A nucleic acid molecule capable of regulating the development of corn female ear and application thereof

Abstract

The application provides a nucleic acid molecule capable of regulating the development of corn female ear and application thereof, the nucleic acid molecule is rGRF16 gene, compared with wild type GRF16 in the corn genome, a synonymous mutation is introduced at the miR396 recognition site of the rGRF16 gene, so that the coding amino acid sequence of the rGRF16 gene is the same as the coding amino acid sequence of the GRF16 gene, and the mRNA transcribed by the rGRF16 gene cannot be recognized and cut by miR396; the nucleotide sequence of the GRF16 gene is shown as SEQ ID NO. 1. By constructing the miR396 insensitive form gene rGRF16 of GRF16, the site-directed base mutation is carried out on the coding sequence of GRF16 based on the codon degeneracy, the mutation modification only changes the target binding sequence of the gene transcript, does not change the coding amino acid sequence, can block the targeted cleavage and degradation of the endogenous miR396 on the transcript of GRF16, and the purpose of overexpression of the GRF16 gene is achieved. By constructing the GRF16 plant of the miR396 insensitive form, the development of the female ear and the grain is significantly promoted, and then the corn yield is improved, and an effective way is provided for the genetic improvement of the corn variety.

Description

Technical Field

[0001] This invention relates to the technical field of plant genetic engineering, and in particular to a nucleic acid molecule that can regulate the development of maize female ears and its applications. Background Technology

[0002] As one of the world's three major staple crops, maize occupies an irreplaceable core position in human dietary supply, livestock feed production, and industrial raw material processing systems. Its stable and high yields are directly related to global food security and the stable development of the agricultural economy. Currently, the continuous growth of the global population has led to a rigid increase in food demand, while frequent extreme weather disasters such as high temperatures and droughts caused by climate change not only seriously disrupt the traditional agricultural production order but also further exacerbate agricultural production problems such as farmland degradation and water scarcity, posing a great challenge to global food security. Under these circumstances, continuously breaking through the bottleneck of maize yield and increasing maize production capacity remains the core and primary goal in the field of crop breeding.

[0003] The female ear is a crucial reproductive organ in maize, and its development directly determines core yield indicators such as ear morphology, grain weight, and number of grains per ear. Therefore, systematically analyzing the molecular regulatory mechanisms of maize ear development and identifying key functional genes that regulate yield traits, thereby unlocking the high-yield potential of maize at the genetic level, has significant theoretical and practical value for accelerating the breeding process of new high-yield maize varieties and ensuring national food security.

[0004] Traditional breeding methods suffer from drawbacks such as lengthy breeding cycles, limited germplasm genetic background, and low improvement efficiency, making it difficult to meet the rapid iterative demands of current high-yield maize breeding. In contrast, molecular breeding and transgenic breeding offer significant advantages such as shorter breeding cycles, more precise trait improvement, and stronger targeting, providing an efficient technical pathway for the targeted improvement of maize yield traits. However, the number of maize yield-related functional genes currently identified is limited, and most cloned genes exhibit significant pleiotropic effects. While regulating yield traits such as ear development and grain size, they can easily have negative synergistic effects on other agronomic traits such as plant architecture and stress resistance, greatly limiting their application value in breeding practice. In summary, identifying key gene resources that can specifically regulate maize ear development, positively regulate grain traits, and have no adverse side effects, and systematically elucidating their upstream and downstream molecular regulatory networks, are core technical challenges that urgently need to be overcome in the field of high-yield maize molecular breeding. Summary of the Invention

[0005] The purpose of this invention is to provide a nucleic acid molecule that can regulate the development of maize female ears and its application, in order to solve the problem of how to promote the development of maize female ears.

[0006] The first aspect of the present invention provides a nucleic acid molecule that can regulate the development of maize female ears, characterized in that the nucleic acid molecule is the rGRF16 gene, which, compared with the wild-type GRF16 in the maize genome, contains a synonymous mutation at the miR396 recognition site, such that the amino acid sequence encoded by the rGRF16 gene is the same as that encoded by the GRF16 gene, and the mRNA transcribed from the rGRF16 gene cannot be recognized and cleaved by miR396; The nucleotide sequence of the GRF16 gene is shown in SEQ ID NO.1.

[0007] Furthermore, the synonymous mutation is located in the nucleotide region of position 744-768 bp of the GRF16 gene, where at least one or more bases are mutated, and the amino acid sequence remains unchanged.

[0008] Furthermore, the nucleotides at positions 744-768 bp of the GRF16 gene are 5'-CATCGTTCAAGAAAGCATGTGGAA-3', and the nucleotides at positions 744-768 bp of the rGRF16 gene are 5'-CACAGGAGCCGGAAACACGTAGAG-3'.

[0009] Furthermore, the nucleotide sequence of the rGRF16 gene is shown in SEQ ID NO.2.

[0010] A second aspect of the present invention provides a recombinant vector comprising the above-described nucleic acid molecules.

[0011] Furthermore, the sequence of this recombinant vector is shown in SEQ ID NO.3.

[0012] A third aspect of this invention provides a method for preparing transgenic maize plants, comprising: Synonymous mutations in the base sequence of the GRF16 gene that is recognized by miR396 result in the rGRF16 gene. Without affecting the amino acid composition, the mRNA transcribed from the rGRF16 gene cannot be recognized and cleaved by miR396. The enzyme-digested vector was ligated with the rGRF16 sequence to finally construct a miR396-insensitive rGRF16 gene recombinant vector. Transgenic maize plants were obtained by introducing Agrobacterium-mediated transformation into maize embryonic cells, followed by co-culture, screening, differentiation, and regeneration.

[0013] The fourth aspect of the present invention provides a transgenic maize plant whose genome contains and expresses the above-mentioned rGRF16 gene.

[0014] Furthermore, compared with wild-type control maize plants that do not contain the rGRF16 gene, the transgenic maize plants exhibit increased ear length and / or larger kernels.

[0015] The fifth aspect of the present invention provides an application of the above-mentioned nucleic acid molecule that can regulate the development of maize female ears, for regulating maize plants to increase ear length and / or increase kernel size.

[0016] The beneficial effects of this plan are as follows: By constructing a miR396-insensitive form of the GRF16 gene, rGRF16, and performing site-directed base mutations on the GRF16 coding sequence based on codon degeneracy, this mutation alters only the target binding sequence of the gene transcript without changing its encoded amino acid sequence. This blocks the targeted cleavage and degradation of the GRF16 transcript by endogenous miR396, achieving overexpression of the GRF16 gene. Constructing miR396-insensitive GRF16 plants allows the GRF16 gene to resist miR396 degradation and thus undergo overexpression, significantly promoting ear development and grain size, thereby increasing maize yield and providing an effective approach for the genetic improvement of maize varieties. Attached Figure Description

[0017] Figure 1 A schematic diagram illustrating miR396's recognition of the GRF16 gene transcript target site; Figure 2 The image shows the spectrum of the rGRF16 recombinant vector; Figure 3 The GRF16 gene sequence was compared between wild-type plants and rGRF16 transgenic plants. Figure 4 A comparison of spike length phenotypes between wild-type and transgenic plants; Figure 5 A comparison diagram of the seed phenotypes of wild-type plants and transgenic plants; Figure 6 This is a statistical analysis chart of the yield traits of rGRF16 transgenic plants. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0019] The GROWTH-REGULATING FACTOR (GRF) family is a class of plant-specific transcription factors whose encoded protein sequences possess two highly conserved evolutionary domains: the QLQ domain and the WRC domain. The conserved QLQ motif primarily mediates protein-protein interactions between GRF proteins and GRF-INTERACTING FACTOR (GIF) co-activators, while the WRC domain, containing zinc finger motifs, is responsible for specifically recognizing and binding to cis-acting elements of downstream target gene promoters, thus performing DNA binding. Recent abundant molecular and genetic evidence indicates that GRF family transcription factors, as core regulatory nodes, widely participate in and coordinate the regulation of the entire plant growth and development process, playing an irreplaceable regulatory role in the occurrence and morphogenesis of several key organs, including root formation, leaf morphogenesis, and floral organ differentiation and development.

[0020] MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs, approximately 20–24 nt in length, widely distributed in plants and animals. They mediate the degradation of target mRNAs or inhibit translation by complementary pairing with target gene mRNAs, negatively regulating gene expression at the posttranscriptional level. In plants, miR396 can target the GRF gene family, participating in various life processes such as cell proliferation, organ development, and stress response, and is a key factor in regulating growth and development. In this invention, utilizing the characteristic that miR396 can target and specifically degrade GRF16 mRNA, transgenic plants overexpressing GRF16 in a miR396-insensitive form were constructed by mutating the site of GRF16 gene recognized by miR396 without altering the amino acid sequence. These plants exhibited phenotypes of increased ear length and larger grains.

[0021] The degeneracy of the genetic code refers to the phenomenon that multiple different triplet codons can encode the same amino acid. Except for methionine and tryptophan, which have only a single corresponding codon, other amino acids have 2-6 synonymous codons, with most differences concentrated at the third base position. This characteristic has significant biological implications: when a gene undergoes a point mutation, synonymous codon substitutions often do not alter the translated amino acid sequence, significantly reducing the harmful effects of the mutation and maintaining protein structural and functional stability; simultaneously, it can adapt to the codon usage preferences of different organisms, ensuring normal growth and genetic stability.

[0022] This invention discloses the application of the GROWTH-REGULATING FACTOR 16 (GRF16) gene in regulating maize ear development and grain size, thereby affecting yield per plant. This invention constructs a miR396-insensitive form of the GRF16 gene (i.e., a miR396-resistant GRF16 gene, abbreviated as rGRF16). Based on codon degeneracy, site-directed base mutations are performed on the GRF16 coding sequence. This mutation only alters the target binding sequence of the gene transcript without changing its encoded amino acid sequence, thus blocking the targeted cleavage and degradation of the GRF16 transcript by endogenous miR396, achieving the goal of overexpressing the GRF16 gene. The results show that the miR396-insensitive rGRF16 transgenic plants exhibit longer ears and larger kernels. This indicates that the miR396-insensitive form of the GRF16 gene can promote ear development in transgenic maize plants, showing phenotypes of increased ear length, larger kernels, and higher kernel weight. This invention provides a theoretical basis for promoting maize ear development and improving maize yield traits, and has significant application prospects.

[0023] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the examples are conventional methods well known to those skilled in the art, and the reagents used are all commercially available products.

[0024] Construction of rGRF16 gene expression vector See Figure 1 The coding sequence of the maize GRF16 gene was analyzed using SnapGene Viewer software (version 6.0, GSL Biotech). Based on homology sequence alignment results, a miR396 target recognition site was identified at base pairs 744-768 of the GRF16 gene coding region, with the nucleotide sequence 5'-CATCGTTCAAGAAAGCATGTGGAA-3' (as shown in positions 744-768 of SEQ ID NO. 1). A schematic diagram illustrating the miR396 target site for recognizing the GRF16 gene transcript is shown below. Figure 1 As shown.

[0025] in, Figure 1 The red text indicates the rGRF16 mutant base. This represents a codon reading frame. A, adenine; G, guanine; C, cytosine; U, uracil. H, histidine; R, arginine; S, serine; K, lysine; V, valine; E, glutamate.

[0026] To prevent the transcript of the GRF16 gene from being recognized and cleaved by miR396 without altering the amino acid sequence of the encoded GRF16 protein, this invention utilizes codon degeneracy to design synonymous mutations in the base sequence of the recognition site. Without changing any amino acid encoding, the nucleotide sequence of this recognition site is mutated from 5'-CATCGTTCAAGAAAGCATGTGGAA-3' to 5'-CACAGGAGCCGGAAACACGTAGAG-3'. The resulting gene is named rGRF16, which encodes an amino acid sequence identical to the wild-type GRF16 gene, but its transcript is resistant to miR396-mediated cleavage. The complete nucleotide sequence of the rGRF16 gene is shown in SEQ ID NO. 2.

[0027] The process of obtaining the rGRF16 gene fragment is as follows: 1. Plant materials Leaf tissues from maize inbred line (B73) V3 were taken, quickly frozen in liquid nitrogen, and then stored at -80℃ for later use.

[0028] 2. Total RNA extraction Total RNA was extracted from leaves using the Trizol method. The specific procedure was as follows: leaf powder ground in liquid nitrogen was transferred to a centrifuge tube containing Trizol reagent, thoroughly vortexed, lysed at room temperature, and then extracted with chloroform. The supernatant was collected by centrifugation, and RNA was precipitated with isopropanol. The precipitate was washed with 75% ethanol, dried, and dissolved in DEPC-treated water. RNA integrity and concentration were assessed by agarose gel electrophoresis and spectrophotometry.

[0029] 3. Reverse transcription to synthesize cDNA Using the extracted total RNA as a template, cDNA was synthesized by reverse transcription using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientifi, K1622).

[0030] 4. PCR amplification of the rGRF16 gene Based on the known sequence of the maize GRF16 gene in the NCBI database (LOC100285734), and the target mutation site ( Figure 1 Design specific primers to amplify its full-length coding region (CDS). Primer sequences are as follows: Forward primer 1: ATGGACCTGGGCGGGT Reverse primer 1: CTCTACGTGTTTCCGGCTCCTGTGGCGTCCCCGGTTCATGT Forward primer 2: CAGGAGCCGGAAACACGTAGAGGGCCAGCCTGGCCATG Reverse primer 2: TCACACAAGGCGGATGCTTGGA Using cDNA as a template, PCR amplification was performed using the high-success-rate PCR polymerase KOD FX (TOYOBO, KFX-101).

[0031] 5. Gene fragment recovery and sequencing verification PCR products were separated by 1% agarose gel electrophoresis, the target band was excised, and purified and recovered using the Fastpure Gel DNA Extraction Mini Kit (Vazyme, DC301-01). The recovered product was ligated into the TOPO vector (AidLab, CV1702), transformed into E. coli DH5α competent cells, and positive clones were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results were compared with sequences in the NCBI database, confirming that the cloned fragment was the full-length CDS of the rGRF16 gene.

[0032] 6. Construction of rGRF16 overexpression vector The cloned rGRF16 fragment was inserted into the plant expression vector pCambia3301. Homologous recombination was used for cloning, following the instructions for the homologous recombinase (Jinsha Biotechnology, SC612). The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing the appropriate antibiotics, and incubated overnight at 37°C. Single colonies were picked and cultured by shaking, and plasmids were extracted for PCR identification and sequencing verification.

[0033] The identification primers are: Forward primer: ACAGCTATGACATGATTACGAATTCTGCGAGCCTAATCGGGCA Reverse primer: CCTGCAGGTCGACTCTAGAGGATCCCACAAGGCGGATGCTTGGA The vector was constructed according to the instructions of the homologous recombinase (SC612, Jinsha Biotechnology, Beijing). The digested vector was ligated with the rGRF16 sequence with added homologous arm mutation, and the miR396 insensitive GRF16 gene editing vector was finally constructed. After sequencing was confirmed to be correct, it was used for subsequent maize genetic transformation.

[0034] Genotyping The GRF16 gene in rGRF16 transgenic plants was amplified by PCR, and the PCR product was sequenced and compared with the wild-type sequence. Results are as follows: Figure 3 As shown. WT represents wild-type GRF16 gene plants, and MT represents rGRF16 base mutant plants. Red text indicates the mutated bases in rGRF16.

[0035] The identification primers are: Forward primer: ATGGAGTCCTCCCCTGTGG Reverse primer: GGGAAATTCGAGCTGGTCACC Preparation of transgenic plants The constructed vector has the sequence shown in SEQ ID NO.3, and its map is shown in... Figure 2 As shown, the maize inbred line KN5585 was transformed using Agrobacterium-mediated transformation. The transgenic maize material was genetically transformed by Weimi Biotechnology (Jiangsu) Co., Ltd. T0 generation transgenic maize material was obtained through Agrobacterium transformation of maize embryos and tissue culture. After being planted in the field, T1 generation positive seeds were obtained through self-pollination or testcross combined with PCR genotyping. After multiple generations of selection, three independent rGRF16 transgenic homozygous lines were obtained, named rGRF16-OE2, rGRF16-OE3, and rGRF16-OE5. These three lines represent three independent T-DNA insertion events, each with a different T-DNA insertion site. To ensure that the observed phenotypes stemmed from GRF16 overexpression rather than a specific insertion site effect, we compared these three independent events simultaneously in subsequent analyses, focusing on their consistent phenotypic changes.

[0036] See Figure 4-6 Using wild-type maize plants (WT) as a control, kernel length, kernel width, 100-kernel weight, ear length, kernel yield per plant, and number of kernels per ear were measured in rGRF16 transgenic plants at three independent events (rGRF16-OE2, rGRF16-OE3, and rGRF16-OE5). The results showed that compared with the wild type, rGRF16 gene overexpression plants exhibited significantly increased kernel length, kernel width, 100-kernel weight, ear length, kernel yield per plant, and number of kernels per ear, indicating that overexpression of the GRF16 gene can improve kernel and ear-related traits in maize and increase yield per plant.

[0037] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A nucleic acid molecule that can regulate the development of maize female ears, characterized in that, The nucleic acid molecule is the rGRF16 gene. Compared with the wild-type GRF16 in the maize genome, the rGRF16 gene introduces a synonymous mutation at the miR396 recognition site, so that the amino acid sequence encoded by the rGRF16 gene is the same as that encoded by the GRF16 gene, and the mRNA transcribed from the rGRF16 gene cannot be recognized and cleaved by miR396. The nucleotide sequence of the GRF16 gene is shown in SEQ ID NO.

1.

2. The nucleic acid molecule for regulating maize ear development according to claim 1, characterized in that, The synonymous mutation is located in the nucleotide region of position 744-768 bp of the GRF16 gene, where at least one or more bases are mutated, and the amino acid sequence remains unchanged.

3. The nucleic acid molecule for regulating maize ear development according to claim 2, characterized in that, The nucleotides at positions 744-768 bp of the GRF16 gene are 5'-CATCGTTCAAGAAAGCATGTGGAA-3', and the nucleotides at positions 744-768 bp of the rGRF16 gene are 5'-CACAGGAGCCGGAAACACGTAGAG-3'.

4. The nucleic acid molecule for regulating maize ear development according to claim 3, characterized in that, The nucleotide sequence of the rGRF16 gene is shown in SEQ ID NO.

2.

5. A recombinant vector, characterized in that, Includes nucleic acid molecules as described in any one of claims 1-4.

6. The recombinant vector according to claim 5, characterized in that, The sequence of the recombinant vector is shown in SEQ ID NO.

3.

7. A method for preparing a transgenic maize plant, characterized in that, include: Synonymous mutations in the base sequence of the GRF16 gene that is recognized by miR396 result in the rGRF16 gene. Without affecting the amino acid composition, the mRNA transcribed from the rGRF16 gene cannot be recognized and cleaved by miR396. The enzyme-digested vector was ligated with the rGRF16 sequence to construct a miR396-insensitive rGRF16 gene recombinant vector. Transgenic maize plants were obtained by introducing Agrobacterium-mediated transformation into maize embryonic cells, followed by co-culture, screening, differentiation, and regeneration.

8. A transgenic maize plant, characterized in that, Its genome contains and expresses the rGRF16 gene as described in any one of claims 1-4.

9. The transgenic maize plant based on claim 8, characterized in that, Compared with wild-type control maize plants that do not contain the rGRF16 gene, the transgenic maize plants exhibit increased ear length and / or larger kernels.

10. The application of a nucleic acid molecule capable of regulating maize ear development as described in any one of claims 1-4, characterized in that, It is used to regulate corn plants to increase ear length and / or increase kernel size.

Images