Biomarkers for detecting a possible intolerance to metal implants

Abstract

Method for predicting an increased risk of increased intolerance to metal implants in a test subject, wherein an isolated sample containing genetic material of the test subject is used: a) a single nucleotide variation rs1143627 AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG, SEQ ID NO: 1, in the gene encoding interleukin 1 beta, is examined and it is determined whether a C is present at the position of the single nucleotide variation and / or b) a VNTR polymorphism rs2234663 with the repeat unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, SEQ ID NO: 2, in the gene encoding the IL1 receptor antagonist, IL1-RN, is examined and it is determined whether the repeat unit is present five times.

Description

[0001] The invention relates to a method and a kit for predicting an increased risk of increased intolerance to metal implants.

[0002] Implants are playing an increasingly important role in the orthopedic and dental fields, for example. Such implants are often made of metal, such as pure titanium, or metal alloys. However, this is accompanied by an increase in the number of implant intolerance reactions [1-4]. For example, even small amounts of impurities or foreign materials in the metal, such as nickel, can lead to an inflammatory or allergic reaction. Wear particles absorbed by macrophages and monocytes, or corrosion processes, can also trigger inflammatory reactions. However, complications are also observed with endoprostheses that cannot be attributed to known causes, such as corrosion or abrasion products or infections.So far, mysterious excessive inflammatory reactions have been identified, which can be accompanied, for example, by swelling, recurrent joint effusions, pain, restricted movement, loosening or failure of an implant.

[0003] The object of the present invention is to improve the prognosis of possible complications when using metal implants.

[0004] To achieve the object, the invention provides a method for predicting an increased risk of increased intolerance to metal implants in a test person, wherein in an isolated sample with genetic material of the test person: a) a single nucleotide variation rs1143627AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG, SEQ ID NO: 1, in the gene encoding interleukin 1 beta is examined and it is determined whether a C is present at the position of the single nucleotide variation and / or b) a VNTR polymorphism rs2234663 containing the repeat unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, SEQ ID NO: 2, in the gene encoding the IL1 receptor antagonist, IL1-RN, is examined and it is determined whether the repeat unit is present five times.

[0005] Surprisingly, it has been found that the polymorphisms rs1143627 and rs2234663 are suitable biomarkers for determining a potentially increased risk of a person who is about to receive or has already received a metal implant developing intolerance to the implant. An increased risk can be assumed if the single nucleotide variation rs1143627 is C and not T at the position of the single nucleotide variation, and / or if the repeat unit ("repeat") in the VNTR polymorphism rs2234663 is present five times in tandem. The intolerance can manifest itself particularly in an increased tendency to inflammation, which leads to implant loosening (with osteolysis), pain, effusions, and functional impairment (e.g., reduced mobility of joint prostheses).

[0006] Without wishing to be bound to any particular theory, it is assumed that the biomarkers indicate a genetically determined imbalance in inflammatory regulation. This leads to intolerance in response to the "foreign body" implant. The human immune system reacts differently from individual to the same inflammatory stimulus (e.g. bacteria, implant materials), with the course of the immune response being determined by the ratio of pro- and anti-inflammatory messengers (e.g. cytokines), which play a significant role in the defense mechanism. The cytokine IL-1 is one of the most important pro-inflammatory messengers. An excessive release of this messenger, caused for example by a genetic polymorphism, can lead to an overreaction of the immune system. The pro-inflammatory effect of IL-1 is normally downregulated by the antagonist IL-RN.However, if a polymorphism that reduces efficacy is present here as well, the anti-inflammatory effect that counteracts the inflammatory messenger IL-1 is lacking, which can subsequently lead to an excessive inflammatory reaction. This may at least partially explain cases in which a strong inflammatory reaction to an implant occurs without any identifiable cause.

[0007] The method according to the invention can, for example, be used to determine, prior to implantation, whether a person requiring an implant is more likely to experience complications, particularly excessive inflammatory reactions, when using a metal implant. In such a case, a different implant material, such as ceramic, can be used instead. The invention can be advantageous not only in the fields of orthopedics or endoprosthetics, for example, but also in dental implants.

[0008] The term “increased tendency towards intolerance to metal implants” refers to an increased probability of an intolerance reaction, in particular an inflammatory reaction, towards a metal implant compared to the average population.

[0009] An "implant" or "endoprosthesis" refers to an artificial material implanted in the body that is intended to remain there permanently or at least for an extended period of time. Examples of implants include hip, knee, shoulder, or dental implants. The term also includes osteosynthesis devices such as plates, nails, or screws that are implanted into the body.

[0010] A “metal implant” is understood here to mean a cobalt-chromium-molybdenum-based, stainless steel-based or titanium implant, in particular a hip / knee prosthesis or dental implant.

[0011] The term “arthroplasty” (also “alloarthroplasty”) is used here in particular in relation to the use of joint endoprostheses, ie the replacement of one or more joint surfaces with allogeneic, ie foreign, non-biological material.

[0012] The term "polymorphism" refers to sequence variations in the genes of a population. Different individuals within a population, or even different cells within an individual, can exhibit different variants of a particular gene at the same locus due to such sequence variations, also known as "alleles." This term encompasses, for example, variations in individual nucleotides (SNVs or SNPs) or the occurrence of a different number of sequence repeats (e.g., minisatellite sequences, VNTRs).

[0013] The term "single nucleotide variation rs1143627" (possibly also referred to as IL-1B-31) refers to a variation affecting a single nucleotide at position -31 (relative to the start codon) in the promoter region of the gene encoding interleukin 1 beta (IL-1B, IL-1β). This variation can be a C or a T (e.g., NG_008851.1:g.4970C>T according to the HGVS nomenclature recommendation, see

[11] ). A sequence of the respective region with the single nucleotide variation (SNV) is shown below: AGCCTCCTACTTCTGCTTTTGAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG (SEQ ID NO: 1)

[0014] The nucleotide variants in question (here C or T) are indicated in square brackets. Instead of the term "single nucleotide variation" or SNV, the term "single nucleotide polymorphism" or SNP (single nucleotide polymorphism) may also be used synonymously.

[0015] The term “VNTR polymorphism rs2234663” (possibly also referred to as “Intron 2 VNTR rs2234663” or “Intron 2 VNTR”) refers to a polymorphism in which a variable number (2-6) of tandemly arranged repeat units (VNTR, variable number tandem repeat) with the sequence ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2) is present in the gene that encodes the IL1 receptor antagonist (IL1-AN or IL1-RN). A sequence with four repeat units is shown, for example, in the LRG sequence (LRG = Locus Reference Genomic sequence) LRG_188 (see http: / / ftp.ebi.ac.uk / pub / databases / lrgex / LRG_188.xml, see also NCBI reference sequence with accession number NG_021240.1). According to the HGVS nomenclature recommendation (see

[11] ), the VNTR polymorphism with five repeat units would be designated g.17637_17722[5].

[0016] The term "atopic disease" refers to a condition that is based on a genetically determined predisposition to react to airborne, gastrointestinal, or cutaneous contact with natural or artificial environmental substances with an immediate allergic reaction (type I allergy), i.e., with increased IgE production. Atopic diseases often involve the interfaces between the respiratory and gastrointestinal mucous membranes, as well as the skin. Examples of atopic diseases include allergic bronchial asthma, allergic rhinitis (allergic rhinoconjunctivitis), and atopic dermatitis (atopic eczema, neurodermatitis).

[0017] Preferably, in the method according to the invention, the VNTR polymorphism rs2234663 with the repeat unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, SEQ ID NO: 2, in the gene encoding the IL1 receptor antagonist, IL1-RN, is examined and it is determined whether the repeat unit is present five times.

[0018] Particularly preferably, the method according to the invention additionally determines whether the test subject has an atopic disease. Examples of atopic diseases include bronchial asthma, allergic rhinoconjunctivitis, and atopic dermatitis. In particular, the combination of the presence of a VNTR polymorphism rs2234663 with five repeat units and an atopic disease can indicate an increased risk of complications, particularly increased inflammatory reactions, occurring in the affected person upon implantation of a metal implant.

[0019] In a further aspect, the invention also relates to a kit for carrying out the method according to the invention. The kit according to the invention comprises the primer sequences listed in Table 1: Table 1 Polymorphism Primer sequences SEQ ID NO Annealing-Temperature IL-1B-31 TCTTTTCCCCTTTCCTTTAACT 10 52°C (rs1143627) GAGAGACTCCCTTAGCACCTAGT 11 IL-1RN Intron 2 VNTR CCCCTCAGCAACACTCC 12 65°C (rs2234663) GGTCAGAAGGGCAGAGA 13

[0020] The invention is described in more detail below using exemplary embodiments purely for illustrative purposes.

[0021] A study was conducted in which 195 patients with total joint replacements participated under informed consent. The study was approved by the local ethics committee and registered under study ID 230-12 at ClinicalTrials.gov.

[0022] 102 patients (72 female, 30 male, 41-81 years of age) had arthroplasties with complications. The control group consisted of 93 patients (70 female, 23 male, 18-96 years of age) with normal functioning arthroplasties. questionnaire

[0023] A questionnaire-based medical history was collected, including information on smoking, medication use, implant type, history of metal allergy, and a history of atopic diseases such as allergic rhinitis, atopic eczema, or asthma. Additionally, the orthopedic WOMAC (Western Ontario and McMaster Universities Osteoarthritis Index, WOMAC) questionnaire was used to quantify the patient's self-assessment of the prosthetic joint's performance regarding pain, stiffness, and functional limitation [5]. Allergens and patch tests

[0024] All patients underwent allergological patch testing using Almirall Hermal patch test preparations and Finn chambers on Scanpor (Almirall Hermal, Reinbek, Germany). The substances were applied to the upper back on day 0. The standard series of 29 allergens, a routine supplementary series, and a bone cement series (if the respective patients had a cemented endoprosthesis) were tested according to the guidelines of the German Contact Dermatitis Research Group (DKG) [6]. Measurements were performed by physicians from the allergy department on days 2, 3, and 6. The reactions described here as positive were reactions classified as +, ++, and +++. Lymphocyte transformation test (LTT)

[0025] A lymphocyte transformation test (LTT) was performed according to Summer et al. [7]. Briefly, peripheral blood mononuclear cells (PBMC) were isolated by density centrifugation and stimulated for four days in four parallel assays with different concentrations of NiSO4, CoCl2, or CrCl3. Control stimuli were the T-cell mitogen phytohemagglutinin (PHA, Biochrom, Berlin, Germany) 2.4 µg / ml, and tetanus toxoid as a control recall antigen (TT, Chiron Behring, Berlin, Germany) 5 µg / ml. After 5 days, the PBMC were 3 H-thymidine was pulsed, and proliferation was determined after overnight incubation by measuring the uptaken radioactivity. The results are expressed as the stimulation index (SI), which is the ratio of uptaken radioactivity in stimulated versus non-stimulated control cultures. An SI ≥3 was considered a positive response. Polymorphism analysis

[0026] DNA was isolated from the patient's peripheral blood using the peqGOLD Blood DNA Mini Kit (Peqlab, Erlangen, Germany) according to the manufacturer's protocol. The resulting DNA was diluted with distilled water to a final concentration of 40 ng / µl. The three polymorphisms IL-1B-3954 (rs1143634), IL-1B-31 (rs1143627), IL1-B-511 (rs16944), and the minisatellite sequence IL-1 RN Intron 2 VNTR (rs2234663) were analyzed by PCR, digestion with the restriction enzymes TaqI, AluI, or AvaI, followed by gel electrophoresis. The DNA sequences of the polymorphisms are given in Table 1. Table 2: Polymorphisms investigated and the corresponding DNA sequences Polymorphism DNA-Sequenz IL-1 B-3954 CTCCACATTTCAGAACCTATCTTCTT[C / T]GACACATGGGATA (rs1143634) ACGAGGCTTATG (SEQ ID NO:3) IL-1 B-511 CTACCTTGGGTGCTGTTCTCTGCCTC[A / G]GGAGCTCTCTGTC (rs16944) AATTGCAGGAGC (SEQ ID NO: 4) IL-1B-31 AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCG (rs1143627) AGGGAGAACTGG (SEQ ID NO: 1) IL-1RN ACTCCTATTGACCTGGAGCACAGGT[(ATCCTGGGGAAAGTG Intron 2 VNTR AGGGAAATATGGACATCACATGGAACAACATCCAGGAGA (rs2234663) CTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC)2 / 3 / 4 / 5 / 6]TT GGTTTA (SEQ ID NO: 5-9)

[0027] The polymorphisms with their respective restriction enzyme and the resulting fragments are given in Table 2. Table 2: The analyzed polymorphisms with the respective restriction enzymes and the resulting DNA fragment lengths Polymorphism Restriction enzyme Fragment length (bp) IL-1B-3954 Taq I T: 250 bp (rs1143634) C: 136 bp + 114 bp IL-1 B-31 With 1 C: 281 bp (rs1143627) T: 184+97bp IL-1 B-511 Ava 1 A 304 bp (rs16944) G 189 bp + 115 bp IL-1RN Ø Allele 1: 412 bp (4 repeats) Intron 2 VNTR Allele 2: 240 bp (2 repeats) (rs2234663) Allele 3: 498 bp (5 repeats) Allele 4: 326 bp (3 repeats) Allele 5: 584 bp (6 repeats) statistics

[0028] The statistical analysis was carried out in collaboration with the Institute of Statistics of the Ludwig Maximilian University of Munich using cross-tabulations with Fisher's exact tests with an allele model and a risk analysis (odds ratio) according to several authors [8-10]. Results

[0029] Patients with arthroplasty complications exhibited various symptoms such as pain (84.1%), followed by reduced range of motion (78.4%), swelling (71.6%), and others. This is also reflected in the WOMAC score, where 100 points indicate perfect functionality. Here, the arthroscopy control patients confirmed the good performance of the arthroplasty with a high mean score of 82.13 ± 18.11. On the other hand, patients with arthroplasty complications showed a low mean WOMAC score of 42.06 ± 10.12. In the arthroplasty complications group, the rate of atopic diseases was higher (24.5% vs. 16.1%), with hay fever representing the largest fraction (18.7% vs. 11.8%). There was also a higher number of patients with a history of metal hypersensitivity in the arthroplasty complication group (24.05% vs. 9.7%). The positive metal patch test results were as follows: nickel 19.6% vs.9.7%, cobalt 6.9% vs. 3.2%, chromium 2.0% vs. 1.1%. A larger number of patients were positive in the LTT. Of the patients with arthroplasty complications, 28.4% had a positive LTT to nickel, 2.9% to cobalt, and 2.9% to chromium. Fewer patients in the control group had a positive LTT: 19.4% to nickel, 1.1% to cobalt, and none to chromium. The results of the questionnaire, patch test, and LTT are shown in Table 3. Table 3: Results of questionnaire, patch test, and LTT in the patient groups. MW = mean, SD = standard deviation Injured Arthroplasty Patients (n=102) Arthroplasty control patients (n=93) Complaints: 96 94,1% 0 0% Pains 15 14,7% 0 0% eczema 7 6,9% 0 0% effusion 31 30,4% 0 0% swelling 73 71,6% 0 0% Relaxation 20 19,6% 0 0% Restricted movement 80 78,4% 0 0% WOMAC value (mean ± SD 42,06 ±10,12% 92,13 ±18,11% Smoke: Earlier 19 18,6% 16 16,7% Current 7 6,9% 4 3,8% In total 26 25,5% 20 20,5% Atopy: Atopy (total) 25 24,5% 15 16,1% hay fever 19 18,7% 11 11,8% asthma 13 12,7 5 5,4% Atopic eczema 0 0,0% 0 0,0% Metal hypersensitivity (history of history) 25 24,5% 9 9,7% Patch test: Nickel-positive 20 19,6% 9 9,7% Cobalt-positive 7 6,9% 3 3,2% Chromium-positive 2 2,0% 1 1,1% Gentamicin-positive 9 8,8% 0 0,0% Benzoyl peroxide positive 8 7,8% 2 2,2% HEMA positive 2 2,0% 0 0,0% N,N-Dimethyl-p-toluidine-positive 2 2,0% 0 0,0% LTT: Nickel-positive 29 28,4% 18 19,4% Cobalt-positive 3 2,9% 1 1,1% Chromium-positive 3 2,9% 0 0,0%

[0030] There were no differences in the allele frequencies of the two different alleles, C or T, of the IL-1B polymorphism 3954. Subgroup analysis in patients with or without atopy, positive or negative patch test, or LTT also showed no relevant differences. There was a slight trend toward a higher frequency of the C allele in the control group, especially in patients without atopy, without a positive patch test, or positive LTT reaction. The results for the IL-1B polymorphism 3954 are presented in Table 4. Table 4: Allele frequencies of the IL-1 B-3954 polymorphism, including subgroup analysis. Results of Fisher's exact test and Fisher's odds ratio (+95% confidence interval, CI) are presented. Allele IL-1B 3954 Arthroplasty patients with complaints (n=102) Arthroplasty control patients (n=93) p (Fisher's exact test) Odds ratio [95% CI] Allele frequencies (n=204) [%] Allele frequencies (n=186) [%] In total C 184 90,2 174 95,6 0,050 0,423 [0,182-0,985] T 86 42,2 72 39,6 0,682 1,113 [0,741-1,672] With C 46 92,0 28 93,3 1,000 0,821 [0,141-4,780] Atopy T 22 44,0 18 60,0 0,254 0,524 [0,209-1,314] no C 134 89,3 146 96,1 0,028 0,344 [0,131-0,905] Atopy T 62 41,3 54 35,5 0,344 1,279 [0,803-2,035] Patch test C 46 95,8 24 92,3 0,609 1,917 [0,254-14,465] pos. T 18 37,5 12 46,2 0,620 0,700 [0,266-1,842] Patch test C 138 88,5 150 96,2 0,018 0,307 [0,118-0,985] negative T 68 43,6 60 38,5 0,420 1,236 [0,103-2,748] LTT C 52 89,7 32 94,1 0,705 0,542 [0,103-2,748] pos. T 30 51,7 18 52,9 1,000 0,925 [0,408-2,223] LTT C 94 87,0 106 94,6 0,061 0,380 [0,140-1,029] negative T 46 42,6 38 33,9 0,212 1,445 [0,837-2,495]

[0031] The IL-1B-31 polymorphism with the T allele had higher frequencies in the control group (84.3% vs. 48%). This may reflect a "protective" genotype that can reduce the immunological response to the implant. This difference in T allele frequencies was also present in the subgroup analysis. The results of the IL-1B-31 allele frequencies are presented in Table 5. Table 5: Allele frequencies of the IL-1B-31 polymorphism including subgroup analysis. The results of Fisher's exact test and odds ratio (+ 95% confidence interval, CI) are shown. Allele IL-1B -31 Arthroplasty patients with complaints (n=102) Arthroplasty control patients (n=93) p (Fisher's exact test) Odds ratio [95% CI] Allele frequencies (n=204) [%] Allele frequencies (n=186) [%] In total T 98 48,0 150 84,3 0,00000052 0,173 [0,106-0,281] C 156 76,5 112 62,9 0,005 1,915 [1,228-2,986] With T 18 36,0 26 86,7 0,00008 0,087 [0,028-0,288] Atopy C 42 84,0 18 60,0 0,031 3,500 [1,223-10,015] no T 76 50,7 124 83,8 0,0000092 0,199 [0,116-0,342] Atopy C 110 73,3 94 63,5 0,081 1,580 [0,965-2,586] Patch test T 24 50,0 22 91,7 0,001 0,091 [0,019-0,430] pos. C 38 79,2 14 58,3 0,093 2,714 [0,932-7,909] Patch test T 74 47,4 128 83,1 0,0000003 0,183 [0,108-0,310] negative C 118 75,6 98 63,6 0,026 1,774 [1,086-2,900] LTT T 24 41,4 30 88,2 0,000008 0,094 [0,029-0,302] pos. C 44 75,9 16 47,1 0,007 3,536 [1,433-8,722] LTT T 50 46,3 88 81,5 0,000001 0,196 [0,106-0,363] negative C 84 77,8 76 70,4 0,277 1,474 [0,798-2,722]

[0032] There were no relevant differences in the allele frequencies of the IL-1B-511 polymorphism. There was a trend toward a higher frequency of the C allele of this polymorphism in the control group, but this was not statistically significant. The results for the IL-1B-511 polymorphism are presented in Table 6. Table 6: Allele frequencies of the IL-1B 511 polymorphism including subgroup analysis. The results of Fisher's exact test and odds ratio (+ 95% confidence interval, CI) are shown. Allele IL-1B 511 Arthroplasty patients with complaints (n=102) Arthroplasty control patients (n=93) p (Fisher's exact test) Odds ratio [95% CI] Allele frequencies (n=204) [%] Allele frequencies (n=186) [%] In total C 150 73,5 158 87,8 0,0005 0,387 [0,225-0,666] T 130 63,7 106 58,9 0,346 1,226 [0,812-1,851] With C 30 60,0 22 73,3 0,333 0,545 [0,203-1,464] Atopy T 36 72,0 18 60,0 0,327 1,714 [0,659-1,675] no C 116 77,3 136 90,7 0,003 0,351 [0,180-0,686] Atopy T 90 60,0 88 58,7 0,906 1,057 [0,667-1,675] Patch test C 34 70,8 24 92,3 0,040 0,202 [0,042-0,974] pos. T 30 62,5 16 61,5 1,000 1,042 [0,390-2,783] Patch test C 116 74,4 134 87,8 0,006 0,433 [0,240-0,782] negative T 100 64,1 90 58,4 0,351 1,270 [0,803-2,007] LTT C 40 69,0 30 88,2 0,044 0,296 [0,091-0,966] pos. T 38 65,5 20 58,8 0,655 1,330 [0,556-3,180] LTT C 82 75,9 98 87,5 0,035 0,451 [0,221-0,919] negative T 70 64,8 72 64,3 1,000 1,023 [0,589-1,778]

[0033] In the IL-1B RN intron 2 VNTR, there was a much higher risk of arthroplastic complications, correlating with allele 3 (498 bp, 5 repeat units). Interestingly, this risk was increased if patients also had atopic disease. This risk did not correlate with patch test response or LTT reactivity. The results for the IL-1B RN intron 2 VNTR are presented in Table 7. Table 7: Allele frequencies of the IL-1B RN-VNTR polymorphism including subgroup analysis. The results of Fisher's exact test and odds ratio (+ 95% confidence interval, CI) are shown. Alleles IL-1B RN VNTR Arthroplasty patients with complaints (n=102) Arthroplasty control patients (n=93) p (Fisher's exact test) Odds ratio [95% CI] Allele frequencies (n=204) [%] Allele frequencies (n=186) [%] In total 240bp 48 27,6 44 28,2 0,903 0,970 [0,599-1,570] 326bp 6 3,4 6 3,8 1,000 0,905 [0,289-2,865] 412bp 128 72,7 136 86,1 0,030 0,431 [0,247-0,755] 498bp 86 49,4 36 22,8 0,0000475 3,312 [2,058-5,331] 595bp 6 3,4 0 0,0 0,031 0515 [0,464-0,573] With 240bp 8 19,0 10 33,3 0,182 0,471 [0,160-1,138] Atopy 326 bp 0 0,0 2 6,7 0,170 0,400 [0,300-0,533] 412bp 30 71,4 28 93,3 0,032 0,179 [0,037-0,870] 498bp 36 85,7 4 13,3 0,00000001 39,000 [9,990-152,257] 595bp 2 4,8 0 0,0 0,507 0,571 [0,467-0,700] no 240bp 40 31,3 34 27,0 0,491 1,230 [0,715-2,116] Atopy 326bp 6 4,7 4 3,1 0,749 1,525 [0,420-5,536] 412bp 94 72,3 108 84,4 0,023 0,484 [0,262-0,892] 498bp 50 39,1 32 25,0 0,022 1,923 [1,126-3,283] 595bp 4 3,1 0 0,0 0,122 0,492 [0,434-0,558] Patch test 240bp 4 9,1 2 11,1 1,000 0,800 [0,133-4,809] pos. 326bp 0 0 0 0 nb nb 412bp 34 77,3 18 90,0 0,312 0,378 [0,075-1,913] 498bp 26 59,1 4 20,0 0,006 5,778 [1,656-20.159] 595bp 2 4,5 0 0 1,000 0,677 [0,571-0,804] Patch test 240bp 44 33,8 42 30,4 0,601 1,169 [0,700-1,954] negative 326bp 6 4,6 6 4,3 1,000 1,065 [0,334-3,388] 412bp 94 71,2 118 85,4 0,005 0,419 [0,229-0,768] 498bp 60 46,2 32 23,2 0,0001 2,839 [1,680-4,798] 595bp 4 3,1 0 0 0,054 0,477 [0,421-0,541] LTT 240bp 8 16,7 4 14,3 1,000 1,200 [0,326-4,414] pos. 326bp 4 8,3 0 0 0,290 0,611 [0,508-0,735] 412bp 38 76,0 26 92,2 0,073 0,244 [0,050-1,180] 498bp 30 62,5 6 21,4 0,001 6,111 [2,085-17,911] 595bp 0 0 0 0 nb nb LTT 240bp 30 31,3 32 32,0 1,000 0,966 [0,529-1,764] negative 326bp 2 2,1 6 5,9 0,281 0,340 [0,067-1,729] 412bp 72 75,0 84 82,4 0,227 0,643 [0,323-1,278] 498bp 44 45,8 24 23,5 0,001 2,750 [1,496-5,055] 595bp 2 2,1 0 0 0,234 0,480 [0,415-0,555] Reference list 1. Sharkey PF et al. Why are total knee arthroplasties failing today. J Arthroplasty 2017; 29:1774-1778 2. Thomsen M et al. Adverse reactions to orthopedic surgical metal implants after knee replacement. Hautarzt 2016;67:347-351 3. Granchi D et al. Sensitivity to implant materials in patients undergoing total hip replacement. J Biomed Mater Res B Appl Biomater 2006;77(2):257-64 4. Thomas P, Summer B. Diagnosis and management of patients with allergy to metal implants. Exp Rev Clin Immunol. 2015;11(4):501-509 5. Stucki G et al. Evaluation of a German version of the WOMAC (Western Ontario and McMaster Universities) osteoarthritis index. Z Rheumatol 1996;55(1):40-49 6. Schnuch A et al. Conducting patch tests with contact allergens. Guidelines of the German Dermatological Society and the German Society for Allergy and Clinical Immunology. JDDG 2008;6(9):770-775 7. Summer B et al. Nickel (Ni) allergic patients with complications to Ni containing joint replacement show preferential IL-17 type reactivity to Ni. Contact Dermatitis 2010;63:15-22 8. Colhoun HM et al. Problems of reporting genetic associations with complex outcomes. Lancet. 2003;361(9360):865-72 9. Yang H et al. Association of interleukin gene polymorphisms with the risk of coronary artery disease. Genetics and molecular research : GMR. 2015;14(4):12489-96. 10. Lopez-Mejias R et al. Interleukin 1 beta (IL1ss) rs16944 genetic variant as a genetic marker of severe renal manifestations and renal sequelae in Henoch-Schonlein purpura. Clinical and experimental rheumatology. 2016;34(3 Suppl 97):S84-8. 11. den Dunnen et al., HGVS Recommendations for the Description of Sequence Variants: 2016 Update, HUMAN MUTATION, Vol. 37, No. 6, 564-569, 2016, doi10.1002 / humu.22981. This is followed by a sequence listing as an electronic document. This can be accessed both in DEPATISnet and in the DPMA register.

Claims

[1] A method for predicting an increased risk of increased intolerance to metal implants in a test person, wherein in an isolated sample containing genetic material of the test person: a) a single nucleotide variation rs1143627 AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG, SEQ ID NO: 1, in the gene encoding interleukin 1 beta is examined and it is determined whether a C is present at the position of the single nucleotide variation and / or b) a VNTR polymorphism rs2234663 containing the repeat unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, SEQ ID NO: 2, in the gene encoding the IL1 receptor antagonist, IL1-RN, is examined and it is determined whether the repeat unit is present five times. [2] The method according to claim 1, wherein the increased tendency to intolerance is an increased tendency to inflammation. [3] Method according to claim 1 or 2, wherein the possible presence of an atopic disease is additionally determined. [4] The method according to claim 3, wherein the possible presence of an atopic disease selected from allergic bronchial asthma, allergic rhinitis and atopic dermatitis is determined. [5] Kit for carrying out a method according to any one of claims 1 to 4, comprising the following PCR primers: a) TCTTTTCCCCTTTCCTTTAACT and GAGAGACTCCCTTAGCACCTAGT, and / or b) CCCCTCAGCAACACTCC and GGTCAGAAGGGCAGAGA.