METHOD FOR DETERMINING THE IMMUNE STATUS OF AN INDIVIDUAL IN VITRO OR EX VIVO
Patent Information
- Application Number
- DE602019078245
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-09-12
- Filing Date
- 2019-06-28
- Publication Date
- 2025-11-19
- Estimated Expiration
- 2039-06-28
AI Technical Summary
Current biomarkers for determining immune status, such as mHLA-DR expression and CD74 mRNA ratio, are not effective in identifying the inflammatory or immunosuppressive phases of immune dysregulation in patients with conditions like sepsis, and they require significant sample manipulation and specialized equipment, limiting their accessibility and standardization.
The method involves detecting and quantifying the expression of specific HERV/MaLR sequences, using molecular tools like DNA microarrays or PCR, to assess an individual's immune status by comparing the expression levels in a biological sample against a reference, allowing for early identification of immune dysregulation.
This approach provides a standardized and accessible method for determining immune status, capable of identifying immunosuppression or hyperactivity early in conditions like sepsis, with minimal sample handling and adaptable to various platforms, improving clinical management.
Description
[0001] The present invention relates to a method for determining in vitro Or ex vivo the immune status of an individual, preferably a patient, including a step of detection and / or quantification of the expression, in a biological sample of said individual, of one or more HERV / MaLR sequences, as well as the tools to implement it and the uses of these.
[0002] The immune system is the body's defense system against what is recognized as non-self, such as pathogens (e.g., viruses, bacteria, parasites). In mammals, two main types of mechanisms are distinguished: a non-specific defense mechanism, also called "innate" or "natural" immunity, and a specific defense mechanism, also called "acquired" or "adaptive" immunity.
[0003] These immune responses require very fine regulation. In a healthy individual, the immune response is considered "normal" (also referred to as immunocompetence). However, the immune response can sometimes be altered. We speak of an inflammatory state or hyperactive immune state when the immune system is more active than normal, as in the case of inflammatory or autoimmune diseases. In autoimmune diseases, the body's immune system triggers an inflammatory reaction with a characteristic immunization against self-antigens. Conversely, we speak of an immunosuppressive state (or immunodeficiency, immunodeficiency, hypoactive immune state, or immune paralysis) when the immune system is less active than normal.
[0004] Immunosuppression can have various origins, take many forms, and affect both innate and adaptive immunity. In particular, sepsis is a major public health problem, representing the leading cause of death in intensive care units. It is estimated that 28 million individuals develop sepsis each year worldwide, of whom 8 million will die from the condition (Fleischmann et al. (2016) American Journal of Respiratory and Critical Care Medicine;193(3):259-72). In a patient with sepsis (also known as septicemia), the immune response is dysregulated following an infection, leading to multiple and potentially fatal organ failure and dysfunction. This immune response is complex and evolves over time, with excessive and potentially concurrent pro-inflammatory and anti-inflammatory phenomena.All of these immune system dysregulations lead to organ failure, immune system paralysis, and secondary infections. Septic shock is a subtype of sepsis in which hypotension persists despite adequate fluid resuscitation (Singer et al. (2016) JAMA; 315(8): 801-810). In the initial stage of sepsis, an inflammatory, or even hyperinflammatory, response appears to predominate, causing tissue damage and organ failure, particularly in the kidneys. This is why clinical trials in the field of sepsis have long focused on anti-inflammatory treatments, but with inconclusive results. More recent studies on the pathophysiology of sepsis have shown that an anti-inflammatory or immunosuppressive response occurs in some septic patients, either concurrently with the initial inflammation or later.The patient may then find themselves in a state of immunosuppression, potentially severe, depending on the respective degrees of pro-inflammatory and anti-inflammatory responses. These immunocompromised patients have a high risk of developing nosocomial infections (or AIH). Health-care Associated Infections ) , and could benefit from immunostimulating treatments.
[0005] It is therefore important to be able to determine an individual's immune status, and in particular to identify immunosuppression, in order to tailor therapeutic management. However, individuals with immune system dysfunctions do not present specific clinical signs. There is thus a significant need for the identification of biomarkers to determine an individual's immune status.
[0006] Currently, the reference test for monitoring immune alterations in intensive care patients (e.g., patients with sepsis, trauma, who have undergone major surgery, burns, or patients with pancreatitis) is the decrease in HLA-DR expression ( human leucocyte antigen - D related ) à The surface area of monocytes (mHLA-DR), measured by flow cytometry. Indeed, this marker provides valuable information for predicting mortality and assessing the risk of secondary infections in these patients. HLA-DR is a surface receptor belonging to the MHC (major histocompatibility complex) class II. Measuring mHLA-DR expression, in particular, represents the gold standard to identify whether a patient with sepsis is immunocompromised or not (Monneret and Venet (2016) Cytometry Part B (Clinical Cytometry) 90B:376-386). However, this approach requires significant pre-analytical manipulation of the sample (Monneret and Venet (2014) Monocyte HLA-DR in sepsis: shall we stop following the flow? Crit Care 18:102). Furthermore, access to a flow cytometer is not always available in all hospitals, and the measurement is difficult to standardize from one hospital to another, or even from one technician to another.
[0007] To overcome these drawbacks, other biomarkers, using molecular biology tools, have been proposed, such as a biomarker based on the ratio of CD74 mRNA expression level on day 3 (following the patient's admission to a medical facility) to CD74 expression level on day 1. CD74 represents the γ-invariant chain of HLA-DR. The CD74 expression ratio on day 3 / day 1 has been shown to be associated with the development of intensive care unit-acquired infections (Peronnet et al. (2017) Intensive Care Medicine; 43(7):1013-20). Patent application WO2012 / 101387 describes a method for determining an individual's immune status by analyzing the expression of at least two genes selected from several gene groups. Patent application WO2004 / 42346 proposes a test to assess the immune status in a patient in which the level of expression of one or more genes is measured.
[0008] A method for determining immunocompromised or non-immunocompromised status, based on the anellovirus load in a biological sample, was also proposed in patent application WO2013 / 156627. However, none of these biomarkers has yet replaced the use of mHLA-DR. These biomarkers have the particular drawback of not allowing identification of the patient's phase ( i.e. inflammatory phase versus (immunosuppressive phase), their main objective being to identify immunocompromised patients for whom immunostimulatory treatments would be relevant. The use of a DNA microarray to identify sequences with differential expression was also proposed in the publication "Becker et al. A comprehensive hybridization model allows whole HERV transcriptome profiling using high-density microarray, BMC Genomics 2017 18:286".
[0009] As of the date of the present invention, it therefore remains necessary to find new biomarkers to determine the immune status of an individual.
[0010] Endogenous retroviruses, or ERVs (for Endogenous RetroVirus ) refer to stable sequences in an organism's genome that have structural similarities to certain infectious exogenous retroviruses (including the presence of two LTRs, or Long Terminal Repeats, which surround the genes coding for putative proteins). Their origin is uncertain, but the most likely hypothesis is that of germ cell infection by a retrovirus. Following mutations in the retrovirus that rendered it defective, the infected germ cells could have survived, and the retrovirus genome, integrated into the organism's genome, could have been transmitted to the next generation and persisted in the offspring within the organism's genome.
[0011] In humans, HERVs ( Human Endogenous RetroVirus ) have only been identified since the sequencing of the human genome. With MaLRs ( Mammalian apparent LTR-Retrotransposons ) ,which have a structure similar to HERVs, they represent 8.3% of the human genome, with a number exceeding 400,000 elements. By comparison, the 30,000 to 40,000 protein-coding genes represent only 2% of human DNA. HERVs are subdivided into three major classes (I, II, and III) and several groups (sometimes referred to as "families" in this patent application). HERVs are retroelements that transpose only by a copy-and-paste mechanism, via an RNA intermediate and reverse transcriptase. They have long been considered "junk" DNA ( junk DNA ) .While they can be inactive due to mutations or epigenetic mechanisms, their role is beginning to emerge in both physiological and pathological contexts. For example, HERV-W has been shown to participate in one of the mechanisms ensuring placental formation. The HERV-K superfamily, on the other hand, is the most studied in relation to carcinogenesis. The expression of certain HERVs has also been described in some autoimmune diseases, such as multiple sclerosis and lupus erythematosus, and in interferonopathies, although no link has been suggested between HERV reactivation and immune status.
[0012] Thus, it has never been described or suggested that analyzing HERV expression in humans could determine an individual's immune status. Furthermore, HERV reactivation has never been described in the pathology of sepsis.
[0013] However, it has been discovered that, quite surprisingly, among the approximately 420,000 existing HERVs / MaLRs, the analysis of the expression of some of them makes it possible to determine an individual's immune status.
[0014] Thus, the present invention relates to a method for determining in vitro Or ex vivo the immune status of an individual, in which the individual is a trauma patient, a burn patient, a surgical patient, or a septic patient, preferably a patient in septic shock, said method comprising a step of detecting and / or quantifying the expression, in a test biological sample from said individual, of at least a portion, preferably of a size of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30 nucleotides, of at least one HERV / MaLR sequence selected from the sequences identified in SEQ ID NOs: 1 to 34 or among sequences that exhibit at least 99%, preferably at least 99.1%, preferably at least 99.2%, preferably at least 99.3%, preferably at least 99.4%, preferably at least 99.5%, preferably at least 99.6%, preferably at least 99.7%, preferably at least 99.8%, preferably at least 99.9% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, from the following lists: . Tableau 1. Liste 1 SEQ ID NO Localisation GRCh38 Nom du probeset correspondant de la puce HERV-V3 Nom du groupe de HERV / MaLR 1 chr19:54891074-54891496 190665001-HERV0376 HERV0376 2 chr22:36153696-36154283 220247002-HERV0797 HERV0797 3 chr17:35505737-35508365 170369402HE41env HERV-E41 4 chr12:112971073-112971451 121601801-HERV0492 HERV0492 5 chr1:78648318-78648697 011052702-MALR1044 MALR1044 6 chr1:78623489-78623954 011052202-HERV1033 HERV1033 7 chr13:42884951-42886257 130360601-HERV0808 HERV0808 8 chr14:91230494-91230820 141107102-MALR1019 MALR1019 9 chr2:102363654-102366601 021460102-HERV0599uL HERV0599 10 chr2:102013616-102013971 021456001-MALR1017uL MALR1017 11 chr5:14551189-14551685 050286701-HERV0513 HERV0513 12 chr5:14562791-14563322 050287402-MALR1022 MALR1022 Tableau 2. Liste 2 SEQ ID NO Localisation GRCh38 Name of the corresponding probeset for the HERV-V3 chip HERV / MaLR group name 13 chr5:132453630-132454148 052182701-MALR1129 MALR1129 14 chr19:41812466-41813010 190478501-MALR1003 MALR1003 15 chr1:155637287-155637547 011790601ERV9sLU5 ERV9 16 chr5:170290289-170290812 052681601-MALR1018 MALR1018 17 chr16:50662453-50662912 160627301-MALR1014 MALR1014 18 chr11:122671887-122672147 111686702-HERV0861 HERV0861 8 chr14:91230494-91230820 141107102-MALR1019 MALR1019 19 chr4:15825146-15825565 040318302-MALR1134 MALR1134 20 chr4:83464568-83464963 041529101-MALR1026 MALR1026 21 chr14:91222760-91223118 141106902-MALR1133 MALR1133 Table 3. List 3 SEQ ID NO Location GRCh38 Name of the corresponding probeset for the HERV-V3 chip HERV / MaLR group name 1 chr19:54891074-54891496 190665001-HERV0376 HERV0376 1 chr19:54891074-54891496 190665002-HERV0376 HERV0376 22 chr6:18403673-18404108 060281701-MALR1043 MALR1043 23 chr4:184850413-184850785 043166601-MALR1018 MALR1018 24 chr10:5856198-5856795 100090601-HERV0429 HERV0429 25 chr6:107800650-107801138 061529601-HERV0492 HERV0492 26 chr10:60410534-60411224 100871501-MALR1020 MALR1020 27 chr17:78345106-78345577 170842002-MALR1003 MALR1003 Tableau 4. Liste 4 SEQ ID NO Localisation GRCh38 Nom du probeset correspondant de la puce HERV-V3 Nom du groupe de HERV / MaLR 28 chr8:125945973-125951030 081921103-HERV0958 HERV0958 29 chr3:167401329-167401866 032622601MR41sLU5p MR41 30 chr22:36147793-36148208 220246901-HERV0889 HERV0889 31 chr6:127790579-127792191 061827101-HERV0856 HERV0856 3 chr17:35505737-35508365 170369402HE41env HERV-E41 32 chr17:77462942-77463350 170828901-HERV0770 HERV0770 28 chr8:125945973-125951030 081921101-HERV0958 HERV0958 28 chr8:125945973-125951030 081921102-HERV0958 HERV0958 33 chr19:14612123-14612747 190148802-MALR1127 MALR1127 34 chr12:9038254-9038598 120093401-HERV1034 HERV1034
[0015] Within the scope of the present invention: Determining an individual's immune status involves assessing the body's ability to mount an immune response and defend itself against threats or infections. Immune status can be categorized as normal (or immunocompetent), inflammatory (or hyperactive) when the immune system is more active than normal, or immunosuppressive (or immunodeficiency, hypoactive, or immune paralysis) when the immune system is less active than normal. "HERV / MaLR" refers to HERV and MaLR elements, as described in the introduction. The abbreviated term "HERV" may also sometimes be used and has the same meaning as "HERV / MaLR."In the literature, numerous aliases have been used to describe the same HERV element or the same group (or family) of HERVs, and there is still a need for standardization. In this application, to avoid any confusion, the identity of a HERV element will be determined primarily by its chromosomal location, more specifically based on GRCh38 (. Genome Reference Consortium Human Build 38 ) .Reference may also sometimes be made to the various probe sets and probes of the HERV-V3 chip targeting the HERV element in question. It should also be noted that, for a given HERV element, as identified by its GRCh38 location, the sequences found in different individuals may differ from the sequence indicated in the GRCh38 database, due to polymorphism (Wildschutte et al. (2016), Discovery of unfixed endogenous retrovirus insertions in diverse human populations, PNAS 113(16):E2326-34). The term "individual" refers to a human being, regardless of their state of health. A "healthy individual" within the meaning of the present invention is an individual who does not exhibit any dysfunction of the immune system.The term "patient" refers to an individual who has come into contact with a healthcare professional, such as a physician (e.g., a general practitioner) or a medical facility (e.g., a hospital emergency or resuscitation department, or an intensive care unit). "Detection of sequence expression" means the demonstration of the expression of said sequence, without necessarily a quantitative measurement. In the case of an mRNA transcript, detection can be performed by a direct method, by any method known to those skilled in the art that allows the presence of said transcript in a sample to be determined, or by indirect detection of the transcript after its conversion into DNA, or after amplification of said transcript, or after amplification of the DNA obtained after its conversion into DNA."Quantification of sequence expression" refers to the quantitative evaluation of the expression level of a sequence. Numerous methods exist for the detection of nucleic acids (see, for example, Kricka et al., Clinical Chemistry, 1999, No. 45(4), pp. 453-458; Relier GH et al., DNA Probes, 2nd Ed., Stockton Press, 1993, sections 5 and 6, pp. 173-249). By "biological sample", we refer to any sample taken from an individual, and which can be of various kinds, such as blood, serum, plasma, sputum, urine, stool, skin, cerebrospinal fluid, bronchoalveolar lavage fluid, saliva, gastric secretions, semen, seminal fluid, tears, spinal cord, trigeminal nerve ganglion, adipose tissue, lymphoid tissue, placental tissue, gastrointestinal tract tissue, genital tract tissue, central nervous system tissue.Specifically, this sample can be a biological fluid, preferably chosen from whole blood (as collected from the venous route, i.e., containing white and red blood cells, platelets, and plasma), plasma, and serum. It can also be any type of cell extracted from a blood sample, such as peripheral blood mononuclear cells (PBMCs), B cell subpopulations, purified monocytes, or neutrophils. To determine the "percentage sequence identity" of one nucleic acid sequence with another, the two sequences are first optimally aligned. The two sequences to be compared can be the same size or different sizes. In some cases, it may be necessary to introduce "holes" into one of the sequences to allow for optimal alignment with the second sequence.Optimal sequence alignment can be achieved using the Smith-Waterman algorithm (J. Theor. Biol., 91 (2): 370-380, 1981), the Needleman-Wunsch algorithm (J. Mol. Biol., 48(3): 443-453, 1972), or the Pearson-Lipman method (Proc. Natl. Acad. Sri. USA, 85(5): 2444-2448, 1988). Some software programs allow the implementation of certain of these algorithms, such as GAP, BESTFIT, FASTA, TFASTA (Wisconsin Genetics Software Package Release 7.0, Genetic Computer Group, 575 Science Drive, Madison, Wisconsin), BLAST, or CLUSTALW (Nucleic Acids Res. 1994 Nov 11; 22(22): 4673-80). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice ) . The best alignment ( i.e. The sequence that yields the highest percentage of identity within the comparison window, among those generated by these various methods, is selected. The respective nucleotides located at the same position in each sequence are then compared. When a given position is occupied by the same nucleotide in both sequences, the sequences are identical for that position. The percentage of sequence identity is then determined based on the number of positions for which the respective nucleotides are identical, divided by the total number of nucleotides at positions where alignment was possible within the comparison window. A "biomarker" or "marker" is an objectively measurable biological characteristic that represents an indicator of normal or pathological biological processes or of pharmacological response to a therapeutic intervention.This can be, in particular, a molecular biomarker, preferably detectable at the mRNA level. More specifically, the biomarker can be an endogenous biomarker or locus (such as a HERV or a gene, which are found in an individual's chromosomal material) or an exogenous biomarker (such as a virus). Sepsis is a condition in which the immune response is dysregulated in an individual following an infection, leading to multiple and potentially fatal organ failure and dysfunction. Septic shock is a subtype of sepsis in which hypotension persists despite adequate fluid resuscitation.An "amplification primer" is defined as a nucleotide fragment that can comprise from 5 to 100 nucleotides, preferably 15 to 30 nucleotides, and that possesses specificity for hybridization with a target nucleotide sequence under specific conditions for the initiation of enzymatic polymerization, for example, in an enzymatic amplification reaction of the target nucleotide sequence. Generally, "primer pairs," consisting of two primers, are used. When amplifying several different HERVs, several different primer pairs are preferably used, each ideally having the capacity to hybridize specifically with a different HERV.A "hybridization probe" is defined as a nucleotide fragment typically comprising 5 to 100 nucleotides, preferably 15 to 90 nucleotides, and even more preferably 15 to 35 nucleotides, possessing hybridization specificity under defined conditions to form a hybridization complex with a target nucleotide sequence. The probe also includes a reporter (such as a fluorophore, an enzyme, or any other detection system) that enables the detection of the target nucleotide sequence. In the present invention, the target nucleotide sequence may be a nucleotide sequence contained in messenger RNA (mRNA) or a nucleotide sequence contained in complementary DNA (cDNA) obtained by reverse transcription of said mRNA. When targeting several different HERVs, several different probes are preferably used, each preferably having the ability to hybridize specifically with a different HERV.Hybridization refers to the process by which, under appropriate conditions, two nucleotide fragments, such as a hybridization probe and a target nucleotide fragment, with sufficiently complementary sequences, can form a double strand with stable and specific hydrogen bonds. A nucleotide fragment "capable of hybridizing" with a polynucleotide is a fragment that can hybridize with said polynucleotide under hybridization conditions, which can be determined in a known manner in each case. These hybridization conditions are determined by stringency, that is, the severity of the operating conditions. Hybridization is more specific the higher the stringency. Stringency is defined, in particular, by the base composition of a probe / target duplex, as well as by the degree of mismatch between two nucleic acids.Stringency can also depend on reaction parameters, such as the concentration and type of ionic species present in the hybridization solution, the nature and concentration of denaturing agents, and / or the hybridization temperature. The stringency of the conditions under which a hybridization reaction must be carried out depends primarily on the hybridization probes used. All of this data is well known, and the appropriate conditions can be determined by those skilled in the art. In general, depending on the length of the hybridization probes used, the temperature for the hybridization reaction is between approximately 20 and 70°C, specifically between 35 and 65°C in a saline solution with a concentration of approximately 0.5 to 1 M. A detection step of the hybridization reaction is then performed.By "enzymatic amplification reaction" we mean a process generating multiple copies of a target nucleotide fragment, by the action of at least one enzyme. Such amplification reactions are well known to those skilled in the art and include in particular the following techniques: PCR (. Polymerase Chain Reaction ) , LCR ( Ligase Chain Reaction ) , CPR ( Repair Chain Reaction ) , 3SR ( Self Sustained Séquence Replication ) with patent application WO-A-90 / 06995, NASBA ( Nucleic Acid Sequence-Based Amplification ) , TMA ( Transcription Mediated Amplification ) with US patent A-5,399,491, and LAMP ( Loop mediated isothermal amplification ) with patent US6410278. When the enzymatic amplification reaction is a PCR, it is more specifically referred to as RT-PCR (RT for " reverse transcription " , when the amplification step is preceded by a reverse transcription step of messenger RNA (mRNA) into complementary DNA (cDNA), and by qPCR or RT-qPCR when the PCR is quantitative.
[0016] To the inventors' knowledge, it has never been described or suggested that the detection and / or quantification of HERV / MaLR expression could be used to determine an individual's immune status. In particular, the involvement of HERV / MaLR has never been described in the context of sepsis.
[0017] All HERV / MaLRs from SEQ ID NO: 1 to 34 were identified among the approximately 420,000 HERV / MaLRs in the genome. These are the HERV / MaLRs that can be targeted with the HERV-V3 chip (Becker et al., BMC Genomics. 2017; 18: 286). More specifically, these HERV / MaLRs are expressed in the datasets used in the Examples. Even more specifically, these expressed HERV / MaLRs are modulated between the conditions of interest considered in the Examples.
[0018] The detection and / or quantification of HERV expression according to the present invention, to determine an individual's immune status, can be performed using molecular tools that offer advantages over flow cytometry for mHLA-DR measurement in terms of hospital accessibility and standardization. Minimal sample handling is required, and the results are easy to interpret. Furthermore, HERV expression according to the present invention can be detected and / or quantified on various platforms, such as DNA microarrays or by PCR, to determine immune status. Some of the HERVs according to the present invention can be detected early, as early as day 1, while mHLA-DR measurement is performed on day 3 (Monneret and Venet (2014) Monocyte HLA-DR in sepsis: shall we stop following the flow? Crit Care 18:102).
[0019] Preferably, the present invention relates to a method for determining in vitro Or ex vivo the immune status of an individual, in which the individual is a trauma patient, a burn patient, a surgical patient, or a septic patient, preferably a patient in septic shock, said process comprising: a step of detection and / or quantification of the expression, in a biological sample of said individual (or test biological sample), of at least a part of at least one HERV / MaLR sequence chosen from the sequences identified in SEQ ID NOs: 1 to 34 or from the sequences which have at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, from Lists 1 to 4, previously described; a step in which the expression in the test biological sample is compared with a reference expression, or with the expression in a reference biological sample; a step in which the immune status of the individual is determined from this comparison.
[0020] The reference biological sample can be of various types, but it is preferably of the same type, or at least very similar, to the test biological sample. For example, if the test biological sample is a whole blood sample, the reference biological sample will preferably be a whole blood sample, or possibly a plasma or serum sample. The reference biological sample can be a "natural" sample, that is, one from an individual whose immune status is known or determined using a reference method (for example, by the mHLA-DR method). It could, for instance, come from an individual with a known immune status such as immunocompetence, inflammation, or immunosuppression. Preferably, if the test biological sample is from a human being, the reference biological sample is also from a human being.Preferably, the reference biological sample is taken from the same individual as the test biological sample. The reference biological sample can also be a "synthetic" sample, that is, a sample containing a calibrated quantity of at least one of the SEQ ID NO sequences: 1 to 34.
[0021] The invention preferably relates to a method for determining the immune status of an individual, as described above, in which the expression of at least 2 different sequences is detected and / or quantified, chosen from the sequences identified in SEQ ID NOs: 1 to 34 or from the sequences which have at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34. Lists 1 to 4 being complementary to each other, these at least two different sequences are preferably chosen from two different lists.
[0022] The invention preferably relates to a method for determining the immune status of an individual, as described above, in which the expression of at least 3 different sequences is detected and / or quantified, chosen from the sequences identified in SEQ ID NOs: 1 to 34 or from the sequences which have at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34. These at least three different sequences are preferably chosen from two different lists, preferably again from three different lists.
[0023] The invention preferably relates to a method for determining the immune status of an individual, as described above, wherein the expression of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, or at least 34 different sequences selected from the sequences identified in SEQ ID NOs: 1 to 34 or from the sequences which show at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34.These at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34 different sequences are preferentially chosen from two different lists, preferably even more from three different lists, and even more preferably from four different lists.
[0024] The HERVs of SEQ ID NO: 1, 3, and 8 were identified using two different strategies, as described in the Examples, and are thus found in two Lists, respectively. Furthermore, the inventors assigned a score to the different HERV sequences, as explained in Examples 4 to 6. In Example 7, the HERVs were ranked in order of importance. Also, in a most preferred manner, the invention relates to a method for determining the immune status of an individual, as described above, in which the expression of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 different sequences selected from the sequences identified in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 28, or from the sequences which exhibit at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% identity with one of the SEQ ID NO sequences: 1, 3, 8, 11, 12, 13 and 28. Preferred combinations of at least 2 matching HERVs are listed in Table 5 below. Tableau 5 Nombre de HERV dans la combinaison Combinaisons préférées d'au moins 2 HERV 2 SEQ ID NO : 1,SEQ ID NO : 3 SEQ ID NO : 1,SEQ ID NO : 8 SEQ ID NO : 1,SEQ ID NO : 11 SEQ ID NO : 1,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8 SEQ ID NO : 3,SEQ ID NO : 11 SEQ ID NO : 3,SEQ ID NO : 12 SEQ ID NO : 3,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 11 SEQ ID NO : 8,SEQ ID NO : 12 SEQ ID NO : 8,SEQ ID NO : 13 SEQ ID NO : 8,SEQ ID NO : 28 SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 13,SEQ ID NO : 28 3 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 4 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 5 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13,SEQ ID NO : 28 6 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12, SEQ ID NO : 13 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12, SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 13, SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 12,SEQ ID NO : 13, SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 3,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13, SEQ ID NO : 28 SEQ ID NO : 1,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13, SEQ ID NO : 28 SEQ ID NO : 3,SEQ ID NO : 8,SEQ ID NO : 11,SEQ ID NO : 12,SEQ ID NO : 13, SEQ ID NO : 28 7 SEQ ID NO : 1, SEQ ID NO : 3, SEQ ID NO : 8, SEQ ID NO : 11, SEQ ID NO : 12, SEQ ID NO : 13, SEQ ID NO : 28
[0025] The process for determining in vitro Or ex vivo The immune status of an individual, as described above, according to any embodiment, may also include a step of detecting and / or quantifying the expression, in the test biological sample, of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least twelve, at least thirty, at least fifteen, at least sixteen, at least seventeen, at least eight, at least nineteen, at least tenteen, at least eleventeen, at least twelveteen, at least fifteenteen, at least sixteenteen, at least seventeenteen, at least nineteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least twentyteenteen, at least thirty ... 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59,at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95 gene(s) chosen from the following genes: CD74, CX3CR1, IL-10, S100A8, S100A9, MERTK, CLEC7A, CD36, TIMP2, CCL13, PTGS2, IL-12B, IL-6, IL-1A, CCL20, MX1, OAS-1, CCL15, OAS-3, EIF2AK2, IFNγ, NEFH, MMP10, SERPINB2, THBD, STAT1, CCR4, HLA-DRB1 / B3, TCF7, EOMES, BCL11B, ITGA7, IL-18R1, NLRC4, CYP1B1, HGF, IL-5RA, CCL5, CD3G, DPP4, CD4OLG, CD3D, CD127, ICOS, IL-1R2, IL-1RN, IL-18, IL-18RAP, OX40L, PD-1, PD-L1, Zonulin (HP), BTLA, C3AR1, CD154, GM-CSF, IFIH1, IL-15, MCP1, PCSK9, STAT4, LTR82B, CIITA, LILRB2, CD177, ADGRE3, FLT-1,CD64, TREM-1, TNF-α, IL-1β, ALOX5, IL-17A, NFκB, TBX21, HIF1a, RORgT, OAS-2, GNLY, CTLA-4, TIM 3, CD274, IL-2, IL-7R, GATA3, CXCL10, FAS, GSN, MDC1, DYRK2, TDRD9, CNB1IP1, ZAP70 and ARL14EP.
[0026] Preferably, the invention relates to a method for determining an individual's immune status, as described above, wherein expression is detected and / or quantified at the RNA or messenger RNA (mRNA) transcript level. Detection and / or quantification at the RNA or mRNA transcript level can be performed by any means known to those skilled in the art. In particular, examples include: hybridization methods, preferably using a hybridization chip, by hybridization in situ or by Northern blot; amplification methods, preferably by RT-PCR (“ Reverse Transcriptase Polymerase Chain Reaction "), preferably still by RT-qPCR (quantitative RT-PCR). One can cite in particular nested PCR (or nested PCR, " nested PCR PCR reactions can also be multiplexed; sequencing methods, preferably high-throughput sequencing, are also possible.
[0027] Preferably, the invention relates to a method for determining an individual's immune status, as described above, wherein the immune status is determined as being an immunosuppressive status (or immunodeficiency status or immunodeficiency status or hypoactive immune status or immune paralysis), a normal immune status (or immunocompetence status), or an inflammatory status (or hyperactive immune status). The inflammatory status includes the hyperinflammatory status.
[0028] Preferably, the invention relates to a method for determining the immune status of an individual, as described above, in which the individual is a patient admitted to a medical facility, preferably to an intensive care unit, emergency department, or resuscitation unit. Also preferably, the individual is a trauma patient, a burn patient, a surgical patient, or a septic patient, preferably a patient in septic shock. Even more preferably, the biological test sample is obtained within 10 days, preferably within 9 days, preferably within 8 days, preferably within 7 days, preferably within 6 days, preferably within 5 days, preferably within 4 days, preferably within 3 days, preferably within 2 days, preferably within 24 hours, following admission to the medical facility.
[0029] Preferably, the invention relates to a method for determining the immune status of an individual, as described above, wherein the reference biological sample is a biological sample from a healthy individual, preferably a biological sample from the same individual from which the test biological sample is taken but taken before the infection or attack, or a biological sample from an individual of known immune status, preferably with an inflammation status, a normal immune status, or an immunosuppression status.
[0030] Preferably, the test biological sample and / or the reference biological sample, as used in the process to determine the immune status of an individual, according to the invention, as described above, is a blood sample, preferably a whole blood, plasma or serum sample, or a sample of peripheral blood mononuclear cells, extracted from a blood sample.
[0031] Preferably, the method for determining immune status according to the invention, as described above, includes a step of administering a treatment, preferably an immunomodulatory treatment, tailored to the individual's immune status. Preferably, the immunomodulatory treatment is an immunostimulatory treatment, if the individual is determined to have an immunosuppressive status, or an anti-inflammatory treatment, if the individual is determined to have an inflammatory status.Examples of immunostimulatory treatments include interleukins, particularly IL-7, IL-15, or IL-3; growth factors, especially GM-CSF; interferons, particularly IFNγ; Toll agonists; antibodies, particularly anti-PD1, anti-PDL1, anti-LAG3, anti-TIM3, anti-IL-10, or anti-CTLA4; transferrins; apoptosis inhibitors such as FLT3L and Thymosin α1; and adrenergic antagonists. Anti-inflammatory treatments include glucocorticoids; cytostatic agents; immunophilin and cytokine receptor antagonists; IL-1 receptor blockers; and anti-TNF therapies.
[0032] The present invention also relates to the use of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least twelve, at least thirty-four, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty-ten, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-four sequence(s) selected from among the sequences identified in SEQ ID NOs: 1 to 34, as appearing in Lists 1 to 4, or among the sequences that show at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, to determine in vitro Or ex vivo the immune status of an individual, preferably a patient.
[0033] Without being part of the invention, the present application describes a method for identifying or selecting a treatment, preferably an immunomodulatory treatment, more particularly an immunostimulatory treatment or an anti-inflammatory treatment, suitable for treating an individual, preferably a patient, comprising the following steps: a. The immune status of said individual is determined by a procedure as described previously. b. A suitable treatment is identified based on the immune status determined in step a).
[0034] Preferably, immunomodulatory treatment is immunostimulatory treatment, if it is determined that the individual has an immunosuppressive status, or anti-inflammatory treatment, if it is determined that the individual has an inflammatory status.
[0035] Without being part of the invention, the present application describes a method for evaluating the effectiveness of a treatment, preferably an immunomodulatory treatment, more particularly an immunostimulatory or anti-inflammatory treatment, on an individual, preferably a patient, comprising the following steps: a. The expression of at least a portion of a sequence chosen from among the sequences identified in SEQ ID NOs: 1 to 34, or from among the sequences that show at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, is detected and / or quantified in a first biological sample from the individual, taken before treatment, and in a second biological sample from the individual, taken after treatment. b. The expression obtained for the two biological samples is compared to that in step a). c. The effectiveness of the treatment is evaluated based on the comparison in step b).
[0036] While not part of the invention, the present application describes an amplification primer comprising, or consisting of, a nucleotide sequence complementary to at least a portion of a sequence selected from among the sequences identified in SEQ ID NOs: 1 to 34 or from among the sequences that exhibit at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, and the complementary sequences of those sequences. Preferably, the amplification primer according to the invention is selected from among the primers shown in Table 6. Tableau 6 SEQ ID NO Amorce # Séquence nucléotidique 35 1A TGTACAAAACTCAAATGGTCTTC 36 1B ATGACCAACTTAGATTTCCTTGA 37 2A GCCAGAGAGGCATAATGAAGCA 38 2B GATTCTAAGCCTCCCCCTCATTT 39 3A TGGCTCATAGGGATTCCAGACT 40 3B AGCAAGTTGTCAAGAGCCAATCT 41 4A CACTCTAGGAATCTTAGGCA 42 4B TGAAAACCAATAGTCCAGTG 43 5A TTCTACTGTTCACTGCTATCCTCC 44 5B CCTGTGGCAGCTTTTTGAAGTAA 45 6A AGAGCAGAAGAAGATGGATACT 46 6B CATGAGCTGACATCATCCAAT 47 7A TCTGTACTGGTTGCCCCAAC 48 7B CGTGCCAGGCCTCTTAATACTTTT 49 8A AGGGAAGACCCCAAGATGATG 50 8B CATGCAAAGTCCAACGAGAGG 51 9A GGGTGGCTGCATCCTATGG 52 9B CTGGTCAGGAAAAAATTTGCCTTC 53 10A ACATGACATTGTCTGAACTTTGGG 54 10B TAGGACCATGCAGATACTAGTGAC 55 11A GAACTCCACAAACCTTGA 56 11B GCTAGAAGCTTTGGATATCT 57 12A TGGCTGTTACAACTTTCATG 58 12B TCTCCCTATTCTGAGCCACA
[0037] Without being part of the invention, the present application describes a pair of amplification primers, consisting of two amplification primers selected from the primers as described above, for amplifying, preferably specifically amplifying, at least a portion of a sequence selected from the sequences identified in SEQ ID NOs: 1 to 34 or from sequences that exhibit at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, and the complementary sequences of these sequences. Preferably, the pair of amplification primers according to the invention is selected from the pairs of primers presented in Table 7. Table 7 Primer pair # Primers # 1 Forward: Primer #1A Reverse: Primer #1B 2 Forward: Primer #2A Reverse: Primer #2B 3 Forward: Primer #3A Reverse: Primer #3B 4 Forward: Primer #4A Reverse: Primer #4B 5 Forward: Primer #5A Reverse: Primer #5B 6 Forward: Primer #6A Reverse: Primer #6B 7 Forward: Primer #7A Reverse: Primer #7B 8 Forward: Primer #8A Reverse: Primer #8B 9 Forward: Primer #9A Reverse: Primer #9B 10 Forward: Primer #10A Reverse: Primer #10B 11 Forward: Primer #11A Reverse: Primer #11B 12 Forward: Primer #12A Reverse: Primer #12B
[0038] Without being part of the invention, the present application describes a hybridization probe whose nucleotide sequence comprises, or consists of, a nucleotide sequence complementary to at least a portion of a sequence selected from among the sequences identified in SEQ ID NOs: 1 to 34 or from among the sequences that exhibit at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, and the complementary sequences of these sequences. Preferably, the hybridization probe according to the invention is selected from among the hybridization probes shown in Table 8. Table 8 SEQ ID NO. Probe # The name of the chip probe is HERV-V3 Nucleotide sequence 59 1A 190665001-HERV0376uL_at1 ATGACCAACTTAGATTTCCTTGAGT 60 1B 190665001-HERV0376uL_at2 GTCAAGGGTAAAGCTGTGAAAGTTT 61 1C 190665001-HERV0376uL_at3 GGAAGACCATTTGAGTTTTGTACAC 62 1A' 190665001-HERV0376uL_st1 ACTCAAGGAAATCTAAGTTGGTCAT 63 1B' 190665001-HERV0376uL_st2 AAACTTTCACAGCTTTACCCTTGAC 64 1C' 190665001-HERV0376uL_st3 GTGTACAAAACTCAAATGGTCTTCC 65 1D 190665002-HERV0376uL_at1 GAAGATATGGGCCAGAACTTGTATA 66 1E 190665002-HERV0376uL_at2 CAGGACCTGAGTTAAGCCAAGAATA 67 1F 190665002-HERV0376uL_at3 ACCTGAGTTAAGCCAAGAATACAGT 68 1D' 190665002-HERV0376uL_st1 TATACAAGTTCTGGCCCATATCTTC 69 1E' 190665002-HERV0376uL_st2 TATTCTTGGCTTAACTCAGGTCCTG 70 1F' 190665002-HERV0376uL_st3 ACTGTATTCTTGGCTTAACTCAGGT 71 2A 220247002-HERV0797uL_at1 GTAAGATTCTAAGCCTCCCCCTCAT 72 2B 220247002-HERV0797uL_at2 GATTCTAAGCCTCCCCCTCATTTAA 73 2C 220247002-HERV0797uL_at3 CTAAGCCTCCCCCTCATTTAAAGGA 74 2A' 220247002-HERV0797uL_st1 ATGAGGGGGAGGCTTAGAATCTTAC 75 2B' 220247002-HERV0797uL_st2 TTAAATGAGGGGGAGGCTTAGAATC 76 2C' 220247002-HERV0797uL_st3 TCCTTTAAATGAGGGGGAGGCTTAG 77 3A 170369402HE41env_at1 ATGGCTCATAGGGATTCCAGACTCC 78 3B 170369402HE41env_at2 GGCTCATAGGGATTCCAGACTCCCA 79 3C 170369402HE41env_at3 CTCATAGGGATTCCAGACTCCCATT 80 3A' 170369402HE41env_st1 GGAGTCTGGAATCCCTATGAGCCAT 81 3B' 170369402HE41env_st2 TGGGAGTCTGGAATCCCTATGAGCC 82 3C' 170369402HE41env_st3 AATGGGAGTCTGGAATCCCTATGAG 83 4A 121601801-HERV0492uL_at1 TGAAACCAATAGTCCAGTGGTGGCC 84 4B 121601801-HERV0492uL_at2 TTCCAGTGATTTAGATAAAATCCCT 85 4C 121601801-HERV0492uL_at3 TTTCTGCCTAAGATTCCTAGAGTGC 86 4A' 121601801-HERV0492uL_st1 GGCCACCACTGGACTATTGGTTTCA 87 4B' 121601801-HERV0492uL_st2 AGGGATTTTATCTAAATCACTGGAA 88 4C' 121601801-HERV0492uL_st3 GCACTCTAGGAATCTTAGGCAGAAA 89 5A 011052702-MALR1044uL_at1 CTGTGGCAGCTTTTTGAAGTAAGGA 90 5B 011052702-MALR1044uL_at2 ATGGTTAGTGCAGAGTAAAGTTTGG 91 5C 011052702-MALR1044uL_at3 AGGATAGCAGTGAACAGTAGAATGG 92 5A' 011052702-MALR1044uL_st1 TCCTTACTTCAAAAAGCTGCCACAG 93 5B' 011052702-MALR1044uL_st2 CCAAACTTTACTCTGCACTAACCAT 94 5C' 011052702-MALR1044uL_st3 CCATTCTACTGTTCACTGCTATCCT 95 6A 011052202-HERV1033uL_at1 AGATCCAACATGAGCTGACATCATC 96 6A' 011052202-HERV1033uL_st1 GATGATGTCAGCTCATGTTGGATCT 97 7A 130360601-HERV0808cL_at1 GAGGTTGGGGCAACCAGTACAGATT 98 7A' 130360601-HERV0808cL_st1 AATCTGTACTGGTTGCCCCAACCTC 99 8A 141107102-MALR1019uL_at1 CCCCAAGATGATGGACTCTGGTGAT 100 8B 141107102-MALR1019uL_at2 CACTGCCATCACTTTGGGAAAGACT 101 8C 141107102-MALR1019uL_at3 AAGCAGCCTCTCGTTGGACTTTGCA 102 8A' 141107102-MALR1019uL_st1 ATCACCAGAGTCCATCATCTTGGGG 103 8B' 141107102-MALR1019uL_st2 AGTCTTTCCCAAAGTGATGGCAGTG 104 8C' 141107102-MALR1019uL_st3 TGCAAAGTCCAACGAGAGGCTGCTT 105 9A 021460102-HERV0599uL_at1 GAGGGCAGTTTGGAACAGTTGGAAC 106 9B 021460102-HERV0599uL_at2 TGAGAGACGATTATCTGGAAGAAGA 107 9C 021460102-HERV0599uL_at3 TCACAGCTTGAGAATGTGGTAGGAG 108 9D 021460102-HERV0599uL_at4 GGAATGGGGGGCATGGAATTAAAGC 109 9A' 021460102-HERV0599uL_st1 GTTCCAACTGTTCCAAACTGCCCTC 110 9B' 021460102-HERV0599uL_st2 TCTTCTTCCAGATAATCGTCTCTCA 111 9C' 021460102-HERV0599uL_st3 CTCCTACCACATTCTCAAGCTGTGA 112 9D' 021460102-HERV0599uL_st4 GCTTTAATTCCATGCCCCCCATTCC 113 10A 021456001-MALR1017uL_at1 AGTCCCTAACTGTCTGCAAACCCAC 114 10B 021456001-MALR1017uL_at2 ACTGTCTGCAAACCCACAATGGACC 115 10C 021456001-MALR1017uL_at3 CAATGGACCTGTTGCATGTGTAAGA 116 10A' 021456001-MALR1017uL_st1 GTGGGTTTGCAGACAGTTAGGGACT 117 10B' 021456001-MALR1017uL_st2 GGTCCATTGTGGGTTTGCAGACAGT 118 10C' 021456001-MALR1017uL_st3 TCTTACACATGCAACAGGTCCATTG 119 11A 050286701-HERV0513uL_at1 CTGCATCCTATGGTGTTTCTACATG 120 11B 050286701-HERV0513uL_at2 ATAATCTTTTCCGGCATGTTGGTAT 121 11C 050286701-HERV0513uL_at3 TAAAGATAGTGTTTCCTATTGTGTC 122 11A' 050286701-HERV0513uL_st1 CATGTAGAAACACCATAGGATGCAG 123 11B' 050286701-HERV0513uL_st2 ATACCAACATGCCGGAAAAGATTAT 124 11C' 050286701-HERV0513uL_st3 GACACAATAGGAAACACTATCTTTA 125 12A 050287402-MALR1022uL_at1 ACAGAGACTGCAAGAGTAATGACAT 126 12B 050287402-MALR1022uL_at2 TCTGAACTTTGGGAAACAATTATGT 127 12C 050287402-MALR1022uL_at3 ACTTTCCAGTTAATCGAATCAATCC 128 12D 050287402-MALR1022uL_at4 TTTTAACCTAGACTAGTTCCAACTG 129 12E 050287402-MALR1022uL_at5 GTCACTAGTATCTGCATGGTCCTAA 130 12A' 050287402-MALR1022uL_st1 ATGTCATTACTCTTGCAGTCTCTGT 131 12B' 050287402-MALR1022uL_st2 ACATAATTGTTTCCCAAAGTTCAGA 132 12C' 050287402-MALR1022uL_st3 GGATTGATTCGATTAACTGGAAAGT 133 12 D' 050287402-MALR1022uL_st4 CAGTTGGAACTAGTCTAGGTTAAAA 134 12E' 050287402-MALR1022uL_st5 TTAGGACCATGCAGATACTAGTGAC 135 13A 052182701-MALR1129uL_at1 TTATTCCAGTCACCTCGAGTCATTC 136 13B 052182701-MALR1129uL_at2 TCATCCTAGCCGTCGTAGAGCAGAG 137 13C 052182701-MALR1129uL_at3 TGCCCTTCTGACTCCTTGACAGTGG 138 13A' 052182701-MALR1129uL_st1 GAATGACTCGAGGTGACTGGAATAA 139 13B' 052182701-MALR1129uL_st2 CTCTGCTCTACGACGGCTAGGATGA 140 13C' 052182701-MALR1129uL_st3 CCACTGTCAAGGAGTCAGAAGGGCA 141 14A 190478501-MALR1003cL_at1 TAAGTGGGACCAAGACACAAACCAA 142 14B 190478501-MALR1003cL_at3 ACCAAGACACAAACCAACATGCCTG 143 14A' 190478501-MALR1003cL_st1 TTGGTTTGTGTCTTGGTCCCACTTA 144 14B' 190478501-MALR1003cL_st3 CAGGCATGTTGGTTTGTGTCTTGGT 145 15A 011790601ERV9sLU5p_at1 CTGAGGTCCATGGCTTCTTTCCTTG 146 15A' 011790601ERV9sLU5p_st1 CAAGGAAAGAAGCCATGGACCTCAG 147 16A 052681601-MALR1018uL_at1 CCTTTGTTTTCCTACTGACAGGTCC 148 16B 052681601-MALR1018uL_at2 TTCAAAATATTTAACTCTCCAGGCT 149 16C 052681601-MALR1018uL_at3 GAGGTCACATGACTCTGTTGTGGAC 150 16A' 052681601-MALR1018uL_st1 GGACCTGTCAGTAGGAAAACAAAGG 151 16B' 052681601-MALR1018uL_st2 AGCCTGGAGAGTTAAATATTTTGAA 152 16C' 052681601-MALR1018uL_st3 GTCCACAACAGAGTCATGTGACCTC 153 17A 160627301-MALR1014uL_at1 CAGCTGAGATCCGTTGACGCCAGCC 154 17B 160627301-MALR1014uL_at2 TCCGACATGTGGGTGAACTCAGCCA 155 17C 160627301-MALR1014uL_at3 TTCTCAGCCATGTGTTTTGTGAACT 156 17A' 160627301-MALR1014uL_st1 GGCTGGCGTCAACGGATCTCAGCTG 157 17B' 160627301-MALR1014uL_st2 TGGCTGAGTTCACCCACATGTCGGA 158 17C' 160627301-MALR1014uL_st3 AGTTCACAAAACACATGGCTGAGAA 159 18A 111686702-HERV0861uL_at1 TTGAGGCAGGACAGAACCAGGCTCC 160 18B 111686702-HERV0861uL_at2 GGACAGAACCAGGCTCCTGTTAGTC 161 18C 111686702-HERV0861uL_at3 AGTTTACTGAGCAGTGACTTTGTGT 162 18A' 111686702-HERV0861uL_st1 GGAGCCTGGTTCTGTCCTGCCTCAA 163 18B' 111686702-HERV0861uL_st2 GACTAACAGGAGCCTGGTTCTGTCC 164 18C' 111686702-HERV0861uL_st3 ACACAAAGTCACTGCTCAGTAAACT 165 19A 040318302-MALR1134uL_at1 ATAGGGATGATCCTGCACGAATGGC 166 19B 040318302-MALR1134uL_at2 GGATGATCCTGCACGAATGGCATGG 167 19A' 040318302-MALR1134uL_st1 GCCATTCGTGCAGGATCATCCCTAT 168 19B' 040318302-MALR1134uL_st2 CCATGCCATTCGTGCAGGATCATCC 169 20A 041529101-MALR1026uL_at1 AGTGGACACTTTTTAGGATGTCTGC 170 20B 041529101-MALR1026uL_at2 GCCCTGACATAAGAGTTTGCCAGTT 171 20C 041529101-MALR1026uL_at3 CCTGTACCCACCTTTCACCAGAGCT 172 20A' 041529101-MALR1026uL_st1 GCAGACATCCTAAAAAGTGTCCACT 173 20B' 041529101-MALR1026uL_st2 AACTGGCAAACTCTTATGTCAGGGC 174 20C' 041529101-MALR1026uL_st3 AGCTCTGGTGAAAGGTGGGTACAGG 175 21A 141106902-MALR1133uL_at1 AATTGTTGGAATTTGAAAGTGGGGT 176 21A' 141106902-MALR1133uL_st1 ACCCCACTTTCAAATTCCAACAATT 177 22A 060281701-MALR1043uL_at1 GTCAGCACCGTGCTTCTCTAACTTT 178 22B 060281701-MALR1043uL_at2 GCACCGTGCTTCTCTAACTTTCCAC 179 22C 060281701-MALR1043uL_at3 CGTGCTTCTCTAACTTTCCACCTGC 180 22A' 060281701-MALR1043uL_st1 AAAGTTAGAGAAGCACGGTGCTGAC 181 22B' 060281701-MALR1043uL_st2 GTGGAAAGTTAGAGAAGCACGGTGC 182 22C' 060281701-MALR1043uL_st3 GCAGGTGGAAAGTTAGAGAAGCACG 183 23A 043166601-MALR1018uL_at1 CAGCCTCGCACCTAAGAACGCCGTG 184 23B 043166601-MALR1018uL_at2 CAGTGAGAAATCTGCTGGGGATGCC 185 23C 043166601-MALR1018uL_at3 GAAAGGGACATACCTGGCAGGTGCC 186 23A' 043166601-MALR1018uL_st1 CACGGCGTTCTTAGGTGCGAGGCTG 187 23B' 043166601-MALR1018uL_st2 GGCATCCCCAGCAGATTTCTCACTG 188 23C' 043166601-MALR1018uL_st3 GGCACCTGCCAGGTATGTCCCTTTC 189 24A 100090601-HERV0429uL_at1 GGTAGAGACCGAGGCGGATATACAG 190 24B 100090601-HERV0429uL_at3 GAGACCGAGGCGGATATACAGGCCT 191 24A' 100090601-HERV0429uL_st1 CTGTATATCCGCCTCGGTCTCTACC 192 24B' 100090601-HERV0429uL_st3 AGGCCTGTATATCCGCCTCGGTCTC 193 25A 061529601-HERV0492uL_at1 TATACTGGGGCCCAATTCTACAGAC 194 25B 061529601-HERV0492uL_at2 CAGACATTACTTCTTTGCCAGTTGG 195 25C 061529601-HERV0492uL_at3 GACACATTGCAAGTCTGGAAGAGGA 196 25A' 061529601-HERV0492uL_st1 GTCTGTAGAATTGGGCCCCAGTATA 197 25B' 061529601-HERV0492uL_st2 CCAACTGGCAAAGAAGTAATGTCTG 198 25C' 061529601-HERV0492uL_st3 TCCTCTTCCAGACTTGCAATGTGTC 199 26A 100871501-MALR1020cL_at1 CATGATCCTGGGTGAAGCCATGTGT 200 26B 100871501-MALR1020cL_at2 TGTGTCTGAGGATGAAAGGGGATGC 201 26C 100871501-MALR1020cL_at3 CAGATTGATGTGACATGTGGCACCT 202 26A' 100871501-MALR1020cL_st1 ACACATGGCTTCACCCAGGATCATG 203 26B' 100871501-MALR1020cL_st2 GCATCCCCTTTCATCCTCAGACACA 204 26C' 100871501-MALR1020cL_st3 AGGTGCCACATGTCACATCAATCTG 205 27A 170842002-MALR1003uL_at1 AGAGGGAGCACGGTCCCAGTACACC 206 27B 170842002-MALR1003uL_at2 CACGGTCCCAGTACACCTTGAGTGT 207 27C 170842002-MALR1003uL_at3 TGTTACGGCTGTCCCAGGAAAGGAA 208 27A' 170842002-MALR1003uL_st1 GGTGTACTGGGACCGTGCTCCCTCT 209 27B' 170842002-MALR1003uL_st2 ACACTCAAGGTGTACTGGGACCGTG 210 27C' 170842002-MALR1003uL_st3 TTCCTTTCCTGGGACAGCCGTAACA 211 28A 081921103-HERV0958ul_at1 ACTAAGAGCAACAGCCTGAGGCTAA 212 28B 081921103-HERV0958ul_at2 GGCTCACCGGAAACAGGCTGAATGT 213 28C 081921103-HERV0958ul_at3 GAGACACCAGATGACCGCTTGGTCT 214 28D 081921103-HERV0958ul_at4 CAGCTTCCCTAGAATTATACACCAG 215 28E 081921103-HERV0958ul_at5 TACTGAACAGGTTACTTCAACTTGC 216 28F 081921103-HERV0958ul_at6 TTGTAAAAATATAAACGTGAGGCAA 217 28A' 081921103-HERV0958ul_st1 TTAGCCTCAGGCTGTTGCTCTTAGT 218 28B' 081921103-HERV0958ul_st2 ACATTCAGCCTGTTTCCGGTGAGCC 219 28C' 081921103-HERV0958ul_st3 AGACCAAGCGGTCATCTGGTGTCTC 220 28D' 081921103-HERV0958ul_st4 CTGGTGTATAATTCTAGGGAAGCTG 221 28E' 081921103-HERV0958ul_st5 GCAAGTTGAAGTAACCTGTTCAGTA 222 28F' 081921103-HERV0958ul_st6 TTGCCTCACGTTTATATTTTTACAA 223 28G 081921101-HERV0958ul_at1 GATGACAGTTAAGACCCTAGGTTGC 224 28H 081921101-HERV0958ul_at2 CAATCTCAAGTCTGATGACTTGTTA 225 28I 081921101-HERV0958ul_at3 AGACCCATCATTGCTAGCAGACTAT 226 28J 081921101-HERV0958ul_at4 AAGGATGGGAAATGCTCAGGTCACG 227 28K 081921101-HERV0958ul_at5 AGGGCTCATCCACTAACCCCCTGAA 228 28L 081921101-HERV0958ul_at6 GAAATGGATACCCTTGGGTTCAACT 229 28G' 081921101-HERV0958ul_st1 GCAACCTAGGGTCTTAACTGTCATC 230 28H' 081921101-HERV0958ul_st2 TAACAAGTCATCAGACTTGAGATTG 231 28I' 081921101-HERV0958ul_st3 ATAGTCTGCTAGCAATGATGGGTCT 232 28J' 081921101-HERV0958ul_st4 CGTGACCTGAGCATTTCCCATCCTT 233 28K' 081921101-HERV0958ul_st5 TTCAGGGGGTTAGTGGATGAGCCCT 234 28L' 081921101-HERV0958ul_st6 AGTTGAACCCAAGGGTATCCATTTC 235 28M 081921102-HERV0958ul_at1 GTGCCATAACGACAATTAAATTTTT 236 28N 081921102-HERV0958ul_at2 AGTCTTTTGTTATCTATGGAGGACT 237 28O 081921102-HERV0958ul_at3 GTTGTGTTAAAGTTTCTAATTACG 238 28P 081921102-HERV0958ul_at4 GTAACTTTGGGACCAAAACAATGAA 239 28Q 081921102-HERV0958ul_at5 TCATAAGCCTACTAATCCGGGATCA 240 28R 081921102-HERV0958ul_at6 GGGACAAGAACTAATTCCACAGGAG 241 28M' 081921102-HERV0958ul_st1 AAAAATTTAATTGTCGTTATGGCAC 242 28N' 081921102-HERV0958ul_st2 AGTCCTCCATAGATAACAAAAGACT 243 28O' 081921102-HERV0958ul_st3 ACGTAATTAGAAACTTTAACACAAC 244 28P' 081921102-HERV0958ul_st4 TTCATTGTTTTGGTCCCAAAGTTAC 245 28Q' 081921102-HERV0958ul_st5 TGATCCCGGATTAGTAGGCTTATGA 246 28R' 081921102-HERV0958ul_st6 CTCCTGTGGAATTAGTTCTTGTCCC 247 29A 032622601MR41sLU5p_at1 GCCCTTTCTTGAGGTCTGGGTCTGC 248 29A' 032622601MR41sLU5p_st1 GCAGACCCAGACCTCAAGAAAGGGC 249 30A 220246901-HERV0889uL_at1 AGGCTGTAACCCCCCTTAAACTGCC 250 30B 220246901-HERV0889uL_at2 CAACTATGGGGAACTTAACTGGAGT 251 30C 220246901-HERV0889uL_at3 GGAGTCGTTTCAGATGGGTGCTTAC 252 30A' 220246901-HERV0889uL_st1 GGCAGTTTAAGGGGGGTTACAGCC 253 30B' 220246901-HERV0889uL_st2 ACTCCAGTTAAGTTCCCCATAGTTG 254 30C' 220246901-HERV0889uL_st3 GTAAGCACCCATCTGAAACGACTCC 255 31A 061827101-HERV0856uL_at1 GAAGAGTTTCAGCCCTTCAGACAAC 256 31B 061827101-HERV0856uL_at2 GATCCAGGTTTGTCACGCAAGCTGA 257 31C 061827101-HERV0856uL_at3 CCGAGTGGGCACATCAAGCACAGTG 258 31A' 061827101-HERV0856uL_st1 GTTGTCTGAAGGGCTGAAACTCTTC 259 31B' 061827101-HERV0856uL_st2 TCAGCTTGCGTGACAAACCTGGATC 260 31C' 061827101-HERV0856uL_st3 CACTGTGCTTGATGTGCCCACTCGG 261 32A 170828901-HERV0770cL_at1 CACAGGTCTTGCCGAGACCCCCACG 262 32B 170828901-HERV0770cL_at2 CCACGGGCTCACTGTTCAGCTCATC 263 32C 170828901-HERV0770cL_at3 GCTCTGTCACAGTTTCCCACGACTT 264 32A' 170828901-HERV0770cL_st1 CGTGGGGGTCTCGGCAAGACCTGTG 265 32B' 170828901-HERV0770cL_st2 GATGAGCTGAACAGTGAGCCGTGG 266 32C' 170828901-HERV0770cL_st3 AAGTCGTGGGAAACTGTGACAGAGC 267 33A 190148802-MALR1127uL_at1 GGCCAAATTGTGCCACCCCTCCCAA 268 33B 190148802-MALR1127uL_at2 AATTCCCAGGACCTCCTAATATGGC 269 33C 190148802-MALR1127uL_at3 GGTCGTTGTAGGCCCAGCACAGTGG 270 33A' 190148802-MALR1127uL_st1 TTGGGAGGGTGGCACAATTTGGCC 271 33B' 190148802-MALR1127uL_st2 GCCATATTTAGGAGGTCCTGGGAATT 272 33C' 190148802-MALR1127uL_st3 CCACTGTGCTGGGCCTACAACGACC 273 34A 120093401-HERV1034uL_at1 CCTAGCCATGAGCCAATTCCTTGCA 274 34A' 120093401-HERV1034uL_st1 TGCAAGGAATTGGCTCATGGCTAGG
[0039] Without being part of the invention, the present application describes the use of at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least twelve, preferably at least thirty, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-one, preferably at least twenty-one, preferably at least twenty-two, preferably at least twenty-three, preferably at least twenty-four, preferably at least twenty-five, preferably at least twenty-six, preferably at least twenty-seven, preferably at least twenty-eight, preferably at least twenty-nine, preferably at least thirty, of preferably at least 31, preferably at least 32, preferably at least 33,preferably at least 34 pairs of primers according to the invention, as described above, and / or at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least fifteen, preferably at least sixteen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least thirty-ten, preferably at least thirty-ten, preferably at least thirty-ten, preferably at least thirty-ten 32, preferably at least 33, preferably at least 34 hybridization probes according to the invention, as described above, to determine in vitro Or ex vivo the immune status of an individual, preferably a patient.
[0040] Although not part of the invention, the present application describes a method for determining in vitro Or ex vivothe immune status of an individual, as described above, in which at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-seven, preferably at least twenty-one, preferably at least twenty-two, preferably at least twenty-three, preferably at least twenty-four, preferably at least twenty-five, preferably at least twenty-seven, preferably at least twenty-seven, preferably at least twenty-nine, preferably at least thirty, are used preferably at least 31, preferably at least 32, preferably at least 33,preferably at least 34 pairs of primers as described above; and / or at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least thirty, preferably at least sixteen, preferably at least thirty, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least thirty ... 32, preferably at least 33,preferably at least 34 hybridization probes as described above.
[0041] Another object of the invention is the use of a kit to determine in vitro Or ex vivothe immune status of an individual, preferably a patient, comprising means for amplifying and / or detecting at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least sixteen, preferably at least fifteen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-one, preferably at least twenty-one, preferably at least twenty-two, preferably at least twenty-three, preferably at least twenty-four, preferably at least twenty-five, preferably at least twenty-six, preferably at least twenty-seven, preferably at least twenty-eight, preferably at least 29, preferably at least 30, preferably at least 31, preferably at least 32, preferably at least 33,preferably at least 34 sequences chosen from among the sequences identified in SEQ ID NOs: 1 to 34 or from among the sequences which show at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34.
[0042] Preferably, in the kit: the amplification means include, preferably consist of at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least sixteen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least thirty, preferably at least 31, preferably at least 32, preferably at least 33,preferably at least 34 pairs of primers as described above; and / or the detection means include, preferably consist of, at least one, preferably at least two, preferably at least three, preferably at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight, preferably at least nine, preferably at least ten, preferably at least eleven, preferably at least twelve, preferably at least thirty, preferably at least twelve, preferably at least thirty, preferably at least sixteen, preferably at least seventeen, preferably at least fifteen, preferably at least sixteen, preferably at least seventeen, preferably at least eighteen, preferably at least nineteen, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least twenty-ten, preferably at least thirty, preferably at least 31, preferably at least 32,preferably at least 33, preferably at least 34 hybridization probes as described above.
[0043] Preferably, the kit used for the present invention further comprises means for amplifying and / or detecting other biomarkers, in particular endogenous biomarkers (or loci), such as other HERVs / MaLRs and / or genes, preferably genes involved in inflammation and / or immunity, and / or housekeeping genes, and / or exogenous biomarkers, such as viruses.Among the genes involved in immunity, the following are of particular interest: CD74, CX3CR1, IL-10, S100A8, S100A9, MERTK, CLEC7A, CD36, TIMP2, CCL13, PTGS2, IL-12B, IL-6, IL-1A, CCL20, MX1, OAS-1, CCL15, OAS-3, EIF2AK2, IFNγ, NEFH, MMP10, SERPINB2, THBD, STAT1, CCR4, HLA-DRB1 / B3, TCF7, EOMES, BCL11B, ITGA7, IL-18R1, NLRC4, CYP1B1, HGF, IL-5RA, CCL5, CD3G, DPP4, CD4OLG, CD3D, CD127, ICOS IL-1R2, IL-1RN, IL-18, IL-18RAP, OX40L, PD-1, PD-L1, Zonulin (HP), BTLA, C3AR1, CD154, GM-CSF, IFIH1, IL-15, MCP1, PCSK9, STAT4, LTR82B CIITA, LILRB2, CD177, ADGRE3, FLT-1, CD64, TREM-1, TNF-α, IL-1β, ALOX5, IL-17A, NFκB, TBX21, HIF1a, RORgT, OAS-2, GNLY, CTLA-4, TIM 3, CD274, IL-2, IL-7R, GATA3, CXCL10, FAS, GSN, MDC1, DYRK2, TDRD9, CNB1IP1, ZAP70 and ARL14EP.
[0044] Even more preferably, the kit used for the present invention includes means for amplifying and / or detecting up to 100, preferably up to 90, preferably up to 80, preferably up to 70, preferably up to 60, preferably up to 50, preferably up to 40, preferably up to 30, preferably up to 20, preferably up to 10 biomarkers, in total. Figures
[0045] Figure 1 : HERV-V3 chip analysis pipeline. This diagram represents the different steps required to analyze the data from the HERV-V3 chip. Figure 2 : THE figures 2A and 2B represent the protein and molecular (mRNA) expression levels of TNF-α and IL-10 produced by PBMCs from 5 healthy volunteers, stimulated with LPS. Protein levels were measured by an ELISA assay on culture supernatants obtained after performing the endotoxin tolerance model. In the figure 2AThe y-axis represents the protein concentrations (pg / mL) of TNF-α and IL-10. In the figure 2B The y-axis represents the expression levels of TNF-α and IL-10 (expressed as the Fold Change (FC) ratio). The three conditions are represented: NS for negative controls (no stimulation), LPS for cells stimulated once with 100 ng / mL of LPS, and ET for cells subjected to two stimulations with LPS (2 ng / mL followed by 100 ng / mL). Wilcoxon signed-rank tests were performed for statistical analysis of the results: *** indicates a p-value <0.01 between two conditions (NS vs. LPS, NS vs. ET, or LPS vs. ET); ** indicates a p-value <0.05 between two conditions; and * indicates a p-value <0.1 between two conditions. Figure 3 : There figure 3shows the expression of the TNF-α (A) and IL-10 (B) genes, and of the SEQ ID NO 1 (C), SEQ ID NO 4 (D), SEQ ID NO 5 (E) and SEQ ID NO 6 (F) sequences, by PBMCs, from 5 healthy volunteers, stimulated by LPS and quantified by biochips after the endotoxin tolerance model was performed. The y-axis represents the fluorescence intensity of each hybridization probe: (A) 207113_s_at for TNF alpha, (B) 207433_at for IL-10, (C) 190665001-HERV0376uL_at for SEQ ID NO 1, (D) 121601801-HERV0492uL_at for SEQ ID NO 4, (E) 011052702-MALR1044uL_at for SEQ ID NO 5, and (F) 011052202-HERV1033uL_at for SEQ ID NO 6. The three conditions are represented: NS for negative controls (no stimulation), LPS for cells stimulated once with 100 ng / mL of LPS, and ET for cells subjected to two stimulations with LPS. (2 ng / mL then 100 ng / mL). Figure 4 : There figure 4Figure 1 shows the expression of sequences SEQ ID NO 1 (C), SEQ ID NO 4 (D), SEQ ID NO 5 (E), and SEQ ID NO 6 (F) by PBMCs from 5 healthy volunteers, stimulated with LPS and quantified by RT-qPCR after performing the endotoxin tolerance model. The y-axis represents the expression levels of the sequences listed above. The three conditions are represented: NS for negative controls (no stimulation), LPS for cells stimulated once with 100 ng / mL of LPS, and ET for cells subjected to two stimulations with LPS (2 ng / mL then 100 ng / mL). Wilcoxon signed-rank tests were performed for the statistical analysis of the results: *** indicates a p-value <0.01 between two conditions (NS vs. LPS, NS vs. ET, or LPS vs. ET). ** means that the p-value < 0.05 between 2 conditions. * means that the p-value < 0.1 between 2 conditions. Figure 5 : There figure 5shows the expression of the SEQ ID NO 2 (A), SEQ ID NO 3 (B), SEQ ID NO 7 (C), SEQ ID NO 8 (D), SEQ ID NO 11 (E) and SEQ ID NO 12 (F) sequences, from whole blood of 20 patients in septic shock stratified according to the level of mHLA-DR expression and quantified by biochips. The y-axis represents the fluorescence intensity of each of the hybridization probes: (A) 220247002-HERV0797uL for SEQ ID NO 2, (B) 170369402HE41env for SEQ ID NO 3, (C) 130360601-HERV0808cL for SEQ ID NO 7, (D) 141107102-MALR1019uL for SEQ ID NO 8, (E) 050286701-HERV0513uL for SEQ ID NO 11, and (F) 050287402-MALR1022uL for SEQ ID NO 12. The three conditions are represented: VS for healthy volunteers, and on days 1 and 3, DR+ for patients with high HLA-DR expression, considered immunocompetent. DR- patients, having low expression of HLA-DR, are considered immunocompromised. Figure 6 : There figure 6This graph shows the expression of the SEQ ID NO 2 (A), SEQ ID NO 3 (B), SEQ ID NO 7 (C), SEQ ID NO 8 (D), SEQ ID NO 11 (E), and SEQ ID NO 12 (F) sequences from whole blood samples of 20 patients in septic shock stratified according to mHLA-DR expression levels and quantified by RT-qPCR. The y-axis represents the expression levels of the sequences listed above. The three conditions are represented: ESR for healthy volunteers, and on days 1 and 3, DR+ for patients with high HLA-DR expression, considered immunocompetent, and DR- for patients with low HLA-DR expression, considered immunocompromised. Figure 7 : There figure 7This shows the expression of SEQ ID NO 9 (A) and SEQ ID NO 10 (B) sequences from whole blood samples of 102 septic shock patients stratified according to the ratio between CD74 expression levels on day 3 and CD74 expression levels on day 1, and quantified by microarrays. The y-axis represents the fluorescence intensity of each hybridization probe: (A) 021460102-HERV0599uL_st for SEQ ID NO 9 and (B) 021456001-MALR1017uL_at for SEQ ID NO 10. The following conditions are represented on days 1, 3, and 6: immunocompetent patients (high CD74 ratio on day 3 / day 1) and immunocompromised patients (low CD74 ratio on day 3 / day 1). Figure 8 : There figure 8This graph shows the expression of SEQ ID NO 9 (A) and SEQ ID NO 10 (B) sequences from whole blood samples of 102 patients in septic shock, stratified according to the ratio between CD74 expression levels on day 3 and CD74 expression levels on day 1, and quantified by RT-qPCR. The y-axis represents the expression levels of the sequences mentioned above. The following conditions are shown for days 1, 3, and 6: immunocompetent patients (high CD74 ratio on day 3 / day 1) and immunocompromised patients (low CD74 ratio on day 3 / day 1). Figure 9 : There figure 9 shows a graph representing the association between the size of the marker signature and the discriminatory power between patients considered immunocompetent and those considered immunocompromised.
[0046] The present invention is illustrated in a non-limiting way by the following examples. Example 1 : Model of tolerance to endotoxin (ET)
[0047] Endotoxin tolerance refers to a temporary state of inability of a cell or organism to respond to stimulation by an endotoxin, resulting from a first stimulation by an endotoxin.
[0048] The endotoxin tolerance model was developed to mimic, on the one hand, an inflammatory context induced by lipopolysaccharide (LPS) stimulation and, on the other hand, monocyte anergy, which represents a state of cellular "non-response." These components of immunity are found in various types of patients, such as those suffering from sepsis, trauma, burns, or who have undergone major surgery. Materials and methods PBMC stimulation
[0049] The endotoxin tolerance model was established using five units of citrate blood from healthy volunteers collected at the French Blood Establishment (EFS) according to standardized blood donation procedures and used immediately upon receipt. Peripheral blood mononuclear cells (PBMCs) were isolated using a density gradient centrifugation set to 2 million cells per mL and cultured in X-Vivo medium (Lonza) at 37°C and 5% CO2. The endotoxin used in this model was lipopolysaccharide (LPS), a major component of the outer membrane of Gram-negative bacteria. The LPS was obtained from a mixture of three Escherichia coli strains: O111:B4, O55:B5, and O127:B8 (Sigma). All conditions were performed in biological triplicate. ex vivoTo assess endotoxin tolerance, PBMCs are initially cultured for 15 hours either without (NS control cells and LPS cells mimicking the inflammatory condition) or with a dose of 2 ng / mL of LPS (ET cells mimicking monocyte anergy, an immunosuppressive condition). After a washing step, the PBMCs are incubated a second time for 6 hours either without (NS control cells) or with a dose of 100 ng / mL of LPS (LPS and ET cells).
[0050] At the end of the experiments, the culture supernatants are harvested and stored at -80°C. The cells are also harvested, lysed, and stored at -80°C before RNA extraction (using the commercial Qiagen kit) for transcriptomic analysis. To validate the model's effectiveness, the concentrations of the pro-inflammatory cytokine TNF-α (a "tolerable gene") and the anti-inflammatory cytokine IL-10 (a "non-tolerable gene") are determined from the PBMC culture supernatants by ELISA (using commercial R&D System kits). RNA extraction and amplification
[0051] RNA mRNAs are extracted from cultures using commercial kits (RNeasy Mini Plus kit, QIAGEN). ex vivo of PBMC described above.
[0052] The total mRNAs are then quantified and characterized. Characterization of the mRNAs is performed by capillary electrophoresis using the Bioanalyser 2100. The quality of the mRNA samples is assessed by calculating the RNA Integrity Number (RIN). This value is based on the detection of 18S and 28S ribosomal RNAs; if the RIN approaches 10, this indicates that the mRNA is intact (an RIN ≥ 7 is acceptable).
[0053] The synthesis of complementary DNA (cDNA) and the amplification steps are performed using a linear and isothermal method described in 2005 by NuGEN Technologies (Kurn N et al. Novel isothermal, linear nucleic acid amplification systems for highly multiplexed applications. Clinical Chemistry. 2005;51(10):1973-81). The Ribo-SPIA amplification process is used (Watson JD et al. Complementary RNA amplification methods enhance microarray identification of transcripts expressed in the C. elegans nervous system. BMC Genomics. 2008;9:84) starting from 16 ng of total RNA (commercial WTO pico kit, Nugen) and consists of three steps. The first step involves the production of the first cDNA strand by reverse transcription from an mRNA template, using a mixture of random primers and oligo-dT. The second step consists of adding DNA polymerase to the reaction, which induces the production of the second strand of DNA c.The third step initiates SPIA amplification by strand displacement. Hybrid DNA / RNA primers are degraded by the RNase H activity of DNA polymerase when complexed with the cDNA template. Single-stranded DNA synthesis (complementary to the mRNA template) is initiated and continues, allowing new SPIA primers to bind to the cDNA template, thus maintaining the repetitive strand synthesis process. The cDNAs are then fragmented into 50–200 bp fragments using a DNase from 5 µg of purified and amplified DNA (commercial kit, Nugen) and are also labeled at the 3' end (commercial Nugen kit). Both cDNA amplification and fragmentation are verified using BioAnalyser. The amplification profile spans a range of cDNA sizes from 25 to 4,000 nucleotides, with a peak around 1,500 bp.The fragmentation profile should be centered on a population of nucleic acids around a size of 100 nucleotides, which is recommended for hybridization on an Affymetrix DNA chip. Analysis by Biochip
[0054] The identification of sequences exhibiting differential expression relies on the design and use of a high-density DNA microarray in the GeneChip format, called HERV-V3, designed by the inventors and manufactured by Affymetrix. This microarray contains probes that hybridize to distinct HERV sequences within the human genome. These sequences are extracted from a database specific to the inventors, which has already been published (Becker et al. A comprehensive hybridization model allows whole HERV transcriptome profiling using high-density microarray, BMC Genomics 2017 18:286).
[0055] The HERV-V3 chip targets 353,994 HERV / MaLR elements, and more than 1500 immunity genes.
[0056] Once the δ DNA is amplified and fragmented, it can be hybridized onto the HERV-V3 chip in a 50°C oven for 18 hours with constant agitation at 60 rpm during hybridization. A fluidic system automates the washing and staining steps, and finally, after all these steps, the chip is read using a fluorometric scanner.
[0057] The raw dataset is created from the grouping of the CEL files of each chip using classic Affymetrix methods.
[0058] After an initial quality control check of the raw data, several steps are performed: background noise correction using the Robust Multi-array Average (RMA) method, normalization of the data for each chip using quantiles, grouping of probe data into probe sets, and median smoothing. A second quality control step is then carried out. All these steps result in a matrix containing the normalized data.
[0059] Chip pretreatment and statistical analysis are performed using R / Bioconductor.
[0060] A preliminary step to the analysis involves evaluating the quality of the microarrays before and after normalization. Several criteria are considered: RNA quality, cDNA amplification and fragmentation controls, the microarray image produced after scanning, Affymetrix control hybridization, signal intensity (before and after normalization), probe set homogeneity (RLE and NUSE plots), microarray correlation (before and after normalization), and principal component analysis. For all these criteria, a statistical analysis identifies outliers for each microarray, and the data are then grouped. Microarrays that pass fewer than five quality controls are removed from the analysis. For each dataset, a decision table is then generated to summarize all the quality criteria and quickly identify the microarrays to be removed from the analysis.
[0061] Sometimes, a corrective method is necessary for data analysis. This correction, called COMBAT (for Combining Batches), corrects for the technical variability of the dataset, thus highlighting its biological variability.
[0062] Finally, a data filtering step was performed to reduce the dataset and increase statistical power for the analyses. The intensity threshold was defined as the minimum intensity value for which the 75th percentile of the coefficient of variation distribution is below 10%. Thus, the intensity threshold is 2 ≤ 5.5. Probesets below the intensity threshold in more than 68% of all samples (31 out of 45 samples) were eliminated.
[0063] Among the 71,063 probesets targeting HERVs / MaLRs and the 42,560 probesets targeting genes selected in the previous step, a differential expression analysis was performed.
[0064] Studying differential expression between two conditions amounts to calculating the expression ratio or Fold Change (FC). For example, an expression value of 10 under condition A and a value of 5 under condition B, the FC of A / B is 2. FC data will be represented as log2 FC. To determine whether a gene or a HERV / MaLR sequence is differentially expressed between two conditions, the Limma method was used (Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical applications in genetics and molecular biology 2004, 3: Article 3). Statistical tests and their associated p-values are calculated to assess the significance of the observed expression changes. The p-values were adjusted by controlling for the false discovery rate (FDR, due to multiple testing) according to the method of Benjamini and Hochberg (Hochberg et al.).Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B (Methodological) 1995, Vol. 57, No. 1 (1995), pp. 289-300). A probeset is considered to be significantly differentially expressed when the absolute value of the FC in log2 is greater than 1 and the adjusted p-value is below 0.05 (cf. . figure 1 ).
[0065] The sequences that were identified as being most differentially expressed by the biochip were validated by RT-qPCR from the same samples that enabled the production of the HERV-V3 chips. Results
[0066] As previously stated, to validate the effectiveness of the model, the concentrations of the pro-inflammatory cytokine TNF-α ("tolerable gene") and the anti-inflammatory cytokine IL10 ("non-tolerable gene") are determined from PBMC culture supernatants by ELISA (commercial R&D System kits).
[0067] As shown in the figure 2A Cells stimulated twice with LPS (ET model, immunosuppression condition) produce low amounts of TNF-α (100-500 pg / mL) compared to cells stimulated only once (LPS model, inflammatory condition) (500-2000 pg / mL). In contrast, these same cells secrete higher concentrations of IL-10 (100-1000 pg / mL) compared to cells stimulated only once (50-400 pg / mL). These results at the protein level are confirmed at the mRNA level since a significant decrease in TNF-α expression coupled with an increase in IL-10 gene expression ( figure 2B) in cells stimulated twice with LPS were observed compared to PBMCs stimulated only once.
[0068] These results validate the effectiveness of this model.
[0069] An analysis of HERV / MaIR expression and genes in unstimulated (NS, control), once-stimulated with LPS (LPS, inflammatory condition) or twice-stimulated with LPS (ET, immunosuppression condition) PBMCs was performed on the HERV-V3 biochip, designed by the inventors.
[0070] Processing the data generated by analyzing HERV-V3 microarrays using this method allowed us to identify four probe sets. These probe sets exhibited the highest statistically differential expression among sequences showing a statistically significant difference in expression between the different conditions (healthy patients, inflammatory condition, and immunosuppressive condition). As previously stated, for the differential expression to be statistically significant, the absolute value of the log2 fold change must be greater than or equal to 1, and the adjusted p-value must be less than or equal to 0.05. These criteria will apply to all examples. These four probe sets are associated with HERV sequences identified by SEQ IDs NO 1 and 4 through 6. The chromosomal location of each sequence is given in the GRCh38 reference database. In the
[0071] Table 9, below, lists the identified sequences. Table 9 SEQ ID No. CHIP PROBESET NAME HERV-V3 FAMILY NAME LOCATION GRCH38 OF THE ENTIRE ELEMENT SEQ ID NO 1 190665001-HERV0376 LTR101 chr19:54891074-54891496 SEQ ID NO 4 121601801-HERV0492 LTR33 chr12:112971073-112971451 SEQ ID NO 5 011052702-MALR1044 MSTC chr12:112971073-112971451 SEQ ID NO 6 011052202-HERV1033 MLT2B5 chr1:78623489-78623954
[0072] As observed on the figure 3C , the expression of the SEQ ID NO 1 sequence is statistically significantly greater in the NS condition compared to the LPS and ET conditions.
[0073] THE 3D and 3F figures illustrate the expression profile of the SEQ ID NO 4 and SEQ ID NO 5 sequences observed in PBMCs with the HERV-V3 chip. These figures show a similar expression profile, namely, for these two sequences, an increase in expression in the LPS condition compared to the NS and ET conditions, with a statistically significant difference between LPS and ET.
[0074] Sequence SEQ ID NO 6, on the other hand, has a higher expression in the NS and LPS conditions compared to the ET condition, with statistically significant differences between NS and ET, and between LPS and ET ( figure 3F ).
[0075] These results show a modulation of the expression of these sequences in the endotoxin tolerance model and thus their ability to be used as a marker of immune status.
[0076] The results also show that the SEQ ID NO 4 to 6 sequences have a "tolerable" profile (inflammatory condition) in an endotoxin tolerance model while the SEQ ID NO 1 sequence has a "non-tolerable" profile (immunosuppression condition) in an endotoxin tolerance model.
[0077] There figure 3illustrates the expression of the SEQ ID NO 1 (C), SEQ ID NO 4 (D), SEQ ID NO 5 (E), SEQ ID NO 6 (F) sequences on PBMCs, from the same 5 healthy volunteers as for the HERV-V3 biochip, stimulated by LPS and quantified by RT-qPCR after completion of the endotoxin tolerance model.
[0078] The results show that the same profile as that obtained on the biochips is observed for each identified sequence. Thus, the data obtained by the HERV-V3 biochip are confirmed by RT-qPCR ( figure 3 ). Example 2 : Patients in intensive care Materials and methods Patients and Biological Samples
[0079] This retrospective observational study was conducted in patients aged 37 to 77 years (13 men, 7 women, median age: 59 years) admitted to intensive care following septic shock.
[0080] Whole blood samples were collected in PAXgene (PreAnalytix) tubes from these 20 patients in septic shock on days 1 (D1) and 3 or 4 (D3) after admission to intensive care, and then stored (retrospective cohort).
[0081] Patients in this cohort were stratified according to the level of HLA-DR expression on the surface of monocytes (mHLA-DR). mHLA-DR expression was measured on day 3 (days 3 or 4) by flow cytometry.
[0082] 20 patients from this cohort were selected, 10 patients (50%) had high HLA-DR expression on day 3 or 4 (more than 30% expression), and 10 patients (50%) had low HLA-DR expression on day 3 or 4 (less than 30% expression).
[0083] Patients with high HLA-DR expression are considered immunocompetent (DR+) and patients with low HLA-DR expression are considered immunocompromised (DR-). Five healthy volunteers are also included in this study. RNA extraction
[0084] RNA extraction was performed using the PAXgene Blood RNA kit (PreAnalytix) following the manufacturer's recommendations. Before RNA elution, residual genomic DNA was removed by DNase. RNA concentration was determined by fluorimetry (RNA assay kit on a Qubit analyzer, Life Technologies). RNA quality was then checked using the RNA 6000 Nano kit on a bioanalyzer (Agilent Technologies), with samples having an RNA Integrity Number (RIN) greater than 6 being considered of good quality.
[0085] The steps of RNA amplification, biochip analysis and RT-qPCR sequence validation that have been identified as being differentially expressed by the biochip are implemented as described in Example 1. Results
[0086] The processing of data generated by the analysis of HERV-V3 microarrays using this method allowed the identification of six probe sets. These probe sets are the most statistically differentially expressed among the sequences exhibiting a statistically significant difference in expression between the two conditions (immunocompetent and immunosuppressive). These six probe sets are associated with HERV sequences identified by SEQ IDs NO 2, 3, 7, 8, 11, and 12. The chromosomal location of each sequence is given in the GRCh38 reference database. Table 10 below lists the six identified sequences. Table 10 SEQ ID No. PROBESET CHIP NAME HERV-V3 FAMILY NAME LOCATION GRCH38 OF THE ENTIRE ELEMENT SEQ ID NO 2 220247002-HERV0797 MER4B chr22:36153696-36154283 SEQ ID NO 3 170369402HE41env HERV-E4.1 chr17:35505737-35508365 SEQ ID NO 7 130360601-HERV0808 MER50C chr13:42884951-42886257 SEQ ID NO 8 141107102-MALR1019 MLT1J1 chr14:91230494-91230820 SEQ ID NO 11 050286701-HERV0513 LTR40A chr5:14551189-14551685 SEQ ID NO 12 050287402-MALR1022 MLT1K chr5:14562791-14563322
[0087] As observed on the Figures 5A and 5C The expression of SEQ ID NO 2 and 7 sequences is decreased in immunocompromised (DR-) patients from day 1 after admission to intensive care compared to immunocompetent patients. Whereas the expression of SEQ ID NO 3, 8, 11 and 12 is decreased in immunocompromised (DR-) patients by day 3 after admission to intensive care compared to immunocompetent patients (cf. figures 5B, 5D, 5E and 5F ).
[0088] These results demonstrate the usefulness of SEQ ID NO sequences 2 and 7 as markers of immunosuppression, even on day 1. SEQ ID NO sequences 3, 8, 11, and 12, on the other hand, are markers of immunosuppression on day 3.
[0089] These sequences, identified as being differentially expressed by the biochip, were validated by RT-qPCR. The results are illustrated in the following: figure 6 .
[0090] Profiles similar to those obtained on biochips are observed for each identified sequence. Thus, the data obtained by the HERV-V3 biochip are confirmed by RT-qPCR. Example 3 : Patients in intensive care Materials and methods Patients and Biological Samples
[0091] This retrospective observational study was conducted on patients admitted to intensive care units in 6 French hospitals between 2009 and 2011. The inclusion criteria were as follows: patients aged 18 years or older; clinician prediction of a length of stay in intensive care of at least 2 days; patients with at least one site of acute infection suspected or confirmed by the clinician on clinical or paraclinical manifestations; patients with at least two of the following criteria: ∘ temperature above 38°C or below 36°C; ∘ heart rate above 90 beats per minute; ∘ respiratory rate above 20 breaths per minute or PaCO2< 32 mmHg; ∘ leukocyte count above 12000 / mm3 or below 4000 / mm3.
[0092] The exclusion criteria were as follows: pre-existing immunosuppression, including recent chemotherapy or immunosuppressive therapy, high dose (> 5 mg / kg prednisolone equivalent for a duration > 5 days) or prolonged (0.5 mg / kg prednisolone > 30 days) corticosteroid therapy; aplasia (circulating neutrophils <500 cells / mm3), primary immunodeficiency and extracorporeal circulation in the month prior to admission to the intensive care unit.
[0093] Of all the patients, 102 met the following criteria: patients in septic shock; a first blood sample was taken at most within the first 24 hours following the patient's arrival in intensive care (D1); a second blood sample was taken between 3 and 4 days following the patient's arrival in intensive care (D3); a third blood sample was taken 6 days following the patient's arrival in intensive care (D6).
[0094] Next, patients in this cohort were stratified according to the ratio of CD74 expression level on day 3 to CD74 expression level on day 1, as measured by RT-qPCR. The cohort was divided into two categories. Individuals with a CD74 J3 / J1 ratio greater than 1.23 were classified as "high" and considered immunocompetent. Those with a CD74 J3 / J1 ratio less than 1.23 were classified as "low" and considered immunocompromised.
[0095] Of the 102 patients in this cohort, 52 (51%) are considered immunocompromised (low CD74+ / CD1 ratio on day 3) and 50 (49%) are considered immunocompetent (high CD74+ / CD1 ratio on day 3). The RNA extraction step is performed as described in Example 2.
[0096] The steps of RNA amplification, biochip analysis and RT-qPCR validations (on J1 and J3) of sequences that have been identified as being differentially expressed by the biochip are implemented as described in example 1. Results
[0097] The processing of data generated by the analysis of HERV-V3 microarrays using this method allowed the identification of two sets of probe sets. These probe sets are the most statistically differentially expressed among the sequences exhibiting a statistically significant difference in expression between the two conditions (immunocompetent and immunosuppressive). These two probe sets are associated with HERV sequences identified by SEQ IDs NO 9 and 10. The chromosomal location of each sequence is given in the GRCh38 reference database. Table 11 below lists the two identified sequences. Table 11 SEQ ID No. PROBESET CHIP NAME HERV-V3 FAMILY NAME LOCATION GRCH38 OF THE ENTIRE ELEMENT SEQ ID NO 9 021460102-HERV0599uL LTR82B chr2:102363654-102366601 SEQ ID NO 10 021456001-MALR1017uL MLT1I chr2:102013616-102013971
[0098] As observed on the figure 7A , the expression of the SEQ ID NO 9 sequence is higher on day 3 in patients with a "low" CD74 J3 / J1 ratio compared to patients with a "high" CD74 J3 / J1 ratio.
[0099] Similarly for the expression of the sequence SEQ ID NO 10 ( figure 7B ), it is higher on day 3 in patients with a "low" CD74 ratio on day 3 / day 1 compared to patients with a "high" CD74 ratio on day 3 / day 1.
[0100] Thus these results show the usefulness of these SEQ ID NO 9 and 10 sequences as a marker of the state of immunosuppression at day 3.
[0101] These sequences, identified as being differentially expressed by the biochip, were validated by RT-qPCR on days 1 and 3 in 30 of the 102 patients in the cohort. The results are illustrated in Figure 1. figure 8 .
[0102] Profiles similar to those obtained on biochips are observed for each identified sequence. Thus, the data obtained by the HERV-V3 biochip are confirmed by RT-qPCR in 30 patients. Example 4: Notation of identified sequences
[0103] For each of the sequences identified in examples 1 to 3 (SEQ ID NO 1-12), the inventors assigned a score. This score is based on the expression profiles, shown in bullet points, of the SEQ ID NO 1 to 12 sequences observed in the cohort of example 2.
[0104] The inventors assigned scores ranging from 1 to 4 stars. All criteria are visual, based on graphs showing the expression of the different identified sequences. As previously mentioned, all these sequences were already selected based on their level of expression and expression differential. The scoring method is described in Table 12 below. Table 12 CRITERIA NOTE Increased expression in patients with low DR on day 3 and a visible difference from day 1 **** Increased expression in patients with low DR on day 3, difference not visible on day 1 *** Decreased expression in patients with low DR from day 1, difference visible or not on day 3 ** Decreased expression in patients with low DR on day 3, difference not visible on day 1 *
[0105] Table 13 below shows the score obtained for each of the sequences identified in examples 1 to 3. Table 13 SEQ ID No. PROBESET CHIP NAME HERV-V3 CHROMOSOMAL LOCALIZATION SCORE SEQ ID 1 190665001-HERV0376 chr19:54891074-54891496 *** SEQ ID 2 220247002-HERV0797 chr22:36153696-36154283 ** SEQ ID 3 170369402HE41env chr17:35505737-35508365 * SEQ ID 4 121601801-HERV0492 chr12:112971073-112971451 ** SEQ ID 5 011052702-MALR1044 chr1:78648318-78648697 ** SEQ ID 6 011052202-HERV1033 chr1:78623489-78623954 ** SEQ ID 7 130360601-HERV0808 chr13:42884951-42886257 *** SEQ ID 8 141107102-MALR1019 chr14:91230494-91230820 * SEQ ID 9 021460102-HERV0599 chr2:102363654-102366601 *** SEQ ID 10 021456001-MALR1017 chr2:102013616-102013971 *** SEQ ID 11 050286701-HERV0513 chr5:14551189-14551685 **** SEQ ID 12 050287402-MALR1022 chr5:14562791-14563322 **** Example 5 : HERV markers of immunosuppression
[0106] For the identification of specific markers of immunosuppression, the inventors used data generated by the analysis of HERV-V3 chips from the samples of Example 2.
[0107] Thus, the inventors selected the HERV sequences differentially expressed at day 3 between patients considered immunocompromised (DR-) and those considered immunocompetent (DR+), but which are not differentially expressed between the healthy volunteers in the study and all patients (whether DR+ or DR-, whether at day 1 or day 3).
[0108] This selection process identified 17 HERV sequences. For each identified sequence, the researchers assigned a score based on several criteria (expression profile, fold change, expression level, consistency of expression profiles between the sense and antisense probes, visible expression difference from day 1, and absence of excessive variability between patients). Table 14 below describes the method for assigning points for each criterion. Table 14 CRITERIA DESCRIPTION POINTS Expression profile Increase in patients considered immunocompetent (DR-) compared to those considered immunocompromised (DR+) 2 Or Or Decrease in patients considered immunocompetent (DR-) compared to those considered immunocompromised (DR+) 1 Level of expression Overall expression level above 5 1 Fold Change High fold change (log2 FC visually greater than 1.5) 1 Consistency of sense / antisense The expression profile is the same between the sense and antisense probes. 1 Visible difference from day 1 Difference between patients with high DR and low DR visible from day 1 (even if small difference). 1 Variability Penalty if variability is too high. -1 SCORE / 6
[0109] Using this scoring method, the inventors selected 10 candidates and eliminated 7 whose performance appeared insufficient. Table 15 below lists the 10 identified markers with their respective scores. Table 15 SEQ ID No. PROBESET CHIP NAME HERV-V3 CHROMOSOMAL LOCALIZATION SCORE SEQ ID 13 052182701-MALR1129 chr5:132453630-132454148 5 SEQ ID 14 190478501-MALR1003 chr19:41812466-41813010 4 SEQ ID 15 011790601ERV9sLU5 chr1:155637287-155637547 4 SEQ ID 16 052681601-MALR1018 chr5:170290289-170290812 4 SEQ ID 17 160627301-MALR1014 chr16:50662453-50662912 4 SEQ ID 18 111686702-HERV0861 chr11:122671887-122672147 3 SEQ ID 8 141107102-MALR1019 chr14:91230494-91230820 3 SEQ ID 19 040318302-MALR1134 chr4:15825146-15825565 2 SEQ ID 20 041529101-MALR1026 chr4:83464568-83464963 2 SEQ ID 21 141106902-MALR1133 chr14:91222760-91223118 2
[0110] Sequences SEQ ID 13 to 18 and 19 to 21 are newly identified sequences. As for sequence SEQ ID 8, it is a sequence that has already been identified in example 2. Example 6 : HERV markers of inflammation
[0111] For the identification of specific inflammation markers, the inventors used data generated by HERV-V3 chip analyses from samples in Examples 1 and 2.
[0112] Thus, the inventors selected HERV sequences that were differentially expressed between the LPS condition (immunosuppression condition) and the NS condition (negative controls), in example 1, and differentially expressed between patients on day 1 or day 3 compared to healthy volunteers, in example 2.
[0113] This selection process identified 13 HERV sequences. As in Example 5, for each identified sequence, the inventors assigned a score based on the same criteria. The method for assigning points for each criterion is described in Table 16 below. Table 16 CRITERIA DESCRIPTION POINTS Expression profile Increase in patients compared to healthy volunteers 2 Or Or Decrease in patients compared to healthy volunteers 1 Level of expression Overall expression level above 5 1 Fold Change High fold change (log2 FC visually greater than 1.5) 1 Consistency of sense / antisense The expression profile is the same between the sense and antisense probes. 1 Visible difference from day 1 Difference between DR+ and DR- patients visible from day 1 (even if small difference). 1 Variability Penalty if variability is too high. -1 SCORE / 6
[0114] Using this scoring method, the inventors selected 7 candidates and eliminated 6 whose performance appeared insufficient. Here is the
[0115] Table 17, below, lists the 7 identified markers with their respective scores. Table 17 SEQ ID No. PROBESET CHIP NAME HERV-V3 CHROMOSOMAL LOCALIZATION SCORE SEQ ID 1 190665001-HERV0376 chr19:54891074-54891496 6 SEQ ID 1 190665002-HERV0376 chr19:54891074-54891496 6 SEQ ID 22 060281701-MALR1043 chr6:18403673-18404108 5 SEQ ID 23 043166601-MALR1018 chr4:184850413-184850785 5 SEQ ID 24 100090601-HERV0429 chr10:5856198-5856795 4 SEQ ID 25 061529601-HERV0492 chr6:107800650–107801138 3 SEQ ID 26 100871501-MALR1020 chr10:60410534–6 3 SEQ ID 27 170842002-MALR1003 chr17:78345106–78345577 3
[0116] This inflammation marker identification strategy led to the identification of 6 new sequences (SEQ ID 22 to 27) and the rediscovery of a sequence already identified in Example 1 (SEQ ID 1). It should also be noted that 2 probe sets target the same HERV sequence (SEQ ID 1). Example : Signature of immune status markers
[0117] For this example, the objective was to determine a marker signature that would best discriminate between patients considered immunocompromised and those considered immunocompetent. To do this, the inventors used data generated by the HERV-V3 chip analyses from the samples in examples 2 and 3.
[0118] The inventors selected HERV sequences that were differentially expressed on day 3 between patients considered immunocompromised (DR-) and those considered immunocompetent (DR+). This selection resulted in the identification of a list of 193 HERV sequences.
[0119] In order to obtain a reduced signature that would still allow for the best possible discrimination between patients considered immunocompromised and those considered immunocompetent from these 193 HERV sequences, the inventors applied the "Random Forests" method (Tin Kam Ho, Random Decision Forests,AT&T Bell Laboratories). This method allows each sequence to be classified according to its discriminatory power between the two conditions studied (immunocompromised and immunocompetent).
[0120] Next, to determine the optimal number of sequences to compose the signature, the inventors calculated the prediction performance on the cohort of example 3, using the discriminant power for signatures ranging in size from 2 to 30 markers between patients with a low CD74 ratio between day 3 and day 1 and those with the same high ratio. Thus, they determined that the signature with a size of 10 sequences had the best performance (best area under the curve: AUC) (cf. figure 9 ). In Table 18 below, the list of markers composing the signature allowing the best discrimination between patients considered immunocompromised and patients considered immunocompetent. Table 18 SEQ ID NO HERV-V3 CHIP PROBET NAME CHROMOSOMAL LOCALIZATION SEQ ID 28 081921103-HERV0958 chr8:125945973–125951030 SEQ ID 29 032622601MR41sLU5p chr3:167401329–167401866 SEQ ID 30 220246901-HERV0889 chr22:36147793–36148208 SEQ ID 31 061827101-HERV0856 chr6:127790579–127792191 SEQ ID 3 170369402HE41approx chr17:35505737–35508365 SEQ ID 32 170828901-HERV0770 chr17:77462942–77463350 SEQ ID 28 081921101-HERV0958 chr8:125945973–125951030 SEQ ID 28 081921102-HERV0958 chr8:125945973–125951030 SEQ ID 33 190148802-MALR1127 chr19:14612123–14612747 SEQ ID 34 120093401-HERV1034 chr12:9038254–9
[0121] Note that this signature is composed of 8 sequences using 10 different probe sets. Indeed, 3 probe sets target the same sequence (SEQ ID NO 28). Furthermore, this signature includes the SEQ ID 3 sequence already identified in Example 2. The HERV sequences appear in the table above in an order reflecting their "importance" in stratifying patients according to their immune status, based on a score assigned to them by the Random Forests classification algorithm.
Claims
1. A Method for determining in vitro or ex vivo the immune status of an individual, wherein the individual is a trauma patient, a patient with burns, a surgical patient or a patient with sepsis, preferably a patient with septic shock, said method comprising a step of detecting and / or quantifying the expression, in a test biological sample from said individual, also referred to as a test biological sample, of at least a portion of at least one HERV / MaLR sequence selected from the sequences identified in SEQ ID NOs: 1 to 34 or from among the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ ID NOs: 1 to 34, from the following lists: - List 1 : SEQ ID NOGRCh38 LocationName of the corresponding probeset of the HERV-V3 chip1chr19:54891074-54891496190665001-HERV03762chr22:36153696-36154283220247002-HERV07973chr17:35505737-35508365170369402HE41env4chr12:112971073-112971451121601801-HERV04925chr1:78648318-78648697011052702-MALR10446chr1:78623489-78623954011052202-HERV10337chr13:42884951-42886257130360601-HERV08088chr14:91230494-91230820141107102-MALR10199chr2:102363654-102366601021460102-HERV0599uL10chr2:102013616-102013971021456001-MALR1017uL11chr5:14551189-14551685050286701-HERV051312chr5:14562791-14563322050287402-MALR1022 - List 2 : SEQ ID NOGRCh38 LocationName of the corresponding probeset of the HERV-V3 chip13chr5:132453630-132454148052182701-MALR112914chr19:41812466-41813010190478501-MALR100315chr1:155637287-155637547011790601ERV9sLU516chr5:170290289-170290812052681601-MALR101817chr16:50662453-50662912160627301-MALR101418chr11:122671887-122672147111686702-HERV08618chr14:91230494-91230820141107102-MALR101919chr4:15825146-15825565040318302-MALR113420chr4:83464568-83464963041529101-MALR102621chr14:91222760-91223118141106902-MALR1133 - List 3 : SEQ ID NOGRCh38 LocationName of the corresponding probeset of the HERV-V3 chip1chr19:54891074-54891496190665001-HERV03761chr19:54891074-54891496190665002-HERV037622chr6:18403673-18404108060281701-MALR104323chr4:184850413-184850785043166601-MALR101824chr10:5856198-5856795100090601-HERV042925chr6:107800650-107801138061529601-HERV049226chr10:60410534-60411224100871501-MALR102027chr17:78345106-78345577170842002-MALR1003 - List 4 : SEQ ID NOGRCh38 LocationName of the corresponding probeset of the HERV-V3 chip28chr8:125945973-125951030081921103-HERV095829chr3:167401329-167401866032622601MR41sLU5p30chr22:36147793-36148208220246901-HERV088931chr6:127790579-127792191061827101-HERV08563chr17:35505737-35508365170369402HE41env32chr17:77462942-77463350170828901-HERV077028chr8:125945973-125951030081921101-HERV095828chr8:125945973-125951030081921102-HERV095833chr19:14612123-14612747190148802-MALR112734chr12:9038254-9038598120093401-HERV10342. The method according to claim 1, further comprising the following steps of: - comparing the expression in the biological test sample, with a reference expression, or with the expression in a reference biological sample, - then determining the immune status of said individual from said comparison.
3. The method according to any of claims 1 and 2, wherein the expression is detected and / or quantified at the RNA transcript or mRNA level.
4. The method according to claim 3, wherein the expression is detected and / or quantified by a hybridization method, preferably with a hybridization chip, by in situ hybridization or by Northern blot, by an amplification method, preferably by RT-qPCR, or by sequencing, preferably by high throughput sequencing.
5. The method according to any of claims 1 to 4, wherein the immune status is determined as being an immunosuppression status, an immunocompetence status, or an inflammation status.
6. The method according to any of claims 1 to 5, wherein the test biological sample is obtained by sampling made within 10 days following the admission to the medical facility.
7. The method according to any of claims 2 to 6, wherein the reference biological sample is a biological sample taken from a healthy individual, preferably a biological sample taken from the same individual from which the test biological sample was taken but collected before infection or aggression, or a biological sample from an individual of known immune status, preferably with inflammation status, normal immune status, or immunosuppression status.
8. A use of a kit comprising means for amplifying and / or detecting at least one sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which have at least 99% identity with one of the identified sequences in SEQ Nos: 1 to 34, characterized in that said amplification and / or detection means allow the amplification and / or the detection of at most 100 biomarkers, in total, for determining in vitro or ex vivo the immune status of an individual, wherein the individual is a trauma patient, a patient with burns, a surgical patient or a patient with sepsis, preferably a patient with septic shock9. The use according to claim 8, wherein: - the amplification means comprise at least one pair of primers consisting of two amplification primers selected from amplification primers comprising a nucleotide sequence complementary to at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ Nos: 1 to 34, and the complementary sequences of these sequences, said at least one pair of amplification primers making it possible to amplify, preferably making it possible to specifically amplify, at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% of identity with one of the sequences identified in SEQ Nos: 1 to 34, and the sequences complementary to these sequences, and / or - the detection means comprise at least one hybridization probe whose nucleotide sequence comprises a nucleotide sequence complementary to at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ Nos: 1 to 34, and the sequences complementary to these sequences.
10. The use according to claims 8 or 9, characterized in that at least one pair of amplification primers is selected from the following pairs of amplification primers: Pair of primers #Primers # (SEQ ID Nos, nucleotide sequence)1Forward : Primer #1A (SEQ ID No : 35, TGTACAAAACTCAAATGGTCTTC)Reverse : Primer #1B (SEQ ID No : 36, ATGACCAACTTAGATTTCCTTGA)2Forward : Primer #2A (SEQ ID No : 37, GCCAGAGAGGCATAATGAAGCA)Reverse : Primer #2B (SEQ ID No : 38, GATTCTAAGCCTCCCCCTCATTT)3Forward : Primer #3A (SEQ ID No : 39, TGGCTCATAGGGATTCCAGACT)Reverse : Primer #3B (SEQ ID No : 40, AGCAAGTTGTCAAGAGCCAATCT)4Forward : Primer #4A (SEQ ID No : 41, CACTCTAGGAATCTTAGGCA)Reverse : Primer #4B (SEQ ID No : 42, TGAAACCAATAGTCCAGTG)5Forward : Primer #5A (SEQ ID No : 43, TTCTACTGTTCACTGCTATCCTCC)Reverse : Primer #5B (SEQ ID No : 44, CCTGTGGCAGCTTTTTGAAGTAA)6Forward : Primer #6A (SEQ ID No : 45, AGAGCAGAAGAAGATGGATACT)Reverse : Primer #6B (SEQ ID No : 46, CATGAGCTGACATCATCCAAT)7Forward : Primer #7A (SEQ ID No : 47, TCTGTACTGGTTGCCCCAAC)Reverse : Primer #7B (SEQ ID No : 48, CGTGCCAGGCCTCTAATACTTTT)8Forward : Primer #8A (SEQ ID No : 49, AGGGAAGACCCCAAGATGATG)Reverse : Primer #8B (SEQ ID No : 50, CATGCAAAGTCCAACGAGAGG)9Forward : Primer #9A (SEQ ID No : 51, GGGTGGCTGCATCCTATGG)Reverse : Primer #9B (SEQ ID No : 52, CTGGTCAGGAAAAAATTTGCCTTC)10Forward : Primer #10A (SEQ ID No : 53, ACATGACATTGTCTGAACTTTGGG)Reverse : Primer #10B (SEQ ID No : 54, TAGGACCATGCAGATACTAGTGAC)11Forward : Primer #11A (SEQ ID No : 55, GAACTCCACAAACCTTGA)Reverse : Primer #11B (SEQ ID No : 56, GCTAGAAGCTTTGGATATCT)12Forward : Primer #12A (SEQ ID No : 57, TGGCTGTTACAACTTTCATG)Reverse : Primer #12B (SEQ ID No : 58, TCTCCCTATTCTGAGCACA)11. The use according to any of claims 8 to 10, wherein at least one hybridization probe is selected from the hybridization probes of sequences SEQ ID No: 59 to 274.
12. The use according to any of claims 8 to 11, further comprising means for amplifying and / or detecting other biomarkers, particularly endogenous biomarkers, such as other HERV / MaLR and / or genes, preferably genes involved in the inflammation and / or the immunity, and / or housekeeping genes, and / or exogenous biomarkers, such as viruses.
13. The use - of at least one sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which have at least 99% identity with one of the sequences identified in SEQ Nos: 1 to 34; and / or - of at least one pair of amplification primers, consisting of two amplification primers selected from amplification primers comprising a nucleotide sequence complementary to at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ Nos: 1 to 34, and the complementary sequences of these sequences, said at least one pair of amplification primers making it possible to amplify, preferably making it possible to specifically amplify, at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% of identity with one of the sequences identified in SEQ Nos: 1 to 34, and the sequences complementary to these sequences; and / or - of at least one hybridization probe whose nucleotide sequence comprises a nucleotide sequence complementary to at least part of a sequence selected from the sequences identified in SEQ Nos: 1 to 34 or from the sequences which exhibit at least 99% identity with one of the sequences identified in SEQ Nos: 1 to 34, and the sequences complementary to these sequences; and / or - for determining in vitro or ex vivo the immune status of an individual, wherein the individual is a trauma patient, a patient with burns, a surgical patient or a patient with sepsis, preferably a patient with septic shock.
14. The use according to claim 13, characterized in that: - at least one pair of amplification primers is selected from the pairs of amplification primers # 1 to 12 according to claim 10; and / or - at least one hybridization probe is selected from the hybridization probes of sequences SEQ ID No: 59 to 274.