A 3-deoxy-d-arabino-heptulosonic acid-7-phosphate synthetase mutant and use thereof

Abstract

The application discloses a 3-deoxy-D-arabinohexulosonic acid-7-phosphate synthetase mutant and application thereof, and belongs to the field of peptides. The technical problem to be solved by the application is how to improve the ability of a microorganism cell to produce L-tryptophan. The 3-deoxy-D-arabinohexulosonic acid-7-phosphate synthetase mutant provided by the application is a mutant obtained by mutating the glycine residue at the 252th position of an AroG protein with an amino acid sequence shown in SEQ ID NO:1 into one of the following amino acid residues: proline, serine, valine, glutamine, leucine, tyrosine, threonine and asparagine. Compared with the parent enzyme, the AroG protein, the catalytic activity of the 3-deoxy-D-arabinohexulosonic acid-7-phosphate synthetase mutant is significantly improved, and the L-tryptophan synthesis efficiency can be significantly improved. The application can be used for preparing L-tryptophan, and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of peptides, specifically relating to a 3-deoxy-D-arabinoheponic acid-7-phosphate synthase mutant and its application, particularly to a 3-deoxy-D-arabinoheponic acid-7-phosphate synthase mutant and its application in the production of L-tryptophan. Background Technology

[0002] 3-Deoxy-D-arabinoheptulose-7-phosphate synthase (DAHP synthase, EC 2.5.1.54) is a key rate-limiting enzyme in the aromatic amino acid biosynthesis pathway. It catalyzes the condensation of phosphoenolpyruvate and erythrose-4-phosphate to 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP), a crucial first step towards important metabolites such as L-tryptophan. L-tryptophan (chemical formula: C...) 11 H 12 N2O2 (CAS No.: 73-22-3) is an essential amino acid for the human body, widely used in medicine, functional food additives (such as improving sleep and regulating mood), animal feed nutrients, and as a precursor for the synthesis of high-value-added chemicals.

[0003] L-Tryptophan also holds significant value in agriculture and biomedicine. It serves not only as a precursor in the biosynthesis of plant growth regulators (indole-3-acetic acid), participating in the regulation of crop root development and stress resistance, but also, under the influence of gut microbiota, is converted into signaling molecules such as serotonin and melatonin, playing a unique regulatory role in the neuroimmunity and gut health of animals and humans. Currently, the industrial production of L-Tryptophan mainly relies on microbial fermentation, but the screening of high-yield strains and the optimization of metabolic pathways remain limited by the catalytic efficiency of key enzymes. As the first rate-limiting enzyme in the L-Tryptophan synthesis pathway, the activity and feedback inhibition sensitivity of DAHP synthase directly affect the efficiency of carbon allocation to aromatic amino acids. Given the increasing scarcity of petroleum-based raw materials and the growing environmental pollution and high costs associated with chemical synthesis routes, developing DAHP synthases with high catalytic activity and low feedback inhibition sensitivity is crucial for achieving efficient, economical, and sustainable biosynthesis of L-Tryptophan. Therefore, discovering or modifying highly active DAHP synthases is one of the core strategies to overcome the bottlenecks in L-Tryptophan biomanufacturing. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the ability of microbial cells to produce L-tryptophan and / or how to improve the catalytic activity of the parental enzyme 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase—AroG protein.

[0005] The purpose of this invention is to provide 3-deoxy-D-arabinoheptuloate-7-phosphate synthase. Specifically, 3-deoxy-D-arabinoheptuloate-7-phosphate synthase is a mutant obtained by mutating the AroG protein (wild-type parent enzyme) with the amino acid sequence shown in SEQ ID NO: 1 and possessing 3-deoxy-D-arabinoheptuloate-7-phosphate synthase activity.

[0006] This invention first protects proteins. The proteins are selected from at least one of the following: (A1) A mutant containing the amino acid sequence as shown in SEQ ID NO: 1, which is obtained by mutating the glycine residue at position 252 of the AroG protein to the following amino acid residues: proline, serine, valine, glutamine, leucine, tyrosine, threonine and asparagine. (A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the mutant described in (A1).

[0007] Experiments have demonstrated that the protein possesses 3-deoxy-D-arabinoheptuloate-7-phosphate synthase activity, exhibiting enhanced enzyme activity or catalytic activity compared to its parent 3-deoxy-D-arabinoheptuloate-7-phosphate synthase, and significantly improving L-tryptophan synthesis efficiency. This protein is a 3-deoxy-D-arabinoheptuloate-7-phosphate synthase mutant obtained by mutating amino acid position 252 of the AroG protein, as shown in SEQ ID NO: 1.

[0008] The protein may contain K1 or K2. K1) Proteins with amino acid sequences as shown in SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41; K2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in K1).

[0009] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to proline is specifically AroG. G252P The protein, whose amino acid sequence is shown in SEQ ID NO:34.

[0010] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to serine is specifically AroG. G252SThe protein, whose amino acid sequence is shown in SEQ ID NO:35.

[0011] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to valine is specifically AroG. G252V The protein has the amino acid sequence shown in SEQ ID NO:36.

[0012] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to glutamine is specifically AroG. G252Q The protein has the amino acid sequence shown in SEQ ID NO:37.

[0013] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to leucine is specifically AroG. G252L The protein, whose amino acid sequence is shown in SEQ ID NO:38.

[0014] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to tyrosine is specifically AroG. G252Y The protein has the amino acid sequence shown in SEQ ID NO:39.

[0015] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to threonine is specifically AroG. G252T The protein, whose amino acid sequence is shown in SEQ ID NO:40.

[0016] In the embodiments of this application, the mutant obtained by mutating glycine at position 252 of the AroG protein, as shown in SEQ ID NO: 1, to asparagine is specifically AroG. G252N The protein has the amino acid sequence shown in SEQ ID NO:41.

[0017] This invention also protects biological materials. The biological materials are selected from any of the following: B1) Contains a nucleic acid molecule encoding any of the proteins described above; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0018] B1) The nucleic acid molecule may be a DNA molecule or an RNA molecule.

[0019] In the aforementioned biological materials, the nucleic acid molecule B1 may include the following a1), a2), a3), a4), a5), a6), a7), or a8): a1) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 27; a2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 4; a3) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 3; a4) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 29; a5) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 30; a6) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 31; a7) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 32; a8) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 33.

[0020] In the aforementioned biological materials, the B1) nucleic acid molecule may specifically be a1), a2), a3), a4), a5), a6), a7), or a8).

[0021] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 27 is specifically... AroG G252P The gene that encodes AroG G252P protein.

[0022] The DNA molecule with the nucleotide sequence shown in SEQ ID NO:4 is specifically... AroG G252S The gene that encodes AroG G252S protein.

[0023] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 3 is specifically... AroG G252V The gene that encodes AroG G252V protein.

[0024] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 29 is specifically... AroG G252Q The gene that encodes AroG G252Q protein.

[0025] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 30 is specifically... AroG G252L The gene that encodes AroG G252L protein.

[0026] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 31 is specifically... AroG G252Y The gene that encodes AroG G252Y protein.

[0027] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 32 is specifically... AroG G252T The gene that encodes AroG G252T protein.

[0028] The DNA molecule with the nucleotide sequence shown in SEQ ID NO: 33 is specifically... AroG G252N The gene that encodes AroG G252N protein.

[0029] The present invention also protects DNA molecules that have 75% or more identity with the nucleotide sequence of the DNA molecules shown in a1), a2), a3), a4), a5), a6), a7), or a8), and that encode any of the proteins described above.

[0030] The term "vector" refers to any construct that can introduce heterologous DNA or RNA into a host cell.

[0031] The term "construct" refers to any recombinant DNA or recombinant RNA molecule. Recombinant DNA molecules can be plasmids, granules, viruses, or bacteriophages. Constructs typically include one or more expression cassettes.

[0032] The expression cassette is a DNA molecule capable of expressing the protein-coding gene in the host cell (e.g., a microbial cell). In some embodiments, the expression cassette further includes a DNA fragment containing all regulatory sequences necessary for expressing the encoded gene. The regulatory sequences, under compatible conditions, direct the expression of the encoded gene in a suitable host cell. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylated sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and termination signals for transcription and translation. The regulatory sequence can be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and can be derived from a gene encoding an extracellular or intracellular protein that is homologous or heterologous to that of the host cell. The regulatory sequence can also be a suitable transcription terminator sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The terminator sequence is operatively linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in a selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in a selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence linked to the amino terminus of a protein that guides the encoded protein into the cellular secretory pathway. Signal peptide coding regions that guide the expressed protein into the secretory pathway of the host cell used can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby opening or closing gene expression. Other examples of regulatory sequences are those that enable gene amplification. In these examples, the nucleic acid sequence encoding the protein should be operatively linked to the regulatory sequence.

[0033] In some embodiments, the recombinant vector may be a recombinant expression vector containing a gene encoding the protein. When preparing the recombinant expression vector, the coding gene may be located within the vector so as to be operatively linked to an appropriate expression regulatory sequence. The recombinant expression vector may be any vector (e.g., plasmid or virus) that facilitates recombinant DNA manipulation and expression of the coding gene. The choice of vector typically depends on its compatibility with the host cell into which it will be introduced. The vector may be a linear or closed circular plasmid. The vector may be a self-replicating vector (i.e., a complete structure existing outside the chromosome that can replicate independently of the chromosome), such as a plasmid, extrachromosomal element, microchromosome, or artificial chromosome. The vector may contain any mechanism that ensures self-replication. Alternatively, the vector may be a vector that, when introduced into a host cell, integrates into the genome and replicates along with the integrated chromosome.

[0034] In this application, the term "operable link" refers to an operable connection between segments in a nucleic acid sequence that are functionally related to each other. For example, operably linked promoters, enhancers, open reading frames, 5'UTRs and 3'UTRs, and terminator sequences result in the accurate production of a nucleic acid molecule (e.g., RNA). In some embodiments, operably linked nucleic acid elements lead to transcription of the open reading frame and ultimately to the production of a polypeptide (i.e., expression of the open reading frame).

[0035] This invention also protects a whole-cell catalyst. The whole-cell catalyst may comprise any of the proteins and / or the biological materials described above.

[0036] In some embodiments of the present invention, the whole-cell catalyst may be a whole-cell catalyst obtained by introducing a construct containing a nucleic acid molecule encoding the protein into a host cell.

[0037] The term "host cell," also known as the recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as microbial cells, animal cells, or plant cells. The term "host cell" can be understood not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, need not be completely identical to the original parent cell but are still included within the scope of the host cell.

[0038] Suitable host cells are those known in the art, wherein the term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, spirochetes, or algae, etc. For example, the bacteria may be from the genus Corynebacterium ( Corynebacterium sp. (such as Corynebacterium glutamicum, Corynebacterium pekinensis, Corynebacterium obliterans, etc.), Escherichia coli spp. ( Escherichia sp. (such as Escherichia coli), Brugia () Brevibacterium sp.(such as short bacilli of lactic acid fermentation, short bacilli of yellow, short bacilli of ammonia-eating bacteria, etc.), Erwinia spp. ( Erwinia sp. ), Agrobacterium ( Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium spp. ( Flavobacterium sp. Alcaligenes ( ) Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) or Bacillus spp. ( Bacillus sp. The microbial cells are, but not limited to, those of the genus *Corynebacterium*. In one embodiment of the invention, the *Corynebacterium* is *Corynebacterium glutamicum*. In some embodiments of the invention, the microbial cells are *Escherichia coli* cells. In one embodiment of the invention, the *Escherichia coli* is *Escherichia coli*.

[0039] The viruses may include, but are not limited to, rotaviruses, baculoviruses, retroviruses (such as lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, influenza viruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus). The fungi may be derived from yeasts (…). Saccharomyces sp. (such as Saccharomyces cerevisiae, Candida albicans, Methylospermum oryzae, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin ( Cephalosporium sp. Fungi such as, but not limited to, Streptomyces. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., fucus vesiculosus). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus *Stellaria* ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. Actinomycetes such as, but not limited to, Arabidopsis thaliana. Arabidopsis thaliana ),tobacco( Nicotiana tobacco ),corn( Zea mays ), rice ( Oryza sativa ) or wheat ( Triticum aestivumPlants, but not limited to these, may include animal cells such as mammalian cells, African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc., avian cells (e.g., chicken or duck cells), and amphibian cells (e.g., African clawed frog cells). Xenopus laevis ) cells or giant salamander ( Andrew davidianus Cells include, but are not limited to, fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells, Sf-9 cells, or Hi-5 cells), etc.

[0040] In some embodiments, the mammalian cells do not include animal germ cells, animal fertilized eggs, and animal embryonic stem cells, but may be somatic cells or cell lines. In some embodiments, the animal embryonic stem cells do not include human embryonic stem cells.

[0041] This invention also protects the use of any of the proteins or biological materials or whole-cell catalysts described above in the preparation of L-tryptophan and / or the construction of recombinant microorganisms for the production of L-tryptophan and / or in the regulation of the yield of L-tryptophan produced by microorganisms.

[0042] In the above applications, the recombinant microorganism producing L-tryptophan can be a recombinant cell producing L-tryptophan. The recombinant cell producing L-tryptophan can be a recombinant cell expressing the coding gene for the protein. The recombinant cell expressing the coding gene can be obtained according to methods well known in the art.

[0043] In some embodiments, an expression cassette containing the coding gene is introduced into the host cell to obtain recombinant cells expressing the coding gene. In some embodiments, a recombinant expression vector containing the expression cassette containing the coding gene is introduced into the host cell to obtain recombinant cells expressing the coding gene. In some embodiments, the host cell is the aforementioned microbial cell. In some embodiments, the recombinant cell is a recombinant microbial cell. In some embodiments, the recombinant microbial cell is a recombinant Corynebacterium spp. bacterial cell. In one embodiment of the present invention, the recombinant Corynebacterium spp. bacterial cell is a recombinant Corynebacterium glutamicum cell. In some embodiments of the present invention, the recombinant microbial cell is a recombinant Escherichia spp. bacterial cell. In one embodiment of the present invention, the recombinant Escherichia spp. bacterial cell is a recombinant Escherichia coli cell.

[0044] This invention also protects a method for preparing L-tryptophan. The method may include: 1) Construct recombinant microbial cells expressing the encoding genes of any of the proteins described above; 2) The recombinant microbial cells were cultured in a culture medium to obtain L-tryptophan.

[0045] In the above methods, the recombinant microbial cells expressing the coding genes of any of the aforementioned proteins can be obtained according to methods well known in the art. In some embodiments, an expression cassette containing the coding gene is introduced into the microbial cells to obtain recombinant microbial cells expressing the coding gene. In some embodiments, a recombinant expression vector containing the coding gene expression cassette is introduced into the microbial cells to obtain recombinant microbial cells expressing the coding gene. In some embodiments of the present invention, the recombinant microbial cells are recombinant Corynebacterium cells. In one embodiment of the present invention, the recombinant Corynebacterium cells are recombinant Corynebacterium glutamicum cells. In some embodiments of the present invention, the recombinant microbial cells are recombinant Escherichia coli cells. In one embodiment of the present invention, the recombinant Escherichia coli cells are recombinant Escherichia coli cells.

[0046] The fermentation product of the recombinant microbial cells may be a culture obtained by culturing the recombinant microbial cells in a culture medium. In some embodiments, the culture may be the recombinant microbial cells and / or substances secreted into a liquid culture medium, i.e., fermentation broth. In other embodiments, the culture may be the recombinant microbial cells and / or substances secreted into a solid culture medium, i.e., solid-state fermentation product.

[0047] In some embodiments, the recombinant microbial cells can be cultured in the slant culture medium, seed culture medium or fermentation culture medium mentioned in the examples.

[0048] This invention also protects an engineered bacterium. The engineered bacterium may include strains modified in vivo to express any of the proteins described above or to introduce any of the biological materials described above.

[0049] Among the engineered bacteria mentioned above, the strains may include recombinant Corynebacterium glutamicum or recombinant Escherichia coli.

[0050] The aforementioned engineered bacteria are generally applicable to all Corynebacterium glutamicum or Escherichia coli. Preferably, Corynebacterium glutamicum or Escherichia coli capable of producing L-tryptophan is used, but no further limitations are imposed here.

[0051] The Corynebacterium glutamicum mentioned above can specifically be Corynebacterium glutamicum SXCGTRP0.

[0052] The Escherichia coli mentioned above can specifically be Escherichia coli SXTRP0.

[0053] The host cell described above can be any host suitable for preparing any of the proteins described above, such as Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, and other microbial expression systems.

[0054] This invention modifies 3-deoxy-D-arabinoheptuloate-7-phosphate synthase through protein engineering and gene mutation. It is the first to discover the active site at position 252 of 3-deoxy-D-arabinoheptuloate-7-phosphate synthase, and screens for highly active mutants, providing another important new target for enzyme engineering. Furthermore, this invention utilizes the enhanced activity of 3-deoxy-D-arabinoheptuloate-7-phosphate synthase for the biosynthesis of L-tryptophan, significantly improving the microbial fermentation level of L-tryptophan.

[0055] This invention uses *Escherichia coli* and *Corynebacterium glutamicum* chassis cells as examples to obtain genetically engineered bacteria containing the 3-deoxy-D-arabinoheptuloate-7-phosphate synthase mutant provided by this invention, and applies these genetically engineered bacteria to the biosynthesis of L-tryptophan. Compared with unmutated engineered bacteria, the engineered bacteria containing the 3-deoxy-D-arabinoheptuloate-7-phosphate synthase mutant of this invention exhibit high catalytic activity and can significantly increase the yield of L-tryptophan. This invention has significant application prospects. Detailed Implementation

[0056] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0058] In the following examples, amino acid residues are named using the recognized IUPAC nomenclature, in the form of three-letter abbreviations or single-letter symbols.

[0059] In the following examples, the parental enzyme 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase is the unmodified AroG protein, whose amino acid sequence is shown in SEQ ID NO: 1. The gene encoding the AroG protein is named... AroG Gene, AroG The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0060] In the following examples, the term "amino acid replaced at the original amino acid position" is used to represent the mutated amino acid in the 3-deoxy-D-arabinohepanoate-7-phosphate synthase mutant. For example, G252S indicates that the amino acid residue at position 252 in the sequence from the N-terminus to the C-terminus of SEQ ID NO: 1 is replaced by serine (S) instead of glycine (G). Accordingly, the modified 3-deoxy-D-arabinohepanoate-7-phosphate synthase mutant is referred to as AroG. G252X Protein representation. AroG protein and AroG G252X The only difference in the amino acid sequence of the proteins is the amino acid residue at position 252 of SEQ ID NO: 1; the former is a glycine residue, while the latter is a modified amino acid residue (represented by X); for example, AroG G252S This indicates that the protein obtained by replacing the glycine residue at position 252 of SEQ ID NO:1 with a serine residue, while keeping all other amino acid residues in SEQ ID NO:1 unchanged, is a protein. In this application, in the substitution of amino acids, the letter G before the number represents an amino acid residue of the AroG protein (corresponding to the 252nd amino acid residue of SEQ ID NO:1), and the letter after the number represents an amino acid residue of the mutant. For example, G252P indicates that replacing the G at position 252 of SEQ ID NO:1 with P, while keeping the other amino acid residues in SEQ ID NO:1 unchanged, yields a mutant protein, which is named AroG. G252P protein.

[0061] The primer names, nucleotide sequences, and their uses in this application involved in the following examples are shown in Table 1.

[0062] Table 1

[0063]

[0064]

[0065]

[0066]

[0067] Example 1: Construction of a 3-deoxy-D-arabinoheponic acid-7-phosphate (DAHP) synthase mutant and its application in L-tryptophan production. I. Construction of Escherichia coli SXTRP0 With Escherichia coli EscherichiacoliK-12 W3110 (described in the following references: Hayashi, K., Morooka, N., Yamamoto, Y., Fujita, K., & Horiuchi, T. Highly accurate genome sequences of Escherichiacoli K-12 strains MG1655 and W3110. John Wiley & Sons, 2006(1). *Escherichia coli* Escherichiacoli The name of K-12 W3110 in this document is... Escherichiacoli K-12 strainsW3110; in the following text, Escherichia coli Escherichiacoli Using K-12 W3110 (hereinafter referred to as W3110) as the starting strain, the lactose operon repressor protein was knocked out and its own tryptophan operon was modified to obtain Escherichia coli SXTRP0.

[0068] The specific steps are as follows: 1. Using W3110 genomic DNA as a template, the following methods were employed: LacI -US and LacI PCR amplification was performed using a primer pair consisting of -UA, and the 628bp upstream homologous arm fragment was recovered; LacI -DS and LacI PCR amplification was performed using primers composed of -DA, and the 742bp downstream homologous arm fragment was recovered; using the upstream and downstream homologous arm fragments as templates, PCR was performed... LacI -US and LacI PCR amplification was performed using primers composed of -DA, and 1348 bp was recovered. LacI Gene knockout fragment.

[0069] 2. Using pEcgRNA plasmid (described in the following literature: Q Li, B Sun, J Chen, Y Zhang, Y Jiang, SYang. A modified pCas / pTargetF system for CRISPR-Cas9 assisted genome editing in...) Escherichiacoli Using Acta Biochimica et Biophysica Sinica. 2021 as a template, LacI -sgRNA-S and LacI Full plasmid PCR was performed using a primer pair consisting of -sgRNA-A. The PCR amplification product was purified and recovered, then chemically transformed into *E. coli* DH5α competent cells (a product of Beijing TransGen Biotech Co., Ltd.). After single colonies grew on the plate, the product was used. LacI -sgRNA-VS and LacI Colony PCR identification was performed using a primer pair consisting of -sgRNA-VA. If the PCR amplification product of a single colony contained a DNA fragment of 984 bp, then the single colony was identified as the recombinant bacterium DH5α-. LacI -sgRNA.

[0070] 3. Extraction of recombinant bacteria DH5α- LacI The plasmid was obtained from the -sgRNA. LacI -sgRNA.

[0071] 4. LacI Gene knockout fragments and plasmids LacI -sgRNA was transformed into W3110 competent cells, and after single colonies grew on the plate, it was used. LacI -VS and LacI Colony PCR identification was performed using primer pairs consisting of -VA. If the PCR amplification product of a single colony contained a DNA fragment of 1434 bp, then the single colony was identified as recombinant strain W3110. lacI Hereinafter referred to as W3110, Δ lacI .

[0072] 5. Using strain SX1 (described in the following literature: Xiong B, Zhu Y, Tian D, et al. Fluxredistribution of central carbon metabolism for efficient production of L-tryptophan in...) Escherichiacoli Using the genomic DNA of strain SX1 (named SX1 in this literature) as a template, [Biotechnology and Bioengineering, 2021]... trp -S and trp PCR amplification was performed using a primer pair consisting of -A and 630 bp samples were recovered. trp Gene fragments.

[0073] 6. Using pEcgRNA plasmid as a template, the following methods were employed: trp -sgRNA-S and trp Full plasmid PCR was performed using a primer pair consisting of -sgRNA-A. The PCR amplification product was purified and recovered, then chemically transformed into *E. coli* DH5α competent cells. After single colonies grew on the plate, the product was used. trp -sgRNA-VS and trp Colony PCR identification was performed using a primer pair consisting of -sgRNA-VA. If the PCR amplification product of a single colony contained a DNA fragment of 776 bp, then the single colony was identified as the recombinant bacterium DH5α-. trp -sgRNA.

[0074] 7. Extraction of recombinant bacteria DH5α- trp The plasmid was obtained from the -sgRNA. trp -sgRNA.

[0075] 8. trp Gene fragments and plasmids trp -sgRNA transforms W3110, Δ lacI competent cells are used after single colonies have grown on the plate. trp -VS and trp Colony PCR identification is performed using primer pairs composed of -VA. If the PCR amplification product of a single colony contains a DNA fragment of 714 bp, then the single colony is Escherichia coli SXTRP0.

[0076] The genotypes of Escherichia coli SXTRP0 are shown in Table 4.

[0077] II. Construction of Recombinant Plasmids 1. Using pSTV28 plasmid (a product of Takara) as a template, PCR amplification was performed using primers consisting of pSTV28-S and pSTV28-A, and approximately 3 kb of linearized vector was recovered.

[0078] 2. DNA molecules with nucleotide sequences as shown in SEQ ID NO: 2 (i.e. AroG Using the gene as a template, PCR amplification was performed using primers consisting of aroG-S and aroG-A, and the PCR amplification products were recovered.

[0079] 3. The linearized vector recovered in step 1 and the PCR amplification product recovered in step 2 were subjected to homologous recombination, and then transformed into *E. coli* SXTRP0 by chemical transformation to obtain several single colonies. Each single colony was identified by colony PCR (using primers pSTV28-VS and pSTV28-VA). If the PCR amplification product of a recombinant bacterium contains a DNA fragment of 1339 bp, then the single colony is the recombinant bacterium SXTRP0-pSTV28-AroG.

[0080] 4. Extract the plasmid of the recombinant bacteria SXTRP0-pSTV28-AroG obtained in step 3, i.e., the recombinant plasmid pSTV28-AroG.

[0081] The recombinant plasmid pSTV28-AroG contains the plasmid shown in SEQ ID NO: 2. AroG The gene expresses the 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase shown in SEQ ID NO: 1, namely the AroG protein.

[0082] 5. To obtain potential, highly active AroG protein mutants, primer pairs were designed and synthesized based on the codon bias of *E. coli* to replace glycine at position 252 of the AroG protein with 19 other amino acids, for constructing single-point mutants. Specifically, the synthesized primers were used to perform full-plasmid PCR on the recombinant plasmid pSTV28-AroG to saturate-mutate position 252 of the AroG protein amino acid sequence, obtaining a recombinant plasmid containing the 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase mutant. After purification and recovery, the PCR amplification product was transformed into *E. coli* SXTRP0 via chemical transformation. After single colonies grew on plates, colony PCR identification was performed (using primers pSTV28-VS and pSTV28-VA). If the PCR amplification product of a recombinant bacterium contained a DNA fragment of 1339 bp, then the single colony was identified as the recombinant bacterium SXTRP0-pSTV28-AroG. G252X (X represents the amino acid residue resulting from the mutation at position 252).

[0083] 6. Extract the recombinant bacteria SXTRP0-pSTV28-AroG obtained in step 5. G252X The plasmid, namely the recombinant plasmid pSTV28-AroG G252X (X represents the amino acid residue resulting from the mutation at position 252).

[0084] For example, extract the recombinant bacteria SXTRP0-pSTV28-AroG G252V The plasmid—recombinant plasmid pSTV28-AroG G252V It contains the substance shown in SEQ ID NO: 3 AroG G252V Gene, expressing AroG G252V Protein. AroG G252V The only difference between this protein and the AroG protein is that the former has valine at position 252, while the latter has glycine at position 252.

[0085] For example, extract the recombinant bacteria SXTRP0-pSTV28-AroG G252S The plasmid—recombinant plasmid pSTV28-AroG G252S It contains the substance shown in SEQ ID NO: 4 AroG G252S Gene, expressing AroG G252S Protein. AroG G252S The only difference between this protein and the AroG protein is that the former has serine at position 252, while the latter has glycine at position 252.

[0086] III. Application of 3-deoxy-D-arabinoheponic acid-7-phosphate (DAHP) synthase mutants in L-tryptophan production Each recombinant bacterium constructed in step one was subjected to the following experiments: 1. Inoculate a single clone of the recombinant bacteria into 100 µL of LB liquid medium and incubate at 37°C and 800 rpm for 12 h to obtain the seed culture.

[0087] 2. After completing step 1, inoculate 100 µL of seed culture into 10 mL of LB liquid medium and incubate at 37℃ and 800 rpm for 12 h to obtain the culture solution.

[0088] 3. After completing step 2, inoculate 10 mL of the culture medium into a culture flask containing 1 L of fermentation medium, and incubate at 37℃ and 800 rpm for 12 h to obtain the fermentation broth. The experiment is repeated three times, with three culture flasks per repetition.

[0089] The solutes and their concentrations in the fermentation medium were: glucose 20 g / L, yeast extract 1 g / L, peptone 2 g / L, K₂HPO₄ 3 g / L, MgSO₄·7H₂O 1 g / L, FeSO₄·7H₂O 15 mg / L, MnSO₄·7H₂O 15 mg / L, V B1 1 mg / L, V B3 1 mg / L, V B5 1 mg / L, V B12 1 mg / L and V H 1 mg / L, solvent: water, pH 7.0.

[0090] 4. After completing step 3, take the fermentation broth, centrifuge at 4000 rpm for 5 min at 4℃, and collect the supernatant; filter the supernatant through a 0.22 μm filter membrane and collect the filtrate.

[0091] 5. After completing step 4, the L-tryptophan content in the filtrate was detected by high performance liquid chromatography, and the yield of L-tryptophan per liter of fermentation broth (g / L) was further calculated.

[0092] The chromatographic conditions were as follows: Kromasil C18 column (250 mm × 460 mm, 5 μm), mobile phase was 10% acetonitrile aqueous solution, flow rate was set at 1.0 mL / min, column temperature was 40℃, retention time was 15 min, UV detection wavelengths for L-tryptophan were 280 nm, 210 nm and 270 nm, and injection volume was 20 μL.

[0093] The test results are shown in Table 2 (average of three replicate experiments). The results indicate that the recombinant strain SXTRP0-pSTV28-AroG... G252PThe fermentation broth showed the highest L-tryptophan production, significantly increasing from 2.47 g / L (in the fermentation broth of recombinant strain SXTRP0-pSTV28-AroG) to 3.27 g / L. Furthermore, compared to recombinant strain SXTRP0-pSTV28-AroG, the L-tryptophan production of recombinant strain SXTRP0-pSTV28-AroG was significantly higher. G252S Recombinant strain SXTRP0-pSTV28-AroG G252V Recombinant strain SXTRP0-pSTV28-AroG G252Q Recombinant strain SXTRP0-pSTV28-AroG G252L Recombinant strain SXTRP0-pSTV28-AroG G252Y Recombinant strain SXTRP0-pSTV28-AroG G252T and recombinant bacteria SXTRP0-pSTV28-AroG G252N The yield of L-tryptophan in the fermentation broth was also significantly increased.

[0094] Table 2

[0095]

[0096] Note: * express P <0.05, indicating a significant difference; ** express P <0.01, indicating a highly significant difference; *** express P <0.001 indicates a highly significant difference.

[0097] Table 3 details the recombinant plasmids contained in each of the aforementioned recombinant bacteria and the expressed mutants of 3-deoxy-D-arabinohepanoic acid-7-phosphate synthase. It is evident that mutating glycine at position 252 of the AroG protein to proline, serine, valine, glutamine, leucine, tyrosine, threonine, or asparagine significantly enhances the enzyme activity of 3-deoxy-D-arabinohepanoic acid-7-phosphate synthase, and further preparation of recombinant bacteria can improve the synthesis capacity of L-tryptophan.

[0098] Table 3

[0099] Example 2: Preparation of recombinant Escherichia coli using a 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase mutant and its application in L-tryptophan production. The 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase mutant in this embodiment is specifically AroG.G252P Protein, AroG G252S Protein and AroG G252V protein.

[0100] AroG G252V The protein is a mutant obtained by mutating glycine to valine at position 252 of the AroG protein. It encodes AroG... G252V Protein genes— AroG G252V The nucleotide sequence of the gene is shown in SEQ ID NO: 3.

[0101] AroG G252S The mutant AroG protein was obtained by mutating the glycine residue at position 252 to a serine residue. It encodes AroG... G252S Protein genes— AroG G252S The nucleotide sequence of the gene is shown in SEQ ID NO: 4.

[0102] AroG G252P The mutant AroG protein was obtained by mutating the glycine residue at position 252 to proline. It encodes AroG... G252P Protein genes— AroG G252P The nucleotide sequence of the gene is shown in SEQ ID NO: 27.

[0103] I. Obtaining the genetically engineered bacteria SXTRP1, SXTRP2, SXTRP3, and SXTRP4 Using Escherichia coli SXTRP0 as the starting strain, AroG protein and AroG protein were expressed in the genome of Escherichia coli SXTRP0, respectively. G252P Protein, AroG G252S Protein and AroG G252V Proteins were extracted to obtain the genetically engineered bacteria SXTRP1, SXTRP2, SXTRP3, and SXTRP4, as shown in Table 4. The specific steps are as follows: 1. Using the genomic DNA of Escherichia coli SXTRP0 as a template, the following methods were employed: yghX -US and yghX PCR amplification was performed using a primer pair consisting of -UA, and the 568bp upstream homologous arm fragment was recovered; yghX -DS and yghX PCR amplification was performed using primers composed of -DA, and the 575 bp downstream homologous arm fragment was recovered. Recombinant plasmids pSTV28-AroG and pSTV28-AroG were used for PCR amplification. G252P Recombinant plasmid pSTV28-AroG G252S and recombinant plasmid pSTV28-AroG G252VAs a template, use aroG -S and aroG PCR amplification was performed using a primer pair consisting of -A and 1141 bp molecules were recovered sequentially. aroG Gene, aroG G252P Gene, aroG G252S Genes and aroG G252V Gene.

[0104] 2. The upstream homologous arm fragment, downstream homologous arm fragment, and... (The sentence is incomplete and requires more context to be fully translated.) aroG Using genes as templates, yghX -US and yghX PCR amplification was performed using primers composed of -DA, and 2242 bp was recovered. yghX - aroG Gene fragments.

[0105] Following the steps above, aroG Genes were replaced with aroG G252P Gene, aroG G252S Genes and aroG G252V Genes, with all other steps remaining unchanged, are obtained sequentially. yghX - aroG G252P Gene fragments, yghX - aroG G252S Gene fragments and yghX - aroG G252V Gene fragments.

[0106] 3. Using pEcgRNA plasmid as a template, the following methods were employed: yghX -sgRNA-S and yghX Full plasmid PCR was performed using a primer pair consisting of -sgRNA-A. The PCR amplification product was purified and recovered, then chemically transformed into *E. coli* DH5α competent cells. After single colonies grew on the plate, the product was used. yghX -sgRNA-VS and yghX Colony PCR identification was performed using a primer pair consisting of -sgRNA-VA. If the PCR amplification product of a single colony contained a DNA fragment of 853 bp, then the single colony was identified as the recombinant bacterium DH5α-. yghX -sgRNA.

[0107] 4. Extraction of recombinant bacteria DH5α- yghX The plasmid was obtained from the -sgRNA. yghX -sgRNA.

[0108] 5. Place the plasmid yghX -sgRNA and yghX - aroG Gene fragments were transformed into E. coli SXTRP0 competent cells, and used after single colonies grew on plates. yghX -VS and yghX Colony PCR identification is performed using primer pairs composed of -VA. If the PCR amplification product of a single colony contains a DNA fragment of 2433bp, then the single colony is the genetically engineered bacterium SXTRP1 (hereinafter referred to as SXTRP1).

[0109] Following the steps above, yghX - aroG Gene fragments were replaced with yghX - aroG G252P Gene fragments, yghX - aroG G252S Gene fragments and yghX - aroG G252V Gene fragments were used, and all other steps remained unchanged, to obtain the genetically engineered bacteria SXTRP2 (hereinafter referred to as SXTRP2), SXTRP3 (hereinafter referred to as SXTRP3), and SXTRP4 (hereinafter referred to as SXTRP4) in sequence.

[0110] The genotypes of SXTRP1, SXTRP2, SXTRP3 and SXTRP4 are shown in Table 4.

[0111] Table 4

[0112] The foreign DNA inserted into the genetically engineered bacterium SXTRP1 is a recombinant fragment P. trc -aroG Recombined fragment P trc -aroG By P trc The promoter and nucleotide sequence are as shown in SEQ ID NO: 2. AroG Genome composition.

[0113] P trc The nucleotide sequence of the promoter is shown in SEQ ID NO: 28. SEQ ID NO: 28 is: TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC.

[0114] The foreign DNA inserted into the genetically engineered bacterium SXTRP2 is a recombinant fragment P. trc -aroGG252P Recombined fragment P trc - aroG G252P By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 27. AroG G252P Genome composition.

[0115] The foreign DNA inserted into the genetically engineered bacterium SXTRP3 is a recombinant fragment P. trc -aroG G252S Recombined fragment P trc - aroG G252S By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 4. AroG G252S Genome composition.

[0116] The foreign DNA inserted into the genetically engineered bacterium SXTRP4 is a recombinant fragment P. trc -aroG G252V Recombined fragment P trc - aroG G252V By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 3. AroG G252V Genome composition.

[0117] II. Production of L-tryptophan using genetically engineered bacteria SXTRP1, SXTRP2, SXTRP3, and SXTRP4 The strains to be tested are SXTRP1, SXTRP2, SXTRP3, or SXTRP4.

[0118] 1. Slant culture Take the test strain stored at -80℃, streak it onto the slant medium, incubate at 37℃ for 12 h, and subculture once to obtain slant seeds.

[0119] The solutes and their concentrations in the slant culture medium were glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast extract 5 g / L, NaCl 1 g / L and agar 25 g / L, with water as the solvent and a pH of 7.0.

[0120] 2. Seed culture After completing step 1, use an inoculation loop to scrape a loop of slanted seeds and inoculate them into an Erlenmeyer flask (500 mL) containing 30 mL of seed culture medium. Seal the flask with nine layers of gauze and incubate at 37℃ and 200 r / min for 8 h to obtain the seed culture solution.

[0121] The solutes and their concentrations in the seed culture medium were: glucose 20 g / L, yeast extract 5 g / L, peptone 2 g / L, K₂HPO₄ 1 g / L, MgSO₄·7H₂O 1 g / L, FeSO₄·7H₂O 15 mg / L, MnSO₄·7H₂O 15 mg / L, V B1 1 mg / L, V B3 1 mg / L, V B5 1 mg / L, V B12 1 mg / L, V H 1 mg / L of L-arginine and 2 g / L of L-arginine were used in water at a pH of 7.0.

[0122] 3. Fermentation culture After completing step 2, 3 mL of seed culture solution (10% inoculation) was inoculated into a 500 mL Erlenmeyer flask containing 27 mL of fermentation medium. The flask was sealed with nine layers of gauze and incubated at 37℃ with shaking at 200 r / min to obtain the fermentation broth. During fermentation, the pH was maintained at 7.0-7.2 by adding ammonia water; a 60 g / 100 mL glucose solution was added to maintain fermentation; the fermentation period was 20 h. The experiment was repeated three times, with three Erlenmeyer flasks per replicate.

[0123] The solutes and their concentrations in the fermentation medium were: glucose 20 g / L, yeast extract 1 g / L, peptone 2 g / L, K₂HPO₄ 3 g / L, MgSO₄·7H₂O 1 g / L, FeSO₄·7H₂O 15 mg / L, MnSO₄·7H₂O 15 mg / L, V B1 1 mg / L, V B3 1 mg / L, V B5 1 mg / L, V B12 1 mg / L, V H 1 mg / L of L-arginine and 2 g / L of L-arginine were used in water at a pH of 7.0.

[0124] 4. Detect the yield of L-tryptophan in the fermentation broth. After completing step 2, the OD of the fermentation broth was measured. 600nmThe fermentation broth was centrifuged at 4000 rpm for 5 min at 4°C, and the supernatant was collected. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was collected. Finally, the L-tryptophan content in the filtrate was detected by high performance liquid chromatography, and the yield of L-tryptophan per liter of fermentation broth (g / L) was calculated.

[0125] The test results are shown in Table 5. The results indicate that the SXTRP0 genome of *E. coli* is integrated with... AroG G252P Gene, Arog G252S Genes and Arog G252V The L-tryptophan production of the genetically engineered bacteria was 2.33 g / L, 2.25 g / L, and 2.19 g / L, respectively, and was integrated into the genome of Escherichia coli SXTRP0. Arog The genetically engineered bacteria improved by 27.3%, 23.0%, and 19.7%, respectively.

[0126] Table 5

[0127] Note: ** express P <0.01 indicates a highly significant difference.

[0128] This demonstrates that the expression of the 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase mutant AroG in Escherichia coli is effective. G252P Protein, AroG G252S protein or AroG G252V Proteins can significantly increase the production of L-tryptophan.

[0129] Example 3: Preparation of recombinant Corynebacterium glutamicum using a 3-deoxy-D-arabinohepenoyl-7-phosphate synthase mutant and its application in L-tryptophan production. I. Construction of Corynebacterium glutamicum SXCGTRP0 pK18mobrpsL plasmid and Corynebacterium glutamicum rpsL K43N All are documented in the following references: Wang, T.; Li, Y.; Li, J.; Zhang, D.; Cai, N.; Zhao, G.; Ma, H.; Shang, C.; Ma, Q.; Xu, Q.; Chen, N. An update of the suicide plasmid-mediated genome editing system in Coryneba caterium glutamicumMicrobial Biotechnology 2019, 12(5), 907-919. pK18mobrpsL plasmid and Corynebacterium glutamicum rpsL K43N The names used in this paper are pK18mobrpsL and rpsL, respectively. K43N .

[0130] To conduct experiments on L-tryptophan production using AroG protein and its point mutant protein in Corynebacterium glutamicum, Corynebacterium glutamicum SXCGTRP0 was constructed for subsequent experiments. The specific steps are as follows: 1. Recombinant plasmid pK18mobrpsL- cgl1675 - trp Construction (1) Using pK18mobrpsL plasmid as template, PCR amplification was performed using primer pair composed of pK18Linearized-S and pK18Linearized-A, and approximately 3 kb of linearized vector was recovered.

[0131] (2) Using the genomic DNA of Corynebacterium glutamicum ATCC 13032 (an ATCC product) as a template, the following methods were employed: cgl1675 - trp -US and cgl1675 - trp PCR amplification was performed using primers consisting of -UA, and the upstream homologous arm of the cgl1675 gene (685 bp) was recovered; cgl1675 - trp -DS and cgl1675 - trp PCR amplification was performed using a primer pair composed of -DA, and 703 bp was recovered. cgl1675 Downstream homologous arm of the gene; SX1 strain (described in the following literature: Xiong B, Zhu Y, Tian D, et al. Flux redistribution of central carbon metabolism for efficient production of L-tryptophan in...) Escherichia coli Using the genomic DNA of strain SX1 (named SX1 in this literature) as a template, .Biotechnology and Bioengineering, 2021. cgl1675 - trp -S and cgl1675 - trp PCR amplification was performed using primers consisting of -A, and the 6576 bp Ectrp fragment (i.e., the trp operon from E. coli) was recovered; the upstream homologous arm of the cgl1675 gene, cgl1675Using the downstream homologous arm of the gene and the Ectrp fragment as templates, cgl1675 - trp -US and cgl1675 - trp PCR amplification was performed using primers composed of -DA, and 7889 bp was recovered. cgl1675 - trp Excerpt.

[0132] (3) The linearized carrier recovered in step (1) and the one obtained in step (2) are combined by Gibson assembly. cgl1675 - trp The fragments were ligated and then transformed into E. coli DH5α competent cells using chemical transformation. After single colonies grew on the plate, colony PCR was performed using primers consisting of pK18-VS and pK18-VA. If the PCR amplification product of a single colony contained a DNA fragment of 7979 bp, then the single colony was the recombinant bacterium DH5α-pK18mobrpsL-cgl1675-trp.

[0133] (4) Extract the plasmid from the recombinant bacterium DH5α-pK18mobrpsL-cgl1675-trp to obtain the recombinant plasmid pK18mobrpsL- cgl1675 - trp .

[0134] 2. Obtaining Corynebacterium glutamicum SXCGTRP0 (1) The recombinant plasmid pK18mobrpsL- cgl1675 - trp Electroporation to Corynebacterium glutamicum rpsL K43N competent cells are used after single colonies have grown on the plate. cgl1675 Colony PCR identification is performed using primer pairs consisting of -VS and pK18-VA. If the PCR amplification product of a single colony contains a DNA fragment of 7958bp or 2763bp, then the single colony is a single-exchange strain.

[0135] (2) After completing step (1), double-exchange the single-exchange strain according to the method in the literature (Wang, T.;Li, Y.;Li, J.;Zhang, D.;Cai, N.;Zhao, G.;Ma, H.;Shang, C.;Ma, Q.;Xu, Q.;Chen, N.An update of thesuicide plasmid-mediated genome editing system in Corynebacterium glutamicum.Microbial Biotechnology 2019,12(5), 907-919.). Use the plate after single-celled bacteria have grown. cgl1675 -VS and cgl1675 Colony PCR identification is performed using primer pairs composed of -VA. If the PCR amplification product of a single colony contains a DNA fragment of 7965bp, then the single colony is Corynebacterium glutamicum SXCGTRP0 (hereinafter referred to as SXCGTRP0).

[0136] The genotypes of Corynebacterium glutamicum SXCGTRP0 are shown in Table 6.

[0137] II. Obtaining the genetically engineered bacteria SXCGTRP1, SXCGTRP2, SXCGTRP3, and SXCGTRP4 To further expand the application of the point mutant AroG protein (i.e., the 3-deoxy-D-arabinohepenoyl-7-phosphate synthase mutant) in commonly used chassis strains, *Corynebacterium glutamicum* was further modified for L-tryptophan fermentation to identify its effect on L-tryptophan production. AroG protein and AroG... G252P Protein, AroG G252S Protein and AroG G252V Proteins were extracted, and the genetically engineered bacteria SXCGTRP1, SXCGTRP2, SXCGTRP3, and SXCGTRP4, as shown in Table 6, were obtained sequentially. Specifically, gene editing methods using Corynebacterium glutamicum strains were employed (refer to the following literature: Wang, T.; Li, Y.; Li, J.; Zhang, D.; Cai, N.; Zhao, G.; Ma, H.; Shang, C.; Ma, Q.; Xu, Q.; Chen, N. An update of the suicide plasmid-mediated genome editing system in...). CorynebacteriumglutamicumMicrobial Biotechnology 2019, 12(5), 907-919.) The genome of Corynebacterium glutamicum SXCGTRP0... cgl1819 The gene (Genebank number BAB99212.1; BCT04-JUN-2002) was replaced with exogenous DNA.

[0138] The exogenous DNA in the genetically engineered bacterium SXCGTRP1 is a recombinant fragment P. trc -aroG Recombined fragment P trc -aroG By P trc The promoter and nucleotide sequence are as shown in SEQ ID NO: 2. Arog Genome composition.

[0139] The foreign DNA inserted into the genetically engineered bacterium SXCGTRP2 is a recombinant fragment P. trc -aroG G252P Recombined fragment P trc - aroG G252P By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 27. Arog G252P Genome composition.

[0140] The foreign DNA inserted into the genetically engineered bacterium SXCGTRP3 is a recombinant fragment P. trc -aroG G252S Recombined fragment P trc - aroG G252S By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 4. Arog G252S Genome composition.

[0141] The foreign DNA inserted into the genetically engineered bacterium SXCGTRP4 is a recombinant fragment P. trc -aroG G252V Recombined fragment P trc - aroG G252V By P trc The promoter and nucleotide sequence are shown in SEQ ID NO: 3. Arog G252V Genome composition.

[0142] Table 6

[0143] The specific steps are as follows: 1. Construction of recombinant plasmids (1) Using the pK18mobrpsL plasmid (described in the following references: Wang, T.; Li, Y.; Li, J.; Zhang, D.; Cai, N.; Zhao, G.; Ma, H.; Shang, C.; Ma, Q.; Xu, Q.; Chen, N. An update of the suicide plasmid-mediated genome editing system in Corynebacteriumglutamicum Using pK18Linearized-S and pK18Linearized-A as a template, PCR amplification was performed using a primer pair and recovered approximately 3 kb of linearized vector.

[0144] (2) Using the genomic DNA of Corynebacterium glutamicum SXCGTRP0 as a template, the following methods were employed: cgl1819 - aroG -US and cgl1819 - aroG PCR amplification was performed using a primer pair consisting of -UA, and 631 bp was recovered. cgl1819 Upstream homologous arms of genes; using cgl1819 - aroG -DS and cgl1819 - aroG PCR amplification was performed using a primer pair composed of -DA, and 648bp was recovered. cgl1819 Downstream homologous arm of the gene.

[0145] Using recombinant plasmid pSTV28-AroG and recombinant plasmid pSTV28-AroG respectively G252P Recombinant plasmid pSTV28-AroG G252S and recombinant plasmid pSTV28-AroG G252V As a template, use cgl1819 - aroG -S and cgl1819 - aroG PCR amplification was performed using a primer pair consisting of -A and 1141 bp molecules were recovered sequentially. aroG - cgl1819 Fragments aroG G252P - cgl1819 Fragments aroG G252S - cgl1819 Fragments and aroGG252V - cgl1819 Excerpt.

[0146] (3) Use cgl1819 - aroG -US and cgl1819 - aroG -DA primer pair cgl1819 upstream homologous arm of gene, aroG - cgl1819 Fragments and cgl1819 The downstream homologous arm of the gene was amplified by overlap extension PCR to obtain... aroG Insert a fragment.

[0147] Following the steps above, aroG - cgl1819 The fragments were replaced with aroG G252P - cgl1819 Fragments aroG G252S - cgl1819 Fragments and aroG G252V - cgl1819 The fragment remains unchanged, with all other steps remaining the same, and the following results are obtained sequentially. aroG G252P Insert fragment, aroG G252S Insert fragments and aroG G252V Insert a fragment.

[0148] (4) The linearized carrier recovered in step (1) and the one obtained in step (3) are combined by Gibson assembly. aroG The inserted fragment was ligated and then chemically transformed into *E. coli* DH5α competent cells. After single colonies grew on plates, colony PCR was performed using primers consisting of pK18-VS and pK18-VA. If the PCR amplification product of a single colony contained a DNA fragment of 2465 bp, that single colony was considered a positive colony. The plasmid of the positive colony was extracted to obtain the recombinant plasmid pK18mobrpsL- aroG .

[0149] Following the steps above, aroG The inserted fragments were replaced with aroG G252P Insert fragment, aroG G252S Insert fragments and aroG G252V Insert the fragment, and keep all other steps unchanged to obtain the recombinant plasmid pK18mobrpsL- aroG G252P Recombinant plasmid pK18mobrpsL- aroG G252S and recombinant plasmid pK18mobrpsL- aroG G252V .

[0150] 2. Obtaining the genetically engineered bacteria SXCGTRP1, SXCGTRP2, SXCGTRP3 and SXCGTRP4 (1) The recombinant plasmid pK18mobrpsL- aroG Electroporation was performed on Corynebacterium glutamicum SXCGTRP0 competent cells, and the cells were used after single colonies had grown on the plate. cgl1819 Colony PCR identification is performed using primer pairs consisting of -VS and pK18-VA. If the PCR amplification product of a single colony contains a DNA fragment of 2631bp or 1816bp, then the single colony is a single-exchange strain.

[0151] (2) After completing step (1), double-exchange the single-exchange strain according to the method in the literature (Wang, T.;Li, Y.;Li, J.;Zhang, D.;Cai, N.;Zhao, G.;Ma, H.;Shang, C.;Ma, Q.;Xu, Q.;Chen, N.An update of thesuicide plasmid-mediated genome editing system in Corynebacterium glutamicum.Microbial Biotechnology 2019,12(5), 907-919.). Use the plate after single-celled bacteria have grown. cgl1819 -VS and cgl1819 Colony PCR identification is performed using primer pairs composed of -VA. If the PCR amplification product of a single colony contains a DNA fragment of 2629 bp, then the single colony is the genetically engineered bacterium SXCGTRP1 (hereinafter referred to as SXCGTRP1).

[0152] Following the steps described above, the recombinant plasmid pK18mobrpsL- aroG Replace them with recombinant plasmid pK18mobrpsL- aroG G252P Recombinant plasmid pK18mobrpsL- aroG G252S and recombinant plasmid pK18mobrpsL- aroG G252VWith all other steps unchanged, the genetically engineered bacteria SXCGTRP2 (hereinafter referred to as SXCGTRP2), SXCGTRP3 (hereinafter referred to as SXCGTRP3), and SXCGTRP4 (hereinafter referred to as SXCGTRP4) were obtained in sequence.

[0153] The genotypes of the genetically engineered bacteria SXCGTRP1, SXCGTRP2, SXCGTRP3 and SXCGTRP4 are shown in Table 6.

[0154] III. Production of L-tryptophan using genetically engineered bacteria SXCGTRP1, SXCGTRP2, SXCGTRP3, and SXCGTRP4 Following the method in step two of Example 2, the test strains were replaced with SXCGTRP1, SXCGTRP2, SXCGTRP3, and SXCGTRP4, respectively, while all other steps remained unchanged. The OD values ​​of the fermentation broths of SXCGTRP1, SXCGTRP2, SXCGTRP3, and SXCGTRP4 were then obtained. 600nm Value and yield of L-tryptophan per liter of fermentation broth (g / L).

[0155] The test results are shown in Table 7. The results showed that the 3-deoxy-D-arabinoheptulose-7-phosphate synthase mutant AroG was expressed in Corynebacterium glutamicum. G252P Protein, AroG G252S protein or AroG G252V The protein also plays a positive role in L-tryptophan production. It is integrated into the genome of Corynebacterium glutamicum SXCGTRP0. Arog G252P Gene, Arog G252S Genes and Arog G252V The L-tryptophan production of the genetically engineered bacteria was 2.04 g / L, 1.93 g / L, or 1.88 g / L, respectively, compared to the L-tryptophan integrated into the genome of Corynebacterium glutamicum SXCGTRP0. Arog The genetically engineered bacteria improved the gene yield by 31.6%, 24.5%, and 21.3%, respectively.

[0156] Table 7

[0157] Note: ** express P <0.01 indicates a highly significant difference.

[0158] This demonstrates that the 3-deoxy-D-arabinohepenoic acid-7-phosphate synthase mutant AroG is expressed in Corynebacterium glutamicum. G252PProtein, AroG G252S protein or AroG G252V Proteins can significantly increase the production of L-tryptophan.

[0159] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A protein, characterized in that, The protein is selected from any of the following: (A1) A mutant obtained by mutating the glycine residue at position 252 of the AroG protein, as shown in the amino acid sequence SEQ ID NO: 1, to a valine residue; (A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the mutant described in (A1).

2. The protein according to claim 1, characterized in that, The protein is either K1 or K2. K1) The amino acid sequence of the protein is shown in SEQ ID NO:36; K2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in K1).

3. A biomaterial, characterized in that, The biomaterial is selected from any one of the following: B1) Contains a nucleic acid molecule encoding the protein of claim 1 or 2; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that, The B1) nucleic acid molecule contains a DNA molecule with a nucleotide sequence as shown in SEQ ID NO:

3.

5. A whole-cell catalyst, characterized in that, The whole-cell catalyst comprises the protein of claim 1 or 2 and / or the biomaterial of claim 3 or 4.

6. The use of the protein of claim 1 or 2, the biomaterial of claim 3 or 4, or the whole-cell catalyst of claim 5 in the preparation of L-tryptophan and / or the construction of recombinant microorganisms for producing L-tryptophan and / or in the regulation of the yield of L-tryptophan produced by microorganisms.

7. A method for preparing L-tryptophan, characterized in that: The method includes: 1) Constructing a recombinant microbial cell expressing the gene encoding the protein of claim 1 or 2; 2) The recombinant microbial cells were cultured in a culture medium to obtain L-tryptophan; The recombinant microbial cells are recombinant Corynebacterium glutamicum or recombinant Escherichia coli cells.

8. An engineered bacterium, characterized in that: The engineered bacteria include strains that have been modified in vivo to express the protein of claim 1 or 2 or to introduce the biological material of claim 3 or 4. The strain is recombinant Corynebacterium glutamicum or recombinant Escherichia coli.

Images