Microorganisms comprising exogenous fructokinase and non-pts sugar transporters and methods of producing l-amino acids using the same

By introducing Escherichia coli fructokinase and non-PTS sugar transporter protein from Fermentomonas spp. into Corynebacterium spp., the problem of efficient L-amino acid production was solved, achieving high-yield L-amino acid production and meeting the application needs of multiple fields.

CN122514604APending Publication Date: 2026-08-04CJ CHEILJEDANG CORP
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN202580008432.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-09-01
Filing Date
2025-12-02
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently produce L-amino acids, especially in Corynebacterium microorganisms, due to the lack of effective exogenous fructokinase and non-PTS sugar transporter proteins, resulting in low production efficiency.

Method used

Fructose kinase from Escherichia coli and non-PTS sugar transporter protein from Fermentomonas genus were introduced and expressed in Corynebacterium genus through genetic engineering, forming microorganisms containing exogenous fructokinase and non-PTS sugar transporter protein for the efficient production of L-amino acids.

Benefits of technology

It has achieved high-yield production of L-amino acids, improved the production efficiency of Corynebacterium microorganisms, and met the needs of pharmaceutical raw materials, food additives, animal feed and pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present disclosure relates to microorganisms comprising an exogenous fructokinase and a non-PTS sugar transporter, and methods of producing L-amino acids using the same.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to microorganisms containing exogenous fructokinase and non-PTS sugar transporters, and methods for producing L-amino acids using them. Background Technology

[0002] The production of desired substances (such as amino acids) in microorganisms is an environmentally friendly and safe process and has become the subject of various research projects. Among these, research on the large-scale production of desired substances from Corynebacterium microorganisms has been ongoing. Corynebacterium microorganisms are Gram-positive microorganisms widely used in the production of L-amino acids and other useful substances.

[0003] L-amino acids are the basic building blocks of proteins and are important materials used in pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, and fungicides. Various studies have been conducted to develop microbial and fermentation processes for the efficient production of L-amino acids and other useful substances. For example, substance-specific methods are primarily employed, such as increasing the expression of genes encoding enzymes involved in L-tryptophan biosynthesis or eliminating genes unnecessary for biosynthesis (US 8,945,907 B2). Summary of the Invention

[0004] Technical issues

[0005] The technical problem to be solved by this disclosure is to provide microorganisms containing exogenous fructokinase and non-PTS sugar transporter proteins, and methods for producing L-amino acids using them.

[0006] Technical solution

[0007] One example of this disclosure is a Corynebacterium microorganism that produces L-amino acids, comprising: at least one of the following groups: a fructokinase derived from Escherichia microorganisms, a polynucleotide encoding the fructokinase, a variant polypeptide of the fructokinase, or a polynucleotide encoding the variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter derived from Zymomonas microorganisms, or a polynucleotide encoding the non-PTS sugar transporter.

[0008] Another example of this disclosure is a composition for producing L-amino acids, comprising the microorganism, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more of them.

[0009] Another example of the present invention is to provide a method for producing L-amino acids, which includes culturing the microorganisms in a culture medium.

[0010] Beneficial effects

[0011] When the microorganisms disclosed herein containing exogenous fructokinase and non-PTS sugar transporter proteins are cultured, high-yield production of L-amino acids can be achieved. Detailed Implementation

[0012] This disclosure will be described in detail below. Furthermore, each description and embodiment described herein can be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed herein fall within the scope of this disclosure. Moreover, the scope of this disclosure is not limited by the specific descriptions below.

[0013] Furthermore, those skilled in the art can recognize or identify many equivalents of the specific aspects of this disclosure described herein using conventional experiments. Moreover, these equivalents are intended to be included in this disclosure.

[0014] Furthermore, this specification cites numerous academic papers and patent documents throughout. The content of these cited papers and patent documents is incorporated herein by reference in its entirety to more clearly describe the level of the technical field to which this disclosure pertains and the content of this disclosure.

[0015] definition

[0016] As used in this disclosure and the appended claims, the singular articles (“a,” “an,” and “the”) include plural referents unless the context clearly indicates otherwise. Furthermore, unless the context clearly indicates otherwise, singular terms include their plural forms, and plural terms include their singular forms. Additionally, as used in this disclosure and the appended claims, the use of “or” can include the meaning of “and / or” unless otherwise stated.

[0017] As used herein, the term "about" may precede a specific numerical value. As used herein, the term "about" includes not only the exact numerical value specified after the term, but also a range that approximates or approaches that value. Considering the context in which the number appears, it can be determined whether the specific number mentioned is close to or near that number. In one instance, the term "about" may refer to the range of -10% to +10% of the numerical value. As another instance, the term "about" may refer to the range of -5% to +5% of a given numerical value. However, the term is not limited to these.

[0018] As used herein, terms such as “first, second, third…”, “i), ii), iii)…”, or “(a), (b), (c), (d)…” are used to distinguish similar elements. When these terms are used in relation to steps of a method, purpose, or analysis, they do not imply that these steps will be performed sequentially or in a particular order, and that these steps may be performed, for example, without time intervals between steps, simultaneously or sequentially, in reverse order, or in a random order with intervals of seconds, minutes, hours, days, or months.

[0019] As used herein, the term "composed of" means that the total percentage of a specific feature, step, component, or other element in the term is 100%. The features, steps, components, or other elements in the term "composed of" may be necessary or mandatory. For example, any other features, steps, components, or other elements, or non-essential features, steps, components, or other elements, may be excluded in addition to those in the term "composed of".

[0020] As used herein, the term "consistently of" can mean that at least one unspecified feature, step, component or other element may be present, provided that the feature, step, component or other element claimed in this disclosure is substantially unaffected by the presence of at least one unspecified feature, step, component or other element.

[0021] As used herein, the term "comprising" means the presence of a feature, step, component, or other element that follows the term, and does not exclude the presence of at least one additional feature, step, or component. As used herein, the specific feature, step, component, or other element that follows the term "comprising" may be necessary or mandatory; however, in some specific embodiments, other arbitrary or non-essential features, steps, components, or other elements may also be included.

[0022] Proteins, peptides, variant proteins and variant peptides

[0023] As used herein, the terms "protein" or "polypeptide" refer to a polymer or oligomer of consecutive amino acid residues. In this disclosure, the terms "polypeptide," "protein," and "peptide" are used interchangeably.

[0024] As used herein, the terms "mature polypeptide" or "mature protein" refer to a polypeptide or protein in the form of which there is no signal sequence or precursor peptide sequence. A mature polypeptide or mature protein can be the functional form of a polypeptide or protein. A mature polypeptide or mature protein refers to the final form of a polypeptide after translation and / or post-translational modifications. Examples of post-translational modifications may include, but are not limited to, N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, or leader sequence removal.

[0025] In this disclosure, unless otherwise stated, amino acid sequences are described in the direction from N-terminus to C-terminus.

[0026] In this disclosure, with regard to the amino acid sequence, it is obvious that a polypeptide or protein "comprising" the amino acid sequence indicated by a specific sequence number, a polypeptide or protein "composed of" the amino acid sequence indicated by a specific sequence number, or a polypeptide or protein "having" the amino acid sequence indicated by a specific sequence number may also include polypeptides or proteins in which certain amino acids are deleted, modified, substituted, or added, provided that they have the same or corresponding activity as the polypeptide or protein composed of the amino acid sequence indicated by that sequence number. For example, a polypeptide or protein may also include polypeptides or proteins in which the addition or deletion of amino acids, naturally occurring mutations, silent mutations, or conserved substitutions in the internal region or upstream or downstream region (N-terminus or C-terminus) of the polypeptide or protein do not alter the function of the protein disclosed herein.

[0027] In addition, the range of polypeptides or proteins with amino acid sequences indicated by a specific sequence number may also include, for example, polypeptides or proteins conjugated to an N-terminal signal (or leader) sequence involved in co-translation or post-translational translocation of a protein (polypeptide), or polypeptides or proteins conjugated to another sequence or linker, so as to enable the identification, purification or synthesis of the polypeptide or protein.

[0028] As used herein, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions can typically occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; and amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another example, amino acids with charged side chains (charged amino acids) include arginine, lysine, histidine, glutamic acid, and aspartic acid, while amino acids with uncharged side chains (also called uncharged amino acids or neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In another example, phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids. In another example, valine, leucine, and isoleucine can be classified as branched-chain amino acids. In yet another example, the 20 amino acids can be divided into five groups based on size, starting with the smaller group: glycine, alanine, and serine; cysteine, proline, threonine, aspartic acid, and asparagine; valine, histidine, glutamic acid, and glutamine; isoleucine, leucine, methionine, lysine, and arginine; and phenylalanine, tryptophan, and tyrosine. However, the classification of amino acids is not limited to this. Generally, conserved substitutions have little or no effect on the activity of polypeptides or proteins.

[0029] As used herein, the terms “variant peptide,” “variant protein,” or “variant” refer to a peptide in which one or more amino acids have been conservedly substituted and / or modified, resulting in an amino acid sequence different from that of the pre-mutant variant, while retaining its function or properties. Such variants are typically identified by modifying one or more amino acids in the peptide’s amino acid sequence and assessing the properties of the modified peptide. That is, the ability of a variant may be increased, unchanged, or decreased relative to the pre-mutant peptide. Furthermore, some variants may include those in which one or more regions (such as the N-terminal leader sequence or transmembrane domain) have been removed. Other variants may include those in which a portion has been removed from the N-terminus and / or C-terminus of the mature protein. The term “variant” may be used interchangeably with terms including modification, modified peptide, modified protein, mutant, mutein, and variant, as long as these terms are used to refer to mutations.

[0030] Furthermore, variants can also contain the deletion or addition of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated to a signal (or leader) sequence at the N-terminus of a protein that is involved in protein co-translation or post-translational translocation. Additionally, the polypeptide can be conjugated to another sequence or linker to identify, purify, or synthesize the polypeptide.

[0031] As used herein, “N-position” can include the N-position and the amino acid position corresponding to the N-position. Specifically, the term can include the amino acid position corresponding to any amino acid residue in a mature polypeptide represented by a particular amino acid sequence. The particular amino acid sequence can be the amino acid sequence of SEQ ID NO: 139.

[0032] As used herein, the term "corresponding to" refers to an amino acid residue at a position described in the polypeptide, or an amino acid residue that is similar to, identical to, or homologous to a residue described in the peptide. Identifying an amino acid at a corresponding position can be done by determining a specific amino acid in a sequence that references a specific sequence.

[0033] For example, based on the alignment of any amino acid sequence with SEQ ID NO: 139, each amino acid residue in the amino acid sequence can be numbered with reference to the position number of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 139. For example, the sequence alignment algorithm described herein can identify the position of an amino acid or the position where it has been modified, such as by substitution, insertion, or deletion, compared to the query sequence (also known as the "reference sequence").

[0034] For such alignments, algorithms such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), etc., can be used, but are not limited to these. In addition, sequencing programs and pairwise sequence comparison algorithms known in the art can be appropriately used.

[0035] Genes, polynucleotides

[0036] As used herein, the term "gene" narrowly refers to a polynucleotide that encodes a functional molecule, and broadly refers to a polynucleotide that contains a polynucleotide encoding a functional molecule and a polynucleotide containing upstream or downstream regions of that polynucleotide. In one specific embodiment, the functional molecule may be RNA or a protein, and the gene may have sequences (introns) inserted between each coding region (exon).

[0037] As used herein, the terms "polynucleotide" or "nucleic acid" refer to a polymer of nucleotides in which nucleotide monomers are covalently linked together to form a long chain, which is a DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) chain having at least a certain length. In this disclosure, "polynucleotide" and "nucleic acid" are used interchangeably.

[0038] Identity, homology

[0039] As used herein, the terms “identity” or “homology” refer to the degree of similarity between two given amino acid sequences or base sequences, expressed as a percentage. In this disclosure, “identity” and “homology” are often used interchangeably.

[0040] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, and a default gap penalty established by the program used can be applied.

[0041] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined, for example, by a known computer algorithm such as the “FASTA” program (Pearson et al., (1988) [Proc. Natl. Acad. USA 85]: 2444), using default parameters. Alternatively, sequence information can be compared using the following methods to determine: the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) (version 5.0.0 or later) executed in the Needleman program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277), or GAP computer programs such as the Smith-Waterman algorithm (Smith and Waterman, Adv. Appl. Math (1981) 2:482) (GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, and FASTA (Atschul, SF et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J.). Bishop (ed.), Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For example, homology or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information.

[0042] Furthermore, the homology or identity of any two polynucleotide sequences can be confirmed by Southern hybridization under appropriate hybridization conditions, which can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., New York), but are not limited thereto. For example, homologous or identical polynucleotide sequences can typically hybridize at least about 50%, 60%, 70%, 80%, or 90% along the entire sequence or full length under stringent conditions.

[0043] As used herein, the term “strict conditions” refers to conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in the literature (see Sambrook et al., above, 9.50-9.51, 11.7-11.8). For example, said strict conditions include polynucleotides having high homology or identity, i.e., polynucleotides having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with each other, while polynucleotides having less than the above homology or identity do not hybridize with each other; or may include routine washing conditions for Southern hybridization, i.e., washing once, specifically twice or three times, at salt concentrations and temperatures corresponding to 60°C, 1×SSC, and 0.1% SDS, specifically 60°C, 0.1×SSC, and 0.1% SDS, and more specifically 68°C, 0.1×SSC, and 0.1% SDS.

[0044] Hybridization can occur between nucleotides with complementary base sequences, but depending on the strictness of the hybridization, hybridized polynucleotides can contain some base mismatches. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of this disclosure may also include isolated nucleic acid fragments complementary to the whole sequence as well as nucleic acid sequences substantially similar to them.

[0045] Specifically, polynucleotides homologous to or identical with the polynucleotides disclosed herein can be subjected to a T at 55°C. m Hybridization was performed under conditions of T values ​​for detection. Furthermore, the T... m The value can be 60°C, 63°C or 65°C, but is not limited to these, and can be appropriately adjusted by those skilled in the art.

[0046] The appropriate stringency of polynucleotide hybridization depends on the length and complementarity of the polynucleotides, and these variables are well known in the field (e.g., Sambrook, see above).

[0047] Carrier, Transformation

[0048] As used herein, the term "vector" refers to a DNA construct used to deliver a desired polynucleotide to a suitable host or host cell.

[0049] In one example, the vector may contain a polynucleotide sequence encoding a desired polypeptide, operatively linked to a suitable expression regulatory region (or expression regulatory sequence) to express the desired polypeptide in a suitable host. The expression regulatory sequence may include a promoter capable of initiating transcription, any operon sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into a suitable host cell (microbe), the vector may replicate or function independently of the host genome, or it may be inserted into its genome to replicate or function.

[0050] Furthermore, in one instance, the vector of this disclosure may contain a sequence for inserting a desired polynucleotide into a chromosome. Insertion of a polynucleotide into a chromosome using a vector can be performed by any method known in the art, such as homologous recombination, but is not limited thereto.

[0051] The vectors used in this disclosure are not particularly limited and can be any vector known in the art. Examples of commonly used vectors include plasmids, granules, viruses, and bacteriophages in their native or recombinant states. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc., can be used as phage vectors or granule vectors; and those based on pDZ, pDC, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc., can be used as plasmid vectors. In one example, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, etc., can be used.

[0052] The vector may further include selection markers to confirm transformation into host cells, or further, to confirm insertion into the chromosome of the host cell. The selection markers are used to select cells transformed with the vector or to confirm desired polynucleotide insertion into the chromosome, and may use markers that confer selectable phenotypes (such as drug resistance, nutritional deficiencies, resistance to cytotoxic agents, or expression of surface peptides). In an environment treated with a selection agent, only cells expressing the selection marker survive or exhibit a different phenotype, thereby allowing for the selection of transformed cells.

[0053] As used herein, the term "transformation" refers to the introduction of a desired polynucleotide or a vector containing that polynucleotide into a host cell (microorganism), thereby altering the genetic traits of the host cell (microorganism). The transformed polynucleotide may be inserted into the chromosome of the host cell or located extrachromosomally. Furthermore, the polynucleotide may comprise DNA and / or RNA. Depending on the purpose of the introduction, the polynucleotide may be introduced in a suitable form. For example, the polynucleotide may be introduced into the host cell (microorganism) in the form of an expression cassette, which is a gene construct containing all the elements required for autonomous expression. The expression cassette may typically contain a promoter, transcription termination signal, ribosome binding site, and translation termination signal operatively linked to the coding sequence of the desired polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into the host cell (microorganism) as is and may be operatively linked to, but is not limited to, the sequence required for expression in the host cell (microorganism).

[0054] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately to regulate the expression of a coding sequence. Therefore, the term "operably linked" includes attaching or linking a regulatory region with a functional domain having known or desired activity, such as a promoter, stop codon, signal sequence, or enhancer region, to a target (gene or polypeptide) to regulate the expression, secretion, or function of the target according to known or desired activity. For example, it could mean functionally linking a polynucleotide sequence encoding a polypeptide to a promoter sequence that initiates and mediates polynucleotide transcription.

[0055] As used herein, the term “expression” includes, but is not limited to, any step involved in peptide production, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0056] As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule containing a desired polynucleotide sequence and a operatively linked regulatory sequence for its expression. For example, it may contain the base sequence of a polynucleotide encoding a desired polypeptide, which is operatively linked to a suitable expression regulatory region (or expression regulatory sequence) so that the desired polypeptide can be expressed in a suitable host.

[0057] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary to regulate the expression of a desired polynucleotide sequence. Each regulatory sequence can be a natural (from the same source) or exogenous (from a different gene) regulatory sequence of the coding sequence, a variant of that sequence, or another artificial sequence. Examples of regulatory sequences can include leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, operon sequences, sequences encoding ribosome-binding domains, and sequences regulating the termination of transcription and translation. The smallest unit of a regulatory sequence can contain a promoter and a sequence for terminating transcription and translation.

[0058] As used in this article, the term “genetic recombination” refers to a natural or artificial process in which the elements that make up a gene, such as DNA or RNA, are rearranged into a sequence different from the original sequence during the process of decomposition and recombination.

[0059] As used herein, the term "recombinant gene" refers to a gene having a novel genomic conformation resulting from genetic recombination (such as chemical synthesis or genetic engineering techniques). In this disclosure, the terms "recombinant gene," "recombinant DNA," and "recombinant polynucleotide" are used interchangeably. In one instance, a recombinant gene may comprise an artificial combination of nucleic acid fragments, such as regulatory sequences not naturally found together.

[0060] As used in this article, the term "recombinant protein" refers to a protein produced due to gene recombination.

[0061] microorganism

[0062] As used herein, the term "microorganism (or strain)" includes wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone natural or artificial genetic modifications. It can be a microorganism in which a particular mechanism is weakened or enhanced due to the insertion of a foreign gene or the increase or inactivation of an endogenous gene, and can be a microorganism containing genetic modifications for the production of polypeptides, proteins, or target products. In this disclosure, the terms "microorganism," "strain," "host," and "host cell" are used interchangeably.

[0063] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified to exhibit a genotype and / or phenotype different from that of naturally occurring microorganisms (e.g., when the genetic modification affects how nucleic acid sequences are encoded in the microorganism), and may include all or potential offspring of that microorganism. In this disclosure, the terms "recombinant microorganism," "genetically modified microorganism," "recombinant host cell," "recombinant cell," and "recombinant strain" are used interchangeably. For example, a recombinant microorganism may express genes not found in its natural (non-recombinant) form, not express genes expressed in its natural form, or express natural genes in a manner different from those expressed in its natural form.

[0064] For example, the microorganisms disclosed herein may include microorganisms (e.g., recombinant microorganisms) in which the following substances are inserted: at least one of the following groups consisting of a fructokinase derived from a microorganism of the genus Escherichia, a polynucleotide encoding the same, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following groups consisting of a non-PTS sugar transporter derived from a microorganism of the genus Fermentomonas and a polynucleotide encoding the same, but not limited thereto.

[0065] As used herein, the term "microorganism with L-amino acid production capacity" refers to a microorganism capable of producing L-amino acids in vivo, and may include any microorganism that inherently lacks L-amino acid production capacity but is endowed with it, or any microorganism inherently possesses L-amino acid production capacity. The ability to produce L-amino acids can be conferred or enhanced through strain modification.

[0066] As used herein, the term "unmodified microorganism (strain)" does not exclude the inclusion of microorganisms (strains) that may have naturally occurring mutations, and may refer to wild-type microorganisms (strains) or natural microorganisms (strains) themselves, or to microorganisms (strains) before their traits are altered by genetic variation caused by natural or artificial factors. In this disclosure, the term "unmodified microorganism (strain)" may be used interchangeably with "pre-modified microorganism (strain)," "unmutated microorganism (strain)," "parental microorganism," "parental strain," "wild-type microorganism (strain)," "reference microorganism (strain)," or "standard microorganism (strain)." In this disclosure, unmodified microorganism may refer to a microorganism (strain) that does not contain: at least one of the following: a fructokinase selected from microorganisms of the genus *Escherichia*, a polynucleotide encoding the same, a variant polypeptide of said fructokinase, and a polynucleotide encoding said variant polypeptide; and / or at least one of the following: a non-PTS sugar transporter protein selected from organisms of the genus *Fermentomonas*, and a polynucleotide encoding the same; or a microorganism (strain) before the insertion of a protein or polynucleotide, but is not limited thereto. In one instance, the unmodified microorganism in this disclosure may be a Corynebacterium genus microorganism that does not contain, but is not limited to, a polypeptide consisting of the amino acid sequences of SEQ ID NO: 139, SEQ ID NO: 147, SEQ ID NO: 148 and / or SEQ ID NO: 140, or a polynucleotide encoding thereus.

[0067] Increased protein (peptide) activity

[0068] As used herein, “increased” protein (peptide) activity means an increase in the activity of a protein (peptide) compared to its inherent activity in the host cell (microorganism). Increase may be used interchangeably with terms such as “activation,” “upregulation,” “overexpression,” or “enhancement.” The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0069] Increased protein (peptide) activity can include situations where host cells (microorganisms) exhibit protein (peptide) activity that they did not originally possess, as well as situations where host cells exhibit improved protein (peptide) activity compared to their inherent activity or their activity before modification.

[0070] For example, cases where a protein (peptide) exhibits activity that it did not originally possess, or cases where an improved protein (peptide) exhibits activity, may be due to the introduction of a protein (peptide), but are not limited to this.

[0071] As used herein, the term “introduction” of a protein (peptide) refers to the expression of a gene not originally present in the microorganism, thereby exhibiting the activity of a specific protein, or to an enhancement, increase, or improvement of peptide activity compared to its inherent activity or its activity before modification. For example, it can be achieved by introducing a gene encoding the protein (peptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (peptide) can be introduced into the chromosome of a host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (peptide) can be introduced into a host cell (microorganism), thereby exhibiting or enhancing its activity.

[0072] "Inherent activity" refers to the activity of a specific protein (peptide) that was originally present in the host cell (microorganism) before transformation or in the unmodified host cell (microorganism) when the trait is altered by genetic modification caused by natural or artificial factors. This term can be used interchangeably with "unmodified activity".

[0073] An increase in the activity of a protein (peptide) compared to its inherent activity means that the activity and / or concentration (expression level) of the protein (peptide) in the host cell (microorganism) is enhanced compared to the activity and / or concentration (expression level) of the protein (peptide) originally present in the unmodified host cell (microorganism) or the unmodified host cell (microorganism).

[0074] In one instance, an increase may refer to the presence of the activity of a corresponding protein (peptide) that was not previously present, or an increase in the activity or concentration of that protein relative to the activity or concentration in the host cell (microorganism) before transformation or in the unmodified host cell (microorganism), typically an increase of at least about 1%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, or at least about 500%, up to at least about 1000% or at least about 2000% or more, but not limited thereto.

[0075] Increased protein (peptide) activity can be achieved by introducing exogenous proteins (peptides) or by increasing the activity of endogenous proteins (peptides). Whether protein (peptide) activity has increased can be confirmed by an increase in the protein (peptide) activity level, its expression level, or the amount of product generated by the activity of the corresponding protein (peptide).

[0076] Increased protein (peptide) activity can be achieved by a variety of methods well known in the art, and is not limited thereto, as long as the desired protein (peptide) activity can be increased compared to the activity of the host cell (microbe) before modification. Specifically, it can be achieved using genetic engineering and / or protein engineering techniques well known to those skilled in the art, which are conventional molecular biology techniques, but are not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al., Molecular Cloning 2012, etc.).

[0077] Specifically, the increased protein (peptide) activity disclosed herein may originate from:

[0078] 1) Increase the intracellular copy number of the polynucleotide encoding the protein (peptide);

[0079] 2) Modify the expression regulatory region of the gene encoding the protein (polypeptide) on the chromosome (e.g., introduce modifications to the expression regulatory region, replace it with a more active sequence, or insert a more active sequence).

[0080] 3) Modify the start codon or 5'-UTR base sequence of the gene transcript (which encodes the protein (polypeptide));

[0081] 4) Modify the amino acid sequence of the protein (peptide) to increase its activity;

[0082] 5) Modify the polynucleotide sequence encoding the protein (peptide) to increase the activity of the protein (peptide) (e.g., modify the polynucleotide sequence of the gene encoding the protein (peptide) so that the gene encodes a modified protein (peptide) with increased activity).

[0083] 6) Introduce a foreign protein (peptide) having the activity of the stated protein (peptide) or a foreign polynucleotide encoding the stated protein (peptide);

[0084] 7) Codon optimization of the polynucleotides encoding the protein (peptide);

[0085] 8) By analyzing the tertiary structure of the protein (peptide), select and modify or chemically modify the exposed regions of the protein (peptide);

[0086] 9) Regulating the cellular localization of the protein (peptide); or

[0087] 10) Selected from two or more of the above 1) to 9), but not particularly limited thereto.

[0088] For example,

[0089] The 1) increase in the intracellular copy number of the polynucleotide encoding the protein (peptide) can be achieved by introducing a vector containing the polynucleotide encoding the protein (peptide) into the host cell (microorganism), the polynucleotide being operatively linked to a suitable regulatory sequence. Alternatively, this can be achieved by introducing one or two or more copies of the polynucleotide encoding the protein (peptide) into the chromosome of the host cell (microorganism), the polynucleotide being operatively linked to a suitable regulatory sequence. Chromosomal introduction can be performed by introducing a vector capable of inserting the polynucleotide into the host cell (microorganism) chromosome, but is not limited thereto. The vector is as described above. Regarding the polynucleotide sequence encoding the protein, the regulatory sequence can be a natural sequence (of the same origin) or a foreign sequence (from a different gene), a variant thereof, or another artificial sequence, and can induce the expression of the polynucleotide in the host cell (microorganism).

[0090] The second step, replacing the expression regulatory region (or expression regulatory sequence) of the gene encoding the protein (polypeptide) on the chromosome with a highly active sequence, can be achieved by, for example, introducing modifications into the sequence (through deletion, insertion, substitution, or a combination thereof) to further increase the activity of the expression regulatory region, or replacing the sequence with a sequence of stronger activity. The expression regulatory region may include, but is not limited to, promoters, operon sequences, sequences encoding ribosome binding sites, sequences regulating transcription and translation termination, etc. In one instance, it may specifically include replacing the original promoter with a strong promoter, but is not limited thereto.

[0091] Examples of known strong promoters include the cj1 to cj7 promoters (US 7,662,943 B2), lac promoter, trp promoter, trc promoter, tac promoter, λ phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US 10,584,338 B2), O2 promoter (US 10,273,491 B2), tkt promoter, yccA promoter, etc., but strong promoters are not limited to these.

[0092] The modification of the start codon or 5'-UTR sequence of the encoded gene transcript (which encodes the protein (peptide)) can be achieved by, for example, modifying the sequence to encode a different start codon that has a higher protein (peptide) expression rate than the endogenous start codon, or modifying the sequence to encode an RBS sequence that has a higher protein (peptide) expression rate than the endogenous ribosome binding site (RBS) sequence, but is not limited thereto.

[0093] The modifications to the amino acid sequence or polynucleotide sequence of the protein (peptide) described in 4) and 5) can be achieved by introducing modifications into the amino acid sequence of the protein (peptide) or the sequence encoding the protein (peptide) through deletion, insertion, substitution, or a combination thereof to increase the activity of the protein (peptide); or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence to increase activity, but not limited thereto. Specifically, the substitution can be performed by inserting polynucleotides into the chromosome through homologous recombination, but is not limited thereto.

[0094] The introduction of a foreign polynucleotide having the activity of the protein (peptide) in step 6) can be achieved by introducing a foreign polynucleotide encoding a protein (peptide) exhibiting the same / similar activity as the protein (peptide) into a host cell (microorganism). The source or sequence of the foreign polynucleotide is not limited, as long as it exhibits the same / similar activity as the protein (peptide). Introduction can be carried out using transformation methods known in the art and appropriately selected by those skilled in the art, and the expression of the introduced polynucleotide in the host cell can produce the protein (peptide), thereby increasing its activity.

[0095] The codon optimization of the polynucleotide encoding the protein (peptide) mentioned in 7) can be achieved by: optimizing the codons of endogenous polynucleotides to increase transcription or translation in the host cell (microorganism), or optimizing the codons of exogenous polynucleotides to achieve their optimized transcription and translation in the host cell.

[0096] The step 8) by analyzing the tertiary structure of the protein (peptide), the selection and modification or chemical modification of the exposed region of the protein (peptide) can be achieved by the following methods: for example, comparing the sequence information of the protein (peptide) to be analyzed with a database storing the sequence information of known proteins to identify template protein candidates based on sequence similarity, and confirming the structure based on the information, thereby selecting the exposed site to be modified or chemically modified, and transforming or modifying the site.

[0097] The regulation of the cellular localization of the protein (peptide) described in 9) can be achieved by targeting the protein (peptide) to specific intracellular organelles or specific intracellular spaces. For example, this can be achieved by adding or removing a leader sequence that plays a role in protein (peptide) targeting, thereby targeting the protein (peptide) to the periplasm or cytoplasm, but is not limited thereto.

[0098] This increase in protein (peptide) activity may refer to, but is not limited to, an increase in the activity or concentration of the protein (peptide) expressed relative to the unmodified wild-type strain or host cell (microorganism), or an increase in the amount of product produced by the protein (peptide).

[0099] Reduced protein (peptide) activity

[0100] As used herein, “reduction” in protein (peptide) activity is a concept encompassing any reduction or inactivation of the activity of a protein (peptide) compared to its inherent activity in the host cell (microorganism). That is, reduction in protein (peptide) activity can include a decrease in protein (peptide) activity compared to its inherent or unmodified activity, where the protein (peptide) is not completely inactivated; or the protein (peptide) is completely inactivated.

[0101] For example, the aforementioned reduction may include: a situation where the protein (peptide) activity is lower or absent compared to the protein (peptide) present in the untransformed host cell (microorganism) or unmodified host cell due to mutations in the polynucleotide encoding the protein (peptide); a situation where the overall level of intracellular protein (peptide) expression is lower compared to the untransformed host cell (microorganism) or unmodified host cell due to inhibition of polynucleotide or protein (peptide) expression; a situation where polynucleotide or protein (peptide) is not expressed; and a situation where protein (peptide) activity is low or absent despite normal protein (peptide) expression.

[0102] "Inherent activity" refers to the activity of a specific protein (peptide) that was originally present in the host cell (microorganism) before transformation or in the unmodified host cell (microorganism) when the trait is altered by genetic modification caused by natural or artificial factors. This term can be used interchangeably with "unmodified activity".

[0103] The host cell (microorganism) can be a prokaryotic or eukaryotic microorganism.

[0104] A decrease in the activity of a protein (peptide) compared to its inherent activity means that the activity and / or concentration (expression level) of the protein (peptide) in the host cell (microorganism) is lower than the activity and / or concentration (expression level) of the protein (peptide) originally present in the unmodified host cell (microorganism) or the unmodified host cell (microorganism).

[0105] Whether the activity of a protein (peptide) has decreased can be confirmed by the activity level of the protein (peptide), its expression level, or the increase in the amount of product produced by the activity of the corresponding protein (peptide).

[0106] In one instance, the aforementioned reduction could be a decrease in the activity or concentration of the corresponding protein (peptide) to approximately less than 100%, approximately 90% or lower, approximately 80% or lower, approximately 70% or lower, approximately 60% or lower, approximately 50% or lower, approximately 40% or lower, approximately 30% or lower, approximately 20% or lower, approximately 10% or lower, approximately 5% or lower, or 0% based on the activity or concentration in the unmodified host cell (microorganism), but is not limited thereto.

[0107] The reduction of protein (peptide) activity can be achieved by a variety of methods well known in the art, and is not limited thereto, as long as the desired protein (peptide) activity can be reduced compared to the activity of the host cell (microbe) before modification. Specifically, it can be achieved using genetic engineering and / or protein engineering techniques well known to those skilled in the art, which are conventional molecular biology techniques, but are not limited thereto (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793; Sambrook et al., Molecular Cloning 2012, etc.).

[0108] Specifically, the reduction in protein (peptide) activity disclosed herein may stem from:

[0109] 1) The gene encoding all or part of the protein (peptide) is missing;

[0110] 2) Modify the gene expression regulatory region on the chromosome that encodes the protein (peptide) (e.g., introduce modifications into the expression regulatory region, replace it with a sequence that exhibits expression repression activity, or insert a sequence that exhibits expression repression activity).

[0111] 3) Modify the amino acid sequence of the protein (peptide) to reduce the activity of the protein (peptide) (e.g., by deleting / replacing / adding one or more amino acids in the amino acid sequence).

[0112] 4) Modify the polynucleotide sequence encoding the protein (peptide) to reduce the activity of the protein (peptide) (e.g., modify the polynucleotide sequence of the gene encoding the protein (peptide) so that the gene encodes a modified protein (peptide) with reduced activity).

[0113] 5) Modify the start codon or 5'-UTR of the gene encoding the protein (polypeptide);

[0114] 6) Introduce an antisense oligonucleotide (e.g., antisense RNA) that binds complementary to the transcript of the gene encoding the protein (polypeptide).

[0115] 7) Add a sequence complementary to the SD sequence upstream of the Shine-Dalgarno (SD) sequence of the gene encoding the protein (peptide) to form a secondary structure that prevents ribosome attachment;

[0116] 8) Reverse transcription engineering (RTE), which involves adding a promoter for reverse transcription to the 3' end of the open reading frame (ORF) encoding the polynucleotide sequence of the protein (peptide); or

[0117] 9) Regulating the cellular localization of the protein (peptide); or

[0118] 10) Selected from two or more of the above 1) to 9), but not particularly limited thereto.

[0119] For example,

[0120] The deletion of all or part of the gene encoding the protein (polypeptide) mentioned in 1) can be achieved by using homologous recombination via chromosome insertion vector in microorganisms, or by using electromagnetic waves (e.g., ultraviolet, X-rays, or gamma rays) or chemicals, but is not limited thereto.

[0121] The replacement of the expression regulatory region encoding the protein (peptide) on the chromosome with a sequence having expression repressive activity, as described in point 2), can be achieved by, for example, introducing modifications (through deletion, insertion, substitution, or a combination thereof) into the expression regulatory region sequence to further reduce the expression-inducing activity of the expression regulatory region, or replacing the sequence with a sequence having expression repressive activity. The expression regulatory region may include, but is not limited to, promoter, operator sequences, sequences encoding ribosome binding sites, and sequences regulating transcription and translation termination.

[0122] Modifications to the amino acid sequence or polynucleotide sequence of the protein (peptide) as described in 3) and 4) can be achieved by introducing modifications into the amino acid sequence of the protein (peptide) or the sequence encoding the protein (peptide) through deletion, insertion, substitution, or a combination thereof to reduce the activity of the protein (peptide); or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence that has reduced activity, but not limited thereto. Sequence modification can specifically be performed by inserting the modified polynucleotide sequence into the chromosome through homologous recombination, but is not limited thereto. In one specific embodiment, the protein (peptide) can be inactivated by introducing a mutation into the polynucleotide sequence encoding the protein (peptide) to form a stop codon, but is not limited thereto.

[0123] The modification of the start codon or 5'-UTR base sequence of the encoded gene transcript (which encodes the protein (peptide)) can be achieved by, for example, replacing the start codon with a different start codon that has a lower protein (peptide) expression rate compared to the endogenous start codon, or modifying the base sequence to encode an RBS sequence that has a lower protein (peptide) expression rate compared to the endogenous ribosome binding site (RBS) sequence, but is not limited thereto.

[0124] The introduction of antisense oligonucleotides (e.g., antisense RNA) that bind complementary to the transcript of the gene encoding the protein (polypeptide) in step 6) may be performed with reference to, but is not limited to, the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0125] The addition of a sequence complementary to the SD sequence upstream of the Shine-Dalgarno (SD) sequence of the gene encoding the protein (peptide) to form a secondary structure that prevents ribosome attachment can be achieved by inhibiting mRNA translation or slowing its rate, but is not limited thereto.

[0126] The 8) reverse transcription engineering (RTE), which involves adding a promoter for reverse transcription to the 3' end of the open reading frame (ORF) of the polynucleotide sequence encoding the protein (peptide), can be achieved by generating an antisense nucleotide complementary to the transcript of the gene encoding the peptide to inhibit the translation of the protein (peptide) and thus reduce its activity.

[0127] The regulation of the cellular localization of the protein (peptide) described in 9) can be achieved by targeting the protein (peptide) to specific intracellular organelles or specific intracellular spaces. For example, this can be achieved by adding or removing a leader sequence that plays a role in protein (peptide) targeting, thereby targeting the protein (peptide) to the periplasm or cytoplasm, but is not limited thereto.

[0128] This reduction in protein (peptide) activity can refer to, but is not limited to, a decrease in the activity or concentration of the protein (peptide) expressed in the wild-type strain or host cell (microorganism) before modification.

[0129] The partial or complete modification of polynucleotides in the host cell (microorganism) disclosed herein can be induced by: (a) homologous recombination (using a vector for chromosome insertion) or genome editing (using engineered nucleases (e.g., CRISPR-Cas9)), and / or (b) treatment with light (such as ultraviolet light and radiation) and / or chemicals, but not limited thereto.

[0130] nourish

[0131] As used herein, the term "culture" refers to the growth of microorganisms under appropriately controlled environmental conditions. The culture process can be carried out in suitable culture media and under suitable culture conditions known in the art. Those skilled in the art can readily adapt and use such a culture method depending on the selected microorganisms. Specifically, the culture can be a batch culture, a continuous culture, and / or a fed-batch culture, but is not limited thereto.

[0132] As used herein, the term "culture medium" refers to a mixture of substances containing nutrients required for the cultivation of microorganisms as its main components, and that the medium provides nutrients, growth factors, etc., including water, which is essential for survival and growth. Specifically, any culture medium and culture conditions can be used to cultivate the microorganisms of this disclosure without particular limitation, as long as the medium is used for the general culture of microorganisms. For example, the microorganisms of this disclosure can be cultured under aerobic conditions in a general culture medium containing suitable carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, while controlling temperature, pH, etc. For example, culture media for Corynebacterium spp. can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)].

[0133] In this disclosure, the carbon sources include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, and citric acid; and amino acids such as glutamic acid, methionine, and lysine. Additionally, natural organic nutrients such as starch hydrolysates, molasses, brown molasses, rice bran, cassava, bagasse, and corn steep liquor can be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted to reducing sugars) can be used, and various other carbon sources can be used without limitation in appropriate amounts. These carbon sources can be used alone or in combination of two or more, but are not limited thereto.

[0134] As nitrogen sources, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate can be used, or organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysate, fish or its decomposition products, and defatted soybean meal or its decomposition products can be used. These nitrogen sources can be used alone or in combination of two or more, but are not limited thereto.

[0135] Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or corresponding sodium-containing salts can be used as phosphorus sources. For inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc., can be used. In addition, amino acids, vitamins, and / or suitable precursors can be included. These components or precursors can be added to the culture medium in batches or continuously. However, the culture medium is not limited to these.

[0136] During the cultivation of the microorganisms of this invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the culture medium in a suitable manner to adjust the pH of the medium. During cultivation, antifoaming agents such as fatty acid polyethylene glycol esters can be used to suppress foaming. To maintain an aerobic state in the culture medium, oxygen or oxygen-containing gas can be injected. To maintain an anaerobic or slightly aerobic state in the culture medium, no gas injection is necessary, or nitrogen, hydrogen, or carbon dioxide gas can be injected. However, the cultivation conditions are not limited to these.

[0137] In the cultivation of this disclosure, the cultivation temperature can be maintained between 20°C and 45°C, specifically between 25°C and 40°C, and the cultivation can be carried out for about 10 to 160 hours, but the cultivation conditions are not limited thereto.

[0138] As used herein, the term "culture" refers to a culture medium, concentrated culture medium, dried product of a culture medium, culture filtrate, concentrated culture filtrate, or dried product of a culture filtrate obtained by culturing a specific microorganism in a culture medium. The culture medium refers to a solution containing the specific microorganism, while the culture filtrate refers to a solution substantially free of the specific microorganism (where "substantially" means excluding the specific microorganism isolated by methods such as filtration, but does not mean that the microorganism is completely absent from the filtrate). The form of the culture is not limited, and in one instance, it may be in the form of a liquid, emulsion, or solid.

[0139] As used herein, the term "fermentation" refers to the process by which microorganisms use their enzymes to break down organic matter, excluding putrefaction. Fermentation and putrefaction proceed using similar processes. However, during decomposition, fermentation produces useful substances, while putrefaction produces foul odors or harmful substances.

[0140] In this disclosure, the method for obtaining fermentation products from microorganisms is not particularly limited and can be obtained according to methods conventionally used in related or similar technical fields.

[0141] As used herein, the term "fermentation product" includes not only the fermentation material itself, but also all types of substances containing fermentation products produced by microorganisms, including substances containing fermenting microorganisms, cultures produced by fermenting microorganisms, fermentation products of cultures, concentrated fermentation products, dried products of fermentation products, filtrates of fermentation products, filtrates of concentrated fermentation products, dried products of filtrates of fermentation products, extracts of fermentation products, or dilute solutions of fermentation products.

[0142] Specific description of this disclosure

[0143] The embodiments of this disclosure will be described in more detail below.

[0144] One aspect of this disclosure provides a Corynebacterium microorganism that produces L-amino acids, comprising: at least one of the following groups: a fructokinase selected from microorganisms of the Escherichia genus, a polynucleotide encoding the fructokinase, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter selected from microorganisms of the Fermentomonas genus, and a polynucleotide encoding the non-PTS sugar transporter.

[0145] As used in this article, the term "fructokinase" is a protein that has the activity of phosphorylating fructose.

[0146] It is known that in microorganisms expressing fructokinase, sucrose is broken down into 6-phosphorylated glucose and fructose by invertase, and then the fructose is phosphorylated by fructokinase. The 6-phosphorylated glucose and phosphorylated fructose are used for glycolysis.

[0147] In one instance, the fructokinase of this disclosure may be a protein with fructokinase activity encoded by the cscK gene, but is not particularly limited to any type, as long as it has the activity corresponding to fructokinase. In one instance, the fructokinase of this disclosure may be derived from *Escherichia coli*. In one instance, the fructokinase of this disclosure may be encoded by the cscK gene of *Escherichia coli*.

[0148] cscK, derived from Escherichia coli, is a fructokinase gene belonging to the csc regulator group. It is known to participate in sucrose metabolism along with cscB (proton symport-type sucrose permease) and cscA (sucrose hydrolase) (J. Bacteriol., 184: 5307-5316, 2002).

[0149] Fructose kinase encoded by the cscK gene is known in the art, and the amino acid and polynucleotide sequences of fructokinase are available from publicly available databases, including, but not limited to, NCBI’s GenBank.

[0150] In one example, a fructokinase protein derived from a microorganism of the genus *Escherichia* may contain, but is not limited to, the amino acid sequence of SEQ ID NO: 139 or an amino acid sequence having 60% or more homology or identity with it, as long as it possesses fructokinase activity. Furthermore, it is apparent that even if a protein contains a portion of the amino acid sequence of SEQ ID NO: 139 that has been deleted, modified, substituted, or added, the protein may still fall within the scope of the fructokinases disclosed herein, as long as the protein exhibits efficacy corresponding to fructokinase. Fructokinases may include proteins having, containing, or consisting of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO: 139, and exhibiting efficacy equivalent to fructokinase.

[0151] Furthermore, the sequence of the polynucleotide encoding a fructokinase derived from a microorganism of the genus *Escherichia* can be obtained, for example, based on codon information known in the art, wherein the fructokinase has the amino acid sequence of SEQ ID NO: 139 or an amino acid sequence having at least 60% homology or identity with it. In one example, the fructokinase may be encoded by a polynucleotide having, comprising, or consisting substantially of the following sequences: the sequence of SEQ ID NO: 11 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the sequence of SEQ ID NO: 11, but is not limited thereto. The base sequence of SEQ ID NO: 11 can be obtained from known databases, such as NCBI's GenBank, but is not limited thereto.

[0152] In this disclosure, the term “polynucleotide (gene) containing the base sequence of SEQ ID NO: 11” may be used interchangeably with the terms “polynucleotide (gene) having the base sequence of SEQ ID NO: 11”, “polynucleotide (gene) composed of the base sequence of SEQ ID NO: 11”, or “cscK”.

[0153] The variant polypeptide or fructokinase variant polypeptide disclosed herein refers to a variant polypeptide in which the amino acid at position 79 or 181 of the amino acid sequence of SEQ ID NO: 139 is replaced by another amino acid.

[0154] The term "fructokinase variant polypeptide" may be referred to as "fructokinase variant," "variant CscK," "CscK variant," "variant polypeptide," etc. The fructokinase polypeptide that incorporates the variants of this disclosure may be used interchangeably with the term "CscK" without particular limitation, but may be encoded by the cscK gene and may be a CscK derived from Escherichia coli, but is not limited thereto.

[0155] The fructokinase variant polypeptide disclosed herein can refer to a variant polypeptide in which the amino acid at position 79 or 181 in the amino acid sequence corresponding to SEQ ID NO: 139 is replaced by another amino acid.

[0156] The term "another amino acid" or "other amino acid" is not limited, as long as the amino acid is different from the amino acid before the substitution. Furthermore, in this disclosure, when stating "a specific amino acid has been substituted," it can be substituted by an amino acid different from the amino acid before the substitution, even if it is not specifically stated that it has been substituted by a different amino acid.

[0157] In one example, the variant polypeptide may have an amino acid substitution at position 79 of the amino acid sequence corresponding to SEQ ID NO: 139, other than tryptophan (the amino acid before substitution), or an amino acid substitution at position 181 of the amino acid sequence corresponding to SEQ ID NO: 139, other than alanine (the amino acid before substitution), or a combination thereof. The variant may be, but is not limited to, a variant in which the amino acid at position 79 of the amino acid sequence corresponding to SEQ ID NO: 139 is substituted with an amino acid selected from, but not limited to, the group consisting of asparagine, valine, glycine, leucine, arginine, alanine, methionine, threonine, glutamine, proline, isoleucine, serine, phenylalanine, histidine, cysteine, tyrosine, lysine, aspartic acid, and glutamic acid.

[0158] The variant may be, but is not limited to, a variant in which the amino acid at position 181 of the amino acid sequence corresponding to SEQ ID NO: 139 is replaced by an amino acid substitution selected from the group consisting of asparagine, valine, glycine, leucine, arginine, tryptophan, methionine, threonine, glutamine, proline, isoleucine, serine, phenylalanine, histidine, cysteine, tyrosine, lysine, aspartic acid, and glutamic acid.

[0159] In one example, the variant polypeptide may have an amino acid substitution of cysteine ​​at position 79 of the amino acid sequence corresponding to SEQ ID NO: 139, or an amino acid substitution of valine at position 181 of the amino acid sequence corresponding to SEQ ID NO: 139, or a combination thereof.

[0160] In one instance, the variant polypeptide provided in this disclosure may comprise an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or higher homology or identity with SEQ ID NO: 139.

[0161] In one example, the variant polypeptide provided in this disclosure may fix the amino acid at position 79 of the amino acid sequence shown in SEQ ID NO: 139 to cysteine, and may contain an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or higher homology or identity with SEQ ID NO: 139. Furthermore, the variant polypeptide provided in this disclosure may fix the amino acid at position 181 of the amino acid sequence shown in SEQ ID NO: 139 to valine, and may contain an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or higher homology or identity with SEQ ID NO: 139. Furthermore, the variant peptides provided in this disclosure may fix the amino acid at position 79 of the amino acid sequence shown in SEQ ID NO: 139 to cysteine ​​and fix the amino acid at position 79 of the amino acid sequence shown in SEQ ID NO: 139 to valine, and may contain an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% or higher homology or identity with the amino acid sequence shown in SEQ ID NO: 139. Moreover, as long as it is an amino acid sequence having such homology or identity and exhibiting the efficacy corresponding to the variant peptides of this disclosure, it may be a variant peptide having, but is not limited to, amino acid sequences with deletions, modifications, substitutions, conservative substitutions, or additions in a portion thereof.

[0162] Furthermore, those skilled in the art can identify the amino acid at position 79 or 181 of the amino acid sequence corresponding to SEQ ID NO: 139 of this disclosure in any amino acid sequence by sequence alignment known in the art. And even if not specifically described in this disclosure, if an "amino acid at a specific position in a specific SEQ ID NO" is disclosed, it can be included in any amino acid sequence at its "corresponding position", but is not limited thereto.

[0163] In one instance, the variant polypeptide may consist of the amino acid sequence of SEQ ID NO: 147 or SEQ ID NO: 148.

[0164] Specifically, the variant polypeptides of this disclosure may have, comprise, or consist of, or substantially consist of, an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 147 or SEQ ID NO: 148.

[0165] Specifically, the variant polypeptides of this disclosure may have, comprise, or consist of, or substantially consist of, the amino acid sequence of SEQ ID NO: 147 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 147.

[0166] Specifically, the variant polypeptides of this disclosure may have, comprise, or consist of, or substantially consist of, the amino acid sequence of SEQ ID NO: 148 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 148.

[0167] For example, the amino acid sequence may have sequence additions or deletions, naturally occurring mutations, silent mutations, or conserved substitutions that do not alter the function of the variants disclosed herein.

[0168] The polynucleotide encoding the fructokinase variant polypeptide disclosed herein may include, without limitation, a polynucleotide sequence encoding a variant polypeptide having fructokinase activity.

[0169] For example, the polynucleotide encoding the fructokinase variant polypeptide disclosed herein may be a polynucleotide sequence encoding the amino acid sequence of the fructokinase variant polypeptide disclosed herein, but is not limited thereto.

[0170] For example, it may comprise a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 147 or SEQ ID NO: 148. As an example of this disclosure, the polynucleotide of this disclosure may have or comprise SEQ ID NO: 149 or SEQ ID NO: 150. Furthermore, the polynucleotide of this disclosure may consist of or substantially consist of SEQ ID NO: 149 or SEQ ID NO: 150.

[0171] For example, in a sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.8% or higher homology or identity with the sequence of SEQ ID NO: 11, the polynucleotide of this disclosure may include replacing the codon encoding tryptophan (corresponding to amino acids 235 to 237 of SEQ ID NO: 11) with a codon encoding an amino acid other than tryptophan (e.g., cysteine); or replacing the codon encoding alanine (corresponding to amino acids 541 to 543 of SEQ ID NO: 11) with a codon encoding an amino acid other than alanine (e.g., valine); or both of the above replacements, but not limited thereto.

[0172] Furthermore, it is obvious that variants having a polynucleotide sequence in a portion thereof containing deletions, modifications, substitutions, conserved substitutions, or additions fall within the scope of this disclosure, provided that the polynucleotide sequence has such homology or identity and encodes the amino acid sequence of the fructokinase variant polypeptide of this disclosure.

[0173] In this disclosure, non-PTS glycan transporters are proteins that have the activity of taking external sugars into cells without consuming phosphoenolpyruvate (PEP).

[0174] In one instance, the non-PTS glycan transporter of this disclosure may have glucose and / or fructose uptake capabilities.

[0175] Specifically, the non-PTS glycan transporter may have the activity of transporting glucose and / or fructose into the cell, but is not limited thereto.

[0176] In microorganisms, sugar uptake proteins can be mainly classified into ATP-binding cassette (ABC) transporters, major promoting factor superfamily (MFS), and phosphoenolpyruvate (PEP): carbohydrate phosphotransferase system (PTS). PTS, also known as the phosphoenolpyruvate (PEP)-dependent phosphotransferase transport system, is a sugar transport system in bacteria, which differs from non-PTS systems.

[0177] ATP-binding cassette transporters are characterized by the requirement of ATP for sugar molecules to enter the cell. In the case of MFS, they are characterized by comprising an H+-linked symporter, a Na+-linked symporter-antiporter, or a uniporter. For example, an H+-linked symporter-antiporter... + - Cotransporters require an extracellular proton to allow sugar molecules to enter the cell. These ABC transporters and MFS are considered examples of non-PTS sugar transporters. However, non-PTS sugar transporters are not limited to these examples.

[0178] In one instance, the non-PTS sugar transporter of this disclosure can be a protein with sugar uptake protein activity encoded by the glf gene, and its type is not particularly limited as long as it has sugar uptake activity that does not consume PEP and can be included in the category of non-PTS sugar transporters. In one instance, the non-PTS sugar transporter of this disclosure can be derived from Zymomonas mobilis. In one instance, the non-PTS sugar transporter of this disclosure can be encoded by the glf gene of Zymomonas mobilis, but is not limited thereto.

[0179] Non-PTS glycotransporters encoded by the glf gene are known in the art, and the amino acid and polynucleotide sequences of non-PTS glycotransporters are available from publicly available databases, including, but not limited to, NCBI’s GenBank.

[0180] In one example, a non-PTS glycan transporter derived from a microorganism of the genus *Fermentomonas* may contain, but is not limited to, the amino acid sequence of SEQ ID NO: 140 or an amino acid sequence having 60% or more homology or identity with it, as long as it has sugar uptake activity that does not deplete PEP. Furthermore, it is apparent that even if a protein contains a portion of the amino acid sequence of SEQ ID NO: 140 that has been deleted, modified, substituted, or added, the protein may still fall within the scope of the non-PTS glycan transporters of this disclosure, as long as the protein exhibits efficacy corresponding to a non-PTS glycan transporter. The non-PTS glycan transporter may include a protein having, containing, or consisting of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the amino acid sequence of SEQ ID NO: 140, and exhibiting efficacy equivalent to a non-PTS glycan transporter.

[0181] Furthermore, the sequence of the polynucleotide encoding a non-PTS glycan transporter derived from microorganisms of the genus *Fermentomonas* can be obtained, for example, based on codon information known in the art, wherein the non-PTS glycan transporter has the amino acid sequence of SEQ ID NO: 140 or an amino acid sequence having at least 60% homology or identity with it. In one example, the non-PTS glycan transporter may be encoded by a polynucleotide having, comprising, or consisting substantially of the following sequences: the sequence of SEQ ID NO: 35 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the sequence of SEQ ID NO: 35, but is not limited thereto. The base sequence of SEQ ID NO: 35 can be obtained from known databases, such as NCBI's GenBank, but is not limited thereto.

[0182] In this disclosure, the term “polynucleotide (gene) containing the base sequence of SEQ ID NO: 35” may be used interchangeably with the terms “polynucleotide (gene) having the base sequence of SEQ ID NO: 35”, “polynucleotide (gene) composed of the base sequence of SEQ ID NO: 35”, or “glf”.

[0183] Taking into account codon degeneracy or preferred codons in organisms expressing the proteins of this disclosure, the polynucleotides of this disclosure can be modified in various ways in the coding region without altering the amino acid sequence of the proteins of this disclosure. Therefore, it is evident that polynucleotides that can be translated by codon degeneracy into polypeptides consisting of the amino acid sequences of the fructokinase, fructokinase variant polypeptides, and / or non-PTS sugar transporters of this disclosure, or polypeptides having at least 60% homology or identity with them, may also be included in the polynucleotides of this disclosure. For example, the polynucleotides of this disclosure may be SEQ ID NO: 11, SEQ ID NO: 35, SEQ ID NO: 149, SEQ ID NO: 150, or their degenerate sequences.

[0184] In another instance, the polynucleotide of this disclosure may have or comprise a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the sequence of SEQ ID NO: 11, SEQ ID NO: 35, SEQ ID NO: 149, or SEQ ID NO: 150, or may consist of, but is not limited to, a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the sequence of SEQ ID NO: 11, SEQ ID NO: 35, SEQ ID NO: 149, or SEQ ID NO: 150.

[0185] Furthermore, the polynucleotides disclosed herein may include, but are not limited to, probes that can be prepared from known gene sequences, such as sequences encoding fructokinases, fructokinase variant peptides, and / or non-PTS glycans prepared by hybridization under stringent conditions with all or part of the complementary sequences of the polynucleotide sequences disclosed herein.

[0186] The Corynebacterium species disclosed herein have the ability to produce L-amino acids.

[0187] The microorganisms disclosed herein may include any microorganism capable of producing desired L-amino acids by comprising: at least one of the following: a fructokinase selected from microorganisms of the genus Escherichia, a polynucleotide encoding the same, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following: a non-PTS sugar transporter selected from microorganisms of the genus Fermentomonas, and a polynucleotide encoding the same.

[0188] For example, the microorganism disclosed herein may be a microorganism or a recombinant microorganism, characterized by having an increased L-amino acid production capacity by comprising at least one of the following: a fructokinase selected from microorganisms of the genus Escherichia, a polynucleotide encoding the same, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following: a non-PTS sugar transporter selected from organisms of the genus Fermentomonas, and a polynucleotide encoding the same, and the microorganism or recombinant microorganism is genetically modified by introducing the protein or polynucleotide therein, but is not limited thereto.

[0189] Specifically, the recombinant strain with enhanced L-amino acid production capacity can be a microorganism with enhanced L-amino acid production capacity compared to an unmodified microorganism, wherein the unmodified microorganism does not contain fructokinase or polynucleotides encoding such fructokinase from natural wild-type microorganisms or Escherichia coli; and non-PTS sugar transport proteins or polynucleotides encoding such fructokinase from microorganisms of the Fermentomonas genus, but is not limited thereto.

[0190] In one example, a microorganism capable of producing L-amino acids is a microorganism that can produce L-amino acids in a living organism, and may include any microorganism inherently capable of producing L-amino acids, or microorganisms conferred L-amino acid production capability by the activity of a fructokinase or a variant polypeptide derived from Escherichia coli of this disclosure; and microorganisms whose parent strains do not possess L-amino acid production capability by the activity of a non-PTS sugar transporter derived from Fermentomonas genus. The ability to produce L-amino acids can be conferred or enhanced through strain modification.

[0191] The microorganisms disclosed herein may include any microorganism wherein the following substances are inserted therein by various known methods: at least one of the following groups consisting of a fructokinase derived from a microorganism of the genus Escherichia, a polynucleotide encoding the same, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following groups consisting of a non-PTS sugar transporter derived from a microorganism of the genus Fermentomonas and a polynucleotide encoding the same.

[0192] In one instance, the recombinant microorganisms of this disclosure with L-amino acid production capabilities may include any microorganism capable of producing L-amino acids by introducing exogenous genes through transformation with a vector, the exogenous genes encoding fructokinase or variant polypeptides thereof from Escherichia coli microorganisms of this disclosure, and non-PTS sugar transporters from Microbes of the Fermentomonas genus.

[0193] For example, the microorganism that produces L-amino acids may be a microorganism into which a fructokinase encoding an amino acid sequence comprising SEQ ID NO: 139 or a polynucleotide comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or higher homology or identity with the amino acid sequence comprising SEQ ID NO: 139.

[0194] For example, the microorganisms that produce L-amino acids may be microorganisms that introduce polynucleotide sequences encoding the following substances: a fructokinase variant polypeptide comprising a sequence in which the amino acid corresponding to position 79 or 181 of SEQ ID NO: 139 is replaced with a different amino acid; or a fructokinase variant polypeptide comprising a cysteine-substituted amino acid corresponding to position 79 of SEQ ID NO: 139, a valine-substituted amino acid corresponding to position 181 of SEQ ID NO: 139, or a combination thereof; or a fructokinase variant polypeptide comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or higher homology or identity with the amino acid sequence of SEQ ID NO: 147 or 148.

[0195] For example, the microorganisms that produce L-amino acids may be microorganisms into which the following substances are introduced: polynucleotides capable of encoding proteins containing an amino acid sequence having at least 60% homology with the amino acid sequence of SEQ ID NO: 139; or polynucleotides containing the base sequence of SEQ ID NO: 11 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 11.

[0196] For example, the microorganisms that produce L-amino acids may be microorganisms into which the following substances are introduced: polynucleotides capable of encoding proteins containing an amino acid sequence having at least 60% homology with the amino acid sequence of SEQ ID NO: 147 or 148; or polynucleotides containing a base sequence of SEQ ID NO: 149 or 150 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 149 or 150.

[0197] For example, the microorganism that produces L-amino acids may be a microorganism into which a non-PTS glycan transporter encoding an amino acid sequence containing the amino acid sequence of SEQ ID NO: 140 or a non-PTS glycan transporter containing an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or higher homology or identity with the amino acid sequence of SEQ ID NO: 140.

[0198] For example, the microorganisms that produce L-amino acids may be microorganisms to which the following substances are introduced: polynucleotides capable of encoding proteins containing an amino acid sequence having at least 60% homology with the amino acid sequence of SEQ ID NO: 140; or polynucleotides containing the base sequence of SEQ ID NO: 35 or a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequence of SEQ ID NO: 35.

[0199] In one instance, the microorganism with increased L-amino acid production capacity disclosed herein may be, but is not limited to, a microorganism with increased L-amino acid production capacity compared to an unmodified microorganism. In one instance, the unmodified microorganism used as a reference strain for comparing whether L-amino acid production capacity is increased may be, but is not limited to, strains ATCC13869, CA04-8357, KCCM11016P, ATCC 13032, CM05-9841, CJH1, or KCCM 12120P.

[0200] In one instance, a recombinant microorganism with increased L-amino acid production capacity may exhibit an increase of at least about 1%, specifically at least about 1%, at least about 2.5%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, or at least about 21% (with no particular upper limit, for example, it could be up to about 200%, up to about 150%, up to about 100%, up to about 50%, up to about 45%, up to about 40%, up to about 35%, up to about 30%, or up to about 25%), but is not limited thereto. In another embodiment, the microorganism with increased L-amino acid production capacity may have an increase of at least about 1.1 times, at least about 1.15 times, at least about 1.16 times, at least about 1.17 times, at least about 1.18 times, at least about 1.19 times, at least about 1.2 times, or at least about 1.21 times (with no particular upper limit, e.g., up to about 10 times, up to about 5 times, up to about 3 times, up to about 2 times, up to about 1.5 times, up to about 1.4 times, up to about 1.3 times, or up to about 1.25 times), but is not limited thereto.

[0201] The microorganisms disclosed herein may be microorganisms of the genus Corynebacterium.

[0202] In one example of this disclosure, the microorganisms may be *Corynebacterium glutamicum*, *Corynebacterium crudilactis*, *Corynebacterium deserti*, *Corynebacterium efficiens*, *Corynebacterium callunae*, *Corynebacterium stationis*, *Corynebacterium singulare*, *Corynebacterium halotolerans*, *Corynebacterium striatum*, *Corynebacterium pollutisoli*, *Corynebacterium imitans*, *Corynebacterium testudinoris*, or *Corynebacterium flavescens*. Specifically, the microorganisms disclosed may be *Corynebacterium glutamicum*, but are not limited thereto.

[0203] Meanwhile, the Corynebacterium genus microorganisms with L-amino acid production capacity disclosed herein include any of the following microorganisms: naturally wild-type microorganisms, Corynebacterium genus microorganisms with enhanced L-amino acid production capacity by enhancing or weakening the activity of genes related to branched-chain amino acid production mechanisms, or Corynebacterium genus microorganisms with L-amino acid production capacity by introducing or enhancing the activity of exogenous genes.

[0204] In one instance, the microorganism of this disclosure may have reduced activity of the PEP-dependent phosphotransferase system (PTS). For example, the activity of some or all of the proteins constituting the phosphotransferase system that absorbs fructose may be reduced. In one instance, the microorganism of this disclosure may have reduced pts gene expression. In one instance, the expression of the ptsF gene may be reduced, or its expression may be reduced due to the deletion of the ptsF gene, but is not limited thereto.

[0205] In one instance, the microorganisms of this disclosure may include modifications to increase L-tryptophan production capacity. Microorganisms modified to increase L-tryptophan production capacity may have enhanced expression of genes encoding anthranilic acid synthase, the tryptophan operon, and transketolase, and relieve feedback inhibition. Microorganisms modified to increase L-tryptophan production capacity may contain TrpE with an S38R substitution at the N-terminal 38 position corresponding to the Corynebacterium TrpE, or a P21S substitution at the N-terminal 21 position corresponding to the Escherichia coli TrpE. The disclosure of KR 10-2035844 B1, which relates to microorganisms with an improved tryptophan biosynthetic pathway, is incorporated herein by reference.

[0206] In one instance, the microorganisms disclosed herein may contain modifications that increase L-histidine production capacity. Microorganisms modified to increase L-histidine production capacity may contain HisG (ATP phosphoribosyltransferase), which relieves feedback inhibition. HisG may contain, for example, substitutions of G233H and T235Q corresponding to HisG in Corynebacterium glutamicum, as described in ACSSynth. Biol., 2014, 3(1), pp. 21-29, which are incorporated herein by reference. Microorganisms modified to increase L-histidine production capacity may have enhanced expression of hisE, hisG, hisN, hisD, hisA, hisH, and hisB. Enhanced expression may be achieved, for example, by substitution of the start codon, substitution of the promoter, or increase of gene copy number.

[0207] In one instance, the microorganisms of this disclosure may contain modifications that increase L-threonine production capacity. Microorganisms modified to increase L-threonine production capacity may contain aspartate kinase (LysC) and homoserine dehydrogenase (Hom), and relieve feedback inhibition. LysC may contain, for example, an L377K substitution corresponding to *Corynebacterium glutamicum* LysC. Hom may contain, for example, an R398Q substitution corresponding to *Corynebacterium glutamicum* Hom. The disclosure of US 11,236,374 B2, regarding microorganisms with increased threonine production capacity, is incorporated herein by reference.

[0208] Another aspect of the present invention provides a method for producing L-amino acids, comprising culturing a Corynebacterium microorganism in a culture medium, the Corynebacterium microorganism comprising at least one of the following groups: a fructokinase selected from a microorganism of the Escherichia genus, a polynucleotide encoding the same, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter selected from a microorganism of the Fermentomonas genus, and a polynucleotide encoding the same.

[0209] In the method for producing L-amino acids disclosed herein, the microorganisms can be cultured using any culture conditions and methods known in the art. Those skilled in the art can readily adapt and use this culture method depending on the selected strain.

[0210] The L-amino acids produced by the culture of this disclosure can be secreted into the culture medium or retained in the cells.

[0211] The L-amino acids disclosed herein include any L-amino acids that can be produced by microorganisms endowed with production capacity, or any L-amino acids that are inherently produced through metabolic pathways derived from various carbon sources. Specifically, the L-amino acids may be basic amino acids, such as L-lysine, L-arginine, or L-histidine; nonpolar amino acids, such as L-valine, L-leucine, L-glycine, L-isoleucine, L-alanine, L-proline, or L-methionine; polar amino acids, such as L-serine, L-threonine, L-cysteine, L-asparagine, or L-glutamine; aromatic amino acids, such as L-phenylalanine, L-tyrosine, or L-tryptophan; or acidic amino acids, such as L-glutamic acid or L-aspartic acid. In one example, in this disclosure, the L-amino acids may be selected from L-tryptophan, L-lysine, L-histidine, and L-threonine.

[0212] In one instance, the method for producing L-amino acids of this disclosure may further include, for example, preparing the microorganisms of this disclosure prior to culturing, preparing a culture medium for culturing the microorganisms, or a combination thereof (in any order), but is not limited thereto.

[0213] The method for producing L-amino acids of the present invention may further include recovering the desired substance, particularly L-amino acids, from the cultured microorganisms, the culture product of the microorganisms, or the culture medium. The recovery may also be performed after culturing, but is not limited thereto.

[0214] Recovery can be achieved by collecting the desired L-amino acids using suitable methods known in the art, depending on the method of culturing the microorganisms disclosed herein, such as batch culture, continuous culture, or fed-batch culture. For example, the recovery may include centrifugation, filtration, treatment with a crystalline protein precipitant (salting out), extraction, sonication, ultrafiltration, dialysis, various chromatographic methods such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography and affinity chromatography, HPLC, or combinations thereof. Using suitable methods known in the art, desired substances, particularly L-amino acids, can be recovered from culture media or microorganisms.

[0215] Furthermore, the method for producing L-amino acids disclosed herein may further include purification. Purification can be performed using suitable methods known in the art. In one instance, when the method for producing L-amino acids disclosed herein includes both recovery and purification, these steps may be performed sequentially or discontinuously, simultaneously, or as an integrated step in any order, but are not limited thereto.

[0216] In the methods disclosed herein, the fructokinase derived from Escherichia coli, the non-PTS sugar transporter derived from Fermentomonas genus, the polynucleotide encoding it, the Corynebacterium genus containing it, and the L-amino acid, etc., are as described in the other aspects above.

[0217] Another aspect of this disclosure provides a composition for producing L-amino acids, comprising a Corynebacterium genus microorganism, a culture of said microorganism, a fermentation product of said microorganism, or a combination of two or more of said microorganisms, said Corynebacterium genus microorganism comprising at least one of the following groups: a fructokinase selected from a microorganism of the Escherichia genus, a polynucleotide encoding thereof, a variant polypeptide of said fructokinase, and a polynucleotide encoding said variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter selected from a microorganism of the Fermentomonas genus, and a polynucleotide encoding thereof.

[0218] The compositions disclosed herein may further comprise suitable excipients commonly used in compositions for the production of L-amino acids. Examples of such excipients include preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0219] In one specific embodiment, the compositions disclosed herein may comprise microbially effective amounts or amounts suitable for being present in the compositions used in production.

[0220] In the compositions disclosed herein, the fructokinase, variant polypeptides, and non-PTS sugar transporters derived from Escherichia coli, polynucleotides encoding them, Corynebacterium genus containing them, and L-amino acids, etc., are as described in the other aspects above.

[0221] Another aspect of the invention provides the use of Corynebacterium microorganisms for the production of L-amino acids, said Corynebacterium microorganisms comprising: at least one of the group consisting of a fructokinase derived from Escherichia coli, a polynucleotide encoding the same, a variant polypeptide of said fructokinase, and a polynucleotide encoding said variant polypeptide; and at least one of the group consisting of a non-PTS sugar transporter protein derived from Fermentomonas microorganisms and a polynucleotide encoding the same.

[0222] In the purposes of this disclosure, the fructokinases, variant peptides, and non-PTS sugar transporters, polynucleotides encoding them, and the L-amino acids contained therein from Escherichia coli microorganisms are as described in the other aspects above.

[0223] [Modes for Implementing the Invention]

[0224] The present disclosure will be described in more detail below by way of examples and experiments. However, these examples and experiments are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these examples and experiments.

[0225] Example 1. Construction of tryptophan-producing strains

[0226] The tryptophan-producing strain CA04-8357, constructed according to Korean Patent No. 10-2035844, was used. To enhance tryptophan production capacity by increasing precursor biosynthesis, the ptsF gene encoding the phosphotransferase system responsible for fructose uptake was deleted. To construct the deletion vector, chromosomal DNA from Corynebacterium glutamicum ATCC 13869 was used as a template, and primer pairs SEQ ID NO: 1 and SEQ ID NO: 2, and SEQ ID NO: 3 and SEQ ID NO: 4 were used for PCR. The polymerase used for PCR was Solg™ Pfu-X DNA polymerase (SolGent Co.). PCR amplification was performed under the following conditions: denaturation at 95°C for 5 minutes, followed by 27 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and extension at 72°C for 1 minute, with a final extension at 72°C for 5 minutes.

[0227] SEQ ID NO: 1

[0228] -tcgagctcggtacccATACCTCCGACAAGCCACTG

[0229] SEQ ID NO: 2

[0230] - GATTGCCCAGACCACGAAGAATAGCAACTTGACCGGGGAC

[0231] SEQ ID NO: 3

[0232] -GTCCCCGGTCAAGTTGCTATTCTTCGTGGTCTGGGCAATC

[0233] SEQ ID NO: 4

[0234] -ctctagaggatccccAAAAGCAAAAGGCGGTACCA

[0235] As a result, DNA fragments of 719 bp and 738 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit (QIAGEN), and the purified amplified products and chromosome transformation vector pDC24 (SEQ ID NO:138) digested with SmaI restriction enzyme were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly MasterMix) to obtain recombinant plasmids, which were named pDC24ΔptsF. Cloning was performed by mixing Gibson assembly reagent with each gene fragment at a calculated molar ratio and incubating the mixture at 50°C for 1 hour. The constructed pDC24ΔptsF vector was transformed into strain CA04-8357 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545). Following the second exchange process, strain CA04-8357::ΔptsF, in which the ptsF gene was deleted from the chromosome, was obtained. The corresponding genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 5 and SEQ ID NO: 6 (which can amplify the external regions of the upstream and downstream homologous recombination sites of the corresponding gene deletion, respectively).

[0236] SEQ ID NO: 5

[0237] - CAGGTGGTAAAGGCATCAA

[0238] SEQ ID NO: 6

[0239] - CTCTCGTTTGGTTGCTGT

[0240] The strain CA04-8357::ΔptsF obtained in this way was named Corynebacterium glutamicum CM05-9836.

[0241] Example 2. Construction of a Corynebacterium strain incorporating fructokinase from multiple microorganisms

[0242] Example 2-1. Construction of plasmids for inserting fructokinases derived from various microorganisms

[0243] To insert the exogenous fructokinase gene into the chromosome of *Corynebacterium glutamicum*, the genes BBD29_02180-BBD29_02200, known as genes encoding transposons in *Corynebacterium glutamicum*, were used as insertion sites. Specifically, to construct a vector for the deletion of BBD29_02180-BBD29_02200 and the insertion of the target gene, PCR was performed using the chromosome of ATCC13869 as a template and primer pairs SEQ ID NO: 7 and SEQ ID NO: 8, and SEQ ID NO: 9 and SEQ ID NO: 10, in the same manner as in Example 1. Primers SEQ ID NO: 8 and 9 were designed to include a ScaI cleavage site between the left and right homologous arms.

[0244] SEQ ID NO: 7

[0245] - AATTCGAGCTCGGTACCCAGTGGACACGGAGGATTT

[0246] SEQ ID NO: 8

[0247] - TGGTGACCGCATTATGGagtactGTTTAGGGTGGGGATAA

[0248] SEQ ID NO: 9

[0249] -TTATCCCCACCCTAAACagtactCCATAATGCGGTCACCA

[0250] SEQ ID NO: 10

[0251] - GGTCGACTCTAGAGGATCCCCGTGTAAAGAGCAATCGGG

[0252] As a result, DNA fragments of 823 bp and 813 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit, and the purified amplification products and the chromosome transformation vector pDC24 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24ΔBBD29_02180-BBD29_02200. Gibson cloning was performed in the same manner as in Example 1.

[0253] Example 2-2. Construction of Corynebacterium glutamicum microorganisms with cscK gene introduced from Escherichia coli

[0254] The fructose kinase cscK gene (SEQ ID NO: 11) from *E. coli* was introduced into the CM05-9836 strain constructed in Example 1 above. Information on the corresponding gene and surrounding base sequence (CP002967.1) was obtained from NIH GenBank. To amplify the cscK gene based on the obtained base sequence, PCR was performed using chromosomal DNA of the *E. coli* strain as a template and primers of SEQ ID NO: 12 and SEQ ID NO: 13, in the same manner as in Example 1. As a result, a 950 bp DNA fragment containing the 915 bp cscK gene was obtained.

[0255] SEQ ID NO: 12

[0256] -CGAAAGGAAACACTCATGTCAGCCAAAGTATGGGT

[0257] SEQ ID NO: 13

[0258] - TGGTGACCGCATTATGGagtCTATTCCAGTTCTTGTCGAC

[0259] To utilize the CJ7 promoter derived from Corynebacterium tarda (SEQ ID NO: 14, US 7,662,943 B2), PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 16. As a result, a 353 bp DNA fragment containing the 318 bp CJ7 promoter gene was obtained.

[0260] SEQ ID NO: 15

[0261] - TTATCCCCACCCTAAACagtAGAAACATCCCAGCGCTACT

[0262] SEQ ID NO: 16

[0263] - TACTTTGGCTGACATGAGTGTTTCCTTTCGTTGGG

[0264] After treating the pDC24ΔBBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and cscK gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_02180-BBD29_02200::Pcj7-csck. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_02180-BBD29_02200::Pcj7-csck vector was transformed into the CM05-9836 strain constructed in Example 1 by electroporation. After a second exchange process, a strain containing one copy of the Pcj7-cscK gene was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 17 and SEQ ID NO: 18 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9837.

[0265] SEQ ID NO: 17

[0266] - TTTTTCTCCCCTCGACCT

[0267] SEQ ID NO: 18

[0268] - TCCTCCTTTCTTCTTCAAC

[0269] Examples 2-3. Construction of Corynebacterium glutamicum microorganisms incorporating the mak gene from Escherichia coli

[0270] The fructose kinase *mak* gene (SEQ ID NO: 19) from *E. coli* was introduced into the strain constructed in Example 1 above. Information on the corresponding gene and surrounding base sequence (NC_000913.3) was obtained from NIH GenBank. To amplify the *mak* gene based on the obtained base sequence, PCR was performed in the same manner as in Example 1, using chromosomal DNA of the *E. coli* strain as a template and primers of SEQ ID NO: 20 and SEQ ID NO: 21. As a result, a 944 bp DNA fragment containing a 909 bp gene from *E. coli* was obtained.

[0271] SEQ ID NO: 20

[0272] -CGAAAGGAAACACTCGTGCGTATAGGTATCGATTTAGG

[0273] SEQ ID NO: 21

[0274] - TGGTGACCGCATTATGGagtTTACTCTTGTGGCCATAACC

[0275] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 22.

[0276] SEQ ID NO: 22

[0277] -AAATCGATACCTATACGCACGAGTGTTTCCTTTCGTTGGG

[0278] After treating the pDC24ΔBBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and the mak gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_02180-BBD29_02200::Pcj7-mak. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_02180-BBD29_02200::Pcj7-mak vector was transformed into the CM05-9836 strain constructed in Example 1 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-mak gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 17 and SEQ ID NO: 18 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9838.

[0279] Examples 2-4. Construction of Corynebacterium glutamicum microorganisms incorporating the scrK gene from Klebsiella pneumoniae.

[0280] The fructokinase *scrK* gene (SEQ ID NO: 23) from *Klebsiella pneumoniae* was introduced into the strain constructed in Example 1 above. Information on the corresponding gene and surrounding base sequence (NC_016845.1) was obtained from NIH GenBank. To amplify the *scrK* gene based on the obtained base sequence, PCR was performed in the same manner as in Example 1, using chromosomal DNA of the *Klebsiella pneumoniae* strain as a template and primers of SEQ ID NO: 24 and SEQ ID NO: 25. As a result, a 959 bp DNA fragment containing a 924 bp gene from *Klebsiella pneumoniae* was obtained.

[0281] SEQ ID NO: 24

[0282] - AACGAAAGGAAACACTCATGAATGGAAAAATCTGGGT

[0283] SEQ ID NO: 25

[0284] - GTGACCGCATTATGGagtTCACAGCGAGCGCTGAAGA

[0285] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 26.

[0286] SEQ ID NO: 26

[0287] - CCAGATTTTTCATTCATGAGTGTTTCCTTTCGTTGGG

[0288] After treating the pDC24ΔBBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and scrK gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_02180-BBD29_02200::Pcj7-scrk. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_02180-BBD29_02200::Pcj7-scrk vector was transformed into the CM05-9836 strain constructed in Example 1 by electroporation. After a second exchange process, a strain containing one copy of the Pcj7-scrk gene was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 17 and SEQ ID NO: 18 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9839.

[0289] Examples 2-5. Construction of Corynebacterium glutamicum microorganisms incorporating the frk gene from *Mammotrophic motility*.

[0290] The fructose kinase frk gene (SEQ ID NO: 27) from *Fermentomonas motilityis* was introduced into the strain constructed in Example 1 above. Information on the corresponding gene and surrounding base sequence (M97296.1) was obtained from NIH GenBank. To amplify the frk gene based on the obtained base sequence, PCR was performed in the same manner as in Example 1, using chromosomal DNA of the *Fermentomonas motilityis* strain as a template and primers of SEQ ID NO: 28 and SEQ ID NO: 29. As a result, a 936 bp DNA fragment containing a 906 bp gene from *Fermentomonas motilityis* was obtained.

[0291] SEQ ID NO: 28

[0292] -CGAAAGGAAACACTCATGAAAAACGATAAAAAAATTTATGG

[0293] SEQ ID NO: 29

[0294] -ACCGATTATGGagtTTATTTATTTTCTGCAGCCAATG

[0295] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 30.

[0296] SEQ ID NO: 30

[0297] -TTTATCGTTTTTCATGAGTTGTTTCCTTTCGTTGG

[0298] After treating the pDC24ΔBBD29_02180-BBD29_02200 vector constructed in Example 2-1 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and frk gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_02180-BBD29_02200::PCJ7-frk. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_02180-BBD29_02200::PCJ7-frk vector was transformed into the CM05-9836 strain constructed in Example 1 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-frk gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 17 and SEQ ID NO: 18 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9840.

[0299] Example 3. Evaluation of sugar utilization / L-tryptophan production capacity of Corynebacterium microorganisms incorporating fructokinase derived from various microorganisms.

[0300] To verify the L-tryptophan production capacity and fructose utilization of the strains constructed in the above examples, the strains were cultured and evaluated using the following method. Each strain was inoculated into a 250 mL corner-baffled flask containing 25 mL of seed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL corner-baffled flask containing 25 mL of production culture medium and cultured at 30°C with shaking at 200 rpm for 30 hours. After incubation, the L-tryptophan yield was determined by HPLC.

[0301] [Seed culture medium (pH 7.0)]

[0302] 20 g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 100 μg biotin, 1000 μg thiamine hydrochloride, 2000 μg calcium pantothenate, and 2000 μg nicotinamide (per 1 L distilled water).

[0303] [Production medium (pH 7.0)]

[0304] Fructose 30 g, (NH4)2SO4 15 g, MgSO4·7H2O 1.2 g, KH2PO4 1 g, yeast extract 5 g, biotin 900 μg, thiamine hydrochloride 4500 μg, calcium pantothenate 4500 μg and CaCO3 30 μg (per 1 L of distilled water).

[0305] [Table 1]

[0306] Comparison of fructose utilization and L-tryptophan production capacity (30 hours) of L-tryptophan-producing strains derived from Corynebacterium glutamicum ATCC 13869.

[0307]

[0308] In addition to the parental strain CA04-8357, which is capable of producing L-tryptophan, strains CM05-9836, CM05-9837, CM05-9838, CM05-9839, and CM05-9840 were also cultured using fructose as the sole carbon source. Furthermore, the concentration of L-tryptophan and sugar consumption in the cultures were determined, and the results are shown in Table 1 above.

[0309] In the case of CA04-8357 (in which ptsF is present), it completely consumes the added fructose within a given time and produces 2.1 g / L of L-tryptophan. However, in the case of CM05-9836 (in which ptsF is absent from CA04-8357), it consumes almost no sugar compared to the parent strain CA04-8357 and produces a significantly lower concentration of tryptophan.

[0310] CM05-9838 and CM05-9839, which introduced mak and scrK, showed similar sugar consumption and L-tryptophan production capacity as CM05-9836, confirming that mak and scrK had little effect as fructokinases.

[0311] On the other hand, in the case of CM05-9837 (with the introduction of cscK), sugar consumption and tryptophan production were slightly increased compared to the parental strain CA04-8357. In the case of CM05-9840 (with the introduction of frk), it showed the highest level of sugar consumption capacity and produced 0.8 g / L of L-tryptophan.

[0312] Based on the above results, it is confirmed that frk exhibits the best function as a fructokinase when using fructose as the sole carbon source.

[0313] However, when culturing microorganisms, it is more common to culture in the presence of both fructose and glucose than to use fructose as the sole carbon source. Therefore, the same strains evaluated in this example were cultured and evaluated in a fructose / glucose mixed medium using the following method. Each strain was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of seed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of mixed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. After incubation, the yield of L-tryptophan was determined by HPLC.

[0314] [Seed culture medium (pH 7.0)]

[0315] 20 g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 100 μg biotin, 1000 μg thiamine hydrochloride, 2000 μg calcium pantothenate, and 2000 μg nicotinamide (per 1 L distilled water).

[0316] [Fructose / glucose mixed medium (pH 7.0)]

[0317] 15 g fructose, 15 g glucose, 15 g (NH4)2SO4, 1.2 g MgSO4·7H2O, 1 g KH2PO4, 5 g yeast extract, 900 μg biotin, 4500 μg thiamine hydrochloride, 4500 μg calcium pantothenate, and 30 μg CaCO3 (per L distilled water).

[0318] [Table 2]

[0319] Compare the glucose and fructose utilization capacity and L-tryptophan production capacity (20 hours) of L-tryptophan-producing strains derived from Corynebacterium glutamicum ATCC 13869.

[0320]

[0321] It was confirmed that all five strains constructed under the evaluation conditions consumed glucose at levels similar to the parental strain CA04-8357. However, fructose consumption rates showed different results compared to conditions using fructose as the sole carbon source. The strain CM05-9840, with introduced frk, exhibited the best glucose consumption rate under fructose-only carbon source conditions, showing a lower glucose consumption rate in fructose / glucose mixed medium compared to the strain CM05-9837 with introduced cscK. Therefore, cscK was identified as the most effective fructose kinase, exhibiting appropriate activity levels under fructose-only carbon source conditions without its activity being inhibited by glucose.

[0322] Example 4. Construction of Corynebacterium species incorporating non-PTS sugar transporters from various microorganisms.

[0323] Example 4-1. Screening and selection of non-PTS fructose uptake genes

[0324] The aim is to further improve tryptophan production capacity by increasing the fructose uptake of the strain.

[0325] We searched for known exogenous genes capable of introducing sugars and selected 14 candidate genes. As a result, considering the biosafety level suitable for the production strain and the feasibility of protecting the organism, seven organisms were selected, as shown in Table 3 below.

[0326] [Table 3]

[0327]

[0328] Example 4-2. Construction of plasmids for inserting non-PTS sugar transport proteins from various microorganisms

[0329] To insert a foreign non-PTS sugar transporter gene into the chromosome of *Corynebacterium glutamicum*, the genes BBD29_12045-BBD29_12055, known as genes encoding transposons in *Corynebacterium glutamicum*, were used as insertion sites. Specifically, to construct a vector for the deletion of BBD29_12045-BBD29_12055 and the insertion of the target gene, PCR was performed using the chromosome of ATCC13869 as a template and primer pairs SEQ ID NO: 31 and SEQ ID NO: 32, and SEQ ID NO: 33 and SEQ ID NO: 34, in the same manner as in Example 1. Primers SEQ ID NO: 32 and 33 were designed to include a ScaI cleavage site between the left and right homologous arms.

[0330] SEQ ID NO: 31

[0331] - AATTCGAGCTCGGTACCCGATGGAACTACGAGACT

[0332] SEQ ID NO: 32

[0333] - TGACAATCACCGCATCCagtactGGATATTCGAGACAG

[0334] SEQ ID NO: 33

[0335] -CTGTCTCGAATATCCagtactGGATGCGGTGATTGTCAG

[0336] SEQ ID NO: 34

[0337] - GGTCGACTCTAGAGGATCCCCTAACCACGACGAC

[0338] As a result, DNA fragments of 793 bp and 843 bp were obtained, respectively. The obtained DNA products were purified using a PCR purification kit, and the purified amplification products and the chromosome transformation vector pDC24 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named pDC24ΔBBD29_12045-BBD29_12055. Gibson cloning was performed in the same manner as in Example 1.

[0339] Example 4-3. Construction of Corynebacterium microorganisms incorporating the glf gene from *Mammotrophic motility*.

[0340] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the glf gene (SEQ ID NO: 35) encoding a non-PTS sugar uptake protein derived from *Fermentomonas motilityis*, selected in Example 4-1, was introduced. Information on the corresponding gene and its surrounding base sequence (CP002850.1) was obtained from NIH GenBank. To amplify the glf gene based on the obtained base sequence, PCR was performed in the same manner as in Example 1, using chromosomal DNA of the *Fermentomonas motilityis* strain as a template and primers of SEQ ID NO: 36 and SEQ ID NO: 37. As a result, a 1452 bp DNA fragment containing the 1422 bp glf gene was obtained.

[0341] SEQ ID NO: 36

[0342] -CGAAAGGAAACACTCATGAGTTCTGAAAGTAGTCA

[0343] SEQ ID NO: 37

[0344] -ATCACCGCATCCAGTCTACTTCTGGGAGCGCCACA

[0345] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 39.

[0346] SEQ ID NO: 38

[0347] -TCTCGAATATCCAGTAGAAACATCCCAGCGCTACT

[0348] SEQ ID NO: 39

[0349] -ACTTTCAGAACTCATGAGTGTTTCCTTTCGTTGGG

[0350] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and glf gene fragment using the Gibson assembly method, and named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-glf. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24-Pcj7-glf vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-glf gene inserted was obtained. The corresponding genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (capable of amplifying the outer regions of the upstream and downstream homologous recombination sites of the corresponding gene, respectively). The strain obtained in this way was named CM05-9841.

[0351] SEQ ID NO: 40

[0352] - AACAACACCACATCTACATC

[0353] SEQ ID NO: 41

[0354] - CAGCCTTTTCCAGCACCA

[0355] Example 4-4. Construction of Corynebacterium microorganisms incorporating the iolT1 gene from Corynebacterium glutamicum.

[0356] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the iolT1 gene (SEQ ID NO:42), encoding a non-PTS sugar uptake protein derived from Corynebacterium glutamicum selected in Example 4-1, was introduced. Information on the corresponding gene and its surrounding base sequence (CP016335.1) was obtained from NIH GenBank. To amplify the iolT1 gene based on the obtained base sequence, PCR was performed in the same manner as in Example 1, using chromosomal DNA of the Corynebacterium glutamicum strain as a template and primers of SEQ ID NO:43 and SEQ ID NO:44. As a result, a 1506 bp DNA fragment containing 1476 bpiolT1 gene was obtained.

[0357] SEQ ID NO: 43

[0358] -CGAAAGGAAACACTCATGGCTAGTACCTTCATTCAGGC

[0359] SEQ ID NO: 44

[0360] -ATCACCGCATCCAGTTTAGTGCACCTTTCCTTTTCG

[0361] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 45.

[0362] SEQ ID NO: 45

[0363] - GAAGGTACTAGCCATGAGTGTTTCCTTTCGTTGGG

[0364] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and iolT1 gene fragment using the Gibson assembly method, and named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-iolT1. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24-Pcj7-iolT1 vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-iolT1 gene inserted was obtained. The corresponding genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which can amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding gene, respectively). The strain obtained in this way was named CM05-9842.

[0365] Examples 4-5. Construction of Corynebacterium microorganisms incorporating the ffz1 gene from *Zygosacchariformis*.

[0366] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the ffz1 gene (SEQ ID NO: 46) encoding a non-PTS sugar uptake protein derived from *Zygosacchariformis* selected in Example 4-1 was introduced. Information on the gene encoding the membrane protein and its surrounding base sequence (AJ515522.1) was obtained from NIH GenBank. To amplify the ffz1 gene based on the obtained base sequence, PCR was performed using chromosomal DNA of the *Zygosacchariformis* strain as a template and primers of SEQ ID NO: 47 and SEQ ID NO: 48, in the same manner as in Example 1. As a result, a 1884 bp DNA fragment containing the 1854 bp ffz1 gene was obtained.

[0367] SEQ ID NO: 47

[0368] -CGAAAGGAAACACTCATGGTTAAGATAGACGCTTC

[0369] SEQ ID NO: 48

[0370] - ACAATCACCGCATCCAGTTTTATTCATCATCATGCT

[0371] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 49.

[0372] SEQ ID NO: 49

[0373] -GTCTATCTTAACCATGAGTGTTTCCTTTCGTTGGG

[0374] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and ffz1 gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-ffz1. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_12045-BBD29_12055::Pcj7-ffz1 vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-ffz1 gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding gene, respectively). The strain thus obtained was named CM05-9843.

[0375] Examples 4-6. Construction of Corynebacterium microorganisms incorporating the frt1 gene from Kluyveromyces lactis.

[0376] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the frt1 gene (SEQ ID NO: 50), encoding a non-PTS sugar uptake protein derived from *Kluyveromyces lactis* selected in Example 4-1, was introduced. Information on the gene encoding the membrane protein and its surrounding base sequence (NC_006041.1) was obtained from NIH GenBank. To amplify the frt1 gene based on the obtained base sequence, PCR was performed using chromosomal DNA of the *Kluyveromyces lactis* strain as a template and primers of SEQ ID NO: 51 and SEQ ID NO: 52, in the same manner as in Example 1. As a result, a 1731 bp DNA fragment containing the 1701 bp frt1 gene was obtained.

[0377] SEQ ID NO: 51

[0378] -CGAAAGGAAACACTCATGTCTAGTAATCTGTCTGA

[0379] SEQ ID NO: 52

[0380] -ATCACCGCATCCAGTTTAAATAGATTTACGGTTAC

[0381] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 53.

[0382] SEQ ID NO: 53

[0383] - CAGATTACTAGACATGAGTGTTTCCTTTCGTTGGG

[0384] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and frt1 gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-frt1. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_12045-BBD29_12055::Pcj7-frt1 vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain containing one copy of the Pcj7-frt1 gene was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9844.

[0385] Examples 4-7. Construction of Corynebacterium microorganisms incorporating the hxt6 gene from Saccharomyces cerevisiae.

[0386] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the hxt6 gene (SEQ ID NO: 54), encoding a non-PTS sugar uptake protein derived from *Saccharomyces cerevisiae* selected in Example 4-1, was introduced. Information on the gene encoding the membrane protein and its surrounding base sequence (NC_001136.10) was obtained from NIH GenBank. To amplify the hxt6 gene based on the obtained base sequence, PCR was performed using chromosomal DNA of the *Saccharomyces cerevisiae* strain as a template and primers of SEQ ID NO: 55 and SEQ ID NO: 56, in the same manner as in Example 1. As a result, a 1743 bp DNA fragment containing the 1713 bp hxt6 gene was obtained.

[0387] SEQ ID NO: 55

[0388] -CGAAAGGAAACACTCATGTCACAAGACGCTGCTAT

[0389] SEQ ID NO: 56

[0390] -ATCACCGCATCCAGTTTTATTTGGTGCTGAACATTC

[0391] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 57.

[0392] SEQ ID NO: 57

[0393] - AGCGTCTTGTGACATGAGTGTTTCCTTTCGTTGGG

[0394] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and hxt6 gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-hxt6. Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_12045-BBD29_12055::Pcj7-hxt6 vector was transformed into the CM05-9837 strain constructed in Example 2-1 by electroporation. After a second exchange process, a strain containing one copy of the Pcj7-hxt6 gene was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9845.

[0395] Examples 4-8. Construction of Corynebacterium microorganisms incorporating the fsy1 gene from Zygomyces rouxii.

[0396] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the fsy1(zro) gene (SEQ ID NO: 58), encoding a non-PTS sugar uptake protein derived from *Zygosacchariformis* selected in Example 4-1, was introduced. Information on the gene encoding the membrane protein and its surrounding base sequence (XM_002495633.1) was obtained from NIH GenBank. To amplify the fsy1(zro) gene based on the obtained base sequence, PCR was performed using chromosomal DNA from the *Sacchariformis* strain as a template and primers from SEQ ID NO: 59 and SEQ ID NO: 60, in the same manner as in Example 1. As a result, a 1725 bp DNA fragment containing the 1695 bp fsy1(zro) gene was obtained.

[0397] SEQ ID NO: 59

[0398] -CGAAAGGAAACACTCATGAAGTTTTCTACTTGGCG

[0399] SEQ ID NO: 60

[0400] -ATCACCGCATCCAGTCTAATAGCTTAGTTTACCTC

[0401] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 61.

[0402] SEQ ID NO: 61

[0403] -AGTAGAAAACTTCATGAGTGTTTCCTTTCGTTGGG

[0404] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and fsy1(zro) gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-fsy1(zro). Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_12045-BBD29_12055::Pcj7-fsy1(zro) vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-fsy1(zro) gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9846.

[0405] Examples 4-9. Construction of Corynebacterium microorganisms incorporating the fsy1 gene from Pasteurella multocida.

[0406] To enhance the fructose uptake capacity of the CM05-9837 strain constructed in Example 2-2, the fsy1(spa) gene (SEQ ID NO: 62) encoding a non-PTS sugar uptake protein derived from *Pasteurella multocida*, selected in Example 4-1, was introduced. Information on the gene encoding the membrane protein and its surrounding base sequence (AJ250992.1) was obtained from NIH GenBank. To amplify the fsy1(spa) gene based on the obtained base sequence, PCR was performed using chromosomal DNA of the *Pasteurella multocida* strain as a template and primers of SEQ ID NO: 63 and SEQ ID NO: 64, in the same manner as in Example 1. As a result, a 1743 bp DNA fragment containing the 1713 bp fsy1(spa) gene was obtained.

[0407] SEQ ID NO: 63

[0408] -CGAAAGGAAACACTCATGTCACATGTTAACGCGTC

[0409] SEQ ID NO: 64

[0410] -ATCACCGCATCCAGTCTAATAGCTCAATTGGCCCT

[0411] To use the CJ7 promoter (SEQ ID NO: 14, US 7,662,943 B2) derived from Corynebacterium tarda, PCR was performed in the same manner as in Example 1, using Corynebacterium tarda genomic DNA as a template and primers of SEQ ID NO: 38 and SEQ ID NO: 65.

[0412] SEQ ID NO: 65

[0413] - GTTAACATGTGACATGAGTGTTTCCTTTCGTTGGG

[0414] After treating the pDC24ΔBBD29_12045-BBD29_12055 vector constructed in Example 4-2 with the restriction enzyme ScaI, a recombinant plasmid was obtained by cloning the amplified CJ7 promoter region and fsy1(spa) gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔBBD29_12045-BBD29_12055::Pcj7-fsy1(spa). Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔBBD29_12045-BBD29_12055::Pcj7-fsy1(spa) vector was transformed into the CM05-9837 strain constructed in Example 2-2 by electroporation. After a second exchange process, a strain with one copy of the Pcj7-fsy1(spa) gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 4 and SEQ ID NO: 41 (which amplify the outer regions of the upstream and downstream homologous recombination sites of the corresponding genes, respectively). The strain thus obtained was named CM05-9847.

[0415] Example 5. Evaluation of sugar utilization / L-tryptophan production capacity of Corynebacterium microorganisms with non-PTS sugar transporters derived from various microorganisms.

[0416] To verify the L-tryptophan production capacity and fructose utilization of the strains constructed in Example 4, the strains were cultured and evaluated using the following method. Each strain was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of seed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of mixed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. After incubation, the L-tryptophan yield was determined by HPLC.

[0417] Seed culture medium (pH 7.0)

[0418] 20 g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 100 μg biotin, 1000 μg thiamine hydrochloride, 2000 μg calcium pantothenate, and 2000 μg nicotinamide (per 1 L distilled water).

[0419] [Fructose / glucose mixed medium (pH 7.0)]

[0420] 15 g fructose, 15 g glucose, 15 g (NH4)2SO4, 1.2 g MgSO4·7H2O, 1 g KH2PO4, 5 g yeast extract, 900 μg biotin, 4500 μg thiamine hydrochloride, 4500 μg calcium pantothenate, and 30 μg CaCO3 (per L distilled water).

[0421] [Table 4]

[0422] Comparison of glucose and fructose utilization and L-tryptophan production capacity (20 hours) of L-tryptophan-producing strains derived from Corynebacterium glutamicum ATCC 13869 with introduced fructose utilization factors.

[0423]

[0424] Based on the strain constructed in Example 4, the strains were cultured in a mixed glucose and fructose medium. The results, as shown in Table 4 above, confirmed that the parental strain CM05-9837 consumed most of the glucose but exhibited low fructose consumption capacity. However, the CM05-9841 strain, which incorporated a non-PTS sugar uptake protein from *Fermentomonas motilityis*, showed approximately 4.7 times higher fructose consumption capacity than the parental strain and demonstrated the highest tryptophan production rate. These results confirm that among the seven types of exogenous non-PTS fructose uptake factors, *Fermentomonas motilityis*-derived glf is the most effective, and when combined with cscK, it increases tryptophan production while maximally improving sugar uptake capacity.

[0425] Example 6. Evaluation of sugar utilization / L-histidine production capacity of Corynebacterium microorganisms with the cscK gene introduced from Escherichia coli and the glf gene introduced from Fermentomonas spp.

[0426] Example 6-1. Construction of histidine-producing strains

[0427] To evaluate L-histidine production capacity, the Corynebacterium glutamicum strain CJH1 was constructed.

[0428] Specifically, to relieve feedback inhibition of the HisG protein (the first enzyme in the L-histidine biosynthesis pathway), the amino acids at positions 233 and 235 of the N-terminus of HisG were replaced with histidine (glycine) and glutamine (threonine) (SEQ ID NO: 66) (ACS Synth. Biol., 2014, 3 (1), pp 21-29), respectively. Furthermore, to enhance the activity of the hisE gene present in operons such as hisG, the start codon was replaced with ATG instead of GTG. Additionally, to enhance the L-histidine biosynthesis pathway, the promoters of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB were replaced with strong promoters, and additional copies of the hisE(g1a)G(G233H / T235Q) and hisD genes were introduced to enhance the corresponding pathways.

[0429] Example 6-1-1. Production of histidine-producing strains that relieve feedback inhibition

[0430] To construct a histidine-producing strain free from feedback inhibition, PCR was performed using chromosomal DNA from *Corynebacterium glutamicum* ATCC 13032, in the same manner as in Example 1. Primers SEQ ID NO: 67 and SEQ ID NO: 68 were used to obtain the left homologous arm fragment of 'hisE(g1a)G(G233H / T235Q)', and primers SEQ ID NO: 69 and SEQ ID NO: 70 were used to obtain the right homologous arm fragment of 'hisE(g1a)G(G233H / T235Q)'. Using these two amplified DNA fragments as templates and primers SEQ ID NO: 67 and SEQ ID NO: 70, PCR was performed in the same manner as in Example 1 to obtain the 'hisE(g1a)G(G233H / T235Q)' gene fragment. In addition, using ATCC13032 chromosomal DNA as a template, PCR was performed using primers SEQ ID NO: 71 and 72 to obtain the upstream region of the hisE gene.

[0431] SEQ ID NO: 67

[0432] - gaggagatcaaaacaATGAAGACATTTGAC

[0433] SEQ ID NO: 68

[0434] - AGTGGGGATACCTGTGGGTGGGATAAGCCT

[0435] SEQ ID NO: 69

[0436] - GGCTTATCCCACCCACAGGTATCCCCACTG

[0437] SEQ ID NO: 70

[0438] -ACTCTAGAGGATCCCCCTAGATGCGGGC

[0439] SEQ ID NO: 71

[0440] -TCGAGCTCGGTACCCACCGAACTCCTGACAGAGT

[0441] SEQ ID NO: 72

[0442] - acatgaagcgccTCGGTACATTCTTCCACA

[0443] To replace the promoter with a strong promoter, PCR was performed using the synthesized Pspl13 promoter (SEQ ID NO: 73, US 10,584,338 B2) as a template and primers SEQ ID NO: 74 and SEQ ID NO: 75, in the same manner as in Example 1.

[0444] SEQ ID NO: 74

[0445] -AAGAATGTACCGAggcgcttcatgtcaaca

[0446] SEQ ID NO: 75

[0447] - CAAATGTCTTCATtgttttgatctcctcca

[0448] After treating the pDC24 vector with the restriction enzyme SmaI, a recombinant plasmid was obtained by cloning the upstream DNA fragment of the hisE gene, the Pspl13 promoter region, and the hisEG(G233H / T235Q) gene fragment using the Gibson assembly method. This plasmid was named pDC24ΔPn_hisEG::Pspl13_hisEG(G233H / T235Q). Gibson cloning was performed in the same manner as in Example 1. The constructed pDC24ΔPn_hisEG::Pspl13_hisEG(G233H / T235Q) vector was transformed into *Corynebacterium glutamicum* ATCC 13032 by electroporation. After a second exchange process, a strain was obtained in which feedback inhibition was alleviated by introducing a mutation into the native hisE gene, and hisE activity was enhanced by replacing the start codon of the hisE gene. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 76 and SEQ ID NO: 77. The strain obtained in this way was named CJ-HIS1.

[0449] SEQ ID NO: 76

[0450] - AGCTTTTCGACGAATCCC

[0451] SEQ ID NO: 77

[0452] - CTGCCTCTCACAAGTTGAAG

[0453] Example 6-1-2. Production of histidine-producing strains with enhanced biosynthetic pathways via promoter substitution

[0454] Next, in order to enhance the activity of the biosynthetic genes hisN, hisH, hisD, hisA, and hisB, plasmids were constructed as follows, replacing the wild-type promoter of each gene with a strong promoter.

[0455] Specifically, in the same manner as in Example 1, PCR was performed using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template and primers of SEQ ID NO: 78 and SEQ ID NO: 79, SEQ ID NO: 80 and SEQ ID NO: 81, SEQ ID NO: 82 and SEQ ID NO: 83, SEQ ID NO: 84 and SEQ ID NO: 85, SEQ ID NO: 86 and SEQ ID NO: 87 to obtain upstream fragments of the hisN, hisH, hisD, hisA and hisB genes, respectively.

[0456] SEQ ID NO: 78

[0457] - TCGAGCTCGGTACCCATTGGTGCTCGGCGC

[0458] SEQ ID NO: 79

[0459] - tgggatgtttctGTGTTGTTAGTCTAGTG

[0460] SEQ ID NO: 80

[0461] - TCGAGCTCGGTACCCAACCAAGTTTAGATGCGCC

[0462] SEQ ID NO: 81

[0463] - gctgggatgtttctGCCGATAGTTTATGTCA

[0464] SEQ ID NO: 82

[0465] - TCGAGCTCGGTACCCGGTGACAGCTCGCGCCGCAT

[0466] SEQ ID NO: 83

[0467] - gcgctgggatgtttctGGCGAAAAGTTCTCCC

[0468] SEQ ID NO: 84

[0469] - TCGAGCTCGGTACCCTTGATGCCTGCATGAAGG

[0470] SEQ ID NO: 85

[0471] - tgacatgaagcgccGAATATTGATCCTATCT

[0472] SEQ ID NO: 86

[0473] - TTCGAGCTCGGTACCCACCTTCAGCAACCACTC

[0474] SEQ ID NO: 87

[0475] - tgacatgaagcgccGAAAAATTCTTCTCT

[0476] In addition, PCR was performed using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template and primer pairs of SEQ ID NO: 88 and SEQ ID NO: 89, SEQ ID NO: 90 and SEQ ID NO: 91, SEQ ID NO: 92 and SEQ ID NO: 93, SEQ ID NO: 94 and SEQ ID NO: 95, SEQ ID NO: 96 and SEQ ID NO: 97 to obtain the downstream regions of the hisN, hisH, hisD, hisA and hisB genes, respectively.

[0477] SEQ ID NO: 88

[0478] - aaaggaaacactcATGAGCAAATATGCAGACG

[0479] SEQ ID NO: 89

[0480] - CTAGAGGATCCCCCAGCCGGAGAGGGAGGAG

[0481] SEQ ID NO: 90

[0482] - aaaggaaacactcATGACCAAAACTGTCGC

[0483] SEQ ID NO: 91

[0484] -CTAGAGGATCCCCACCTCTGGAGGCGTGGTC

[0485] SEQ ID NO: 92

[0486] - cgaaaggaaacactcATGTTGAATGTCACTGACC

[0487] SEQ ID NO: 93

[0488] - CTAGAGGATCCCCCCGTGCTCAGCCTGAGGAG

[0489] SEQ ID NO: 94

[0490] -ggagatcaaaacaATGACCTTCACTATTCTTCC

[0491] SEQ ID NO: 95

[0492] - CTAGAGGATCCCCACGAAACGTGCACAACCTT

[0493] SEQ ID NO: 96

[0494] - gagatcaaaacaATGACTGTCGCACCA

[0495] SEQ ID NO: 97

[0496] - CTAGAGGATCCCCGGGTCGCGGCCGTAGTGGC

[0497] To replace the endogenous promoters of the hisN, hisH, and hisD genes with the strong Pcj7 promoter (SEQ ID NO: 14, US 7,662,943 B2), PCR was performed using genomic DNA of Corynebacterium tarda as a template and primers of SEQ ID NO: 98 and SEQ ID NO: 99, SEQ ID NO: 100 and SEQ ID NO: 101, SEQ ID NO: 102, and SEQ ID NO: 103, in the same manner as in Example 1.

[0498] SEQ ID NO: 98

[0499] -ACTAGACTAACAACACagaaacatcccagcgc

[0500] SEQ ID NO: 99

[0501] - TCTGCATATTTGCTCATgagtgtttccttt

[0502] SEQ ID NO: 100

[0503] - ACATAAACTATCGGCagaaacatcccagcgcta

[0504] SEQ ID NO: 101

[0505] - GACAGTTTTGGTCATgagtgtttcctttcg

[0506] SEQ ID NO: 102

[0507] - GAGAACTTTTCGCCagaaacatcccagcgct

[0508] SEQ ID NO: 103

[0509] -AGTGACATTCAACATgagtgtttcctttcg

[0510] In addition, to replace the endogenous promoters of the hisA and hisB genes with the strong Pspl13 promoter (SEQ ID NO: 73, US 10,584,338 B2), PCR was performed using the Pspl13 promoter as a template and primers of SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, and SEQ ID NO: 107 in the same manner as in Example 1.

[0511] SEQ ID NO: 104

[0512] -AGGATCAATATTCggcgcttcatgtcaac

[0513] SEQ ID NO: 105

[0514] - GAATAGTGAAGGTCATtgttttgatctcct

[0515] SEQ ID NO: 106

[0516] -GAGAAGAATTTTTCggcgcttcatgtcaa

[0517] SEQ ID NO: 107

[0518] - TGGTGCGACAGTCATtgttttgatctcct

[0519] After treating the pDC24 vector with the restriction enzyme SmaI, recombinant plasmids were obtained by cloning the upstream DNA fragments of the hisN, hisH, and hisD genes, the Pcj7 promoter fragment, and the downstream DNA fragments of the hisN, hisH, and hisD genes using the Gibson assembly method. These plasmids were named pDC24ΔPn::Pcj7_hisN, pDC24ΔPn::Pcj7_hisH, and pDC24ΔPn::Pcj7_hisD, respectively. Similarly, after treating the pDC24 vector with the restriction enzyme SmaI, recombinant plasmids were obtained by cloning the upstream DNA fragments of the hisA and hisB genes, the Pspl13 promoter fragment, and the downstream DNA fragments of the hisA and hisB genes using the Gibson assembly method. These plasmids were named pDC24ΔPn::Pspl13_hisA and pDC24ΔPn::Pspl13_hisB, respectively. Gibson cloning was performed in the same manner as in Example 1.

[0520] The constructed pDC24ΔPn::Pcj7_hisN vector was transformed into the CJ-HIS1 strain constructed in Example 6-1-1 via electroporation. After a second exchange process, a strain was obtained in which the natural hisN gene was enhanced by replacing its promoter. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 108 and SEQ ID NO: 109. The strain thus obtained was named CJ-HIS2.

[0521] SEQ ID NO: 108

[0522] - GAGCATGCATCAAAG

[0523] SEQ ID NO: 109

[0524] - AGAAATTTGATCCTTATAA

[0525] Subsequently, the constructed pDC24ΔPn::Pcj7_hisH vector was transformed into the aforementioned CJ-HIS2 strain via electroporation. After a second exchange process, a strain was obtained in which the native hisH gene was enhanced by replacing its promoter. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 110 and SEQ ID NO: 111. The strain thus obtained was named CJ-HIS3.

[0526] SEQ ID NO: 110

[0527] - TTGAGAGATGCTTATCG

[0528] SEQ ID NO: 111

[0529] - CACTTCAGTGCGGATTCCAA

[0530] Subsequently, the constructed pDC24ΔPn::Pcj7_hisD vector was transformed into the aforementioned constructed CJ-HIS3 strain via electroporation. After a second exchange process, a strain was obtained in which the native hisD gene was enhanced by replacing its promoter. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 112 and SEQ ID NO: 113. The strain thus obtained was named CJ-HIS4.

[0531] SEQ ID NO: 112

[0532] - AGCGGGTTTAATTCAGG

[0533] SEQ ID NO: 113

[0534] - GTGGGTAAGGGTTTTCGT

[0535] Subsequently, the constructed pDC24ΔPn::Pspl13_hisA vector was transformed into the aforementioned constructed CJ-HIS4 strain via electroporation. After a second exchange process, a strain was obtained in which the natural hisA gene was enhanced by replacing its promoter. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 114 and SEQ ID NO: 115. The strain thus obtained was named CJ-HIS5.

[0536] SEQ ID NO: 114

[0537] - CACGAAAATGATCGTTTTG

[0538] SEQ ID NO: 115

[0539] - TATGGGATTCGATGGCCA

[0540] Subsequently, the constructed pDC24ΔPn::Pspl13_hisB vector was transformed into the aforementioned CJ-HIS5 strain via electroporation. After a second exchange process, a strain was obtained in which the natural hisB gene was enhanced by replacing its promoter. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 116 and SEQ ID NO: 117. The strain thus obtained was named CJ-HIS6.

[0541] SEQ ID NO: 116

[0542] - TGTGGGAATCGCTGGGCAC

[0543] SEQ ID NO: 117

[0544] - CGGTCGCCCGCATCTG

[0545] Example 6-1-3. Generation of histidine-producing strains with enhanced biosynthetic pathways through additional gene insertion.

[0546] To additionally insert the 'hisE(g1a)G(G233H / T235Q)' and hisD genes, NCgl1021, known as a gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site. Specifically, to construct vectors for NCgl1021 deletion and target gene insertion, PCR was performed using the chromosome of ATCC13032 as a template and primer pairs SEQ ID NO: 118 and SEQ ID NO: 119 and SEQ ID NO: 120 and SEQ ID NO: 121, in the same manner as in Example 1, to amplify the left homologous arm region and the right homologous arm region of NCgl1021, respectively.

[0547] SEQ ID NO: 118

[0548] - TTCGAGCTCGGTACCCATGAAGTCTACCGGC

[0549] SEQ ID NO: 119

[0550] -gacatgaagcgccGACATCTAATAACCGGG

[0551] SEQ ID NO: 120

[0552] - CCGACGAGGCCTAAGAACTCATTCCTTCTGCT

[0553] SEQ ID NO: 121

[0554] - CTCTAGAGGATCCCCTTAGAGTGCATTGATC

[0555] In the same manner as in Example 1, the pDC24ΔPn::Pspl13_hisEG(G233H / T235Q) vector constructed in Example 6-1-1 was used as a template and primers of SEQ ID NO: 122 and SEQ ID NO: 123 were used for PCR to obtain the 'Pspl13_hisE(g1a)G(G233H / T235Q)' gene fragment.

[0556] In addition, PCR was performed using the Pcj7_hisD vector constructed in Example 6-1-2 as a template and primers of SEQ ID NO: 124 and SEQ ID NO: 125 in the same manner as in Example 1, thereby obtaining the 'Pcj7_hisD' gene fragment.

[0557] SEQ ID NO: 122

[0558] - CCGGTTATTAGATGTCggcgcttcatgtca

[0559] SEQ ID NO: 123

[0560] - ggatgtttctCTAGATGCGGGCGAT

[0561] SEQ ID NO: 124

[0562] - GCCCGCATCTAGagaaacatcccagcgct

[0563] SEQ ID NO: 125

[0564] - AGAAGGAATGAGTTCTTAGGCCTCGTCGG

[0565] After treating the pDC24 vector with the restriction enzyme SmaI, the left homologous arm region and the right homologous arm region of NCgl1021, as well as the gene fragments 'Pspl13_hisEG(G233H / T235Q)' and 'Pcj7_hisD', of the amplified NCgl1021 were cloned using the Gibson assembly method to obtain a recombinant plasmid, which was named 'pDC24ΔNCgl1021::Pspl13_hisEG(G233H / T235Q)-Pcj7_hisD'. Gibson cloning was performed in the same manner as in Example 1. After transforming the CJ-HIS6 strain constructed in Example 6-1-2 into the constructed vector 'pDC24ΔNCgl1021:: Pspl13_hisEG(G233H / T235Q)-Pcj7_hisD' via electroporation and undergoing a second crossover process, a strain with an enhanced histidine biosynthetic pathway was obtained through the insertion of additional genes. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 126 and SEQ ID NO: 127. The strain thus obtained was named CJH1.

[0566] SEQ ID NO: 126

[0567] - CTTTCAGCTTTCCCTCCCG

[0568] SEQ ID NO: 127

[0569] - GCTGTACTTTTAGTACA

[0570] Example 6-2. Construction of a transformant strain in which the cscK (E.co) gene and glf (Z.mo) gene have been introduced into a histidine-producing strain.

[0571] To determine whether introducing a combination of the cscK (E.co) and glf (Z.mo) genes into a glutamic acid-producing Corynebacterium strain capable of producing L-histidine has the effect of increasing histidine production capacity, a strain was constructed in which the fructose-introducing ptsF gene was deleted from the histidine-producing strain CJH1 constructed in Example 6-1 above, and the cscK gene derived from Escherichia coli and the glf gene derived from Fermentomonas motilityis were introduced.

[0572] Specifically, PCR was performed using Corynebacterium glutamicum ATCC13032 chromosomal DNA as a template and primer pairs SEQ ID NO: 128 and SEQ ID NO: 129, and SEQ ID NO: 130 and SEQ ID NO: 131, in the same manner as in Example 1. As a result, DNA fragments of 807 bp and 837 bp for ptsF gene deletion were obtained, respectively.

[0573] SEQ ID NO: 128

[0574] -ATTCGAGCTCGGTACCCCCTGGCGGGCTCGCTGCC

[0575] SEQ ID NO: 129

[0576] - agcgctgggatgtttctTGACCAGGAACGCCGGTGCCGGACT

[0577] SEQ ID NO: 130

[0578] - TGGCGCTCCCAGAAGTAGTCTTCGTGGTCTGGGC

[0579] SEQ ID NO: 131

[0580] -ACTCTAGAGGATCCCCATTTCTAGGCCCGCA

[0581] PCR was performed using the vector 'pDC24ΔBBD29_02180-BBD29_02200:: Pcj7-csck' constructed in Examples 2-2 as a template and primers of SEQ ID NO: 132 and SEQ ID NO: 133, in the same manner as in Example 1.

[0582] As a result, a 1270 bp DNA fragment containing a 1233 bp 'Pcj7-csck' gene fragment was obtained.

[0583] SEQ ID NO: 132

[0584] - CCGGCACCGGCGTTCCTGGTCAagaaacatcccagcgcta

[0585] SEQ ID NO: 133

[0586] - CGCTGGGATGTTTCTCTATTCCAGTTCTTGTCGACATGGC

[0587] PCR was performed using the vector 'pDC24ΔBBD29_12045-BBD29_12055:: Pcj7-glf' constructed in Examples 4-3 as a template and primers of SEQ ID NO: 134 and SEQ ID NO: 135, in the same manner as in Example 1.

[0588] As a result, a 1767 bp DNA fragment containing a 1740 bp 'Pcj7-glf' gene fragment was obtained.

[0589] SEQ ID NO: 134

[0590] - CAAGAACTGGAATAGAGAAACATCCCAGCGCT

[0591] SEQ ID NO: 135

[0592] - AGACCACGAAGACTACTTCTGGGAGCGCC

[0593] Each obtained DNA product was purified using a PCR purification kit, and the purified amplification product and the chromosome transformation vector pDC24 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, named 'pDC24ΔptsF::Pcj7-csck-Pcj7-glf'. Gibson cloning was performed in the same manner as in Example 1.

[0594] The constructed pDC24ΔptsF::Pcj7-csck-Pcj7-glf vector was transformed into the histidine-producing CJH1 strain via electroporation. After a second exchange process, a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NO: 136 and SEQ ID NO: 137. The strain thus obtained was named 'CJH1ΔptsF::Pcj7-csck-Pcj7-glf'.

[0595] SEQ ID NO: 136

[0596] - CAACAAGAACGTCCGCACC

[0597] SEQ ID NO: 137

[0598] - TCGAGATCCGTGGGCACTC

[0599] Example 6-3. Evaluation of histidine production capacity of the transformant strain

[0600] To verify the L-histidine production and fructose utilization capabilities of the strains constructed in the above examples, they were cultured and evaluated using the following method. Each strain was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing less than 25 mL of seed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of production culture medium and cultured at 30°C with shaking at 200 rpm for 48 hours.

[0601] [Seed culture medium (pH 7.0)]

[0602] 5% glucose, 1% bacterial peptone, 0.25% sodium chloride, 1% yeast extract, and 0.4% urea (based on 1 liter of distilled water)

[0603] [Production medium (pH 7.0)]

[0604] Glucose 3%, fructose 3%, ammonium sulfate 2%, potassium dihydrogen phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, CSL (corn steep liquor) 2.0%, biotin 200 µg / L and calcium carbonate 30 g / L (per liter of distilled water)

[0605] [Table 5]

[0606] Compare the glucose and fructose utilization capacity and L-histidine production capacity (48 hours) of L-histidine-producing strains derived from Corynebacterium glutamicum ATCC 13032 that have been introduced with fructose utilization factors.

[0607]

[0608] As shown in the table above, the introduction of the cscK gene from *E. coli* and the glf gene from *Fermentomonas motilityis* confirmed that histidine production increased. Based on the above, it was found that the combination of the cscK and glf genes is effective in increasing L-histidine production.

[0609] Example 7. Evaluation of sugar utilization / L-lysine production capacity of Corynebacterium microorganisms with the cscK gene introduced from Escherichia coli and the glf gene introduced from Fermentomonas spp.

[0610] Example 7-1. Construction of a transformant strain in which the cscK (E.co) gene and glf (Z.mo) gene have been introduced into a lysine-producing strain.

[0611] To determine whether introducing a combination of the cscK (E.co) and glf (Z.mo) genes into a Corynebacterium glutamicum strain capable of producing L-lysine increases lysine production capacity, a strain was constructed in which the fructose-introducing ptsF gene was deleted from the lysine-producing KCCM11016P strain (US 9,938,546 B2), and the cscK gene derived from Escherichia coli and the glf gene derived from Fermentomonas motilityis were introduced.

[0612] Specifically, the pDC24ΔptsF::Pcj7-csck-Pcj7-glf vector prepared in Example 6-2 was transformed into the lysine-producing strain KCCM11016P via electroporation. After a second exchange process, a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 136 and SEQ ID NO: 137 (capable of amplifying the outer regions of the upstream and downstream homologous recombination sites of the inserted gene, respectively). The strain thus obtained was named 'KCCM11016PΔptsF::Pcj7-csck-Pcj7-glf'.

[0613] Example 7-2. Evaluation of the lysine production capacity of the transformant strain

[0614] To verify the L-lysine production and fructose utilization capabilities of the strains constructed in the above examples, they were cultured and evaluated using the following method. Each strain was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing less than 25 mL of seed culture medium and cultured at 37°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 24 mL of production culture medium and cultured at 37°C with shaking at 200 rpm for 42 hours.

[0615] [Seed culture medium (pH 7.0)]

[0616] 20 g crude sugar, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 0.1 mg biotin, 1 mg thiamine hydrochloride, 22 mg calcium pantothenate, and 2 mg nicotinamide (based on 1 liter of distilled water).

[0617] [Production medium (pH 7.0)]

[0618] Glucose 22.5 g, fructose 22.5 g, (NH4)2SO4 30 g, soy protein 10 g, 50% molasses 10 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, biotin 0.9 mg, thiamine hydrochloride 4.5 mg, calcium pantothenate 4.5 mg, nicotinamide 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, and CCaCO3 30 g (based on 1 liter of distilled water)

[0619] [Table 6]

[0620] Compare the glucose and fructose utilization capacity and L-lysine production capacity (42 hours) of L-lysine-producing strains derived from Corynebacterium glutamicum ATCC13032 that have been introduced with fructose utilization factors.

[0621]

[0622] As shown in the table above, lysine production increased when the cscK gene from *E. coli* and the glf gene from *Fermentomonas motilityis* were introduced. This demonstrates that the combination of the cscK and glf genes is effective in increasing L-lysine production.

[0623] Example 8. Evaluation of sugar utilization / L-threonine production capacity of Corynebacterium microorganisms with the cscK gene introduced from Escherichia coli and the glf gene introduced from Fermentomonas spp.

[0624] Example 8-1. Construction of a transformant strain in which the cscK (E.co) gene and glf (Z.mo) gene have been introduced into a threonine-producing strain.

[0625] To determine whether introducing a combination of the cscK (E.co) and glf (Z.mo) genes into a glutamate-producing Corynebacterium strain capable of L-threonine production increases threonine production capacity, a strain was constructed in which the fructose-introducing ptsF gene was deleted from the threonine-producing KCCM12120P strain (US 11,236,374 B2), and the cscK gene derived from Escherichia coli and the glf gene derived from Fermentomonas motility were introduced.

[0626] Specifically, the pDC24ΔptsF::Pcj7-csck-Pcj7-glf vector prepared in Example 6-2 was transformed into the threonine-producing strain KCCM12120P via electroporation. After a second exchange process, a strain with one copy of the Pcj7-csck-Pcj7-glf gene inserted was obtained. The genetic manipulation was confirmed by PCR and genome sequencing using primers SEQ ID NO: 136 and SEQ ID NO: 137 (capable of amplifying the outer regions of the upstream and downstream homologous recombination sites of the inserted gene, respectively). The strain thus obtained was named 'KCCM12120PΔptsF::Pcj7-csck-Pcj7-glf'.

[0627] Example 8-2. Evaluation of threonine production capacity of the transformant strain

[0628] To verify the L-threonine production capacity and fructose utilization capacity of the strains constructed in the above examples, they were cultured and evaluated using the following method. Each strain was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 25 mL of seed culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL Erlenmeyer flask with a corner baffle containing 24 mL of production culture medium and cultured at 30°C with shaking at 200 rpm for 20 hours.

[0629] [Seed culture medium (pH 7.0)]

[0630] 20 g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 100 μg biotin, 1000 μg thiamine hydrochloride, 2000 μg calcium pantothenate, and 2000 μg nicotinamide (per 1 L distilled water).

[0631] [Production medium (pH 7.0)]

[0632] 15 g glucose, 15 g fructose, 2 g KH2PO4, 3 g urea, 40 g (NH4)2SO4, 2.5 g peptone, 5 g CSL (Sigma) (10 mL), 0.5 g MgSO4·7H2O, 400 mg leucine, and 20 g CaCO3 (based on 1 liter of distilled water).

[0633] [Table 7]

[0634] Compare the glucose and fructose utilization capacity and L-threonine production capacity (48 hours) of L-threonine-producing strains derived from Corynebacterium glutamicum ATCC13032 that have been introduced with fructose utilization factors.

[0635]

[0636] As shown in the table above, the introduction of the cscK gene from *E. coli* and the glf gene from *Fermentomonas motilityis* confirmed that threonine production increased. Based on the above, it was found that the combination of the cscK and glf genes is effective in increasing L-threonine production.

[0637] Example 9. Evaluation of L-amino acid production capacity of Corynebacterium microorganisms incorporating the cscK gene variant from Escherichia coli and the glf gene from Fermentomonas genus.

[0638] Example 9-1. Vector Construction

[0639] To determine whether introducing a combination of the variant cscK gene (cscK_W79C or cscK_W79C / A181V) and the glf(Z.mo) gene into a strain of Corynebacterium glutamicum capable of producing L-amino acids would increase amino acid production capacity, a vector was constructed to introduce a cscK gene variant derived from Escherichia coli.

[0640] Specifically, PCR was performed in the same manner as in Example 1, using the vector 'pDC24ΔBBD29_02180-BBD29_02200:: Pcj7-csck' constructed in Examples 2-2 as a template and primer pairs SEQ ID NO: 141 and SEQ ID NO: 142, as well as primer pairs SEQ ID NO: 143 and SEQ ID NO: 144. Overlap PCR was then performed again using a mixture of the two obtained fragments as a template and primer pairs SEQ ID NO: 141 and SEQ ID NO: 144. As a result, a DNA fragment for introducing the variant csck(W79C, E.co) (SEQ ID NO: 147) was obtained.

[0641] In addition, PCR was performed in the same manner as in Example 1, using the vector 'pDC24ΔBBD29_02180-BBD29_02200:: Pcj7-csck' constructed in Examples 2-2 as a template and primer pairs SEQ ID NO: 141 and SEQ ID NO: 142, SEQ ID NO: 143 and SEQ ID NO: 145, and SEQ ID NO: 146 and SEQ ID NO: 144. Overlap PCR was then performed again using a mixture of the three obtained fragments as a template and primer pairs SEQ ID NO: 141 and SEQ ID NO: 144, resulting in a DNA fragment for introducing the variant cscK(W79C / A181V, E.co) (SEQ ID NO: 148).

[0642] SEQ ID NO: 141

[0643] -TCGAGCTCGGTACCCccaccacctaaaaat

[0644] SEQ ID NO: 142

[0645] -CGTGGATGTCCGGTGACATTCATCTTGCTT

[0646] SEQ ID NO: 143

[0647] -CTGAAGCAAGATGAATGTCACCGGACATCC

[0648] SEQ ID NO: 144

[0649] -CTCTAGAGGATCCCGATAATTCGTCGCATTTC

[0650] SEQ ID NO: 145

[0651] -AGAGCTTGACGACATCCACCAGTTGTAGCGC

[0652] SEQ ID NO: 146

[0653] -GCGCTACAACTGGTGGATGTCGTCAAGCTCT

[0654] The DNA products obtained were purified using a PCR purification kit, and the purified amplification products and the chromosome transformation vector pDC24 digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain recombinant plasmids, which were named 'pDC24Δcsck(E.co):: csck(W79C, E.co)' and 'pDC24Δcsck(E.co):: csck(W79C / A181V,E.co)', respectively. Gibson cloning was performed in the same manner as in Example 1.

[0655] Example 9-2. Strain Construction

[0656] After the recombinant vectors 'pDC24Δcsck(E.co)::csck(W79C,E.co)' and 'pDC24Δcsck(E.co)::csck(W79C / A181V, E.co)' constructed in Example 9-1 were transformed into the production strains CM05-9841, 'CJH1ΔptsF::Pcj7-csck-Pcj7-glf', 'KCCM11016PΔptsF::Pcj7-csck-Pcj7-glf' and 'KCCM12120PΔptsF::Pcj7-csck-Pcj7-glf' constructed in Examples 4-3, 6-2, 7-1 and 8-1 respectively using the electropulse method... After the second exchange process, strains were obtained in which the wild-type csck(E.co) gene on the chromosome was replaced by the variant csck(W79C,E.co) or csck(W79C / A181V,E.co) gene. These strains were named CM05-9841Δcsck(E.co)::csck(W79C, E.co), CJH1ΔptsF::Pcj7-csck(W79C)-Pcj7-glf, KCCM11016PΔptsF::Pcj7-csck(W79C)-Pcj7-glf, KCCM12120PΔptsF::Pcj7-csck(W79C)-Pcj7-glf, and CM05-9841Δcsck(E.co)::csck(W79C / A181V,E.co) gene. E.co), CJH1ΔptsF::Pcj7-csck(W79C / A181V)-Pcj7-glf, KCCM11016PΔptsF::Pcj7-cs ck(W79C / A181V)-Pcj7-glf and KCCM12120PΔptsF::Pcj7-csck(W79C / A181V)-Pcj7-glf.

[0657] Example 9-3. Production Capacity Evaluation

[0658] To verify the L-amino acid production capacity of the strains produced in the above examples, they were cultured and evaluated in the same manner as in Examples 5, 6-3, 7-2 and 8-2.

[0659] [Table 8]

[0660] Comparison of L-tryptophan production capacity (20 hours) of L-tryptophan-producing strains

[0661]

[0662] [Table 9]

[0663] Comparison of L-histidine production capacity (48 hours) of L-histidine-producing strains

[0664]

[0665] [Table 10]

[0666] Comparison of L-lysine production capacity (42 hours) of L-lysine-producing strains

[0667]

[0668] [Table 11]

[0669] Comparison of L-threonine production capacity (48 hours) of L-threonine-producing strains

[0670]

[0671] As shown in the table above, the introduction of the variant cscK gene from *E. coli* confirmed an increase in amino acid production. The above findings demonstrate that the combination of the variant cscK and the glf gene is effective in increasing L-amino acid production.

[0672] As described above, those skilled in the art will understand that this disclosure may be implemented in other specific forms without departing from the technical spirit or essential characteristics of this disclosure. In this regard, it should be understood that the foregoing embodiments are illustrative in all respects and should not be construed as restrictive. The scope of this disclosure should be interpreted to include the meaning and scope of the appended claims, rather than a detailed description, and all changes or variations derived from equivalent concepts fall within the scope of this disclosure.

Claims

1. A Corynebacterium microorganism that produces L-amino acids, comprising: at least one of the following groups: a fructokinase selected from microorganisms of the Escherichia genus, a polynucleotide encoding the fructokinase, a variant polypeptide of the fructokinase, and a polynucleotide encoding the variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter selected from microorganisms of the Fermentomonas genus, and a polynucleotide encoding the non-PTS sugar transporter.

2. The Corynebacterium genus microorganism according to claim 1, wherein the microorganism has increased L-amino acid production capacity compared with unmodified microorganisms.

3. The Corynebacterium genus microorganism according to claim 1, wherein the fructose kinase is encoded by the cscK gene.

4. The Corynebacterium genus microorganism according to claim 1, wherein the fructose kinase is encoded by the cscK gene derived from Escherichia coli.

5. The Corynebacterium genus microorganism according to claim 1, wherein the fructose kinase comprises the amino acid sequence of SEQ ID NO:139 or an amino acid sequence having at least 80% sequence identity with it.

6. The Corynebacterium genus microorganism according to claim 1, wherein the variant polypeptide has an amino acid substitution made with different amino acids at position 79 or 181 corresponding to SEQ ID NO:

139.

7. The Corynebacterium genus microorganism according to claim 6, wherein the variant polypeptide has an amino acid substitution with cysteine ​​at position 79 corresponding to SEQ ID NO: 139, or an amino acid substitution with valine at position 181 corresponding to SEQ ID NO: 139, or a combination thereof.

8. The Corynebacterium genus microorganism according to claim 6, wherein the variant polypeptide comprises the amino acid sequence of SEQ ID NO: 147 or an amino acid sequence having at least 80% sequence identity therewith; or the amino acid sequence of SEQ ID NO: 148 or an amino acid sequence having at least 80% sequence identity therewith.

9. The Corynebacterium genus microorganism according to claim 1, wherein the non-PTS sugar transporter protein has glucose and fructose uptake capabilities.

10. The Corynebacterium genus microorganism according to claim 1, wherein the non-PTS sugar transporter is encoded by the glf gene.

11. The Corynebacterium genus microorganism according to claim 1, wherein the non-PTS sugar transporter is encoded by the glf gene derived from *Morphomonas motiformis*.

12. The Corynebacterium genus microorganism according to claim 1, wherein the non-PTS glycotransporter comprises the amino acid sequence of SEQ ID NO: 140 or an amino acid sequence having at least 80% sequence identity with it.

13. The microorganism according to claim 1, wherein the Corynebacterium genus microorganism is Corynebacterium glutamicum.

14. The Corynebacterium genus microorganism according to claim 1, wherein the Corynebacterium genus microorganism has the ptsF gene deleted.

15. The Corynebacterium genus microorganism according to claim 1, wherein the L-amino acid is at least one selected from the group consisting of L-tryptophan, L-lysine, L-histidine and L-threonine.

16. A composition for producing L-amino acids, comprising the microorganism according to claim 1, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof.

17. A method for producing L-amino acids, comprising culturing a Corynebacterium genus microorganism in a culture medium, said Corynebacterium genus microorganism comprising at least one of the following groups: a fructokinase selected from a microorganism of the Escherichia genus, a polynucleotide encoding the same, a variant polypeptide of said fructokinase, and a polynucleotide encoding said variant polypeptide; and at least one of the following groups: a non-PTS sugar transporter selected from a microorganism of the Fermentomonas genus, and a polynucleotide encoding the same.

18. The method for producing L-amino acids according to claim 17, further comprising recovering L-amino acids from the cultured microorganism, the culture of the microorganism, the fermentation product of the microorganism, or the culture medium.

19. Use of a Corynebacterium microorganism for the production of L-amino acids, wherein said microorganism comprises at least one of the following: a fructokinase selected from a microorganism of the Escherichia genus, a polynucleotide encoding the same, a variant polypeptide of said fructokinase, and a polynucleotide encoding said variant polypeptide; and at least one of the following of a non-PTS sugar transporter selected from a microorganism of the Fermentomonas genus and a polynucleotide encoding the same.