated for subsequent specific sequence analysis and alignment.

[0090] Genomic DNA was extracted from the isolated strain using conventional methods (as described above). Using this extracted genomic DNA as a template, two primer pairs, N1 / N2 and M1 / M2 (synthesized by GenScript, catalog number: C039A006G0), were designed for PCR amplification. The PCR amplification system is described in the section on 16S rDNA identification above. The primer sequences are shown below: N1: ATGAGTGTAAATGCAAGAGATTATATC (SEQ ID NO: 4); N2: TTATTGTGTATCATATAATCCT (SEQ ID NO: 5); M1: ATGAAAGCCGAAGGTTATGAATT (SEQ ID NO: 6); M2:TTAAACACTCTCCTTAATATCT (SEQ ID NO: 7) Sequencing analysis of the genomic DNA fragment obtained by primer N1 / N2 amplification revealed that the sequence encodes an aldehyde dehydrogenase family protein, as shown in SEQ ID NO: 8. Using public sequence resources in the National Center for Biotechnology Information (NCBI) database, a BLAST search was performed on this sequence (using NCBI default parameters: Database: Standard databases (nr etc.) — Core nucleotide database (core_nt); Program Selection: Highly similar sequences (megablast)) to analyze its homology. The results showed that this sequence is similar to… Staphylococcus carnosus strain LTH 3730 and Staphylococcus carnosus The fragments from strain TMW 2.218 showed the highest similarity, with a homology of 99.6%, and were similar to those from strain TMW 2.218. Staphylococcus carnosus subsp. carnosus The homology with TM300 was 99.4%. The above homology analysis results indicate that the Staphylococcus aureus strain 90658 of this invention differs from other Staphylococcus aureus strains, further demonstrating that the Staphylococcus aureus strain 90658 of this invention is a novel Staphylococcus aureus.

[0091] Sequencing analysis of the genomic DNA fragment obtained by primer M1 / M2 amplification revealed that the sequence likely encodes an XRE family transcriptional regulator, as shown in SEQ ID NO: 9. Using public sequence resources in the NCBI database, a BLAST search was performed on this sequence (using NCBI default parameters: Database: Standard databases (nr etc.) — Core nucleotide database (core_nt); Program Selection: Highly similar sequences (megablast)) to analyze its homology. The results showed no homologous sequences matching other Staphylococcus aureus strains. These search results indicate that the nucleic acid fragment encoding an XRE family transcriptional regulator is unique to Staphylococcus aureus strain 90658 compared to other Staphylococcus aureus strains and can be used as a specific fragment for identifying this strain. Identifying this nucleic acid fragment encoding an XRE family transcriptional regulator allows for simple and rapid species identification and differentiation.

[0092] Example 2. Identification of ethanol resistance characteristics of Staphylococcus aureus strain 90658

[0093] To further verify the ethanol resistance of Staphylococcus aureus 90658, the inventors used other strains simultaneously screened from cellar mud, namely Lactobacillus paracasei and Pediococcus pentosus, as controls. They inoculated the strains with an initial OD value of 1.0 into culture medium A containing 5% and 10% ethanol, respectively, for comparison.

[0094] The results are shown in Table 1: The control strain was significantly affected by ethanol toxicity. A 5% ethanol concentration was sufficient to inhibit the growth of the control strain, while Staphylococcus aureus 90658 showed a high tolerance to ethanol. In medium A containing 10% ethanol, it could still maintain basically normal growth, showing high ethanol tolerance (Table 1).

[0095] Table 1. Growth capacity test of 5% and 10% ethanol medium A

[0096] Example 3. Evaluation of the gastrointestinal tolerance characteristics of Staphylococcus aureus strain 90658

[0097] Considering that in real-world scenarios, probiotics need to function in the gastrointestinal environment to alleviate hangovers, and that the gastrointestinal environment is typically harsh and unfavorable for probiotic survival, effective probiotics must first tolerate the stringent pH of the human gastrointestinal environment (gastric juice pH 2.5-3.5, intestinal juice pH 6.5-7) and resist interference from various components such as proteases. Therefore, the inventors first tested the survival rate of Staphylococcus aureus strain 90658 in the gastrointestinal environment.

[0098] 1. Prepare buffer solutions to simulate gastric and intestinal fluids.

[0099] Gastric buffer solution: Prepared with 2.758 g / L NaCl, 0.514 g / L KCl, 0.122 g / L KH2PO4, 0.011 g / L MgCl2, 0.048 g / L (NH4)2CO3, and 2.100 g / L NaHCO3. Adjust the pH of the solution to 2.5, 3.0, and 3.5 respectively with hydrochloric acid solution or sodium hydroxide solution. Make up to 1000 mL with distilled water and sterilize for later use.

[0100] Enteric buffer solution: Prepared with 2.244 g / L NaCl, 0.507 g / L KCl, 0.109 g / L KH2PO4, 0.031 g / L MgCl2, 0.003 g / L CaCl2, 7.141 g / L NaHCO3, and 0.2 g / L bile salts. Adjust the pH of the solution to 7 with hydrochloric acid or sodium hydroxide solution, bring the volume to 1000 mL with distilled water, and sterilize for later use.

[0101] 2. Detection of the gastrointestinal environment resistance characteristics of Staphylococcus aureus strain 90658

[0102] Staphylococcus aureus strain 90658 was cultured normally in MRS liquid medium. After one day of culture, the cells were collected by centrifugation and resuspended three times by washing with prepared physiological saline. Finally, the cells of Staphylococcus aureus strain 90658 were diluted with physiological saline to OD=5 for later use. Then, the colony counts of simulated gastric and intestinal fluids were calculated, according to the method described in INFOGEST static in vitro simulation of gastrointestinal food digestion, André Brodkorb et al., Nature Protocols, 14, pp. 991–1014, published March 18, 2019.

[0103] Simulated gastric fluid colony count calculation: Pepsin (final pepsin activity 2000 U / mL) was added to gastric buffer in a clean bench. 5 mL of the prepared OD=5 90658 bacterial suspension was taken and mixed thoroughly with 5 mL of gastric buffer containing pepsin (for the control parallel sample, 5 mL of physiological saline was mixed thoroughly with 5 mL of gastric buffer containing pepsin). After incubation at 37°C for 2 h, serial dilutions and plate counting were performed.

[0104] Simulated intestinal fluid colony count calculation: Trypsin (final trypsin activity 100 u / mL) was added to the intestinal buffer in a clean bench. 5 mL of the 90658 bacterial suspension with OD=5 prepared above was taken and mixed thoroughly with 5 mL of intestinal buffer containing trypsin (the control parallel sample consisted of 5 mL of physiological saline and 5 mL of intestinal buffer containing trypsin). After incubation at 37°C for 2 h, serial dilutions and plate counting were performed.

[0105] Colony count was determined according to the national standard method GB 4789.2-2022. Results are as follows: Figure 2 As shown, Staphylococcus aureus strain 90658 exhibits excellent tolerance to the gastric fluid environment, maintaining a survival rate of over 80% under gastric fluid conditions of pH 2.5-3.5 with minimal decline in viable bacterial count. In intestinal fluid at pH 7, it maintains a 20% survival rate. This differentiated survival performance of Staphylococcus aureus 90658 in simulated gastrointestinal fluids ensures that sufficient viable bacteria can function effectively and maintain metabolic activity in the stomach, a crucial location for alcohol intake. Before alcohol is fully absorbed, the Staphylococcus aureus residing in the gastric environment can partially undertake the alcohol metabolism and absorption process, thereby reducing the peak concentration of ethanol and its toxic metabolite acetaldehyde in the blood from the source, alleviating symptoms of intoxication and reducing the burden on the liver.

[0106] Example 4. In vitro antioxidant capacity assessment of Staphylococcus aureus strain 90658

[0107] 1. Preparation of culture supernatant, bacterial suspension and intracellular extract of Staphylococcus aureus strain 90658

[0108] (1) Culture supernatant: After culturing the bacteria in MRS medium for 1 day, collect the culture medium and count the bacteria. Adjust the bacterial concentration (CFU / ml) to 1.0×10⁻⁶. 9 The cells were then centrifuged at 4°C and 5000 rpm for 10 min, and the supernatant and bacterial cells were collected separately. The supernatant was filtered through a 0.22 μm sterile filter membrane to obtain the culture supernatant.

[0109] (2) Bacterial suspension: After washing the bacterial cells three times with sterile PBS, resuspend them in sterile PBS and adjust the bacterial concentration to 1.0 × 10⁻⁶. 9 CFU / ml was used to obtain a bacterial suspension.

[0110] (3) Intracellular extract: A portion of the bacterial suspension was retained and stored at 4°C. The remainder was 1.0 × 10⁻⁶. 9 The bacterial suspension of CFU / ml was sonicated in an ice bath (700 w, sonication for 3 s, pause for 3 s, for a total of 30 min). The lysate was centrifuged at 12000 rpm for 15 min, and the supernatant was collected. The supernatant at this time is the cell-free extract (CFE).

[0111] 2. Evaluation of the in vitro antioxidant capacity of each component of the strain

[0112] (1) Determination of reduced glutathione (GSH) content in strain culture supernatant and intracellular extract

[0113] Reduced glutathione (GSH) is an important endogenous antioxidant and detoxifying agent in the body. It can effectively reduce oxidative stress damage and the direct toxicity of acetaldehyde by neutralizing free radicals (such as hydroxyl radicals) and the toxic metabolite acetaldehyde produced during alcohol metabolism. Furthermore, the activity of acetaldehyde dehydrogenase is highly dependent on the reduced state of its active site, the cysteine ​​residue. When the body is under severe oxidative stress (e.g., acute alcohol poisoning, liver failure), this site may be oxidized and inactivated. GSH is the most important non-protein thiol antioxidant in cells, forming the core reducing buffer system. It maintains the intracellular reducing environment and helps maintain the reduced state of the active site of ALDH, thereby ensuring its catalytic function, accelerating the conversion of acetaldehyde to acetic acid, and eliminating acetaldehyde toxicity.

[0114] For 1.0×10 9 Reduced glutathione (GSH) in the culture supernatant and intracellular extract of Staphylococcus aureus-90658 (CFU / ml) was determined. The reduced glutathione colorimetric assay kit (Elabscience, E-BC-K030-M) was used, and the results are shown in Table 2. In the results, different concentration units were used for the determination of GSH in the bacterial culture supernatant and intracellular extract. Supernatant concentration was expressed in µmol / L (micromoles per liter), which is the standard expression of solution concentration and directly reflects the absolute concentration of the target substance in the extracellular culture medium. Intracellular extract concentration was expressed in µmol / gprot (micromoles per gram of protein), a commonly used method in biochemistry for standardizing intracellular content. This is mainly because the amount of solvent used for extraction can be flexibly adjusted when extracting intracellular substances. If calculated by volume, more solvent results in a lower concentration. However, protein is the core component of bacterial cells, and its content is directly proportional to the number of cells. "Calculated by the target substance content per gram of protein (µmol / g prot)" is equivalent to calibration with a unified standard, which can eliminate the influence of adding too much or too little solvent and accurately reflect the amount of glutathione actually accumulated in the cell.

[0115] GSH was detected in both the culture supernatant and intracellular extract of Staphylococcus aureus 90658, demonstrating that Staphylococcus aureus 90658 has antioxidant and alcohol-detoxifying abilities.

[0116] Table 2. GSH content in culture supernatant and intracellular extract of Staphylococcus aureus-90658

[0117] (2) Assessment of total antioxidant capacity (ABTS chemical method)

[0118] Using the Total Antioxidant Capacity (T-AOC) colorimetric assay kit (ABTS chemical method) (Elabscience, E-BC-K271-M), according to the kit instructions, 1.0 × 10⁻⁶... 9 The total antioxidant capacity of CFU / ml Staphylococcus aureus 90658 culture supernatant and intracellular extract was analyzed. The ABTS cationic free radical scavenging rate was calculated as follows:

[0119] The test results are shown in Table 3.

[0120] Both the culture supernatant and intracellular extract of Staphylococcus aureus-90658 exhibited antioxidant capacity, with the culture supernatant showing stronger antioxidant capacity at a concentration of only 6.7 × 10⁻⁶. 6 At a concentration of CFU / mL, the clearance rate exceeded 30%; when the concentration reached 1.0 × 10⁻⁶ CFU / mL, the clearance rate was higher than 30%. 8 -1.0×10 9 At CFU / mL, the clearance rate was significantly improved and superior to the control strain. At the same high concentration (1.0 × 10⁻⁶ CFU / mL), the clearance rate was significantly higher than that of the control strain. 9 At CFU / mL, its clearance rate was significantly higher than that of *Lactobacillus plantarum* XZFMCC101.23155 (CN 120485044 A) and *Lactobacillus plantarum* ZFML004 (CN120796153B) reported in the prior art. Furthermore, its intracellular extract also exhibited antioxidant activity, confirming that this strain possesses comprehensive antioxidant properties.

[0121] Table 3 Total antioxidant levels of Staphylococcus aureus-90658 culture supernatant and intracellular extracts

[0122] (3) Assessment of hydroxyl radical scavenging ability

[0123] Hydroxyl radicals are byproducts of alcohol metabolism via the CYP2E1 pathway and possess extremely strong oxidizing power in the body. They can reduce or even inactivate the activity of enzymes such as alcohol dehydrogenase and aldehyde dehydrogenase, thereby hindering ethanol metabolism and leading to a large accumulation of acetaldehyde in the body. Furthermore, long-term excessive alcohol consumption can cause widespread oxidative damage to lipids, proteins, and DNA, leading to alcoholic hepatitis, liver fibrosis, cirrhosis, and even liver cancer. Therefore, the hydroxyl radical scavenging capacity of probiotics reflects their function in maintaining the redox balance of the internal environment. By protecting the activity of key enzymes in ethanol metabolism and reducing oxidative damage to hepatocytes, the hydroxyl radical scavenging capacity of probiotics is an important indicator for assessing their health benefits and alcohol-detoxifying functions.

[0124] For 1.0×10 9 The scavenging capacity of hydroxyl radicals in the culture supernatant, bacterial suspension, and intracellular extract of *Staphylococcus aureus* 90658 (CFU / ml) was determined. 100 μL of the sample was added to 1 ml of 20 mM terephthalic acid solution. After mixing, 20 μL of 1 mM anhydrous copper sulfate solution and 20 μL of 100 mM H₂O₂ solution were added respectively. After mixing, the mixture was reacted at 37 °C for 30 min, and the fluorescence values ​​were measured at an excitation wavelength of 312 nm and an emission wavelength of 426 nm. In the background group, only the sample and terephthalic acid solution were added; PBS was used instead of the sample in the blank tube; and 1 mM GSH was used as a positive control. To ensure the detection limit was met, the supernatant was diluted 25-fold and the bacterial suspension was diluted 10-fold. The scavenging rate was calculated using the following formula: , The test results are shown in Table 4 and Figure 3 As shown.

[0125] All three samples of Staphylococcus aureus exhibited strong hydroxyl radical scavenging levels. Even after a 25-fold dilution of its culture supernatant, its scavenging rate (15%) was comparable to that of the stock solution of the existing strain Lactobacillus plantarum XZFMCC101.23155 (16.95%); its undiluted bacterial suspension showed even lower scavenging rates (1.0 × 10⁻⁶). 8 The clearance rate at CFU / mL (70%) was significantly higher than that of Lactobacillus fermentation strain YYS-K2 (CN116769656B) at a higher concentration (3.0 × 10⁻⁶ CFU / mL). 8 The clearance rate at (CFU / mL) was 47.46%. Particularly noteworthy was the clearance rate of its intracellular extract, which reached 94.2%, significantly superior to the 1 mM GSH standard. These data collectively demonstrate that this strain possesses hydroxyl radical scavenging capabilities at the intracellular, somatic, and extracellular levels.

[0126] Table 4. Scavenging levels of hydroxyl radicals by various components of Staphylococcus aureus-90658

[0127] Note: This indicates a significant difference compared to GSH.

[0128] Example 5: Determination of alcohol dehydrogenase and acetaldehyde dehydrogenase in Staphylococcus aureus strain 90658

[0129] Ethanol dehydrogenase and aldehyde dehydrogenase play important roles in ethanol metabolism. The activities of these two enzymes in *Staphylococcus carinatum* strain 90658 were detected. Culture medium of *Staphylococcus carinatum* strain 90658 was collected during culture (e.g., at 9 and 17 hours of the cell growth exponential phase) and at the end of culture (e.g., at 29 hours). After resuspending and washing three times with PBS phosphate buffer (pH 7.0), the medium was ultrasonically disrupted using a sonicator at 70-80% rated power (150W) in an ice bath for 30 min. Ethanol dehydrogenase activity was detected using a WST-8 assay kit (Beyotime, product number: S0241M). Aldehyde dehydrogenase activity was detected using a UV colorimetric assay kit (Shanghai Sangon Biotech, product number: D799209-0050).

[0130] As shown in Table 5, Staphylococcus aureus possesses strong aldehyde dehydrogenase (ALDH) activity. The importance of probiotics possessing ALDH activity lies in its ability to compensate for the insufficient ALDH activity in some individuals, opening up an "auxiliary detoxification" pathway in the gastrointestinal tract and directly accelerating the breakdown of the key toxin acetaldehyde. By rapidly reducing the concentration of acetaldehyde in the body, it fundamentally reduces the toxic stimulation of acetaldehyde on the vascular and nervous systems, thereby alleviating core hangover symptoms (such as headaches).

[0131] Table 5. Determination of ethanol dehydrogenase and acetaldehyde dehydrogenase activities in Staphylococcus aureus culture medium.

[0132] Example 6: Human Experiment on the Alcohol-Relieving Effect of Staphylococcus aureus 90658

[0133] I. Experimental Design

[0134] Alcohol dehydrogenase (ADH, with the key functional subtype being ADH1B) and aldehyde dehydrogenase (ALDH, with the key functional subtype being ALDH2) are the core enzyme systems for alcohol metabolism in the human body. They work synergistically to complete the alcohol detoxification process, and their enzyme activities are determined by specific genotypes. Genotype differences between individuals can lead to significant variations in alcohol metabolism, potentially interfering with the results of alcohol metabolism experiments. ADH1B is responsible for the first stage of alcohol metabolism, oxidizing ethanol to acetaldehyde. Its key functional SNP site is rs1229984, and its genotypes include TT, CT, and CC. The TT genotype has the highest enzyme activity and the fastest ethanol metabolism rate, the CT genotype has moderate activity and a moderate metabolism rate, and the CC genotype has the lowest activity and the slowest metabolism rate. ALDH2 is responsible for the second stage, further oxidizing toxic acetaldehyde to non-toxic acetic acid. Its key functional SNP site is rs671, and its genotypes include GG, AG, and AA. The GG genotype is wild-type, with normal enzyme activity and the strongest acetaldehyde metabolism capacity. The first type was a heterozygous mutant with approximately 50% of the wild type's enzyme activity and moderate metabolic capacity, while the second type was a homozygous mutant with almost complete enzyme activity and the weakest metabolic capacity. To control for confounding effects of individual metabolic differences among volunteers and ensure consistency of metabolic background among groups, the genotypes of ADH1B (rs1229984 locus) and ALDH2 (rs671 locus) were determined using genotyping technology. Volunteers' ability to metabolize alcohol was graded from 1 to 5 stars, with 1 star representing the weakest alcohol metabolism and 5 stars representing the strongest. Based on these inclusion criteria, suitable volunteers were selected and appropriately grouped to ensure the scientific validity and reliability of the alcohol metabolism experiment results.

[0135] The experiment was designed as a single-blind crossover study (i.e., volunteers did not know whether they were in the experimental or control group, but the researchers did). Each volunteer underwent a two-stage experiment, divided into groups A and B, with six volunteers in each group. Group A volunteers received the experimental sample in the first stage and the control sample in the second stage, while group B volunteers received the control sample in the first stage and the experimental sample in the second stage). The experiment lasted two days, with a one-day rest break in between to avoid volunteer fatigue from drinking and to ensure the comparability and accuracy of data before and after the alcohol detoxification experiment. Volunteers were assigned samples with random three-digit codes. Volunteers were averaged and grouped according to their genotype (selecting volunteers with 3 stars or higher) and their actual alcohol tolerance, ensuring a consistent baseline across groups, meaning each group included volunteers with varying alcohol tolerances and a relatively consistent number of participants. The volunteers were aged between 18 and 60 years old, totaling 12 participants.

[0136] Both experiments simulated drinking sessions. Volunteers took the experimental sample 10 minutes before a meal, and then drank alcohol while eating for 40 minutes. Breath alcohol content was measured every 30 minutes for a total of 180 minutes. Additionally, at the 180-minute mark, volunteers completed a subjective questionnaire, rating the effectiveness of the experiment's hangover-reducing effect and providing a detailed subjective description. Breath alcohol data was not displayed to volunteers during the experiment to avoid influencing their assessment of the hangover-reducing effect.

[0137] II. Sample Preparation

[0138] Volunteers were grouped as shown in Table 6 for a single-blind crossover experiment. In the first phase, they were divided into groups A and B; group A received the sample, and group B received a placebo. In the second phase, group A received the placebo, and group B received the sample. The control sample was 45 mL of fruit-flavored beverage without Staphylococcus aureus 90658 (placebo), and the experimental sample was 45 mL of fruit-flavored beverage with lyophilized Staphylococcus aureus 90658 powder prepared according to standard methods. The viable count of Staphylococcus aureus 90658 in the fruit-flavored beverage remained stable. The Staphylococcus aureus was thoroughly mixed into the fruit-flavored beverage 10 minutes before being given to the volunteers to ensure full activation.

[0139] Table 6. Formulas of Probiotics for Relieving Hangovers

[0140] II. Experimental Results

[0141] 1. Volunteer genotype results

[0142] Thirty-one people participated in the genotyping test. Among them, volunteers with a 1-2 star rating were those who could not drink alcohol or had a very low alcohol tolerance, so only volunteers with a 3-star rating or higher were included. The distribution of the ADH1B and ALDH2 composite genotypes of the enrolled volunteers (n=12) is shown in Table 1, and they were evenly distributed among the groups.

[0143] Table 7. Distribution of Genotypes and Metabolic Capacities of Enrolled Volunteers

[0144] 2. Breath alcohol concentration

[0145] During the alcohol consumption test experiment, breath alcohol tests were conducted on volunteers at different time points (30 min, 60 min, 90 min, 120 min, 150 min, and 180 min), and the breath alcohol content (mg / 100 mL) was recorded. Monitoring breath alcohol content at different time points reflects the dynamic changes in alcohol metabolism in the human body.

[0146] The breath alcohol content of volunteers within 180 minutes after taking the control and experimental group samples was as follows: Figure 4 As shown, the breath alcohol concentration of volunteers who took Staphylococcus aureus 90658 was significantly lower than that of volunteers who took a placebo within 180 minutes. This indicates that Staphylococcus aureus 90658 has a significant effect on reducing breath alcohol concentration during alcohol consumption, suggesting it may have a certain sobering effect.

[0147] 3. Validity scoring (subjective questionnaire)

[0148] At the end of the 180-minute drinking experiment, volunteers completed a questionnaire regarding the effectiveness of the hangover remedy product. The questionnaire primarily included a rating of the sample's hangover-relieving effect during the day's experiment: 3 - effective; 2 - possibly effective; 1 - ineffective. An additional subjective question explained the reason for the given rating. By comparing the effectiveness scores of the same volunteer over two days, the effectiveness of the bacterial strain in relieving hangovers could be determined. The results were categorized into three levels: significantly effective (volunteers scored higher when given the experimental sample than when given the control sample, and their subjective descriptions matched their scores); relatively effective (volunteers scored similarly when given the experimental sample to those given the placebo, but their subjective descriptions indicated a better effect than the control); and ineffective (volunteers scored less than or equal to the placebo when given the experimental sample, and their subjective descriptions did not indicate a better effect than the placebo).

[0149] Table 8. Validity Scoring

[0150] Overall effectiveness rate = (Number of clearly effective people + Number of relatively effective people) / Total number of people

[0151] The effectiveness scores are shown in Table 7. As the table shows, 58.3% of volunteers believed that Staphylococcus aureus had a significant effect on relieving hangovers within 180 minutes, 16.7% believed it was relatively effective, and 25.0% believed it was ineffective, resulting in an overall effectiveness rate of 75.0%. Considering the volunteers' breath alcohol concentrations, it can be concluded that Staphylococcus aureus strain 90658 has a good hangover-relieving effect.

[0152] Example 7. Human experiment on the hangover-relieving effect of Staphylococcus aureus strain 90658 with different concentrations of live bacteria.

[0153] Based on the above results, to further explore the optimal concentration of this bacterium for its hangover-relieving effect, different viable cell concentration gradients were set up. The groups were set as follows: ① Low group (viable cell count 1.0 × 10⁻⁶) 7 ② Middle group (cfu / g); ② Medium group (live bacteria count of 1.0×10⁻⁶) 8③ High group (live count of 1.0 × 10⁻⁶ CFU / g); ③ High group (live count of 1.0 × 10⁻⁶ CFU / g). 9 ④ Ultra-high cfu / g group (live bacteria count of 1.0×10⁻⁶) 10 cfu).

[0154] I. Experimental Design

[0155] Volunteer inclusion and grouping were consistent with Example 6, based on genotype (selecting volunteers with 3 stars or higher) and self-reported alcohol tolerance, ensuring baseline consistency within each group. The experiment was designed as a single-blind crossover, meaning volunteers were unaware of their experimental or control group affiliation, but researchers were. The 32 volunteers were divided into four groups (low, medium, high, and very high), each further subdivided into A and B groups. Group A received different concentrations of Staphylococcus aureus experimental sample (1.0 × 10⁻⁶) in the first phase. 7 cfu / g, 1.0×10 8 cfu / g, 1.0×10 9 cfu / g or 1.0×10 10 Group B received a control sample in the first phase and different concentrations of the sample in the second phase. The experiment lasted two days with a one-day rest period to avoid fatigue among volunteers and to ensure the comparability and accuracy of data from both phases. Volunteers were assigned samples with random three-digit codes. They were grouped evenly based on their genotype and actual alcohol tolerance, ensuring each group included volunteers with varying alcohol tolerances and a relatively consistent number of participants. The volunteers were aged between 18 and 60 years old, and the experiment involved 32 participants.

[0156] Both experiments simulated drinking sessions. Volunteers were required to take the experimental sample 10 minutes before the meal, and then drink alcohol and eat within 40 minutes. At 180 minutes, volunteers were required to fill out a subjective questionnaire, which included a score for the effectiveness of the experiment in relieving hangovers that day and a specific subjective description.

[0157] II. Sample Preparation and Grouping

[0158] Volunteers were grouped according to Table 8 below for a single-blind crossover experiment. The control sample was a placebo (fruit-flavored beverage) without Staphylococcus aureus 90658, while the lower-group experimental samples contained 1.0 × 10⁶ live bacteria. 7 The fruit-flavored beverage containing CFU-containing Staphylococcus aureus was tested in the middle group, with a live bacteria count of 1.0 × 10⁻⁶. 8 CFU-containing Staphylococcus aureus fruit-flavored beverages, the high-group experimental sample had an added live bacteria count of 1.0 × 10⁻⁶. 9 CFU's Staphylococcus aureus-flavored beverage, the sample in the ultra-high category experiment had an added live bacteria count of 1.0 × 10⁻⁶. 10CFU-based Staphylococcus aureus fruit-flavored beverage. The sample formulation and grouping for the hangover relief experiment are shown in Table 8.

[0159] Table 9 Sample formulation and grouping for hangover relief experiment

[0160] III. Experimental Results

[0161] 1. Volunteer Grouping

[0162] Forty-nine participants underwent genotyping. Volunteers with a genotype of 1-2 stars were considered to be essentially unable to drink alcohol; therefore, only volunteers with a genotype of 3 stars or higher were included. The distribution of the ADH1B and ALDH2 combined genotypes among the enrolled volunteers is shown in Table 10. All volunteers had a metabolic capacity of 3 stars or higher, and this was evenly distributed across the groups.

[0163] Table 10. Distribution of Genotypes and Metabolic Capacities of Enrolled Volunteers

[0164] 2. Validity Evaluation

[0165] No adverse symptoms were observed in any volunteers during the experiment. At the end of the 180-minute period, 32 volunteers completed an effectiveness questionnaire, and the results are shown in Table 9. In the low-concentration group, 25% of volunteers considered it significantly effective, 50% considered it relatively effective, and 25% considered it ineffective, for a total effective rate of 75%. In the medium-concentration group, 37.5% of volunteers considered it significantly effective, 37.5% considered it relatively effective, and 25% considered it ineffective, for a total effective rate of 75%. In the high-concentration group, 62.5% of volunteers considered it significantly effective, 25% considered it relatively effective, and 12.5% ​​considered it ineffective, for a total effective rate of 87.5%. In the ultra-high-concentration group, 62.5% of volunteers considered it significantly effective, and 37.5% considered it ineffective, for a total effective rate of 62.5%.

[0166] Table 11 Validity Scoring

[0167] Overall effectiveness rate = (Number of clearly effective people + Number of relatively effective people) / Total number of people

[0168] In summary, the viable count of Staphylococcus aureus 90658 was 1.0 × 10⁻⁶. 7 – 1.0×10 10 CFU (Cholesterol Fumed) is effective in relieving hangovers, with an optimal live bacteria count of 1.0 × 10⁻⁶. 8 –1.0×10 9 CFU (Cholesterol Flavescent Compound) is the most effective and has the most significant hangover-relieving effect among products containing this type of live bacteria.

[0169] sequence list

Claims

1. A Staphylococcus aureus strain whose 16S rDNA fragment contains a sequence having at least 99.79% sequence identity with the sequence shown in SEQ ID NO: 1, or consists of SEQ ID NO:

1.

2. The Staphylococcus aureus strain according to claim 1, which is ethanol resistant and can maintain essentially normal growth in a culture medium containing 10% ethanol.

3. The Staphylococcus aureus strain according to claim 1 or 2, having a diameter between 0.5 and 1.5 mm, with round colonies, neat edges, milky white color, moist, smooth, and colored surface, not producing pigment, and Gram-positive.

4. The Staphylococcus aureus strain according to any one of claims 1-3, which is tolerant to acidic environments, preferably, the strain is tolerant to an environment with pH 2.5-3.

5.

5. The Staphylococcus aureus strain according to any one of claims 1-4, which has high antioxidant capacity and / or high total antioxidant capacity.

6. The Staphylococcus aureus strain according to any one of claims 1-5, having a high content of reduced glutathione.

7. The Staphylococcus aureus strain according to any one of claims 1-6, which has a high hydroxyl radical scavenging ability.

8. The Staphylococcus aureus strain according to any one of claims 1-7, which has high alcohol dehydrogenase activity.

9. The Staphylococcus aureus strain according to any one of claims 1-8, which has high acetaldehyde dehydrogenase activity.

10. The Staphylococcus aureus strain according to any one of claims 1-9, further comprising a characteristic fragment comprising a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 9, or consisting of SEQ ID NO:

9.

11. The Staphylococcus aureus strain according to any one of claims 1-10, further comprising a characteristic fragment comprising a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO: 8, or consisting of SEQ ID NO:

8.

12. The Staphylococcus aureus strain according to any one of claims 1-11, which is Staphylococcus aureus strain 90658 with accession number CGMCC No. 36688, or a derivative thereof, wherein the derivative has the identification characteristics of Staphylococcus aureus strain 90658.

13. A composition for reducing alcohol content or breaking down alcohol, comprising any one of the Staphylococcus aureus strains of claims 1-12, its culture supernatant, bacterial suspension or intracellular extract.

14. A composition for reducing acetaldehyde content or decomposing acetaldehyde, comprising any one of the Staphylococcus aureus strains of claims 1-12, its culture supernatant, bacterial suspension or intracellular extract.

15. Use of the Staphylococcus aureus strain according to any one of claims 1-12 in the decomposition of ethanol or acetaldehyde.

16. A method for relieving hangovers, comprising administering an effective amount of any one of the Staphylococcus aureus strains of claims 1-12, or the composition of claim 13 or 14, to a subject in need.

17. A method for relieving symptoms of intoxication, comprising administering an effective amount of the Staphylococcus aureus strain of any one of claims 1-12, or the composition of claim 13 or 14, to a subject in need, wherein the symptoms of intoxication are selected from one or more of the following: flushing, rapid heartbeat, headache, nausea, vomiting, dizziness, and weakness.

18. A method for reducing the toxicity of acetaldehyde to the body, comprising administering an effective amount of the Staphylococcus aureus strain of any one of claims 1-12, or the composition of claim 13 or 14, to a subject in need.

Images