A molecular marker primer set, kit, and application for identifying the avocado variety Guilong 6

Abstract

This invention discloses a molecular marker primer set, a kit, and its application for identifying the avocado variety Guilong 6. The molecular marker primer set consists of two pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing. This molecular marker primer set can accurately identify the avocado variety Guilong 6.

Description

Technical Field

[0001] This disclosure relates to the fields of molecular biology and genetic breeding, and in particular to a molecular marker primer set, kit, and application for identifying the avocado variety Guilong 6. Background Technology

[0002] Avocados, native to Central America, are a globally recognized premium nutritious fruit and woody oilseed, earning them the nickname "forest butter." Avocado flesh is rich in nutrients, high in fat, primarily unsaturated fatty acids, which are beneficial for cardiovascular health. my country's avocado market has strong demand, historically requiring large-scale imports annually, resulting in a significant supply-demand gap. Therefore, the domestic avocado industry has a very promising future.

[0003] In recent years, the planting area of ​​avocados in my country has continued to grow, with large-scale production areas already established in Yunnan and Guangxi. However, the main varieties currently cultivated rely heavily on imports from abroad. While varieties such as Hass are of excellent quality, their adaptability to different climates varies in some production areas, and the stability of yield and quality needs improvement. At the same time, changes in the international trade environment and increased protection of variety rights by countries of origin have restricted the introduction of foreign avocado varieties into my country. Therefore, there is an urgent need to develop new varieties with independent intellectual property rights that are adapted to the local environment. The avocado variety Guilong 6 is a new avocado variety bred by the Guangxi South Subtropical Agricultural Research Institute, with variety rights number 20251021. Variety information can be found on the website of the National Forestry and Grassland Administration: https: / / www.forestry.gov.cn / c / www / gsgg / 649920.jhtml

[0004] Currently, the identification of the avocado variety Guilong 6 can be based on morphological characteristics, physiological and ecological features, biochemical markers, and molecular markers. Morphological identification is intuitive and simple, but it is easily affected by environmental and human factors, has a long cycle, and exhibits some seasonality. Molecular marker identification has significant advantages, being unaffected by season or developmental stage, exhibiting rich polymorphism and high specificity, and is rapid, efficient, and highly accurate. Currently, the phenomenon of "different species with the same name" and "different names for the same species" is prevalent in avocados, hindering variety selection, intellectual property protection, and industrial promotion. Impure or incorrect seedling varieties can also harm the economic interests of practitioners, seriously affecting the healthy development of the avocado industry. Therefore, accurate identification of the avocado variety Guilong 6 is crucial for its promotion and application. Public content

[0005] To address the issue of inaccurate identification of the avocado variety Guilong 6, this disclosure provides a molecular marker primer set, a reagent kit, and its application for identifying the avocado variety Guilong 6. The technical solution is as follows:

[0006] On one hand, this disclosure provides a molecular marker primer set for identifying the avocado Guilong 6. The molecular marker primer set consists of two pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing.

[0007] On the other hand, this disclosure provides a kit for identifying the avocado variety Guilong 6, the kit comprising the aforementioned molecular marker primer set.

[0008] On another aspect, this disclosure provides an application of a molecular marker primer set for identifying the avocado variety Guilong 6, the application of which includes: using the above-mentioned molecular marker primer set to amplify the sample to be tested and obtain the amplification product;

[0009] The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data;

[0010] The sequencing data is aligned to the avocado reference genome to obtain the sequencing results of the sample to be tested;

[0011] The sequencing results were analyzed to obtain different sequence types as shown in SEQ ID NO: 5 to SEQ ID NO: 35 in the sequence listing;

[0012] When the obtained sequence type is as shown in SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 26 and SEQ ID NO: 32 in the sequence list, the sample to be tested is identified as the avocado variety Guilong 6.

[0013] The application also includes: the molecular marker primer set distinguishing 91 avocado varieties and Guilong 6.

[0014] The beneficial effects of the technical solution provided in this disclosure are as follows: This invention provides a molecular marker primer set, kit, and application for identifying the avocado variety Guilong 6. The molecular marker primer set is used to amplify the test sample, and the obtained amplification products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the avocado variety Guilong 6. Furthermore, these differences can be used to effectively distinguish Guilong 6 from 91 other avocado varieties. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is a sequence alignment diagram of the first pair of primers provided in Embodiment 3 of this disclosure.

[0017] Figure 2 This is a sequence alignment diagram of the second pair of primers provided in Embodiment 3 of this disclosure. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below.

[0019] Example 1

[0020] This embodiment provides a molecular marker primer set for identifying the avocado variety Guilong 6. The primer set consists of two pairs of primers, each pair comprising an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 of the sequence listing, specifically: AGGAGCTTAATTTGGATTCTTAGTTT; the downstream primer of the first pair is shown in SEQ ID NO:2 of the sequence listing, specifically: TCTTTCTTTAGACCTTGGACGGTAG; the upstream primer of the second pair is shown in SEQ ID NO:3 of the sequence listing, specifically: AAAGCCCTAATGACACTTCTCTCTT; and the downstream primer of the second pair is shown in SEQ ID NO:4 of the sequence listing, specifically: CCAACCTCATTCCTTCAAACTTTGA. Relevant information for the two primer pairs is shown in Table 1.

[0021] Table 1 shows the relevant information for molecular marker primer sets.

[0022] Example 2

[0023] This disclosure provides a kit for identifying the avocado variety Guilong 6, which includes the molecular marker primer set provided in Example 1.

[0024] Example 3

[0025] This disclosure provides an application of a molecular marker primer set for identifying the avocado variety Guilong 6. The application includes using the molecular marker primer set provided in Example 1 to identify the avocado variety Guilong 6.

[0026] Furthermore, the application also includes: effectively distinguishing Guilong 6 and 91 avocado varieties using the molecular marker primer set provided in Example 1.

[0027] Specifically, 92 avocado varieties were used as test samples, and the variety names are shown in Table 2. All 92 test samples were obtained from the avocado germplasm resource nursery of the Guangxi South Subtropical Agricultural Research Institute. This resource nursery has complete germplasm preservation conditions and standardized management measures, and all avocado varieties involved in this embodiment were planted and preserved there.

[0028] Table 2 lists the variety names of the 92 samples to be tested.

[0029] DNA was extracted from the 92 samples to be tested. In practice, the DNA was extracted from the samples using a novel plant genomic DNA extraction kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were performed according to the instructions for this novel plant genomic DNA extraction kit.

[0030] DNA from 92 test samples was amplified using the molecular marker primer set provided in Example 1 of this invention. Specifically, the amplification system included: 50 ng of DNA from the test sample, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min.

[0031] After amplification, the amplified products were obtained and subjected to next-generation high-throughput sequencing to obtain sequencing data. The sequencing data were then aligned to the avocado reference genome using Bowtie2 software to obtain the sequencing results for each sample. The avocado genome was published by the Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences in 2024.

[0032] T2T Reference Genome https: / / www.scidb.cn / en / file?fid=c7f00e8033ac13f05213c5 6cadfb2b9a&mode=front .

[0033] Based on the molecular marker primer set, e-PCR was performed using the TBtools software to verify that both primer pairs were for specific amplification.

[0034] Based on the molecular marker primer set and the relevant information in Table 1, the target sequence of each primer pair on the reference genome was extracted using the software TBtools, and represented by the numbers 01 and 02 respectively.

[0035] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained 20 different sequence types. These 20 different sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, i1, j1, k1, l1, m1, n1, o1, p1, q1, r1, s1, and t1, as shown in SEQ ID NO:5 to SEQ ID NO:24 in the sequence listing.

[0036] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 1 As shown, in Figure 1 In the sequence, the number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: AGGAGCTTAATTTGGATTCTTAGTTTTATATGCACACGCAAGCGCGCGCACACACACGTTGAGCTCATCATGTACCTTTGATGGCATTTGTGGGTGATTATGTACCTTTGATGGCATTTGTGGGTGATTTAGATCCATTCGCTGAGGCAAATGCTGAGGACTCTGGTGCTGGGTCAAAGGATTATGTGCATATTCGCACACAGCAAAGAAATGGTAGGAAGAGTCTGACTACCGTCCAAGGTCTAAAGAAAGA (as shown in SEQ ID NO:36 in the sequence listing). All 20 sequences are different from the target sequence 01 on the reference genome.

[0037] Due to the large number of sequence types and the large size of the sequence alignment diagram, it is not clear when compressed and placed on one page. It was observed that the 70 bases at the 3' end of each sequence in the diagram are the reverse complementary sequence of the downstream primer sequence, and the adjacent 45 bases are identical.

[0038] Variety identification involves comparing the differences between different varieties. To ensure that the sequence alignment diagrams can be clearly presented on one page, data processing is performed. First, 70 identical base sequences at the 3' end of 20 sequences and the 01 sequence are removed, namely the reverse complementary sequence of the downstream primer sequence and the adjacent 45 bases. Specifically, the sequence is: ATGTGCATATTCGCACACAGCAAAGAAATGGTAGGAAGAGTCTGACTACCGTCCAAGGTCTAAAGAAAGA (as shown in SEQ ID NO:37 in the sequence listing). This sequence belongs to the homogeneous part of all the samples to be tested, and the processing does not affect the variety identification results.

[0039] The sequence alignment results after removing the 70 identical bases at the 3' end are as follows: Figure 1 As shown, all 20 sequences are different from the target sequence 01 on the reference genome.

[0040] The second pair of primers has 11 different sequence types, which are named a2, b2, c2, d2, e2, f2, g2, h2, i2, j2 and k2, as shown in SEQ ID NO:25~SEQ ID NO:35 in the sequence listing.

[0041] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 2 As shown, number 02 represents the target sequence of the second primer pair on the reference genome, specifically: AAAGCCCTAATGACACTTCTCTCTTCATTTGAAGAACCGCGTGCGGGTGTACCATTCTCGTGATCTATGTTGATGATATCATCATTAGTGGCAACGATTCCGCAGGCATTTCCGAACTCAAAACTCCTCTCATGAATTCCTTCAAGATGAAAGATTTGGGTCCACTCACTTATTTTTTAGGCTTCAAAGTTTGAAGGAATGAGGTTGG (as shown in SEQ ID NO:38 in the sequence listing). All 11 sequences are different from the target sequence 02 on the reference genome. The genotypes of the two primer pairs for the 92 samples to be tested are shown in Table 3.

[0042] Table 3 shows the genotypes of the 92 samples to be tested.

[0043] As shown in Table 3, the genotype combination of the avocado variety Guilong 6 in sample No. 73 is a1f1+b2h2, which corresponds to SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 26, and SEQ ID NO: 32 in the sequence listing. This enables accurate identification of the avocado variety Guilong 6. For the 92 samples tested, the genotype combination of each sample was checked using Excel's conditional formatting rules (highlight cells, duplicate values, red text). No duplicates were found, indicating that the molecular marker primer set provided in Embodiment 1 of this invention can distinguish Guilong 6 from the 91 samples tested, demonstrating the high specificity of this molecular marker primer set.

[0044] Accuracy analysis of molecular marker primer set identification

[0045] Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches of avocado varieties. The high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.

[0046] A reproducibility experiment was conducted using 92 test samples. The results of each experiment were analyzed and the genotype combinations were recorded. See Table 4 for details.

[0047] Table 4 shows the results of the two repeated experiments.

[0048] As shown in Table 4, the specific genotypes and combinations were identical in both replicate experiments. Therefore, the accuracy of the molecular marker primer set provided by this invention is 100%.

[0049] The third embodiment of the present invention shows that the variety identification conclusions between different laboratories or different batches of the same laboratory have a high degree of consistency, thus eliminating the need to use parallel experiments to reduce experimental errors, which greatly facilitates the identification of avocado varieties.

[0050] This invention provides a molecular marker primer set, kit, and application for identifying the avocado variety Guilong 6. The molecular marker primer set is used to amplify the test sample, and the amplified products are sequenced. Varieties are distinguished based on the sequencing results. Multiple base differences exist between the sequences of different varieties, including substitutions, insertions, deletions, and duplications. These differences enable accurate identification of the avocado variety Guilong 6. Simultaneously, these differences can be used to effectively distinguish Guilong 6 from 91 other avocado varieties, and the identification results are unaffected by environmental or other human factors. This invention uses a highly polymorphic molecular marker primer set to amplify the target sequence and compares the base differences between different varieties, thereby achieving efficient avocado variety identification. Reproducibility experiments further verify the accuracy and reliability of this technology. The kit uses the aforementioned molecular marker primer set and therefore possesses its characteristics.

[0051] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A molecular marker primer set for identifying the avocado variety Guilong 6, characterized in that, The molecular marker primer set consists of two pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair is shown in SEQ ID NO:1 in the sequence listing, and the downstream primer of the first pair is shown in SEQ ID NO:2 in the sequence listing. The upstream primer of the second pair is shown in SEQ ID NO:3 in the sequence listing, and the downstream primer of the second pair is shown in SEQ ID NO:4 in the sequence listing.

2. A kit for identifying the avocado variety Guilong 6, characterized in that, The kit includes the molecular marker primer set as described in claim 1.

3. The application of a molecular marker primer set for identifying the avocado variety Guilong 6, characterized in that, The application includes: amplifying a sample to be tested using the molecular marker primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the avocado reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types; When the obtained sequence type is as shown in SEQ ID NO: 5, SEQ ID NO: 10, SEQ ID NO: 26 and SEQ ID NO: 32 in the sequence list, the sample to be tested is identified as the avocado variety Guilong 6.

Images