Method of qualitative control of stem cells
Patent Information
- Application Number
- EP2023782139
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-07
- Filing Date
- 2023-09-12
- Publication Date
- 2025-07-23
AI Technical Summary
Current methods for quality control of pluripotent stem cells, particularly induced pluripotent stem cells (iPSCs), are not standardized, scalable, robust, or rapid, and often require complex and costly assays, including teratoma tests in animal models, which are ethically questionable and difficult to quantify.
A method based on epigenetic analysis of DNA methylation (DNAm) using specific CpG dinucleotides to determine pluripotency and differentiation potential, allowing for rapid and cost-effective quality control of stem cells through high-throughput analysis of DNA methylation levels, eliminating the need for animal testing.
Enables reliable, efficient, and standardized assessment of pluripotency and differentiation potential of stem cells, reducing costs and accelerating research and industrial production by providing a scalable and robust quality control process.
Smart Images

Figure 1.1
Abstract
Description
[0001] Methods for the qualitative control of stem cells
[0002] Background of the invention
[0003] The invention relates to a method for the qualitative control of at least one specific property of at least one stem cell, in particular a method for the quality control of the pluripotency of pluripotent stem cells (PSCs).
[0004] State of the art
[0005] Pluripotent stem cells (PSCs) can differentiate into all cells of the human body. A distinction is made between embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), which are reprogrammed from differentiated cells through the overexpression of certain transcription factors. Pluripotent stem cells are used by the pharmaceutical industry for drug development and tested in clinical trials. However, the quality control of pluripotent stem cells and the quantitative tracking of early differentiation processes represent a major hurdle.
[0006] Pluripotent stem cells are characterized by their ability to differentiate into the three embryonic germ layers: endoderm, mesoderm, and ectoderm. To confirm pluripotency, cells are typically targeted to these lineages using specific culture media or verified using untargeted multilineage differentiation assays in embryoid bodies (EBs) or teratomas (International Stem Cell, 2018). Marker genes can then be evaluated for their gene expression or at the protein level (Gifford et al., 2013; O'Shea et al., 2020). The so-called "ScoreCard panel," based on quantitative reverse transcription-PCR (RT-qPCR) measurements of 96 genes, can be used to determine early germ layer-specific differentiation (Bock et al., 2011; Tsankov et al., 2015). Pluripotency can also be determined based on gene expression profiles by the so-called “PluriTest™”, iea bioinformatics analysis of transcriptomes of undifferentiated cells (Muller et al., 2011). It reflects the transcriptomic characteristics of PSCs but does not reveal the ability to differentiate into specific germ layers (Bouma et al., 2017).
[0007] DNA methylation (DNAm) plays an important role in cellular differentiation and manifests during embryonic development (Bock et al., 2011). It occurs particularly at cytosine-guanine dinucleotides (CpG sites), and these epigenetic modifications can be cell-type specific (Roadmap Epigenomics et al., 2015). Since each cell has two copies of DNA, DNAm is well suited for the application of deconvolution algorithms to estimate the composition of different cell types. This approach has already been used for the so-called "Epi-Pluri-Score," a signature that can distinguish pluripotent from non-pluripotent cells based on DNAm alterations at three specific CpG sites (Lenz et al., 2015). However, this signature was selected only based on somatic cells and reprogrammed iPSCs and thus cannot detect early differentiation changes and germ layer-specific alterations.
[0008] The differentiation potential into various cell types is considered an essential quality characteristic of iPSCs and is often tested using complex and ethically questionable teratoma assays in mouse models. Immunophenotypic and gene expression-based methods, however, are difficult to quantify and standardize. A quantitative, robust, and scalable test for estimating germ layer-associated cell fractions in early differentiation is not yet available. Current methods for detecting the pluripotency of human induced pluripotent stem cells are often not standardizable, time-consuming, and / or associated with relatively high costs. For the pharmaceutical industry, which uses iPSCs for the production of therapeutic products or tests them as cell therapies in clinical trials, robust and rapid quality control of the starting material is essential.However, at present, no commercial process can fully meet these criteria.
[0009] Description of the invention
[0010] The object of the invention is to provide an improved method that enables standardizable, scalable, robust and rapid quality control of stem cells.
[0011] According to the invention, the object is achieved by a method of the type mentioned above, which comprises the following steps:
[0012] - Isolating at least one nucleic acid molecule of the stem cell;
[0013] - determining the respective degree of methylation of at least one specific region of the nucleic acid molecule, wherein the specific region comprises at least one CpG dinucleotide;
[0014] - Determining at least one control value from the determined methylation level; and
[0015] - Comparing the control value with at least one reference value, whereby the result of the comparison directly indicates the specific property of the stem cell.
[0016] In contrast to known or commercially available methods, the inventive solution is based on the epigenetic analysis of genomic DNA. DNA methylation (DNAm) exhibits significantly lower variability compared to gene expression, which allows the obtained results to be easily standardized and compared. The advantageous inventive method is therefore based on epigenetic properties of DNA and is therefore also suitable for retrospective analysis of previously isolated samples. Since DNA is relatively stable, the samples can be easily shipped at room temperature for testing and analyzed using a high-throughput method. In addition to qualitative pluripotency analysis, the inventive method also offers the possibility of enabling users to estimate the differentiation potential of the cells. This is of particular interest for the development of optimized industrially usable iPS cell lines.In conjunction with the differentiation of iPSCs, the method according to the invention also provides the user with information about the differentiability of the analyzed stem cells into the three germ layers, which is considered an essential quality characteristic for pluripotent stem cells. This information can be reliably generated after just a few days of cultivation using pyrosequencing or comparable methods for targeted DNA methylation measurement. In contrast to teratoma assays, this advantageously does not require animal testing.
[0017] In contrast to previously known epigenetic signatures (e.g., "Epi-Pluri-Score"), which were established by comparing pluripotent cells with somatic cells, the signatures of the present invention were selected based on early differentiation stages during development in the endoderm, mesoderm, and ectoderm. In addition to the specifically generated datasets, publicly available methylation data from iPSCs, embryonic stem cells (ESCs), and terminally differentiated cells were used to identify specific CG dinucleotides (CpG sites) where specific changes in DNA methylation occurred during the differentiation processes into the respective germ layers.Three specific CpGs were assigned to each of the four categories of pluripotent stem cells (PSCs), endoderm (ENDO), mesoderm (MESO), and ectoderm (ECTO), each showing significant differences in DNAm levels (levels of DNA methylation) compared to iPSC reference values. Since the epigenetic signatures of endoderm and mesoderm are difficult to separate at the beginning of development, the additional category of endomesoderm (ENDOMESO) was introduced. Methylation values of differentiated and undifferentiated cells from three specifically reprogrammed iPSC clones were used to select the CpG sites for PSCs, and the differences in DNA methylation were analyzed.
[0018] The method according to the invention is therefore based on the methylation of at least one CpG dinucleotide, which exhibits early and characteristic changes during differentiation into endoderm, mesoderm, and ectoderm. The method according to the invention enables both (1) the determination of a first control value based on the degree of methylation (DNAm degree) of at least one CpG, preferably at least two or three CpGs, and enables a reliable differentiation between pluripotent and somatic cells ("pluripotency score"), and (2) the determination of a second control value based on the degree of methylation (DNAm degree) of at least one CpG, preferably at least three CpGs, per germ layer and enables a reliable validation of differentiation into each of the three germ layers ("differentiation score").The method according to the invention can thus be advantageously used, for example, for quality control of the pluripotency of (human) induced pluripotent stem cells by analyzing methylation at three specific CG dinucleotides. However, the method according to the invention can also be applied to embryonic stem cells. Furthermore, the differentiability of stem cells into the three germ layers (endo-, meso-, and ectoderm) can be estimated already in early phases of differentiation. The solution according to the invention thus enables, for example, both the validation of the pluripotency of reprogrammed cells and the validation of the differentiation or differentiability into all three lineages and the composition of the germ layers in early cell aggregates, in particular so-called embryoid bodies (EBs).The method according to the invention can therefore be used for the efficient, reliable, sensitive, standardizable, scalable, robust, and rapid qualitative control of pluripotent stem cells and cell products derived therefrom, in order to reduce costs in research and development as well as industrial production and to accelerate technological progress. The method according to the invention has so far been successfully tested on public datasets as well as on a selection of in-house cell preparations.
[0019] In an advantageous embodiment of the invention, the specific property comprises the pluripotent differentiation potential of the stem cell. For qualitative control of this specific property, the control value can be determined, for example, from the sum of several specific methylation levels. In a further advantageous embodiment of the invention, this embodiment provides that the CpG dinucleotide is selected from the group consisting of the CpG dinucleotides cg00661673, cg00933813, and cg21699252. Determining the methylation of one or more of these CpGs advantageously enables a reliable distinction between pluripotent and somatic cells and thus the qualitative control of the pluripotent differentiation potential of a stem cell ("pluripotency score").
[0020] In an advantageous embodiment of the invention, it is further provided that the specific property comprises the germ layer-specific differentiation of the stem cell. For qualitative control of this specific property, the control value can be determined, for example, from the sum of the determined methylation levels minus the corresponding averaged methylation levels of undifferentiated stem cells, whereby the values of the determined methylation levels are taken into account inversely in the case of hypomethylated CpG dinucleotides.
[0021] In a further advantageous embodiment of the invention, this embodiment provides that the CpG dinucleotide for determining the differentiation towards the different germ layers comprises at least one of the following CpG dinucleotides:
[0022] - Endoderm: cg20548013, cg14521421 and cg08913523;
[0023] - Mesoderm: cg14708360, cg08826152 and cg11599718;
[0024] - Ectoderm: cg01907071 , cg18118164 and cg13075942;
[0025] - Endoderm / mesoderm: cg23385847, cg24919344 and cg11147278.
[0026] Determining the methylation of one or more of these CpGs per germ layer advantageously enables reliable validation of the differentiation of a stem cell into each of the three germ layers and thus the qualitative control of the differentiability of stem cells into the three germ layers (endo-, meso-, and ectoderm) already in early phases of differentiation ("differentiation score"). In an advantageous embodiment of the invention, it is also provided that the stem cells are pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), and / or directly reprogrammed cells derived by direct conversion into other cell types.
[0027] The object is further achieved by using at least one nucleic acid molecule comprising at least one of the CpG dinucleotides cg00661673, cg00933813 and cg21699252 to determine the pluripotent differentiation potential of at least one stem cell.
[0028] The object is further achieved by the use of at least one nucleic acid molecule comprising at least one CpG dinucleotide for determining the germ layer-specific differentiation of at least one stem cell, wherein the CpG dinucleotide for determining the differentiation towards one of the different germ layers is selected from one of the following groups:
[0029] - Endoderm: cg20548013, cg14521421 and cg08913523;
[0030] - Mesoderm: cg14708360, cg08826152 and cg11599718;
[0031] - Ectoderm: cg01907071 , cg18118164 and cg13075942;
[0032] - Endoderm / mesoderm: cg23385847, cg24919344 and cg11147278.
[0033] For the purposes of the invention, the identification number “cg...” refers to the position of the respective CpG dinucleotide on the “Illumina HumanMethylation450 BeadChip” or the “Illumina EPIC BeadChip”.
[0034] DNA methylation (DNAm) analysis can be performed cost-effectively and in high-throughput methods for specific regions (e.g., DNA segments) using pyrosequencing or MassArray. Alternatively, more advanced analysis techniques such as sequencing and microarray-based methods are also possible.
[0035] The invention further relates, for example, to a kit comprising a compilation of suitable reference DNAs, primer sets, and optionally instructions and evaluation software. The object is thus also achieved by a kit, in particular a kit for determining the pluripotent differentiation potential of at least one stem cell and / or for determining the germ layer-specific differentiation of at least one stem cell, preferably for carrying out the methods according to the invention, which comprises at least one oligonucleotide primer (preferably an oligonucleotide-primer pair, e.g., a "primer set," see Tables S3 and S4 below) for amplifying and / or sequencing at least one CpG dinucleotide of at least one nucleotide sequence comprising at least one specific region within the meaning of the invention, and at least one reference nucleic acid.The kit according to the invention can, for example, comprise at least one artificial nucleic acid molecule according to the invention and optionally at least one buffer solution and / or at least one reagent for carrying out at least one method selected from the group consisting of DNA amplification, bisulfite treatment of DNA, DNA sequencing, preferably pyrosequencing of DNA, MassArray analysis, deep sequencing of bisulfite-converted DNA, flow cytometry-based bead assays and SNP genotyping.
[0036] The method according to the invention enables the coverage of the following parameters for the quality control of iPSCs:
[0037] 1 ) The validation of the reprogramming of somatic cells into pluripotent stem cells,
[0038] 2) an assessment of the differentiation capacity of stem cells,
[0039] 3) the detection of unwanted differentiated cells while the iPSCs are cultivated under pluripotent culture conditions, and
[0040] 4) the detection of differentiation processes in endoderm, mesoderm and ectoderm.
[0041] The invention is explained in more detail below with reference to the illustrations, figures, tables and examples.
[0042] Short description of the figures Figure 1: Germ layer-specific DNA methylation during 2D iPSC differentiation.
[0043] (A) Multidimensional scaling (MDS) of the top 10,000 most variable CpGs from our own (dataset 1) and public DNAm profiles (dataset 2) (Daily et al., 2017). PSC lines from dataset 2 without corresponding differentiated samples are shown in gray. The names of three PSC outlier samples are shown.
[0044] (B) Scatterplots of mean beta values (DNAm grades) at individual CpG sites for pairwise comparisons. CpGs with a mean difference of > 0.2 in beta values are highlighted and colored if their adjusted p-values are < 0.05.
[0045] (C) A direct comparison of the DNAm profiles of endoderm and mesoderm shows that there are only minor differences between these differentiated cell types in dataset 2.
[0046] (D) Principal component analysis (PCA) of the RNA-seq profiles of samples from our own (dataset 1) and public data (dataset 2) (Daily et al., 2017). The names of three PSC outlier samples are shown.
[0047] (E) Gene expression of the canonical germ layer marker genes (ten for each lineage) in samples from our own (dataset 1) and public datasets (dataset 2). The heatmap shows the z-score of the vst-transformed read counts.
[0048] Figure 2: Derivation of a new pluripotency score based on the DNAm of three CpGs.
[0049] (A) The DNAm profiles of pluripotent stem cells (PSCs) were compared with all other differentiated cell types (endoderm, mesoderm, and ectoderm) to identify three CpG candidates. The difference in mean beta values (DNAm grades) is plotted against the combined variance within the groups. The parabola is part of the selection process (mean parabolic parameter shown as an example).
[0050] (B) DNAm grades of the three candidate CpGs and the pluripotency score of the remaining samples from dataset 2.
[0051] (C) DNAm grades at the three candidate CpGs and the pluripotency score in different iPSC-derived cell types (Dataset 3; Supplementary Table S1 ).
[0052] (D) DNAm grades at the three candidate CpGs and the pluripotency score for a collection of different somatic cell types (Dataset 4; Supplementary Table S1 ) (Schmidt et al., 2020).
[0053] (E) DNAm grades at the three candidate CpGs and the pluripotency score for iPSC samples (GSE59091) (Butcher et al., 2016), which were grouped into high differentiation capacity (HDC) and low differentiation capacity (LDC) toward the endoderm. The primary donor samples (fibroblasts and endothelial progenitors) are shown for comparison. P values were calculated using the Wilcoxon test (** p < 0.01).
[0054] Figure 3: Selection of germ layer-specific CpG sites.
[0055] (A) Selection of candidate CpGs for endoderm (ENDO), mesoderm (MESO), ectoderm (ECTO), and endomesoderm (ENDOMESO) in the selection set. The mean parabolic parameter is shown as an example, and the selected candidate CpGs are indicated.
[0056] (B) The heatmap shows the differentiation scores of the CpG sites for the remaining samples from dataset 2. The scores are the sum of the differences in DNAm levels compared to the reference stem cells (for hypomethylated CpGs, 1 - DNAm was calculated); white indicates no change compared to stem cells, red indicates a change towards specific methylation, and blue vice versa.
[0057] (C) Deconvulation results (either with ENDO and MESO in the upper row or with ENDOMESO in the lower row) based on a non-negative least squares approach.
[0058] (D) Differentiation scores for iPSC-derived cells differentiated into different cell types (Dataset 3; Supplementary Table S1; formatted analogously to (B)).
[0059] (E) Deconvulation results for data set 3 (formatting analogous to (C)).
[0060] Figure 4: Pluripotency and differentiation values in embryoid bodies.
[0061] (A) Pluripotency score of EBs before (day 0), after 4 days, after 7 days, and after 17 days of differentiation.
[0062] (B) Differentiation scores for the same samples show that most, but not all, CpGs exhibit lineage-specific DNAm alterations. The scores are the sum of the differences in DNAm levels compared to the reference stem cells (for hypomethylated CpGs, 1 - DNAm was calculated).
[0063] (C) Results of deconvulation with ENDO and MESO CpGs (in the upper row) or with ENDOMESO CpGs (in the lower row).
[0064] (D) Differentiation and deconvolution results for EBs after 17 days of culture (Daily et al., 2017). Samples are sorted by the proportion of ectoderm in the deconvolution results.
[0065] (E) The heatmap shows the Z-scores of gene expression signatures for endoderm (279 genes), mesoderm (425 genes), and ectoderm (516 genes) in the corresponding EBs. These signatures were derived from a public single-cell RNA sequencing dataset for D8 EBs (Han et al., 2018). Overall, EBs with ectodermal orientation also showed higher expression of ectodermal gene expression in our epigenetic scores.
[0066] Figure 5: Targeted assays of selected CpGs measured by pyrosequencing.
[0067] (A) Pluripotency scores of the samples measured by pyrosequencing. The methylation values of the three CpGs are also shown individually. Here, iPSCs with directed differentiation towards endoderm (ENDO), mesoderm (MESO), and ectoderm (ECTO) as well as EBs before, after 5 days, and after 15 days of spontaneous differentiation in suspension culture (D0, D5, and D15, respectively) were used. In addition, three knockout (KO) iPSC lines were used (2 YAP / _ and PRDM8' / _ ).
[0068] (B) Differentiation scores for these samples, measured by pyrosequencing. The scores are the sum of the differences in DNAm grades compared to the reference stem cells (for hypomethylated CpGs, 1 - DNAm was calculated). The results of deconvolution using ENDO and MESO or the ENDOMESO CpGs are also shown.
[0069] (C) RT-qPCR results of germ layer-specific genes. The heatmap shows the ddCT values compared to the stem cells. (D) Scorecard results. The combined gene expression scores for each germ layer are shown compared to the reference standard for selected iPSC lines.
[0070] Figure S1 : Three-stage differentiation of pluripotent stem cells (in conjunction with Figure 1)
[0071] (A) Trilineage differentiation protocols used for in-house iPSCs (Dataset 1; STEMdiff Trilineage Differentiation Kit; Stemcell Technologies) and in the public dataset (Dataset 2; GSE85828) (Daily et al., 2017).
[0072] (B) Immunofluorescence staining of exemplary differentiated cells (Protocol Dataset 1) stained with antibodies against OCT4 (stem cells), GATA6 (endoderm), Brachyury (mesoderm), and PAX6 (ectoderm). Nuclear staining with DAPI.
[0073] Figure S2: Heatmap of the most differentially methylated CpGs (relative to Figure 1)
[0074] The 50 most significant CpGs (sorted by mean beta value difference) from the comparisons of germ layers and pluripotent stem cells are shown. The heatmap contains overlapping CpGs, particularly for ENDO and MESO in the public data (GSE85828).
[0075] Figure S3: Overlap of DNA methylation changes in different datasets (in conjunction with Figure 1)
[0076] (A) Venn diagrams show the number of significantly hypo- and hypermethylated CpGs that overlap during differentiation toward endoderm (ENDO), mesoderm (MESO), and ectoderm (ECTO). This analysis was performed in parallel for data sets 1 and 2. The overlap between the data sets is indicated in parentheses.
[0077] (B) To estimate the relationship between the DNAm profiles of the differentiated samples, a pairwise comparison of the differentially methylated probes in datasets 1 and 2 was performed (for hypo- and hypermethylated sites separately). The odds ratio of the Fisher exact test indicates the probability of obtaining the common differentially methylated CpGs, considering the total sample size (all CpGs). The high odds ratio between ENDO and MESO from dataset 2 suggests that the DNA methylation changes in these samples strongly overlap.
[0078] Figure S4: Differentially expressed genes between the germ layers (referring to Figure 1)
[0079] (A) Venn diagrams show the number of significant changes in gene expression during differentiation into endoderm, mesoderm, and ectoderm. This analysis was performed separately for data sets 1 and 2. The overlap between the data sets is indicated in parentheses.
[0080] (B) Integrative analysis of changes in DNA methylation and gene expression. Only CpGs in promoter regions (TSS1500, TSS200) are considered. Each point represents a gene-CpG pair (both genes and CpGs can be duplicated). Colored dots indicate pairs with a significant difference in DNA methylation and changes in gene expression during differentiation.
[0081] C) Heatmap of the pairwise odds ratio between genes with differential expression in the different differentiation modalities (Fisher's exact test). In dataset 2, the changes in gene expression during endodermal and mesodermal differentiation overlap considerably.
[0082] Figure S5: Comparison of different signatures for pluripotency (in conjunction with Figure 2)
[0083] (A) The PluriTest analysis was performed using the online tool PluriTest (https: / / www.pluritest.org / ). RNA-seq FASTAQ files were uploaded to the website for preprocessing, alignment, and automated analysis using the proprietary algorithm. The results showed that most stem cell, mesoderm, and endoderm samples had a similar pluripotency score. PluriTest was unable to distinguish between them, and the predictions did not agree with the pluripotent cloud of the empirical density map. Furthermore, two of three iPSC lines from Dataset 1 and the outlier cell line SC12-040 had scores that were displayed as failing.
[0084] (B) The Epi-Pluri-Score analysis is based on DNAm at three specific CpGs. One of these CpGs was located within the pluripotency-associated gene POU5F1 (also known as OCT4). Furthermore, the difference in DNAm levels of the CpGs in ANKRD46 and C14orf115 was determined and summarized as the Epi-Pluri-Score (Lenz et al., 2015). The dots in the background refer to DNAm profiles (all Illumina HumanMethylation27 BeadChip platform) of 264 pluripotent and 1,951 non-pluripotent cell preparations, respectively (Lenz et al., 2015). In particular, the Epi-Pluri-Score classified all cell preparations as pluripotent, while early differentiation events can be tracked by an increase in DNAm in POU5F1. For the three iPSC samples previously identified as outliers, the sample IDs are highlighted again (GSM2285159, Dataset 2).In particular, sample SC12-040 was clearly classified as non-pluripotent, and this sample also appeared to be out of character in the MDS and PCA plots (Figure 1A, C) and also appeared to have an aberrant karyotype (Salomonis et al., 2016).
[0085] (C) DNA methylation levels are shown for the undifferentiated and differentiated cells of the selection set for the three CpGs selected for the pluripotency score. Each of the CpGs was able to distinguish pluripotent from non-pluripotent cells. Integrating the three values into the pluripotency score further clarified the difference between PSCs and differentiated cells.
[0086] Figure S6: Identification of gene signatures for germ layers in EBs (in conjunction with Figure 4)
[0087] (A) To identify marker genes for endodermal, mesodermal, and ectodermal differentiation during spontaneous differentiation, single-cell RNA sequencing data from EBs on day 8 of spontaneous differentiation were used (Han et al., 2018). Uniform manifold approximation and projection (UMAP) representation of the data showed that the cells could be divided into three distinct clusters.
[0088] (B) The UMAP representation of the normalized expression levels for endoderm markers (GATA6, AFP), mesoderm markers (HAND1, SNAI1), and ectoderm markers (PAX6, OTX2) shows that these clusters were indeed associated with the respective germ layers. The same results were also observed in the Gene Ontology analysis (not shown). For each of these clusters, genes were subsequently selected that are significantly more highly expressed than in the other clusters: 279 genes for the endoderm, 425 genes for the mesoderm, and 516 genes for the ectoderm (Supplementary Table S2).
[0089] Figure S7: Pyrosequencing assays for CpGs of the invention (referring to Figure 5)
[0090] (A) Comparison of DNAm levels measured by pyrosequencing and Illumina EPIC BeadChip technology.
[0091] (B) Reference values based on pyrosequencing for germ layer deconvolution. Shown are the mean values of the three cell lines from directed 2D differentiation.
[0092] Description of exemplary and advantageous embodiments of the invention
[0093] The invention relates, among other things, to the quality control of induced pluripotent stem cells. For the validation of the pluripotent state, it is crucial to determine the potential for tripartite differentiation into endoderm, mesoderm, and ectoderm. For this purpose, the invention uses a combination of site-specific DNA methylation (DNAm) assays, which serve as biomarkers for early germ layer specification. CG dinucleotides (CpGs) were identified with characteristic DNAm in the pluripotent state and after differentiation into endoderm, mesoderm, and ectoderm. On this basis, a "pluripotency score" was derived, which indicates the differentiation capacity, as well as lineage-specific "differentiation scores" to monitor, for example, either directed differentiation or self-organized multilineage differentiation in embryoid bodies.Furthermore, pyrosequencing assays have been developed for rapid and cost-effective analysis. The method according to the invention can thus be advantageously used for quality control of pluripotent cells and for estimating lineage-specific commitment during the initial differentiation events.
[0094] Therefore, characteristic DNAm signatures were identified for each of the three germ layers, i.e., three CpGs with characteristic DNAm were selected for undifferentiated pluripotent cells: endoderm, mesoderm, ectoderm, and endomesoderm. On this basis, the method of the invention was developed: an instrument consisting of a "pluripotency score," which can indicate differentiation potential, and lineage-specific signatures to estimate the proportion of early cell fate decisions in differentiation experiments.
[0095] Changes in DNA methylation during directed germ layer specification
[0096] Three lines of induced pluripotent stem cells (iPSCs) were differentiated toward endoderm, mesoderm, and ectoderm to analyze their DNAm profiles using the Infinium EPIC BeadChips (Supplementary Fig. S1; Dataset 1). In addition, 114 DNAm profiles of iPSCs and embryonic stem cells (ESCs) differentiated using different protocols were used (Dataset 2; 450K BeadChip platform, Supplementary Table S1) (Daily et al., 2017). Multidimensional scaling (MDS) showed that iPSCs that had differentiated toward the ectoderm segregated in clusters, whereas cells that had differentiated toward the endoderm and mesoderm appeared to be more closely associated (Fig. 1A). The lineage-specific DNAm changes were initially analyzed separately for both datasets (for dataset 2 only PSCs with corresponding data for germ layer differentiation) (Daily et al., 2017).Many CpGs showed significant hyper- or hypomethylation during differentiation toward endoderm, mesoderm, or ectoderm (Fig. 1 B, DNAm difference > 20%, adjusted p-values < 0.05; Supplementary Fig. S2). Notably, Dataset 2 showed a very high overlap of DNAm changes toward mesoderm and endoderm (Supplementary Fig. S3). A direct comparison of the DNAm profiles of endoderm and mesoderm confirmed that their epigenetic changes were very similar in Dataset 2 (Fig. 1 C). Corresponding RNA sequencing data revealed overall consistent changes in gene expression during differentiation of the three developmental stages (Fig. 1 D). Many genes are significantly up- or downregulated during differentiation into endoderm, mesoderm, and ectoderm (> 2-fold; adjusted p-value < 0.05; Supplementary Fig. S4A).Genes with hypomethylation in promoter regions tended to show upregulated gene expression and vice versa (Supplementary Fig. S4B). Analogous to the DNAm data, there was a strong overlap of differential gene expression during differentiation into endoderm and mesoderm in Dataset 2 (Supplementary Fig. S4C). Canonical markers for mesodermal differentiation were particularly upregulated in Dataset 1 (Fig. 1E). These results demonstrate that, depending on the differentiation scheme, the differences between endoderm and mesoderm are only marginal, which must be considered when identifying germ layer-specific signatures.
[0097] Development of an epigenetic signature for the pluripotent state
[0098] Established quality control measures for pluripotent cells should be able to detect early differentiation events. However, the previously described methods PluriTest (Muller et al., 2011) and Epi-Pluri-Score (Lenz et al., 2015) were specifically developed to distinguish pluripotent from somatic cell types, while it remained unclear whether these tests would also reliably capture transcriptomic / epigenetic changes during early differentiation into the three germ layers. Therefore, PluriTest analysis was applied to the RNA-seq profiles of datasets 1 and 2 (Supplementary Fig. S5A). Notably, the PluriTest results of all samples—even the pluripotent iPSCs and ESCs—did not agree with the pluripotent samples of the reference cohort, which might be due to the fact that the test was originally developed for a microarray platform that is now no longer used.Furthermore, the differentiated endoderm and mesoderm cells exhibited similar PluriTest results to the undifferentiated pluripotent cells. Similarly, the Epi-Pluri-Score classified the DNAm profiles of all samples as pluripotent, even those that had differentiated toward endoderm, mesoderm, and ectoderm for a few days (Supplementary Fig. S5B). Taken together, PluriTest and Epi-Pluri-Score could not reliably capture early differentiation events.
[0099] To develop the method of the invention, a new pluripotency score was created based on early DNAm changes during differentiation into endoderm, mesoderm, and ectoderm. Relevant CpGs were selected using the R package CimpleG (manuscript in preparation) based on high differences in mean methylation and low variance within groups (Schmidt et al., 2020). The undifferentiated and differentiated samples of the three iPSC lines from our dataset 1 and three randomly selected PSC lines from dataset 2 were used as a selection set to achieve balance between studies (Fig. 2A). The three most important candidate CpGs were: cg00661673, associated with the gene palladin (PALLD), cg00933813, not associated with a specific gene, and cg21699252, associated with MYCN Opposite Strand (MYCNOS).The DNAm grades at these sites were combined into a pluripotency score (sum of DNAm grades and 1 - DNAm grade for the hypomethylated sites), which clearly distinguished PSCs and differentiated cells in the selection set (Supplementary Fig. S5C). Similar results were observed when the remaining samples of Dataset 2 were used for initial validation. Notably, the pluripotency score could also distinguish three samples that showed aberrations when analyzing gene expression and DNAm profiles (Fig. 2B). Furthermore, the pluripotency score could correctly distinguish PSCs and early differentiated cells in a completely independent collection of pluripotent and iPSC-derived cell types (Dataset 3; Supplementary Table S1; Fig. 2C).Next, somatic cells were examined, and it was found that the pluripotency score was consistently very low for primary cell types (549 DNAm profiles compiled from 21 studies (Schmidt et al., 2020); Dataset 4; Fig. 2D). Finally, the inventive pluripotency score was compared with DNAm profiles of PSCs that met the criteria for pluripotency but exhibited either a higher differentiation capacity (HDC) or a lower differentiation capacity toward endoderm (LDC; GSE59091, Dataset 5) (Butcher et al., 2016). Notably, the pluripotency score was significantly higher in HDC than in LDC pluripotent cells (p-value = 0.009; Fig. 2E), suggesting that the signature not only detects early differentiation steps but might also represent a quality measure of pluripotent differentiation potential.
[0100] Selection of germ layer-specific CpG sites
[0101] Since the biomarker of the invention should also reflect specific differentiation toward endoderm, mesoderm, or ectoderm, candidate CpGs were also selected for each germ layer. For this purpose, the same selection set as for the pluripotency score was used, and the same selection method was applied for each differentiated cell type (Fig. 3A). Based on this, the three most important CpGs for the endoderm (ENDO) were selected: cg20548013, associated with phosphatase and actin regulator
[0102] 1 (PHACTR1)', cg14521421 , associated with DENN domain containing 2B (DENND2B); and cg08913523 (no gene); for mesoderm (MESO) the CpGs cg14708360 (no gene); cg08826152, associated with adenosine receptor A2B (ADORA2B); and cg11599718, associated with vacuolar protein sorting-associated protein 37B (VPS37B): for ectoderm (ECTO), the CpGs cg01907071, associated with the gene thrombospondin type 1 domain containing 4 (THSD4), cg18118164, associated with ephrin A5 (EFNA5), and cg13075942, associated with RAD51 Paralog B (RAD51B). Since endoderm and mesoderm are particularly well-connected in the data set
[0103] 2 were closely related, candidate CpGs for a combination of endoderm and mesoderm (ENDOMESO) were also selected: cg23385847, associated with the gene calcium / calmodulin-dependent protein kinase IV (CAMK4)', cg24919344 (no gene); and cg11147278 (no gene).
[0104] These CpG candidates were subsequently validated in the remaining samples of Dataset 2. Since the CpGs exhibit cell-type-specific hypo- or hypermethylation, the complementary DNAm levels (1 - DNAm) for hypomethylated sites were used to determine differentiation values that increase with differentiation. These values were calculated as the difference from the mean DNAm level of the undifferentiated samples (Fig. 3B). Alternatively, the proportion of lineage-specific differentiation in the cell population was estimated by deconvolution using a non-negative least squares (NNLS) approach—which, however, is complicated by the fact that early germ layer specification rather than a defined endpoint of differentiation is sought, as well as by the discrepancy in results between different germ layer differentiation protocols.However, the deconvulation approach correctly classified most samples into the categories PSC, ENDO, MESO, ECTO, and ENDOMESO (Fig. 3C). The three outlier PSC samples could again be distinguished by higher differentiation values. Furthermore, the individual DNAm grades as well as the deconvulation approach correctly classified most iPSC-derived cells that differentiated into different cell types (Dataset 3; Fig. 3D, E).
[0105] DNA methylation changes in embryoid bodies
[0106] To determine whether the method of the invention would also capture germ layer-specific epigenetic changes during spontaneous differentiation, EBs were generated and DNAm profiles analyzed before (day 0), on day 4, and on day 7 after aggregation (EB dataset 1; Supplementary Table S1). As expected, the three CpGs specific for the undifferentiated state changed already within 4 days of undirected EB differentiation, reflected in a rapid decline in the pluripotency score (Fig. 4A), again indicating that most cells had left the pluripotent state. Furthermore, the differentiation scores (Fig. 4B) indicated differentiation in the three germ layers. However, the ENDOMESO-associated CpG site cg2338547 did not show the expected hypermethylation in this dataset, leading to a discrepancy in the deconvolution predictions (Fig. 4C).
[0107] In addition, public DNAm profiles of EBs on day 17 were used (EB Dataset 2; Supplementary Table S1) (Daily et al., 2017). The differentiation scores and deconvolution results again showed an amplification of lineage-specific epigenetic patterns. The strong changes in the MESO CpGs dominated the deconvolution results. In particular, the results showed that some of the EBs differentiated more towards ectodermal or endodermal lineage (Fig. 4D). This finding may reflect the different tendency of individual iPSC lines to preferentially differentiate into one or the other cell lineage. The available gene expression data of the EBs from day 17 were then used (Daily et al., 2017) to determine whether the lineage-specific tendency was also reflected in the transcriptome.For this purpose, we first identified gene signatures characteristic of the different germ layers during spontaneous differentiation. Public single-cell RNA sequencing data obtained from day 8 EBs were clustered according to germ layers (Supplementary Fig. S6) (Han et al., 2018). Based on this, gene lists most clearly associated with the endoderm, mesoderm, and ectodermal clusters were selected (Supplementary Table S2). Indeed, the ectodermal signatures were overall more highly expressed in EBs for which the inventive method also predicted an ectodermal orientation (Fig. 4E).
[0108] Targeted assays with pyrosequencing
[0109] Pyrosequencing assays were then developed for the targeted analysis of the relevant CpGs in order to apply the method of the invention without Illumina BeadChip analysis. When the samples from the directed differentiation were reanalyzed, the DNAm levels showed only minor deviations between the pyrosequencing and EPIC BeadChip measurements (Supplementary Fig. S7A). In each case, the pyrosequencing results were used to adjust the reference matrix for deconvulation (Supplementary Fig. S7B). To further verify this assay, EBs were again generated and cultured for 5 or 15 days. Own iPSC lines with PRDM8 knockout (PRDM8' / _ ), which have been shown to exhibit lower neuronal differentiation (Cypris et al., 2020). In addition, in-house iPSC lines with YAP1 knockout (YAP / _) that barely differentiated towards ectoderm (Zeevaert et al., manuscript in preparation), a phenotype that has recently been described by others (Stronati et al., 2022). The pyrosequencing measurements for the inventive method could clearly distinguish undifferentiated pluripotent cells from either directed differentiation or EBs (Fig. 5A). Furthermore, the differentiation results clearly showed that the EBs of PRDM8 / _ and YAP / _do not exhibit the typical ectoderm-associated DNAm. The deconvolution results for these knockout lines accordingly showed lower proportions of ectoderm (Fig. 5B). To further verify these results, the gene expression of germ layer-associated genes in these samples was analyzed using RT-qPCR: OCT4 for pluripotent cells, GATA6 for endoderm, Brachyury for mesoderm, and PAX6 for ectoderm (Fig. 5C). In addition, ScoreCard tests were performed for selected samples (Fig. 5D). Overall, the predictions using the method of the invention were consistent with the RT-qPCR and ScoreCard results for the knockout cell lines.
[0110] Possible further embodiments of the invention
[0111] Quality measurements of iPSC lines can be used for several purposes: 1) to monitor the initial reprogramming of somatic cells, 2) to determine the differentiation capacity of non-differentiated cells, and 3) to track differentiation to ultimately validate pluripotent differentiation potential (Steeg et al., 2021).
[0112] Initial monitoring of reprogramming often relies on microscopic assessment of colony morphology or upregulation of individual markers by immunofluorescence or RT-qPCR, but these approaches are difficult to quantify and lack standardized thresholds. A more comprehensive gene expression signature, such as PluriTest (Muller et al., 2011), can provide a more robust measure of successful reprogramming. However, when the online tool PluriTest was applied using its proprietary algorithm for preprocessing RNA-seq results, the undifferentiated iPSCs were not clearly associated with the highlighted area for pluripotency in the empirical density map, and early differentiation events were not reliably detected. Our previously described Epi-Pluri score may be a good alternative for validating reprogramming to the pluripotent state (Lenz et al., 2015).Indeed, it was able to clearly identify SC12-040, which was thought to have a problematic karyotype and clearly did not resemble a normal pluripotent cell line. However, until now, there was no epigenetic biomarker capable of detecting early germ layer-specific cell fate decisions. The present invention describes a method that—in contrast to the approaches mentioned above—was specifically developed for the detection of early differentiation events. Although the signature was not developed using somatic cells, it was able to reliably distinguish between somatic and pluripotent cells. Notably, the pluripotency score was overall higher in iPSCs with high differentiation capacity than in cells with low differentiation capacity toward the endoderm (Butcher et al.)., 2016), suggesting that the method of the invention can also be used to estimate the differentiation capacity of undifferentiated iPSCs. Thus, the method of the invention could be an indicator of the differentiation potential of iPSCs already under pluripotent culture conditions. In the future, it will be important to further demonstrate that these signatures reliably capture aspects of differentiation potential and to better define threshold values.
[0113] To date, validating the potential for differentiation into three lineages requires upstream differentiation with directed or spontaneous differentiation for subsequent analysis. The teratoma assay is a method for testing pluripotency in which PSCs are transplanted into an immunodeficient mouse, where they spontaneously form germ cell tumors with immunophenotypic features of all germ layers (International Stern Cell, 2018). This assay raises concerns about animal welfare; analysis takes several months and is costly. Furthermore, teratoma formation is highly variable and difficult to quantify (Dolgin, 2010; Muller et al., 2010; Tsankov et al., 2015). The ScoreCard assay is based on a directed or spontaneous differentiation scheme and uses a relatively large set of reference genes. By analogy, the inventive method could track early lineage decisions during directed differentiation.Furthermore, it could be used to estimate the cellular composition in EBs. The predicted ectodermal fractions correlated with gene expression profiles and deconvolution results. Furthermore, iPSC lines with impaired ectodermal differentiation, such as PRDM8, could be identified. / _ and YAP / _, can be identified. DNA samples are easier to handle and ship than RNA samples. The method of the invention is based on only 12 CpGs (15 CpGs for ENDOMESO). Such small signatures represent a compromise, as they can be more susceptible to individual outliers than signatures integrating hundreds of CpGs. On the other hand, such targeted assays can be measured cost-effectively and robustly, independent of specific microarray platforms or bioinformatics tools. This is important if such assays are to be used for the clinical validation of therapeutic cellular products, which may even require approval as in vitro diagnostics (Wagner, 2022).
[0114] The invention presented several challenges:
[0115] 1 ) The number of available data sets was limited;
[0116] 2) It was unexpected that the directed differentiation scheme with different protocols resulted in very different DNAm and gene expression profiles—it was even difficult to reliably distinguish endoderm and mesoderm in dataset 2. In the future, additional datasets with alternative differentiation schemes should be created to better identify and validate specific DNAm changes for endoderm and mesoderm.
[0117] 3) DNAm changes during directed differentiation with differentiation media do not necessarily reflect spontaneous differentiation in EBs. Cell sorting would be beneficial to further adapt the signatures for spontaneous differentiation; and
[0118] 4) For validating the deconvolution approach, there is no dataset with quantitative data for lineage assignment in EBs. Specific DNAm patterns have already been successfully used to deconvolve cell populations, e.g., for the composition of leukocyte subsets (Frobel et al., 2018; Houseman et al., 2012; Sontag et al., 2022) or even complex tissues (Moss et al., 2018; Schmidt et al., 2020) – but all of these applications were applied to fully differentiated cells. In contrast, the differentiation process of iPSCs resembles a continuum without a fixed endpoint once early germ layer differentiation is complete. The deconvolution results of the inventive method therefore cannot reflect the absolute composition of the different cell types, but rather provide a surrogate marker to estimate early cell fate decisions.
[0119] Overall, the invention provides further insights into epigenetic changes in early cell fate decisions. Candidate CpGs for the assessment of PSCs in the pluripotent state and for detecting early cell fate decisions toward endoderm, mesoderm, and ectoderm have been identified. The method according to the invention offers several advantages compared to conventional methods for quality control of iPSCs. Such an analysis can also be used to optimize culture conditions to obtain a larger proportion of cells in the pluripotent state or to better control differentiation into specific germ layers.
[0120] Experimental procedures
[0121] Cell culture and targeted differentiation
[0122] Four human iPSC lines were generated from bone marrow-derived mesenchymal stromal cells (iPSC 102, iPSC 104, iPSC 106) (Goetzke et al., 2018) or dermal fibroblasts (TF11-C2.3) (Willmann et al., 2013) by reprogramming with episomal plasmids. All samples were collected after informed consent and according to the guidelines approved by the Ethics Committee for the Use of Human Subjects at the University of Aachen (approval number: EK128 / 09). The iPSC lines were cultured with vitronectin (0.5 pg / cm 2 ) coated tissue culture plastic in StemMACS iPS-Brew XF (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Directed differentiation toward endodermal, mesodermal, and ectodermal lineages was induced using the STEMdiff Trilineage Differentiation Kit (Stemcell Technologies, Vancouver, Canada; Supplementary Fig. S1A).
[0123] Formation of embryoid bodies
[0124] Self-detaching iPSCs were generated as previously described (Elsafi Mabrouk et al., 2022). Briefly, vitronectin was printed using a microcontact technique (diameter 600 pm), and iPSCs grew and self-organized on these substrates. After approximately 6 days, when more than 50% of the colonies detached, the floating aggregates were harvested and considered day 0 for further differentiation steps. Alternatively, spin-EBs were generated as previously described (Ng et al., 2005). Non-targeted multilineage differentiation of EBs was performed in ultralow attachment plates (Coming, NY, USA) with differentiation induction medium (EB medium) containing knockout DMEM / F12, 20% knockout serum replacement, 2 mM GlutaMAX supplement, 0.1 mM non-essential amino acids, and 0.1 mM b-mercaptoethanol (all from Gibco, Carlsbad, USA). For long-term culture of EBs over 15 days, EBs were cultured after day 7.On the following day, the cells were transferred from the ultra-low-attachment plates to plates coated with 0.1% gelatin. The medium was changed every other day.
[0125] Immunostaining
[0126] Cells were fixed with 4% paraformaldehyde for 20 minutes, then treated with PBS containing 1% bovine serum albumin and 0.1% Triton X-100 (Bio-Rad, Munich, Germany) for 30 minutes. Then, they were incubated overnight at 4°C with primary antibodies against OCT4 (clone C-10; Santa Cruz, Dallas, Texas, USA), GATA6 (clone D61 E4; Cell Signaling, Danvers, USA), Brachyury (R&D Systems, Minneapolis, USA), and PAX6 (clone AD2.35; Santa Cruz, Dallas, USA). Secondary antibodies were stained at room temperature for 1 hour with donkey anti-goat (Alexa Fluor 488), goat anti-rabbit (Alexa Fluor 594), and goat anti-mouse (Alexa Fluor 594); all from Invitrogen (Waltham, USA). The samples were counterstained with DAPI (10 ng / mL) for 15 minutes and imaged with a Zeiss Axioplan 2 fluorescence microscope.
[0127] Creation of DNA methylation profiles
[0128] Genomic DNA was isolated using the NucleoSpin Tissue Kit (Macherey-Nagel, Düren, Germany) and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fischer Scientific, Waltham, USA). 1.2 pg of DNA was bisulfited and analyzed using Illumina EPIC BeadChip microarrays at Life & Brain (Bonn, Germany; Dataset 1). Additionally, 114 DNA methylation profiles of iPSC and iPSC-derived cells (PSC, ENDO, MESO, ECTO, and EB) generated on Illumina HumanMethylation450 BeadChips from the Progenitor Cell Biology Consortium (PCBC) of the National Heart, Lung, and Blood Institute (Dataset 2; Supplementary Table S1) (Daily et al., 2017) from the Gene Expression Omnibus (https: / / www.ncbi.nlm.nih.gov / geo; GSE85828) were used. For comparison, DNAm profiles of iPSC-derived cells differentiated into different cell types (Dataset 3; Supplementary Table S1) were used.For somatic cells, a selection of DNAm profiles compiled for previous work by the inventors in many studies was used (Dataset 4; Supplementary Table S1) (Schmidt et al., 2020). In addition, DNAm profiles from iPSCs with high differentiation capacity (HDC) or low differentiation capacity toward endoderm (LDC; GSE59091; Dataset 5; for replicate samples, the mean values across all corresponding replicates were always used) were used (Butcher et al., 2016).
[0129] The IDAT files of the Illumina BeadChips were loaded and preprocessed using minfi (Aryee et al., 2014) in R (4.1.3). Low-quality samples were removed (threshold: sum of the medians of the methylated and unmethylated channels < 20), and the remaining samples were normalized using ssNoob (Triche et al., 2013). For samples for which IDAT files were not available, pre-existing beta values were used or the beta values were generated from the signal intensities. CpG sites on XY chromosomes, non-CG probes, and SNP-associated CpGs were not considered for further analysis. Furthermore, only CpGs represented on the 450K and EPIC BeadChip platforms were considered. The R package limma (3.48.0) was used to calculate Benjamini-Hochberg adjusted p-values and MDS plots. Relevant DNAm changes were defined as at least a 20% difference in mean beta values and an adjusted p-value < 0.05.Fisher's exact test was performed using the R package GeneOverlap. The R packages ggplot2, ggrepel, ggbeeswarm, reshape2, ggExtra, ggsignif, cowplot, gprofiler2, ComplexHeatmap, and VennDiagram were used for graphical representation.
[0130] Selection of epigenetic biomarkers
[0131] The selection of marker candidate CpGs is based on a previous work by
[0132] Inventor (Schmidt et al., 2020) and is now available as the R package CimpleG (https: / / github.com / CostaLab / CimpleG). CpG sites with large differences in mean beta values and low variances within groups were selected (method: "CimpleG_parab"). The pluripotency score is based on the sum of the DNAm at the three pluripotency-associated CpGs cg00661673, cg00933813, and cg21699252. Since all of these CpGs have lower DNAm in pluripotent cells, the complementary percentages were calculated for more intuitive application:
[0133] Pluripotency score = (1 - DNAmcg00661673) + (1 - DNAmcg00933813) + (1 - DNAmcg21699252)
[0134] The deconvolution approach is based on non-negative matrix factorization, as described in a previous work by the inventors (Frobel et al., 2018; Schmidt et al., 2020). Either the mean DNAm grades from the selection set or the pyrosequencing data were used as the reference matrix.
[0135] Transcriptomic analysis
[0136] RNA sequencing was performed by Life & Brain (Bonn, Germany) using a NovaSeq 6000 sequencer (100 bp / read). FASTA files were verified with FastQC, and adapter sequences were trimmed with Trimmomatic. Read alignment was performed with STAR (hg38 genome build). Alternatively, count matrices were downloaded from the Progenitor Cell Biology Consortium (PCBC) web portal (https: / / www.synapse.org / #ISynapse:syn2822494). Data were normalized using the variance-stabilizing transformation (VST) from the DESeq2 package in R (Love et al., 2014). Differential gene expression analysis was performed with the same package using a Wald test (Benjamini-Hochberg adjusted P value < 0.05, absolute fold change > 2).To correlate DNAm and gene expression data, Illumina BeadChip annotation was used and the data were merged by alignment with RefSeq transcripts, considering only CpGs in promoter regions (TSS1500 and TSS200).
[0137] To identify gene sets characteristic of the germ layers, a previously published single-cell RNA-seq dataset of human embryoid bodies was used (Han et al., 2018). All runs for day 8 EBs were pooled, and counts were normalized. The Seurat package (v4) was used for quality control and to filter out cells with abnormal feature counts (Hao et al., 2021). Cells were clustered using the nearest neighbor algorithm, and representative markers of each cluster were identified using MAST (Finak et al., 2015). Genes with an adjusted p-value < 0.05 and a fold change > 1.5 were considered germ layer markers (Supplementary Table S2). The identity of each cluster was annotated using gprofiler2 using GO terms associated with marker genes (Kolberg et al., 2020).
[0138] The PluriTest assay was performed using the online tool PluriTest (https: / / www.pluritest.org / ). RNA-seq FASTAQ files were uploaded to the website, where they were automatically preprocessed, aligned, and analyzed using a proprietary algorithm. The resulting pluripotency score and novelty score were recorded accordingly.
[0139] Pyrosequencing
[0140] Genomic DNA (500 ng) was bisulfite-treated overnight with the EZ DNA Methylation Kit (Zymo) and eluted in 20 pL of elution buffer. Primers (Metabion) were designed using PyroMark Assay Design 2.0 software (Qiagen; Supplementary Table S3). Target sequences were amplified using the PyroMark PCR Kit (Qiagen) with 2.5 mM Mg 2+ and a primer concentration of 0.3 pM. Pyrosequencing was performed using a Q96 ID pyrosequencer (Qiagen).
[0141] Semi-quantitative reverse transcriptase PCR
[0142] Total RNA was isolated using the NucleoSpin RNA Plus Kit (Macherey-Nagel, Düren, Germany), quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, USA), and converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, USA). Semiquantitative RT-PCR (qPCR) was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems, Waltham, USA) and gene-specific primers in a StepOnePlus instrument (Applied Biosystems, Waltham, USA). Primers for OCT4, GATA6, Brachyury, PAX6, and the housekeeping gene GAPDH are listed in Supplementary Table S4. Scorecard analysis was performed using the TaqMan hPSC ScoreCard 96-well Kit (Thermo Fischer Scientific) according to the manufacturer's instructions.
[0143] statistics
[0144] All statistical analyses were performed in R. For the analysis of differential gene expression (DEseq2, Wald test) and methylation (Limma, moderated t-test), p-values were adjusted using the Benjamini-Hochberg method. All adjusted p-values less than 0.05 were considered significant. To compare the pluripotency scores of LDC and HDC iPSCs, a Wilcoxon test was performed using the R package ggsignif.
[0145] Availability of data and codes
[0146] The generated RNA-seq and methylation data are available in the Gene Expression Omnibus (https: / / www.ncbi.nlm.nih.gov / geo / ).
[0147] Table S1 : “BeadChip” data sets (see appendix)
[0148] Table S2: Gene lists for each cotyledon (see appendix)
[0149] Table S3: Pyrosequencing primers _
[0150] NAME _ DNA-SEQUENZ _ cgSCl For GGTTGGAGTGTATTGGTGTAA cgSCl Rev Biotin- AATCCCAACCTTTAT AC AT ATT AATTCTT cgSCl Seq GTTGAGATTATAGGTGTGA cgSC2 For AGGTTGGTTATGAATTTTTGGTTTTAAGTA cgSC2 Rev Biotin- ATACCCTACCTTCCTTTCATTTATATTC cgSC2 Seq TTGGGATTATAGGTGTG cgSC3 For GATGTTGAGGGTTAGGGGGTAATT cgSC3 Rev Biotin- CCTAAAACTCTAAAAATCTTTCTCCCTAAA cgSC3 Seq TGAAGGTTTTTTTAGTTTTGA cgEl For GAATAGTATATGGTTGGTTGGGAAAGT cgEl Rev Biotin- CCAAAAAAAAAAAATACCTTTACTATCACT cgEl Seq AGGAGTTATTTTATTATATTGGAG cgE2 For GGGATGTTGTGGATGGTAAAA cgE2 Rev Biotin- ACTCCCACATCTAAACACCTAA cgE2 Seq AGGGGTGTGGGAAGT cgE3 For GGGAGAGGGATTTATTATTAGGT cgE3 Rev Biotin- ACCCCCTCCTTCAACTATAAT cgE3 Seq GGTTTGAGAAAGAAGTTAG cgMl For AGGGTAAGGTTGTTTTGTTTAGTTTAT cgMl Rev Biotin- TCATACCTTTAAAACCCACAACTAAAAT cgMl Seq ATTAGGGTTTTGGTTTTATT cgM2 For TGAGTTTGGTTAGTTTAGTTATAGGT cgM2 Rev Biotin- CATCCCTAAAACAAACAAAAAACAATT cgM2 Seq ATTTGTTGTTGAGGTTTTTAATA cgM3 For ATGGTTTGGTATAGAAAGTTTATGG cgM3 Rev Biotin- ATACTTTCATCTCTTCTAATACCTTTAAC cgM3 SeqGTTTTGTGGGTGGGG cgEMl For GAATAAGATATGGTTTTTGGATTTGAGTA cgEMl Rev Biotin- AAATTTTCCTCTCCTACATCTCTCA cgEMl Seq GTGTTATAAGGTTTTGTTAGTT cgEM2 For Biotin- AGTTTTTTGATTATAAAAGGTATAGAGTGT cgEM2 Rev ACTCAAAAAAATCACCATAAATCACTATC cgEM2 Seq ACAACTAAACTTCTTTATCATATAT cgEM3_C For TGTTAGTAAATGGGGAAGATATAAAAGTT cgEM3_C
[0151] Biotin- AATTCCTACCCAACTCAAACTCATCTA Rev cgEM3_C Seq GAGTTGATTTTGAAAGGT cgECl For GGGGTTTTGAAAGTAAATGTGT cgECl Rev Biotin- TTCCAACTCACTAAAAAACACTTC cgECl Seq AGTAAATGTGTTGAAAGTT cgEC2 For AGTGGGAGTAAATGAGTTTAGT cgEC2 Rev Biotin- CAATTTCAAAATCTCCATCTCAAAATATCA cgEC2 Seq TTTTAGGGTAAGAAAATATAGATAG cgEC3 For GGGAGATTTTAGTTTTTTTTGTAGGG cgEC3 Rev Biotin- CCCAATATTATAATTCTTAACACCTCTCAT cgEC3 Seq AGTTTTTTTTGTAGGGATTTT
[0152] Tabelle S4: RT-qPCR - Primer
[0153] NAME DNA-SEQUENZ
[0154] OCT4 For GGGGGTTCTATTTGGGAAGGTA
[0155] OCT4 Rev ACCCACTTCTGCAGCAAGGG
[0156] GATA6 For CTCAGTTCCTACGCTTCGCAT
[0157] GATA6 Rev GTCGAGGTCAGTGAACAGCA
[0158] Brachyury For CAGTGGCAGTCTCAGGTTAAGAAGGA
[0159] Brachyury Rev CGCTACTGCAGGTGTGAGCAA
[0160] PAX6 For TCGAAGGGCCAAATGGAGAAGAGAAG
[0161] PAX6 Rev GGTGGGTTGTGGAATTGGTTGGTAGA
[0162] GAPDH For GAAGGTGAAGGTCGGAGTC
[0163] GAPDH Rev GAAGATGGTGATGGGATTTC Literature
[0164] Aryee , MJ , Jaffe , AE , Corrada-Bravo , H , Ladd-Acosta , C , Feinberg , AP , Hansen , KD , and Irizarry , RA (2014). Minfi: a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. Bioinformatics 30, 1363–1369.
[0165] Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft, G.F., Amoroso, M.W., Oakley, D.H., et al. (2011 ). Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144, 439-452.
[0166] Bouma, M.J., van Iterson, M., Janssen, B., Mummery, C.L., Salvatori, D.C.F., and Freund, C. (2017). Differentiation-Defective Human Induced Pluripotent Stem Cells Reveal Strengths and Limitations of the Teratoma Assay and In Vitro Pluripotency Assays. Stem Cell Reports 8, 1340-1353.
[0167] Butcher, L.M., Ito, M., Brimpari, M., Morris, T.J., Soares, F.A.C., Ahrlund- Richter, L., Carey, N., Vallier, L., Ferguson-Smith, A.C., and Beck, S. (2016). Non-CG DNA methylation is a biomarker for assessing endodermal differentiation capacity in pluripotent stem cells. Nat Commun 7, 10458.
[0168] Cypris, O., Eipel, M., Franzen, J., Rosseier, C., Tharmapalan, V., Kuo, C.C., Vieri, M., Nikolic, M., Kirschner, M., Brummendorf, T.H., et al. (2020). PRDM8 reveals aberrant DNA methylation in aging syndromes and is relevant for hematopoietic and neuronal differentiation. Clin Epigenetics 12, 125.
[0169] Daily, K., Ho Sui, S.J., Schriml, L.M., Dexheimer, P.J., Salomonis, N., Schroll, R., Bush, S., Keddache, M., Mayhew, C., Lotia, S., et al. (2017). Molecular, phenotypic, and sample-associated data to describe pluripotent stem cell lines and derivatives. Sei Data 4, 170030.
[0170] Dolgin, E. (2010). Putting stem cells to the test. Nat Med 16, 1354-1357. Elsafi Mabrouk, M.H., Goetzke, R., Abagnale, G., Yesilyurt, B., Salz, L, Cypris, 0., Gluck, P., Liesenfelder, S., Zeevaert, K., Ma, Z., et al. (2022). The spatial self-organization within pluripotent stem cell colonies is continued in detaching aggregates. Biomaterials 282, 121389.
[0171] Finak, G., McDavid, A., Yajima, M., Deng, J., Gersuk, V., Shalek, A.K., Slichter, C.K., Miller, H.W., McElrath, M.J., Prlic, M., et al. (2015). MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data. Genome Biol 16, 278.
[0172] Frobel, J., Bozic, T., Lenz, M., Uciechowski, P., Han, Y., Herwartz, R., Strathmann, K., Isfort, S., Panse, J., Esser, A., et al. (2018). Leukocyte Counts Based on DNA Methylation at Individual Cytosines. Clin Chem 64, 566-575.
[0173] Gifford, C.A., Ziller, M.J., Gu, H., Trapnell, C., Donaghey, J., Tsankov, A., Shalek, A.K., Kelley, D.R., Shishkin, A.A., Issner, R., et al. (2013).
[0174] Transcriptional and epigenetic dynamics during specification of human embryonic stem cells. Cell 153, 1149-1163.
[0175] Goetzke, R., Franzen, J., Ostrowska, A., Vogt, M., Blaeser, A., Klein, G., Rath, B., Fischer, H., Zenke, M., and Wagner, W. (2018). Does soft really matter?
[0176] Differentiation of induced pluripotent stem cells into mesenchymal stromal cells is not influenced by soft hydrogels. Biomaterials 156, 147-158.
[0177] Han, X., Chen, H., Huang, D., Chen, H., Fei, L., Cheng, C., Huang, H., Yuan, G.C., and Guo, G. (2018). Mapping human pluripotent stem cell differentiation pathways using high throughput single-cell RNA-sequencing. Genome Biol 19, 47.
[0178] Hao, Y., Hao, S., Andersen-Nissen, E., Mauck, W.M., 3rd, Zheng, S., Butler, A., Lee, M.J., Wilk, A. J., Darby, C., Zager, M., et al. (2021 ). Integrated analysis of multimodal single-cell data. Cell 184, 3573-3587 e3529. Houseman, E.A., Accomando, W.P., Koestler, D.C., Christensen, B.C., Marsit, C.J., Nelson, H.H., Wiencke, J.K., and Kelsey, K.T. (2012). DNA methylation arrays as surrogate measures of cell mixture distribution. BMC Bioinformatics 13, 86.
[0179] International Stem Cell, I. (2018). Assessment of established techniques to determine developmental and malignant potential of human pluripotent stem cells. Nat Commun 9, 1925.
[0180] Kolberg, L, Raudvere, U., Kuzmin, I., Vilo, J., and Peterson, H. (2020). gprofi Ier2 -- an R package for gene list functional enrichment analysis and namespace conversion toolset g: Profiler. FWOORes 9.
[0181] Lenz, M., Goetzke, R., Schenk, A., Schubert, C., Veeck, J., Hemeda, H., Koschmieder, S., Zenke, M., Schppert, A., and Wagner, W. (2015). Epigenetic biomarker to support classification into pluripotent and non-pluripotent cells. Scientific Reports 5, 8973.
[0182] Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
[0183] Moss, J., Magenheim, J., Neiman, D., Zemmour, H., Loyfer, N., Korach, A., Samet, Y., Maoz, M., Druid, H., Arner, P., et al. (2018). Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease. Nat Commun 9, 5068.
[0184] Muller, F.J., Goldmann, J., Loser, P., and Loring, J.F. (2010). A call to standardize teratoma assays used to define human pluripotent cell lines. Cell Stem Cell 6, 412-414.
[0185] Muller, F.J., Schuldt, B.M., Williams, R., Mason, D., Altun, G., Papapetrou, E.P., Danner, S., Goldmann, J.E., Herbst, A., Schmidt, N.O., et al. (2011 ). A bioinformatic assay for pluripotency in human cells. Nat Methods 8, 315-317. Ng, E.S., Davis, R.P., Azzola, L, Stanley, E.G., and Elefanty, A.G. (2005). Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation. Blood 106, 1601-1603.
[0186] O'Shea, O., Steeg, R., Chapman, C., Mackintosh, P., and Stacey, G.N. (2020). Development and implementation of large-scale quality control for the European bank for induced Pluripotent Stem Cells. Stem Cell Res 45, 101773.
[0187] Roadmap Epigenomics, C., Kundaje, A., Meuleman, W., Ernst, J., Bilenky, M., Yen, A., Heravi-Moussavi, A., Kheradpour, P., Zhang, Z., Wang, J., et al.
[0188] (2015). Integrative analysis of 111 reference human epigenomes. Nature 518, 317-330.
[0189] Salomonis, N., Dexheimer, P.J., Omberg, L, Schroll, R., Bush, S., Huo, J., Schriml, L, Ho Sui, S., Keddache, M., Mayhew, C., et al. (2016). Integrated Genomic Analysis of Diverse Induced Pluripotent Stem Cells from the Progenitor Cell Biology Consortium. Stem Cell Reports 7, 110-125.
[0190] Schmidt, M., Maie, T., Dahl, E., Costa, I.G., and Wagner, W. (2020). Deconvolution of cellular subsets in human tissue based on targeted DNA methylation analysis at individual CpG sites. BMC biology 18, 178.
[0191] Sontag, S., Bocova, L, Hubens, W.H.G., Nüchtern, S., Schnitker, M., Look, T., Schroder, K.M., Plumakers, B., Tharmapalan, V., Wessiepe, M., et al. (2022).
[0192] Toward Clinical Application of Leukocyte Counts Based on Targeted DNA Methylation Analysis. Clin Chem.
[0193] Steeg, R., Mueller, S.C., Mah, N., Holst, B., Cabrera-Socorro, A., Stacey, G.N., De Sousa, P.A., Courtney, A., and Zimmermann, H. (2021 ). EBiSC best practice: How to ensure optimal generation, qualification, and distribution of iPSC lines. Stem Cell Reports 16, 1853-1867. Stronati, E., Giraldez, S., Huang, L, Abraham, E., McGuire, G.R., Hsu, H.T., Jones, K.A., and Estaras, C. (2022). YAP1 regulates the self-organized fate patterning of hESC-derived gastruloids. Stem Cell Reports 17, 211-220.
[0194] Triche, T.J., Jr., Weisenberger, D.J., Van Den Berg, D., Laird, P.W., and Siegmund, K.D. (2013). Low-level processing of Illumina Infinium DNA Methylation BeadArrays. Nucleic Acids Res 41 , e90.
[0195] Tsankov, A.M., Akopian, V., Pop, R., Chetty, S., Gifford, C.A., Daheron, L., Tsankova, N.M., and Meissner, A. (2015). A qPCR ScoreCard quantifies the differentiation potential of human pluripotent stem cells. Nat Biotechnol 33, 1182-1192.
[0196] Wagner, W. (2022). How to Translate DNA Methylation Biomarkers Into Clinical Practice. Front Cell Dev Biol 10, 854797.
[0197] Willmann, C.A., Hemeda, H., Pieper, L.A., Lenz, M., Qin, J., Joussen, S., Sontag, S., Wanek, P., Denecke, B., Schuler, H.M., et al. (2013). To clone or not to clone? Induced pluripotent stem cells can be generated in bulk culture. PLoS One 8, e65324.
[0198] Tabelle SI:
[0199] Sample_Name Array_Typ< Data_TypeStem_Cell_Sample_GiGSM GSE Dataset iPSC 102 ECTO EPIC IDAT iPSC ECTO GSM6276770 GSE207119 Training iPSC 102 ENDO EPIC IDAT iPSC ENDO GSM6276771 GSE207119 Training iPSC 102 MESO EPIC IDAT iPSC MESO GSM6276772 GSE207119 Training iPSC 102 undifferentiated EPIC IDAT iPSC SC GSM6276773 GSE207119 Training iPSC 104 ECTO EPIC IDAT iPSC ECTO GSM6276774 GSE207119 Training iPSC 104 ENDO EPIC IDAT iPSC ENDO GSM6276775 GSE207119 Training iPSC 104 MESO EPIC IDAT iPSC MESO GSM6276776 GSE207119 Training iPSC 104 undifferentiated EPIC IDAT iPSC SC GSM6276777 GSE207119 Training iPSC 106 ECTO EPIC IDAT iPSC ECTO GSM6276778 GSE207119 Training iPSC 106 ENDO EPIC IDAT iPSC ENDO GSM6276779 GSE207119 Training iPSC 106 MESO EPIC IDAT iPSC MESO GSM6276780 GSE207119 Training iPSC 106 undifferentiated EPIC IDAT iPSC SC GSM6276781 GSE207119 Training
[0200]
[0201]
[0202] DF-852 4 450K matrix Fibroblast somatic cells GSM 1427320 GSE59091
[0203] DF-852 5 450K matrix Fibroblast somatic cells GSM1427321 GSE59091
[0204] DF-627 2 450K matrix Fibroblast somatic cells GSM1427322 GSE59091
[0205] DF-627 3 450K matrix Fibroblast somatic cells GSM1427323 GSE59091
[0206] DF-700 1 450K matrix Fibroblast somatic cells GSM1427324 GSE59091
[0207] DF-700 2 450K matrix Fibroblast somatic cells GSM1427325 GSE59091
[0208] DF-700 3 450K matrix Fibroblast somatic cells GSM1427326 GSE59091
[0209] DF-700 4 450K matrix Fibroblast somatic cells GSM1427327 GSE59091
[0210] DF-700 5 450K matrix Fibroblast somatic cells GSM1427328 GSE59091
[0211] FF-832 1 450K matrix Fibroblast somatic cells GSM1427329 GSE59091
[0212] FF-832 2 450K matrix Fibroblast somatic cells GSM1427330 GSE59091
[0213] FF-832 3 450K matrix Fibroblast somatic cells GSM1427331 GSE59091
[0214] FF-832 4 450K matrix Fibroblast somatic cells GSM1427332 GSE59091
[0215] FF-832 5 450K matrix Fibroblast somatic cells GSM1427333 GSE59091
[0216] FF-832 6 450K matrix Fibroblast somatic cells GSM1427334 GSE59091
[0217] DF-IPSC-447-39-E 450K matrix IPSC LDC GSM1427335 GSE59091
[0218] EB-IPSC-685-68-S 450K matrix IPSC LDC GSM1427336 GSE59091
[0219] DF-IPSC-283-79-E 450K matrix IPSC HDC GSM1427337 GSE59091
[0220] DF-IPSC-983-15-E 450K matrix IPSC HDC GSM1427338 GSE59091
[0221] EB-IPSC-447-64-S 450K matrix IPSC HDC GSM1427339 GSE59091
[0222] EB-IPSC-283-78-S 450K matrix IPSC HDC GSM1427340 GSE59091
[0223] EB-IPSC-844-53-S 450K matrix IPSC HDC GSM1427341 GSE59091
[0224] Sample_Name Array_Type Data_Type Stem_Cell_type Sample_Gr GSM GSE iPSC 102 EB DO EPIC IDAT iPSC EB GSM6276782 GSE207119 iPSC 102 EB D4 EPIC IDAT iPSC EB GSM6276783 GSE207119 iPSC 102 EB D7 EPIC IDAT iPSC EB GSM6276784 GSE207119 iPSC 106 EB DO EPIC IDAT iPSC EB GSM6276785 GSE207119 iPSC 106 EB D4 EPIC IDAT iPSC EB GSM6276786 GSE207119 iPSC 106 EB D7 EPIC IDAT iPSC EB GSM6276787 GSE207119 iPSCC2.3 EB D0 EPIC IDAT iPSC EB GSM6276788 GSE207119 iPSCC2.3 EB D4 EPIC IDAT iPSC EB GSM6276789 GSE207119 iPSCC2.3 EB D7 EPIC IDAT iPSC EB GSM6276790 GSE207120
[0225] Sample_Name Array_Type Data_Type Stem_Cell_type Sample_Group GSM GSE
[0226] SC12-005 EB [9934089035_R05C01] 450K IDAT iPSC EB GSM2285204 GSE85828
[0227] SC11-006 EB [9341679025_R01C02] 450K IDAT IPSC EB GSM2285157 GSE85828
[0228] SC12-006 EB [9934089035_R04C01] 450K IDAT IPSC EB GSM2285202 GSE85828
[0229] SC11-007 EB [9422493126_R03C02] 450K IDAT IPSC EB GSM2285184 GSE85828
[0230] SC11-013 EB [9934089038_R03C02] 450K IDAT IPSC EB GSM2285213 GSE85828
[0231] SC11-014 EB [9934089038_R01C02] 450K IDAT IPSC EB GSM2285209 GSE85828
[0232] SC11-016 EB [9422493126_R05C02] 450K IDAT IPSC EB GSM2285188 GSE85828
[0233] SC11-017 EB [9341679025_R03C01] 450K IDAT IPSC EB GSM2285160 GSE85828
[0234] SC12-025 EB [9341679022_R04C01] 450K IDAT IPSC EB GSM2285151 GSE85828
[0235] SC12-031 EB [9422493050_R06C02] 450K IDAT IPSC EB GSM2285178 GSE85828
[0236] SC12-035 EB [9934089035_R06C01] 450K IDAT IPSC EB GSM2285206 GSE85828
[0237] SC14-066 EB [9934089035_R03C02] 450K IDAT IPSC EB GSM2285201 GSE85828
[0238] SC14-067 EB [9934089035_R02C02] 450K IDAT IPSC EB GSM2285199 GSE85828
[0239] SC14-069 EB [9934089038_R06C02] 450K IDAT IPSC EB GSM2285219 GSE85828
[0240] SC14-070 EB [3999442133_R01C02] 450K IDAT IPSC EB GSM2285107 GSE85828
[0241] SC14-072 EB [9934089038_R06C01] 450K IDAT IPSC EB GSM2285218 GSE85828
[0242] SC14-073 EB [9934089038_R05C01] 450K IDAT IPSC EB GSM2285216 GSE85828
[0243] H9 EB [9341679025_R04C02] 450K IDAT ESC EB GSM2285163 GSE85828
[0244] Tabelle S2: 54
[0245] Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
[0246] APOA1 1,9467E-165 6,309623763 0,982 0,456 3,0559E-161 21,45099814
[0247] APOA2 3,6757E-155 6,140853514 0,978 0,346 5,7702E-151 7,275942372
[0248] APOB 1,4744E-137 5,807369232 0,916 0,28 2,3144E-133 3,407861862
[0249] AFP 4.86485E-69 5.17736088 0.647 0.165 7.63684E-65 1.431108204
[0250] FGA 2.03937E-75 5.161873598 0.578 0.079 3.2014E-71 0.823676369
[0251] IGFBP6 l,20688E-89 4,56480445 0,895 0,213 l,89456E-85 1,037321937
[0252] MTTP 5.07529E-71 4.529145641 0.804 0.114 7.96718E-67 0.727654915
[0253] CST1 9.92504E-85 4.513582066 0.793 0.173 l.55803E-80 0.772975026
[0254] S100A14 l,41023E-73 4,355984535 0,738 0,098 2,21378E-69 0,533827453
[0255] RBP4 4.3316E-34 4.314065394 0.305 0.051 6.79974E-30 0.398533459
[0256] APOM l.63756E-43 4.272837206 0.633 0.084 2.57064E-39 0.572671668
[0257] LINC00261 l,17904E-82 4,266571092 0,938 0,131 l,85085E-78 0,62982646
[0258] APOC1 8.4151E-170 4.058940748 0.978 0.641 1.321E-165 3.103037205
[0259] DPP4 l,21405E-67 3,986337221 0,731 0,071 l,90581E-63 0,370974924
[0260] <h2 style=";text-align:left;direction:ltr">S100A16 3,516E-58 3,904456126 0,891 0.31 5,51941E-54 1,784345901<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0261] <h2 style=";text-align:left;direction:ltr"> FN1 l,0462E-108 3,819836508 1 0,784 l,6424E-104 20,88973054<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0262] <h2 style=";text-align:left;direction:ltr"> GPX2 l,34496E-24 3,724270876 0,455 0,052 2,11131E-20 0,350105478<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0263] <h2 style=";text-align:left;direction:ltr"> ALDH1A1 l,68565E-37 3.560395714 0.633 0.079 2.64614E-33 0.327158914<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0264] <h2 style=";text-align:left;direction:ltr"> GSTA2 7,34627E-42 3,448474892 0,567 0,043 l,15322E-37 0,220345079<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0265] <h2 style=";text-align:left;direction:ltr"> HNF4A 3.03722E-48 3.354580338 0.629 0.054 4.76783E-44 0.213903237<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0266] <h2 style=";text-align:left;direction:ltr"> CUBN 3,00346E-39 3,344895334 0,542 0,054 4,71484E-35 0,220027161<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0267] <h2 style=";text-align:left;direction:ltr"> CA4 l,04256E-17 3.294929731 0.469 0.075 1.6366E-13 0.39200605<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0268] <h2 style=";text-align:left;direction:ltr"> SLC7A7 2.12233E-39 3.292366328 0.716 0.155 3.33163E-35 0.407406901<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0269] <h2 style=";text-align:left;direction:ltr"> CDKN1C 2.51013E-55 3.267563123 0.949 0.448 3.9404E-51 1.844362981<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0270] <h2 style=";text-align:left;direction:ltr"> GSTA1 6,6673E-20 3,20479552 0,407 0,029 l,04663E-15 0,19971716<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0271] FOXA2 l,85323E-52 3,194028787 0,738 0,068 2,9092E-48 0,210031079
[0272] MYL3 2,94744E-16 3,093849543 0,411 0,054 4,62689E-12 0,241963029
[0273] CYP4X1 l,10556E-31 3,074862969 0,585 0,065 l,73551E-27 0,209028897
[0274] HABP2 8,90617E-33 3,024664397 0,52 0,029 l,39809E-28 0,142008524
[0275] RASSF6 l,06872E-21 2,988549446 0,418 0,035 1,67768E-17 0,167401689
[0276] MYOF 5,00359E-30 2,871303498 0,865 0,233 7,85463E-26 0,646128815
[0277] PPFIBP2 2,29445E-28 2,856286413 0,851 0,214 3,60183E-24 0,537451419
[0278] ANKRD1 l,4019E-16 2,823545598 0,451 0,143 2,2007E-12 0,425516127
[0279] DENND2C l,77096E-23 2,797868601 0,698 0,155 2,78005E-19 0,379145467
[0280] LCP1 l,70955E-12 2,796287793 0,418 0,095 2,68365E-08 0,36142237
[0281] SAT1 7,7862E-79 2,792006593 0,971 0,717 l,22228E-74 2,825867931
[0282] <h2 style=";text-align:left;direction:ltr">CCKBR l,56113E-24 2.693681628 0.713 0.267 2.45066E-20 0.845957267<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0283] <h2 style=";text-align:left;direction:ltr"> HLA-DRB1 7.22183E-19 2.682945231 0.604 0.164 1.13368E-14 0.464752564<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0284] <h2 style=";text-align:left;direction:ltr"> RSP03 l,61207E-26 2.667513497 0.909 0.359 2.53064E-22 1.759270042<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0285] <h2 style=";text-align:left;direction:ltr"> S100A10 3.69111E-73 2.66415085 0.996 0.855 5.79431E-69 10.38969204<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0286] <h2 style=";text-align:left;direction:ltr"> EPSTI1 9.08507E-19 2.657512498 0.564 0.079 1.42617E-14 0.199734288<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0287] <h2 style=";text-align:left;direction:ltr"> MGST2 6,69648E-28 2,645282833 0,804 0,213 l,05121E-23 0,398584136<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0288] <h2 style=";text-align:left;direction:ltr"> VIL1 1.19692E-17 2.642148939 0.404 0.054 1.87893E-13 0.156076671<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0289] <h2 style=";text-align:left;direction:ltr"> PDZK1 3.53389E-25 2.627709987 0.513 0.03 5.5475E-21 0.115214577<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0290] <h2 style=";text-align:left;direction:ltr"> HSPA12A l,52016E-14 2.594787105 0.498 0.08 2.38634E-10 0.246603748<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0291] <h2 style=";text-align:left;direction:ltr"> TMEM144 1.14616E-19 2.589926897 0.425 0.07 1.79924E-15 0.155790967<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0292] <h2 style=";text-align:left;direction:ltr"> SERPINE2 l,74387E-59 2,589202091 0,978 0,67 2,73752E-55 2,343752228<h2 style=";text-align:left;direction:ltr">
[0293] PLA2G12B 2,14411E-17 2,567042854 0,382 0,016 3,36582E-13 0,087783834
[0294] F0LR1 l,50735E-10 2,551944745 0,367 0,057 2,36624E-06 0,203715352
[0295] <h2 style=";text-align:left;direction:ltr">RNASE1 2,1543E-07 2,542024501 0,222 0,031 0,003381821 0,161777234 BMP2 l,24523E-25 2,529440206 0,829 0,264 1,95475E-21 0,595774921 VTN 3,50692E-30 2,515092887 0,593 0,063 5,50516E-26 0,129156015 FLRT3 6,12893E-30 2,513916772 0,96 0,439 9,62119E-26 1.773337685 SGIP1 6.02136E-17 2.493011632 0.378 0.065 9.45234E-13 0.143770783 F10 2.37709E-14 2.465882146 0.356 0.033 3.73156E-10 0.115564935 EPCAM 6.84207E-47 2.448538745 0.985 0.598 l.07407E-42 2.252605003 F2 2.88386E-12 2.401001234 0.291 0.019 4.52708E-08 0.079772596 REEP6 3.29646E-20 2.380766917 0.698 0.217 5.17478E-16 0.452463962 HPX 5.7959E-10 2.37197752 0.269 0.028 9.09841E-06 0.107984145 APOE 2.3524E-160 2.371458536 1 0.92 3.6927E-156 2.29465315 GSN 2.01202E-36 2.367030398 0.905 0.429 3.15847E-32 0.812729138 CAMK2D l,53733E-27 2.366459753 0.895 0.341 2.4133E-23 0.706232367 HNF1A-AS1 2.00034E-15 2.352595114 0.36 0.021 3.14013E-ll 0.077737923 CST3 5.90747E-55 2.351865137 0.949 0.589 9.27354E-51 1.004622482 BMP6 l,91109E-22 2,320215644 0,<h2 style=";text-align:left;direction:ltr">469 0.031 3.00003E-18 0.08199699 LGALS3 2.40316E-15 2.317880296 0.56 0.168 3.77248E-11 0.304448314 APE LA 3.60215E-30 2.296553727 0.815 0.4 5.65466E-26 0.804959824 ANXA3 4.99581E-25 2.288253006 0.815 0.339 7.84243E-21 0.639803046 TMEM37 1.3637E-12 2.27498192 0.545 0.139 2.14074E-08 0.32184307 SLC22A3 3.49513E-13 2.235857244 0.415 0.06 5.48665E-09 0.128221555 UGT3A1 8.43611E-09 2.235750702 0.338 0.075 0.00013243 0.18911798 SMIM10L2A l,94658E-25 2.23026946 0.644 0.198 3.05575E-21 0.246359053 AMOT l.50859E-05 0.063052609 MLXIPL 2.06107E-ll 2.177673529 0.244 0.043 3.23547E-07 0.093203878 AK4 8.46743E-32 2.172550723 0.869 0.449 l,32922E-27 0.889393971 CFTR 1,18619E-11 2,158837209 0,375 0,048 1.181134177 SYTL5 1.52587E-13 2.122822935 0.713 0.184 2.3953E-09 0.341501965 TTN 3.7603E-18 2.120934944 0.745 0.402 5,<h2 style=";text-align:left;direction:ltr">90291E-14 1.114766012 IGSF1 4.75304E-18 2.113016475 0.571 0.251 7.46133E-14 0.350626365 CELF4 6.95691E-18 2.109567142 0.444 0.059 L,0921E-13 0.099088698 HPGD 5.64942E-09 2.096875998 0.298 0.035 8.86846E-05 0.102051572 FAM184A 9.40777E-16 2,087671338 0.647 0.211 1.47683E-11 0.371173733 DNAJC22 2.57742E-13 2.082513103 0.367 0.04 4.04603E-09 0.087961316 B4GALT4 7.32303E-22 2.067800711 0.745 0.299 1.14957E-17 0.382755769 SLC2A3 2.83614E-73 2.037813258 1 0.935 4.45217E-69 6.248630879 ANKRD55 6.23479E-09 2.034814383 0.342 0.054 9.78737E-05 0.121356488 NQO1 3.69002E-33 2.025987193 0.869 0.604 5.79259E-29 1.761741139 SULF2 2.92036E-18 2.024955843 0.756 0.288 4.58438E-14 0.472341167 FZD4 1.82967E-15 2.023475783 0.713 0.186 2.87221E-11 0.267255344 EFHD1 l,22449E-10 2,00903374 0.516 0.095 l,92221E-06 0.182393655 TMEM135 l,89025E-21 2,00322147 0.775 0.305 2,96732E-17 0.402752425 SERPINF1 4,70462E-14 2,00084925 0.615 0.227 7,38531E-10 0,392605903 SPTLC3 l,58573E-09 1,996346213 0.429 0.052 2,48928E-05 0,115984079 FTL 2,495E-230 1,986689679 1 1 3,9166E-226 72,48120121,
[0296] <h2 style=";text-align:left;direction:ltr">STEAP1 5.99742E-12 1.979325543 0.393 0.104 9.41474E-08 0.154163274 CLDN19 l,4577E-10 1.964211207 0.316 0.079 2.2883E-06 0.113695763 LINC01356 3.19518E-16 1.962965489 0.742 0.429 5.01579E-12 1.952068923 AMHR2 2.27032E-06 1.956505952 0.316 0.06 0.035639461 0.157987036 LAMA1 l,37535E-32 1.955589293 0.978 0.65 2.15902E-28 2.380849969 GLYCTK 2.56402E-10 1.951862084 0.327 0.064 4.02499E-06 0.112684628 FLNB 4.1162E-28 1.950522003 0.811 0.506 6.46161E-24 0.814190319 CHST9 3.04709E-13 1.948878085 0.582 0.199 4.78333E-09 0.310516825 MPC2 9.50366E-26 1.945976242 0.92 0.609 1.49189E-21 2.583135218 S100A13 4.9035E-48 1.942584526 0.956 0.648 7.69751E-44 0.813012896 SLC22A18 3.81957E-08 1.938243203 0.298 0.09 0.000599596 0.1632273 PTGR1 2.13563E-35 1.937821497 0.851 0.482 3.35251E-31 0.492723367 GAMT 4.02103E-23 1.924778141 0.836 0.461 6.31222E-19 0.875238006 LIFR l.80796E-17 1.923996423 0.891 0.381 2.83814E-13 1.009789341 S0X17 l.85027E-08 1.898957181 0.262 0.049 0.000290455 0.090678771 B4GALT1 4,<h2 style=";text-align:left;direction:ltr">84225E-20 1.894317686 0.869 0.388 7.60136E-16 0.578438734 HDHD3 2.53407E-10 1.892431314 0.509 0.16 3.97798E-06 0.264128104 ZNF600 2.00484E-09 1.874377785 0.498 0.132 3.14719E-05 0.258293775 HPN 1.51485E-14 1.872599984 0.484 0.093 2,37801E-10 0.121128234 CLDN4 8.48264E-14 1.860523931 0.415 0.117 l.3316E-09 0.121565654 ADD3 7.72323E-34 1.858208122 0.978 0.695 l.21239E-29 1.648837502 ANXA2 8.62051E-36 1.855766234 0.982 0.829 1.35325E-31 6.516690326 SERPINF2 l.47308E-07 1.838207485 0.225 0.025 0.002312444 0.057296457 CHDH 7.53188E-07 1.836766159 0.262 0.084 0.011823545 0.161169035 PHLDA2 8.90134E-07 1.82288462 0.255 0.107 0.013973324 0.189953668 CRYM 2.45485E-09 1.813582669 0.513 0.192 3.85362E-05 0.398094292 TMC4 3.10104E-09 1.804915467 0.236 0.04 4.86801E-05 0.063186869 NEAT1 7.21425E-22 1.804732173 0.96 0.672 1.13249E-17 4.519038267 PLPP3 3.70294E-17 FGFR3 4,19406E-16 1,<h2 style=";text-align:left;direction:ltr">782916169 0.836 0.36 6.58383E-12 0.665849557 0DC1 l,50512E-39 1.776249075 0.989 0.82 2.36274E-35 2.904750184 DNAJC15 l,25685E-24 1.751190817 0.895 0.598 l,973E-20 1.502846882 OVOL2 7,22793E-09 1,744077639 0.313 0.065 0.000113464 0.104781136 TPRG1L 5.64325E-13 1.736778476 0.695 0.303 8.85877E-09 0.46988839 LAM Bl 3.68577E-30 1.728372982 0.996 0.722 5.78592E-26 2.470651448 VCAN 3.45902E-59 1.727100517 1 0.977 5.42997E-55 8.289278503 ITLN2 l.69077E-07 1.720229522 0.233 0.035 0.002654167 0.06875464 AGPAT3 3.05044E-09 1.719429579 0.48 0.139 4.78858E-05 0.174377071 P4HA1 8.36618E-20 1.71849625 0.869 0.509 1.31332E-15 1.051572671 C2orf72 l,20128E-08 1.711544144 0.298 0.033 0.000188577 0.061897972 TPD52L1 5.47806E-08 1.683486304 0.36 0.101 0,000859946 0.13607453 FAM83F l,0336E-12 1.681089967 0.451 0.127 l,62254E-08 0.12883624 ABCA1 7.92794E-11 1.676478853 0.64 0.247 l,24453E-06 0.355319473 KRT19 l,45757E-26 1.66614465 1 0.834 2.28809E-22 9.349799768 TRIM38 2.12041E-07 1.665596263 0.284 0,055 0,003328624 0,0858942 PRDM1 l,04818E-07 1,665551811 0,458 0,067 0,00164543 0,123492258 PDE5A 6,224E-10 1,659551948 0,465 0,198 9,77043E-06 0,24849252 CYB5A 5,65653E-27 1,652973726 0,942 0,704 8,87962E-23 2,501363657 CAV2 5,92918E-10 1,645176232 0,32 0,04 9,30762E-06 0,060616078 ADM 4,23964E-13 1,642604591 0,665 0,426 6,65538E-09 1,36953388 NEU1 l,65032E-16 1,639665461 0,745 0,418 2,59067E-12 0,614836112 IHH 7,57689E-19 1,633399148 0,527 0,03 1,18942E-14 0,041346344 OCLN 9,24027E-14 1,633127127 0,327 0,073 l,45054E-09 0,069108563 DGAT1 2,60073E-09 1,632496574 0,596 0,255 4,08263E-05 0,457598828 FAM20C l,21471E-07 1,630827548 0,36 0,152 0,001906857 0,212261217 DYNLT3 l,52905E-10 1,629347856 0,622 0,215 2,40031E-06 0,303141227 ARHGAP18 2,21132E-06 1,624827066 0,335 0,07 0,034713282 0,123380632 LRP2 2,47527E-09 1,619496642 0,702 0,287 3,88568E-05 0,787226726 GATA5 6,35056E-10 1,599937087 0,793 0,253 9,96912E-06 0,446013956 CRB3 6,14508E-09 1,595741303 0,375 0,09 9,64655E-05 0,111782856 GSTK1 l,02979E-17 1,593750043 0,865 0,542 1,61657E-13 1,038190737 DUSP9 l,69922E-07 1,583464362 0,269 0,02 0,002667443 0,039978319 ERRFI1 3,27889E-16 1,577665582 0,855 0,48 5,1472E-12 0,76271106 ALPK3 2,03702E-08 1,57351733 0,535 0,202 0,000319771 0,308806272 SMOX l,18379E-06 1,563389424 0,382 0,135 0,018583102 0,216204189 RAB17 3,6798E-09 1,56052615 0,44 0,145 5,77655E-05 0,178458481 MARVELD2 1,99625E-11 1,555053524 0,487 0,22 3,13372E-07 0,224622512 PRR13 l,55593E-30 1,543610999 0,945 0,744 2,44249E-26 2,431696981 PITX2 l,53557E-10 1,540156456 0,909 0,318 2,41054E-06 0,662860763 HES4 2,99849E-10 1,528547743 0,411 0,077 4,70703E-06 0,084421083 ZDHHC9 9,93012E-14 1,526089179 0,796 0,418 l,55883E-09 0,711479147 TMEM141 2,27176E-16 1,521627297 0,865 0,451 3,56621E-12 0,660195978 PRR5 4,22587E-07 1,509033242 0,465 0,151 0,006633777 0,193669062 NEDD4L l,1023E-14 1,507400356 0,785 0,409 l,73039E-10 0,601434397 PPM1H 3,69901E-10 1,503815253 0,513 0,211 5,80671E-06 0,203871261 SHTN1 l,54772E-09 1.494186542 0.647 0.232 2.42962E-05 0.275764967 SPINT2 3.75086E-24 1.487684554 0.927 0.6 5.8881E-20 0.994040335 ACOX2 3.87192E-07 1.484939066 0.276 0.053 0.006078145 0.070993251 RHOC 7.38194E-22 1.483068071 0.945 0.673 1.15882E-17 1.700690841 ABO l.51931E-06 1.477794839 0.342 0.063 0.023850156 0.084418923 KIT 2.41057E-08 1.476656618 0.375 0.154 0.000378411 0.148848962 AGPAT2 9.3111E-09 1.47399236 0.553 0.274 0.000146166 0.386255625 CAMSAP3 5.4745E-11 1.468700559 0.382 0.143 8.59387E-07 0.123344373 RAB25 7.782E-08 1.464412547 0.484 0.197 0.001221618 0.28944965 ECHDC2 3.7041E-08 1.463484163 0.513 0.157 0.000581469 0.190972752 ANKMY2 l.38092E-16 1.461466006 0.847 0.482 2.16778E-12 0.536709426 FGFR4 l.07736E-22 1.460715074 0.669 0.205 1.69123E-18 0.110567097 NUDT4 2.63731E-22 1.459401957 0.891 0.554 4.14005E-18 0.574736102 GLUD1 5.24818E-15 1.456768987 0.738 0.492 8.23859E-11 0.748892395 CTSB 2.53684E-19 1.454929724 0.945 0.668 3.98234E-15 1.773360539 PCYT2 5,01399E-ll 1,447164389 0,571 0,268 7,87096E-07 0,269129385 PNPT1 2,38948E-16 1,444371366 0,796 0,513 3,75101E-12 0,761695789 RMND1 l,09488E-ll 1,444312163 0,64 0,287 l,71875E-07 0,320860501 PCBD1 3,17934E-13 1,428828744 0,775 0,401 4,99093E-09 0,536183489 GATA4 6,5295E-08 1,427626376 0,56 0,146 0,001025001 0,146048545 COBL 7,65268E-08 1,4170169 0,407 0,161 0,001201317 0,16796069 RASD1 3,47921E-09 1,412003659 0,28 0,05 5,46166E-05 0,046508851 Clorf210 2,61309E-09 1,411544988 0,258 0,048 4,10203E-05 0,041685833 MRS2 1,42384E-13 1,407689473 0,815 0,443 2,23514E-09 0,665676856 RAPGEF5 6,6849E-07 1,398221005 0,273 0,08 0,010493963 0,084889678 MBNL3 3,42885E-08 1,398061342 0,585 0,239 0,00053826 0,341882203 C12orf75 3,01795E-14 1,397470341 0,753 0,408 4,73758E-10 0,426074088 NUDT14 3,67551E-07 1,395241414 0,425 0,184 0,005769815 0,202246655 GAS6 l,52726E-09 1,392548188 0,564 0,184 2,39749E-05 0,171069369 OGFRL1 l,51597E-07 1,392391562 0,469 0,159 0,002379769 0,177933162 FAM118A 8,89541E-13 1,386790854 0,822 0,483 l,3964E-08 0,745246631 CENPA 2,55987E-10 1,381077831 0,484 0,241 4,01849E-06 0,213665365 MY09A 4,25353E-11 1,372618982 0,855 0,418 6,6772E-07 0,758144596 PEPD 6,50537E-12 1,368146847 0,8 0,487 l,02121E-07 1,073667096 S100A11 l,14885E-26 1.355052914 0.985 0.789 l,80347E-22 2.904173006,
[0297] <h2 style=";text-align:left;direction:ltr">TRAK2 6.17817E-10 1.340883982 0.495 0.292 9.69849E-06 0.291229616 DDIT3 6.35812E-09 1.335954212 0.487 0.194 9.98097E-05 0.164462437 PNPLA3 6.01672E-07 1.329634052 0.327 0.115 0.009445047 0.113986109 RASGEF1B 8.18127E-07 1.311738608 0.331 0.103 0.012842964 0.09815616 SLC3A2 9.09916E-26 1.308924252 0.967 0.875 1.42839E-21 3.857162947 EPS8L2 7.16792E-11 1.305527444 0.476 0.226 l,12522E-06 0.152052678 LRRC1 l,34923E-06 1,305251333 0.455 0.173 0.021180187 0.185256014 APLP2 l,35526E-40 1.299334845 0.996 0.954 2.12749E-36 3.661156703 ARHGAP26 5.21474E-09 1.298665928 0.545 0.263 8.18609E-05 0.245335336 SHISA5 3.73253E-24 1.297856036 0.942 0.771 5.85933E-20 1.908558873 HACD1 7.1641E-08 1.287295049 0.665 0.334 0.00112462 0.552238664 GPC3 l.06916E-12 1,284894258 0,887 0,616 l,67837E-08 2,013388232 FGF13 l,28699E-06 1,279355177 0,433 0,194 0,020203203 0,233608274 FGFR1 7,38806E-37 1,276773417 0,989 0,926 l,15978E-32 3,125570496 UACA 3,70923E-14 1,272360451 0,956 0,659 5,82275E-10 2,<h2 style=";text-align:left;direction:ltr">033436176 FBXO17 l,5626E-07 1.270589067 0.615 0.243 0.002452965 0.302623099 SLC7A5 1.38646E-11 1.26354318 0.542 0.233 2.17646E-07 0.145099049 PATJ 2.26105E-ll 1.263176989 0.789 0.421 3.54939E-07 0.502756059 0.345 0.000198264 0.442954908 COL4A1 2.06673E-13 1.248037448 0.989 0.632 3.24435E-09 1.703912578 GALM l,70287E-06 1.241833416 0.604 0.282 0.02673162 0.425991722 STX3 l,07052E-12 1.238849453 0.898 0.516 l,6805E-08 0.869509703 NENF 2.59216E-10 1,23414168 0,705 0.533 4.06917E-06 1.097639258 FRMD4A 2.51107E-06 1.231620536 0.498 0.254 0.03941878 0.30971493 HLA-B l,267E-07 1.225019092 0.578 0.294 0.001988931 0.390250318 ALDH6A1 8.79934E-09 1.217730785 0.716 0.351 0.000138132 0.439526332 RBM47 l,31586E-10 1.211764265 ASPH 5.40456E-12 0.589 0.327 2.06564E-06 0.250021855 MOSPD1 4, 1.208505212 0.753 0.434 8.48408E-08 0.480060883 PCDH7 4.37647E-07<h2 style=";text-align:left;direction:ltr">61618E-07 1.203789793 0.535 0.29 0.007246475 0.401687872 FRAS1 2.8709E-09 1.200399582 0.724 0.448 4.50674E-05 0.645495154 CD99 2.26757E-22 1.194702096 0.96 0.774 3.55964E-18 1.278261287 CDH2 1.46882E-14 1.191904716 0.982 0.654 2,30576E-10 1.690101225 GPX3 2.10752E-09 1.189243717 0.6 0.339 3.30838E-05 0.323343444 TNNC1 3.32499E-12 1.188685002 0.422 0.048 5.21958E-08 0.030366038 KDM4C 3.69748E-07 1.187836834 0.327 0.124 0.005804304 0.090331396 GSTO1 1.72117E-19 1.185336326 0.982 0.817 2.70189E-15 3.382338224 CAMK2N1 2.16882E-07 1.180900406 0.662 0.24 0.003404614 0.28700461 FLRT2 2.01352E-06 1.17792784 0.778 0.366 0.031608222 0.687992434 BINI 4.17577E-12 1.176914152 0.825 0.493 6.55512E-08 0.582904962 GLUL 5.45296E-24 1.172961542 0.931 0.851 8.56006E-20 2.049673681 ESRP1 l,07489E-08 1.164961539 0.633 0.318 0.000168736 0.344798657 CIB1 3.79772E-11 VAMP8 2,11702E-08 1,134491432 0.698 0.438 0.00033233 0.628865951 SERPINB6 l.83303E-07 1.129004014 0.68 0.409 0.002877484 0.720554415 SLC25A44 l,29685E-06 1,116954414 0,495 0,288 0,020358009 0,308030652 FUR 1,63953E-11 1,105408984 0,836 0,527 2,57374E-07 0.620546657 DAB2 l.38453E-06 1.100173489 0.927 0.454 0.021734405 1.239959842 DST 4.25458E-19 1.08366835 0.985 0.886 6.67884E-15 3.613538471 SPATS2L 1.32881E-11 1.079432706 0.855 0.579 2.08596E-07 0.88373632,
[0298] LLGL2 4.9066E-07 1.077756289 0.68 0.345 0.007702383 0.390104816
[0299] CLDN7 2.8516E-10 1.07493501 0.545 0.234 4.47645E-06 0.134453729
[0300] SNCA 4.67812E-07 1.072586649 0.429 0.169 0.007343705 0.112027009
[0301] COL18A1 8.7906E-20 1.071973805 0.993 0.816 1.37995E-15 1.255852831
[0302] ZFP36L2 5.36801E-14 1.066244711 0.92 0.676 8.4267E-10 1.048696936
[0303] COL4A6 l,50601E-07 1.065747664 0.782 0.467 0.002364142 0.828802395 <h2 style=";text-align:left;direction:ltr">
[0304] <h2 style=";text-align:left;direction:ltr"> SLC7A8 l,05058E-12 1,06091137 0,695 0,472 l,6492E-08 0,370180275<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0305] <h2 style=";text-align:left;direction:ltr"> CKB 5.08912E-17 1.059408863 0.945 0.817 7.98891E-13 2.818433635<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0306] <h2 style=";text-align:left;direction:ltr"> NFE2L2 9.21837E-08 1.046941946 0.753 0.443 0.0014471 0.53414311<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0307] <h2 style=";text-align:left;direction:ltr"> MYL12B 5.14276E-19 1.041167931 0.967 0.861 8.07311E-15 3.37533087<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0308] <h2 style=";text-align:left;direction:ltr"> PPP1R14A 1,13127E-13 1,036173078 0,356 0,113 l,77587E-09 0,041550274<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0309] <h2 style=";text-align:left;direction:ltr"> CAPN1 l,3158E-08 1.035613614 0.727 0.442 0.000206555 0.552434031<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0310] <h2 style=";text-align:left;direction:ltr"> TMED9 8,28662E-10 1,025173862 0,811 0,485 l,30083E-05 0,436495914<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0311] <h2 style=";text-align:left;direction:ltr"> COL9A2 4.00668E-07 1.018274329 0.571 0.321 0.006289688 0.285858098<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0312] <h2 style=";text-align:left;direction:ltr"> SLC48A1 1,1487E-11 1,013923636 0,669 0,446 L,80324E-07 0,280101495<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0313] <h2 style=";text-align:left;direction:ltr"> NAB1 2.62044E-07 1.009396586 0.68 0.386 0.004113567 0.486823025<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0314] <h2 style=";text-align:left;direction:ltr"> HMOX1 l,69648E-06 1,007884464 0,28 0,054 0,026631353 0,037591187<h2 style=";text-align:left;direction:ltr">
[0315] ISG15 l,47616E-07 1,004423196 0,644 0,515 0,002317269 1,069928363
[0316] TM7SF2 l,09501E-06 1,004371455 0,625 0,403 0,017189454 0,61174873
[0317] F0XP1 6,7488E-08 1,002517178 0,789 0,53 0,001059426 0,858016838 pct.l Fraction of endoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes
[0318] Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
[0319] COL3A1 2,6664E-170 4,07387832 0,956 0,388 4,1856E-166 3,866056568
[0320] LUM 7,3571E-140 3,942986352 0,915 0,314 1,1549E-135 2,829044581
[0321] APLNR 2,4056E-151 3,810485096 0,975 0,315 3,7763E-147 2,668094957
[0322] IGFBP3 2,5626E-114 3,730621401 0,858 0,297 4,0228E-110 2,246348223
[0323] HAPLN1 1,85E-147 3,71009579 0,972 0,4 2,9041E-143 3,87102293
[0324] <h2 style=";text-align:left;direction:ltr">POSTN 2.11678E-79 3.623453225 0.657 0.228 3.32293E-75 1.215448898<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0325] <h2 style=";text-align:left;direction:ltr"> COL6A3 1,319E-114 3,391207463 0,787 0,215 2,0706E-110 0,692160798<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0326] <h2 style=";text-align:left;direction:ltr"> LRRC32 4.3895E-81 3.323399633 0.688 0.151 6.89064E-77 0.640747146<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0327] <h2 style=";text-align:left;direction:ltr"> RSPO2 9,30106E-76 3,319808804 0,676 0,162 l,46008E-71 0,71466252<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0328] <h2 style=";text-align:left;direction:ltr"> HAND1 1,1212E-111 3,315597741 0,985 0,276 l,7601E-107 2,353707762<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0329] <h2 style=";text-align:left;direction:ltr"> C0BLL1 4.68089E-97 3.257334099 0.779 0.234 7.34806E-93 0.835500994<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0330] <h2 style=";text-align:left;direction:ltr"> DNAH2 l,18569E-73 3.21272246 0.66 0.155 l,86129E-69 0.594463805<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0331] <h2 style=";text-align:left;direction:ltr"> ACTC1 2.8971E-104 3.197592265 0.937 0.511 4.5478E-100 4.699476701<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0332] <h2 style=";text-align:left;direction:ltr"> ALPK2 3.97178E-81 3.177949396 0.704 0.18 6.2349E-77 0.605465434<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0333] <h2 style=";text-align:left;direction:ltr"> MYL4 7.29751E-72 3.132116997 0.746 0.177 L,14556E-67 0.723387863<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0334] <h2 style=";text-align:left;direction:ltr"> BMP4 4.2735E-102 3.110421506 0.896 0.305 6.70856E-98 1.177296498<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0335] HAS2 2,6865E-99 3,106547193 0,818 0,277 4,21732E-95 0,792039048
[0336] PMP22 3,04648E-57 3,011511302 0,667 0,217 4,78236E-53 0,841166775
[0337] COL5A2 2,4182E-104 3,009679109 0,836 0,304 3,796E-100 0,84772544
[0338] RGS4 6,6765E-68 3,000111226 0,716 0,187 l,04808E-63 0,738846043
[0339] COL5A1 2,4678E-121 2,952935417 0,918 0,386 3,8739E-117 1,020138159
[0340] FREM1 7,85152E-90 2,93241756 0,786 0,2 l,23253E-85 0,517967657
[0341] BMPER 3,09619E-61 2,931596394 0,657 0,15 4,8604E-57 0,479340811
[0342] CDH11 3,9001E-100 2,923401645 0,899 0,318 6,12242E-96 0,943181189
[0343] KDR 5,32622E-96 2,917149726 0,824 0,447 8,36109E-92 1,262620143
[0344] COL1A1 3,7594E-126 2,911059259 0,93 0,422 5,9015E-122 1,0073861
[0345] ART5 2,16554E-46 2,902132362 0,57 0,264 3,39946E-42 0,943925025
[0346] CLSTN2 9,80384E-52 2,901140428 0,391 0,079 l,53901E-47 0,219800777
[0347] SYNE1 1,32264E-61 2,863887869 0,504 0,172 2,07628E-57 0,349579217
[0348] DSC3 6,12155E-62 2,852987737 0,352 0,104 9,60961E-58 0,189091331
[0349] FAM89A l,00952E-77 2,850752913 0,782 0,197 l,58474E-73 0,577439464
[0350] PRRX1 l,34407E-67 2,837837726 0,76 0,196 2,10992E-63 0,640692167
[0351] TGFBI 2,61629E-57 2,812490877 0,496 0,166 4,10705E-53 0,327947887
[0352] DCN 2,15798E-49 2,805048253 0,299 0,074 3,3876E-45 0,169350721
[0353] SLC40A1 4,22974E-57 2,761865108 0,591 0,148 6,63984E-53 0,39225967
[0354] SEMA6D l,16351E-70 2,728412701 0,754 0,252 l,82647E-66 0,603254396
[0355] HOXB5 6,52969E-57 2,726936275 0,463 0,077 l,02503E-52 0,208209186
[0356] TMEM88 l,4181E-130 2,691081851 0,88 0,231 2,2261E-126 0,366066619
[0357] <h2 style=";text-align:left;direction:ltr">SVEP1 l,25196E-47 2.685790694 0.44 0.099 l,96532E-43 0.235778587<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0358] <h2 style=";text-align:left;direction:ltr"> TNC 1.31569E-61 2.668526913 0.674 0.193 2.06537E-57 0.41983214<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0359] <h2 style=";text-align:left;direction:ltr"> ADAMTS9 l,3376E-70 2.639217715 0.843 0.378 2.09976E-66 1.489895077<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0360] <h2 style=";text-align:left;direction:ltr"> WNT5A 7.38245E-62 2.606849564 0.682 0.161 l,1589E-57 0.351819268<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0361] <h2 style=";text-align:left;direction:ltr"> DDR2 l,38038E-43 2.59938804 0.491 0.142 2.16691E-39 0.31481718<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0362] <h2 style=";text-align:left;direction:ltr"> MCOLN3 5.60946E-34 2.562539243 0.559 0.139 8.80573E-30 0.503431405<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0363] <h2 style=";text-align:left;direction:ltr"> H19 4.32442E-67 2.553662936 0.623 0.144 6.78848E-63 0.263206927<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0364] <h2 style=";text-align:left;direction:ltr"> COL6A1 3.4274E-127 2.529451537 0.985 0.679 5.3803E-123 2.862105997<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0365] <h2 style=";text-align:left;direction:ltr"> MYL7 4.81213E-37 2.512914 0.771 0.202 7.55409E-33 1.130013214<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0366] <h2 style=";text-align:left;direction:ltr">PITX1 l,60955E-57 2,510410232 0,726 0,191 2,52668E-53 0,481995888 H0XB-AS3 2,64108E-29 2,509978785 0,416 0,075 4,14597E-25 0,270010145 SAMD4A l,22592E-50 2,50904742 0,415 0,125 l,92444E-46 0,184184206 AFAP1L2 5,04063E-58 2,49293369 0,562 0,13 7,91278E-54 0,240421641 l,6946E-36 0.288474694 GPR155 5.69971E-45 2.450912096 0.346 0.087 8.94741E-41 0.147574611 BNC2 2.82414E-63 2.449358995 0.674 0.333 4.43334E-59 0.574775118 H0XB6 4.4812E-80 2.439038663 0.553 0.094 7.03459E-76 0.157132687 0.839 0.325 l,89044E-52 1.128596861 C0L1A2 6.68619E-93 2.407906465 0.916 0.637 l,0496E-88 2.087571055 MXRA5 l,10992E-35 2,40593622 0.424 0.121 1.74236E-31 0.24393688 PAG1 2.33754E-33 2.380314937 0.431 0.118 3.66948E-29 0.266624149 D0K4 5.11405E-94 RUNX1T1 2.3797357 0.823 0.314 8.02804E-90 0.405740375 SIPA1L2 2.70752E-66 2.360164112 5,<h2 style=";text-align:left;direction:ltr">7599E-60 2.346755931 0.686 0.308 9.04189E-56 0.472940601 AQP1 5.21832E-27 2.342312631 0.249 0.067 8.19171E-23 0.150506091 F0XF1 3.89676E-72 2.33646341 0.523 0.097 6.11713E-68 0.144981261 NRP1 2.48977E-53 2.320007507 0.751 0.23 3,90844E-49 0.490405036 ADAM 19 2.06713E-76 2.301808751 0.811 0.448 3.24498E-72 0.703911687 SLIT2 7.38587E-41 2.298264383 0.584 0.231 l.15943E-36 0.486068399 ZFPM2 5.90478E-39 2.296310457 0.286 0.067 9.26933E-35 0.120522626 RELN 9.51625E-33 2.295145096 0.554 0.195 l,49386E-28 0,542830113 TEK l,17697E-42 2,289316675 0,49 0,181 l,8476E-38 0,269896486 DRD2 5,90869E-23 2,263653933 0,302 0,076 9,27546E-19 0,190741378 RHOBTB3 7,46475E-56 2,263322678 0,865 0,341 1,17182E-51 1,055369354 MLLT3 2,78491E-43 2,253748805 0,66 0.286 4.37176E-39 0.643714048 SNAI2 6.15685E-55 2.241983363 0.748 0.211 9.66502E-51 0.381050307 FNIP2 3.12991E-41 2.220725523 0.639 0.248 4.91332E-37 0.475688376 ADAM 12 l,70049E-33 2,197720108 0.438 0.133 2.66943E-29 0.235622304 CPED1 l,4781E-34 2,196120545 0.321 0.081 2.32033E-30 0.138168733 IL6ST 4.48513E-61 2.18975949 0.899 0.418 7.04076E-57 1.195628402 CYP26A1 l.74369E-36 2.174348876 0.496 0.225 2.73724E-32 0.355674972 SOX6 9.61465E-31 2.152234021 0.444 0.165 l.50931E-26 0.290553499 FLNC 7.94557E-51 2.146084818 0.808 0.293 l.2473E-46 0.546583104 COL6A2 l.53624E-90 2.141445225 0.814 0.327 2.41159E-86 0.303586077 GATA6 2.27013E-36 2.129953448 0.762 0.21 3.56366E-32 0.623860369 AHNAK 4.80569E-55 2.128644042 0.968 0.468 7.54397E-51 2.890607086 ATP7B l.04309E-34 2.123887658 0.522 0.201 l.63744E-30 0.327569721 ANGPT2 1.47475E-16 2.119163555 0.299 0.089 2.31506E-12 0.203271783 HTRA1 7.80379E-32 2.111941079 0.544 0.195 l.22504E-27 0.358926305 PDGFRA 2.11606E-38 2.084850173 0.84 0.306 3.32179E-34 1.176176382 FENDRR l.33244E-23 2.081934463 0.24 0.039 2.09167E-19 0.10530039 CGNL1 l.7995E-63 2.06897596 0.871 0.543 2.82485E-59 1.345293982 CEP85L 2.57098E-29 2.052890384 0.519 0.214 4.03592E-25 0.381109632 HOXB3 3.22204E-33 2.050773258 0,496 0.127 5.05796E-29 0.207883748 MFAP4 9.00312E-32 2.049783303 0.314 0.085 l.41331E-27 0.117520396 ANXA1 l.01344E-19 2.044653955 0.519 0.166 l.5909E-15 0.435549772 RGS5 3.06996E-59 2.044566339 0.877 0.511 4.81922E-55 1.44931897 NID2 4.80683E-33 2.028949858 0.377 0.089 7.54576E-29 0.135333055 SMARCA2 8.75414E-30 2.025319198 0.466 0.165 l.37423E-25 0.25161745 CAB39L 7.5756E-25 2.015469707 0.318 0.106 l.18922E-20 0.167219437 KIFAP3 l.30678E-34 2.010667758 0.663 0.285 2.05138E-30 0.613172723 PLAT 7.73861E-20 2.009704746 0.355 0.153 1.21481E-15 0.3015844 ACKR3 l.3137E-28 2.005739448 0.522 0.157 2.06224E-24 0.309599475 HOPX 3.49074E-26 2.003611823 0.243 0.045 5.47977E-22 0.090630273 ARHGAP28 l.71689E-39 1.997036161 0.72 0.338 2.69517E-35 0.739993732 TGFBR3 l,18387E-30 1,990021907 0.512 0.204 l.85844E-26 0.364971632 LGR4 l.26253E-57 1.986933662 0.826 0.441 l.98192E-53 0.734314313 GLIPR2 6.7968E-32 1.984213309 0.732 0.299 l.06696E-27 0.921136013 CHILDREN l.06414E-55 1.981696087 0.978 0.569 l,<h2 style=";text-align:left;direction:ltr">67049E-51 3.634306791 PCDH17 2.32535E-26 1.979287426 0.644 0.239 3.65033E-22 0.72785464 KIF26B 9.05874E-27 1.965539544 0.49 0.146 l,42204E-22 0.263608594 PTCHI 6.09934E-45 1.965340536 0.842 0.361 9.57474E-41 0.82608087 MSX1 2.43109E-45 1.962996422 0.881 0.44 3.81632E-41 1.400394986 PDZRN3 l,67211E-34 1.956865113 0.465 0.161 2.62488E-30 0.195492083 NAV2 l,46177E-56 1.948110127 0.849 0.458 2.29468E-52 0.741418457 FOSL2 2.58516E-35 1.935164259 0.663 0.202 4.05819E-31 0.344140886 WBP1L 2,20191E-37 1.930271138 0.633 0.287 3.45657E-33 0.432192883 TBX3 4.88759E-32 1.923045487 0.806 0.259 7.67254E-28 0.901825288 MBNL2 9.85685E-27 1.909883857 0.493 0.154 l.54733E-22 0.250914438 WIPF1 2.16028E-31 1.904635113 0.579 0.241 3.39122E-27 0.413932728 GATA6-AS1 l,05071E-25 1.894719911 0.452 0.12 1.6494E-21 0.200372787 PLOD2 2.613E-33 1.893359889 0.567 0.273 4.10189E-29 0.347589857 ADAMTS6 8.42505E-24 1.89278592 0.346 0.079 1.32256E-19 0.129736538 PPIC 6.74492E-33 1.891646237 0.623 0.254 l,05882E-28 0,<h2 style=";text-align:left;direction:ltr">394740559 LIPG 1.44388E-17 1.883755269 0.333 0.155 2.2666E-13 0.246302227 EFEMP2 l,65772E-24 1.883301294 0.501 0.181 2.60229E-20 0.335598614 AMIG02 6.49351E-24 1.876333065 0.46 0.158 l,01935E-19 0.254367156 ADAMTS12 l,05993E-38 1.87432183 0.702 0.317 l,66388E-34 0,462803928 LEF1 8,31099E-39 1,86960641 0,752 0,311 l,30466E-34 0,573148886 SLC9A3R1 9,2821E-81 1,864852026 0,925 0,777 l,4571E-76 2,502020891 CREB3L1 3,61419E-43 1,8639046 0,606 0,28 5,67356E-39 0,265854474 CHD3 3,74911E-45 1,863821706 0,749 0.364 5.88535E-41 0.518013091 ITGA11 6.22788E-26 1.862467225 0.217 0.055 9.77653E-22 0.076406674 CCDC80 3.77165E-23 1.859350024 0.563 0.251 5.92074E-19 0.554982862 RGS2 2.30727E-32 1.829501506 0.674 0.383 3.62195E-28 0.74194692 EDIL3 l.97954E-32 1.823834366 0.55 0.311 3.10748E-28 0.374310941 LGR5 4.4631E-15 1.817887159 0.267 0.079 7.00618E-ll 0.133816482 KRT8 L,36563E-33 5.3757E-104 1.817818674 0.999 0.921 8.4388E-100 7.02604942 ATF3 8.69937E-38 1.81322286 0,618451009 RAB31 l,<h2 style=";text-align:left;direction:ltr">72674E-62 1.80830266 0.925 0.646 2.71064E-58 1.976286421 TSHZ1 5.10152E-23 1.808269737 0.446 0.124 8.00836E-19 0.198113931 ARID5B 3.81463E-17 1.805777984 0.412 0.137 5.9882E-13 0.276649052 TSHZ3 2.47621E-21 1.802795035 0.453 0.149 3,88715E-17 0.23681064 FLT1 l,41514E-37 1,796740039 0.619 0.463 2,22149E-33 0.601812655 MYOCD 3,17629E-16 1,792962981 0.211 0.051 4,98614E-12 0.093020008 SERPINB9 2,93098E-34 1,792644755 0.648 0.318 4,60106E-30 0.453592641 FGFR2 2,9005E-60 1,776808811 0.859 0.633 4.55321E-56 1.318322079 ERVH48-1 9.59718E-18 1.774894688 0.387 0.172 L,50657E-13 0.266665157 EPAS1 6.27388E-16 1.760525712 0.399 0.172 9.84873E-12 0.343945234 ANKS1A 2.40322E-35 1.756253312 0.704 0.43 3.77258E-31 0.879224041 OAF 3,44481E-21 1,752668958 0.538 0.187 5.40766E-17 0.347924394 FBN1 3.26044E-23 1.747086956 0.607 0.235 5.11823E-19 0.483965407 EGFLAM 2.70085E-15 1.743977949 0.352 0.119 4.2398E-11 0.225409623 SERINC5 2.09692E-43 1.741833882 0.77 0.457 3.29175E-39 0.611597678 ADAM33 l,<h2 style=";text-align:left;direction:ltr">86238E-26 1.734560829 0.37 0.128 2.92357E-22 0.136488378 LOX 2.53933E-21 1.730145118 0.223 0.062 3.98624E-17 0.083021196 LRFN5 4.93661E-20 1.728224719 0.226 0.038 7.74949E-16 0.073684132 NCAM1 6.27398E-25 1.72475916 0.674 0.299 9,8489E-21 0.671381888 BST2 3.08047E-51 1.714973018 0.704 0.512 4.83573E-47 0.52812685 GNG11 7.36569E-18 1.714166055 0.356 0.196 1.15627E-13 0.262741156 UNC5C 1.11126E-17 1.710724529 0.393 0.112 1.74446E-13 0.191652431 KCTD12 9.27189E-26 1.705820426 0.367 0.135 1.4555E-21 0.146280463 SPARC 2.83474E-83 1.70401494 0.999 0.877 4.44998E-79 5.369804239 BMPR2 3.53012E-30 1.702173554 0.676 0.359 5.54158E-26 0.583237479 PKP2 3.26763E-31 1.699207955 0.692 0.342 5.12953E-27 0.611409016 SH3RF2 5.02024E-18 1.696776328 0.334 0.088 7.88078E-14 0.148264295 FAM114A1 5.63164E-20 1.691423415 0.516 0.223 8.84054E-16 0.412666913 GATA3 4.28386E-17 ADAMTS2 2,30307E-18 1,<h2 style=";text-align:left;direction:ltr">687062552 0.279 0.082 3.61536E-14 0.110985793 SDC4 l,19384E-63 1.681269835 0.87 0.59 l,87409E-59 0.746933368 TPST1 l,87464E-26 1.680766976 0.61 0.286 2.94281E-22 0.441608732 TNNI1 3.74873E-18 1.676338684 0.232 0.06 5.88476E-14 0,094371893 ADAMTS1 4.00631E-22 1.675546275 0.55 0.221 6.2891E-18 0.366036282 PGF 4.31947E-16 1.673997339 0.372 0.109 6.7807E-12 0.183525218 FBN2 8.394E-36 1.668826845 0.87 0.506 1.31769E-31 1.419700866 PLXNA2 4.99008E-17 1.660450517 0.46 0.174 7.83344E-13 0.311653744 MAN1A1 1.6411E-17 1.652834246 0.331 0.097 2.57621E-13 0.13240562 MYRF 3.79061E-18 1.642278678 0.406 0.118 5.95049E-14 0.185405598 LIX1 8.04694E-19 1.63962686 0.572 0.257 1.26321E-14 0.569285598 EFNB3 6.46351E-20 1.638051709 0.487 0.259 l,01464E-15 0.403675654 VWA5A 1.31312E-19 1.635927533 0.463 0.26 2.06134E-15 0.388627772 FIBIN 3.03747E-13 1.632366044 0.22 0.047 4.76822E-09 0.103141594 HS3ST1 7.13748E-17 1.626825976 0.386 0.152 L,12044E-12 0.240029508 FGF19 8.31206E-23 1.625382742 0.416 0.221 l,<h2 style=";text-align:left;direction:ltr">30483E-18 0.23266083 DSC2 8.19749E-43 1.618259893 0.886 0.567 0.126 l,35108E-17 0.119357792 SLC39A4 7.82856E-12 1.607031714 0.305 0.088 l,22893E-07 0.181198245 EMP2 4.00235E-44 1,606607951 0.811 0.621 6.28289E-40 1.402133997 TRPV2 1.34195E-12 1.605603209 0.141 0.033 2.10659E-08 0.058731799 ELK3 6.53779E-21 1.600621194 0.421 0.196 l.0263E-16 0.209666714 VIM l.14235E-86 1.595649531 0.999 0.904 l.79327E-82 8.082275493 DAB2 6.24192E-24 1.592381571 0.779 0.38 9.79857E-20 1.239959842 ATF7IP2 6.47422E-21 1.589363588 0.532 0.311 l.01632E-16 0.438263474 MMP2 l.01766E-51 1.586788244 0.736 0.325 l.59752E-47 0.212099836 BAG3 1.38968E-21 1.579214019 0.43 0.165 2.18151E-17 0.189001305 TLE3 l,12019E-44 1,57863741 0,84 0,56 l,75848E-40 0,79337837 PLEKHA6 4,63431E-17 1,564854598 0,349 0,122 7,27493E-13 0,144318059 ZMIZ1 8,74035E-41 1,561844838 0,836 0,53 l,37206E-36 0,897369046 H0XB7 1,98595E-17 1,557192931 0,22 0,037 3,11755E-13 0,<h2 style=";text-align:left;direction:ltr">066718013 RPS19P3 5.16675E-33 1.556751319 0.339 0.162 8.11077E-29 0.090875373 MPZL1 7.12336E-53 1.554474986 0.896 0.708 1.546252967 0.342 0.122 l,89104E-10 0.190458934 ISL1 2.36331E-11 1.543599267 0.191 0.054 3.70992E-07 0.095312249 PTPRD 3.56711E-36 NEXN l,52992E-22 1,531732229 0.582 0.35 2.40166E-18 0.50767253 PCOLCE 5.42844E-24 1.531229912 0.478 0.233 8.52156E-20 0.19605214 ST6GALNAC3 2.7246E-23 1.530426607 0.597 0.359 4.27708E-19 0.53529511 ARHGAP42 2.01957E-17 1.526262835 0.396 0.21 3.17033E-13 0.244286082 MME 1.47567E-16 1.521852362 0.315 0.147 2.31651E-12 0.14246424 HOXB2 l.0827E-28 1.518800215 0.475 0.132 l.69962E-24 0.11677366 EHD2 5.97923E-37 1.51465551 0.425 0.161 9.38619E-33 0.093917876 CTSV 6.79964E-66 1.512411268 0.959 0.811 l.06741E-61 2,830270581 MYADM 3,52034E-56 1,510103824 0,889 0,639 5,52623E-52 0,701993451 NDRG2 l,50959E-17 1,498635614 0,353 0,142 2,36976E-13 0,162200582 PITX2 7,39745E-18 1,496970315 0,691 0,244 1,16125E-13 0,662860763 GALNT10 1,69966E-19 1,494820818 0,572 0,291 2,66812E-15 0,512743492 KCNMA1 l,16011E-14 1,494045337 0,261 0,115 l,82114E-10 0,123028121 CDK6 3,03216E-26 1,490370288 0,767 0,427 4,75988E-22 0,85284523 JUN 7,01564E-19 1,489000283 0,54 0,277 l,10131E-14 0,425610938 PARVA l,17428E-24 1,48119544 0,666 0,379 l,84338E-20 0,61035206 ARHGAP6 4,1479E-15 1,477561673 0,242 0,058 6,51138E-11 0,082618609 NTS 5,01146E-10 1,47536556 0,29 0,175 7,86699E-06 0,251631803 PAQR8 l,00065E-14 1,471153711 0,444 0,23 l,57083E-10 0,366058841 MESP1 6,42724E-11 1,463055411 0,154 0,02 l,00895E-06 0,045603203 TRIOBP l,75088E-39 1,460202977 0,858 0,616 2,74853E-35 1,11961201 SH3PXD2A 2,03873E-18 1,459981515 0,444 0,191 3,2004E-14 0,209033211 P4HA2 1,57625E-14 1,457907334 0,299 0,114 2,47439E-10 0,132253535 MEIS1 2,<h2 style=";text-align:left;direction:ltr">15964E-15 1.447176863 0.506 0.166 3.39021E-ll 0.257570914 SERINC3 2.07057E-35 1.447133223 0.845 0.586 3.25038E-31 1.190163613 BCO2 1.96151E-15 1.445972218 0.172 0.049 3.07918E-ll 0.056142548 TCEAL9 2.39184E-63 1.445335957 0.924 0.744 3.75471E-59 1.107021132 HOXAIO 9.45368E-16 1.441935166 0.194 0.035 l.48404E-ll 0.048306725 DSP 2.20394E-38 1.438953828 0.943 0.708 3.45974E-34 3.192100043 DACT3 2.9556E-18 1.438380576 0.331 0.093 4.6397E-14 0.098558081 PKN2 3.97871E-40 1.434391526 0.859 0.619 6.24578E-36 1.076253735 TERF2IP 2.73851E-18 1.434342971 0.512 0.303 4.29891E-14 0.425439116 MXRA7 1.15747E-18 1.432213825 0.496 0.273 1.817E-14 0.316384095 COL13A1 l.26705E-19 1.429367661 0.362 0.12 l.98901E-15 0.115123139 KRT19 l.00405E-34 1,426812048 0.994 0.782 l,57616E-30 9,349799768 TAN Cl 2,98912E-14 1,426775392 0,393 0,195 4,69232E-10 0,250204534 SLA 7,83059E-09 1,426372751 0,132 0,035 0,000122925 0,071571559 CDX2 4,86349E-11 1,423587134 0,374 0,148 7,63471E-07 0,251570552 FRMD4B l,53062E-14 1,<h2 style=";text-align:left;direction:ltr">414743022 0.383 0.172 2.40277E-10 0.214903628 LBH 5.14587E-19 1.413837742 0.598 0.324 8.07798E-15 0.449335784 PTGFRN 5.76449E-16 1.411010534 0.37 0.208 9.04909E-12 0.206665073 PFKP l.01683E-32 1.408216413 0.795 0.586 l.59622E-28 1.083493906 GADD45G l,81905E-13 1.403149787 0.32 0.148 2.85555E-09 0.165966913 ANGPTL2 1.73599E-13 1.390504173 0.421 0.192 2.72515E-09 0.269759319 ST3GAL6 l,06394E-19 1.389470434 0.676 0.337 l,67018E-15 0.504050124 IRS1 9.18492E-20 1.389262736 0.532 0.316 1,44185E-15 0.34475573 STK17B 3.35096E-14 1.387292872 0.276 0.098 5.26034E-10 0.096920499 GATA2 2.36806E-10 1.386605231 0.21 0.049 3.71739E-06 0.083995422 SLC12A2 9.38069E-21 1.385950446 0.645 0.39 1.47258E-16 0.576523215 NEK5 3.55307E-ll 1.380868604 0.182 0.056 5.57761E-07 0.081674712 SMAD7 6.58148E-18 1.376168363 0.43 0.174 0.563 0.413 2.30235E-14 0.668359602 TUBB6 l,20484E-30 1.372789444 0.758 0.573 l,89135E-26 0.820299844 MAML3 6.38641E-11 1,370570681 0,<h2 style=";text-align:left;direction:ltr">289 0.121 l,00254E-06 0.153597224 HTR1E l,06761E-ll 1.365114068 0.17 0.049 l,67593E-07 0.070092866 L0XL2 l,01402E-22 KDM6B l,44312E-25 FURIN 5.27703E-21 1.355922426 0.488 0.223 8.28387E-17 0.188090973 L0XL1 2.98206E-17 1.353596522 0.474 0.264 4.68123E-13 0,273551904 ATP2B4 2.4326E-19 1.351176414 0.694 0.392 3.81869E-15 0.756542589 PXK 4.36741E-12 1.350047625 0.397 0.195 6.85597E-08 0.319595033 CEBPD 6.93248E-18 1.34735071 0.284 0.114 l.08826E-13 0.088860055 PAPSS1 9.53078E-39 1.340012143 0.796 0.657 l,49614E-34 0.905448865 TLN2 1.88289E-21 1.339382819 0.73 0.45 2.95576E-17 1.018834709 FLU 2.20699E-ll 1.336787473 0.144 0.032 3.46454E-07 0.037169858 TRPM7 2.92876E-18 1.333309768 0.639 0.388 4.59757E-14 0.650449276 PRNP 2.21771E-21 1.330396088 0.645 0.425 3,<h2 style=";text-align:left;direction:ltr">48136E-17 0.585980579 CHSY1 3.44957E-25 1.326246496 0.672 0.476 5.41514E-21 0.566827725 PRKCE 1.85931E-13 1.324911462 0.276 0.086 2.91875E-09 0.099642846 DSG2 l,61264E-44 1.312989557 0.95 0.796 2.53153E-40 2.465542369 ZADH2 7.30727E-13 1,312297347 0.375 0.174 l,1471E-08 0.211102937 CCDC34 l,08956E-30 1.312285016 0.783 0.594 l,7104E-26 0.871479222 FLRT2 l,08663E-14 RREB1 9.08797E-20 1.296288376 0.597 0.356 1.42663E-15 0.377291439 COL4A1 l,74335E-23 1.295673554 0.903 0.562 2.73671E-19 1.703912578 APOBEC3C 8.48578E-16 1.294993117 0.488 0.303 1.3321E-11 0.362479511 TENM4 9.36899E-15 1.292994045 0.591 0.299 l,47074E-10 0.57923802 TFPI 7.91311E-17 1.288361053 0.711 0.387 1.2422E-12 0.914619768 EPHA7 2.53955E-20 1.287010676 0.815 0.42 3.98658E-16 1.11805562 FOS l,09035E-29 1,285983187 0.924 0.699 l,71163E-25 2.539654413 ECE1 l,27289E-24 1.284835029 0.74 0.423 l,99818E-20 0,496655338 MYLK3 2,06679E-09 1,283531259 0,161 0,043 3,24444E-05 0,059849526 TM0D1 2,14519E-07 1,281223012 0,11 0,013 0,003367526 0,031471535 APOBEC3G l,23316E-08 1,280850358 0,133 0,022 0,000193581 0,040954979 EFNA1 4,19999E-07 1,280317516 0,245 0,146 0,006593152 0,322540007 SRC 4,14892E-33 1,278029552 0,491 0,187 6,51297E-29 0,097154648 ST3GAL5 1,18112E-11 1,274165816 0,289 0,123 l,85412E-07 0,139542402 MYLIP 7,3426E-19 1,273060486 0,562 0,411 1,15264E-14 0,562702941 EPB41L5 2,158E-21 1,271667068 0,642 0,427 3,38763E-17 0,678471058 SMAD3 9,69564E-18 1,271538523 0,532 0,341 l,52202E-13 0,345652707 TEAD1 6,01407E-28 1,270675357 0,874 0,599 9,44088E-24 1,298861558 SETD7 6,61151E-13 1,266222842 0,287 0,118 l,03788E-08 0,104458041 SMAD6 3,1376E-15 1,261809769 0,443 0,189 4,9254E-11 0,190796473 CHIC2 9,61313E-15 1,261607894 0,302 0,162 l,50907E-10 0,120591291 RPS7P10 5,77142E-33 1,259745089 0,389 0,252 9,05998E-29 0,08672318 PHLDB2 6,85453E-23 1,259261849 0,755 0,54 l,07602E-18 0,916004477 SVIL 7,52837E-15 1,258500081 0,51 0,36 l,1818E-10 0,4623384 FNDC3B 1,11134E-19 1,256930895 0,749 0,418 1,74458E-15 0,728528471 ZCCHC24 l,69765E-20 1,256522466 0,472 0,217 2,66498E-16 0,149094358 RPL10P16 3,41773E-58 1,255482219 0,685 0,453 5,36515E-54 0,126959002 HGSNAT 5,23463E-12 1,255287307 0,485 0,226 8,21733E-08 0,316148079 ASH2L 6,66258E-19 1,253528778 0,67 0,456 l,04589E-14 0,749818485 PVR l,29092E-ll 1,244379147 0,384 0,191 2,02649E-07 0,219811295 GATA5 1,31928E-11 1,243185339 0,545 0,212 2,07101E-07 0,446013956 TIMP1 l,953E-26 1,242636509 0,845 0,709 3,06582E-22 2,432518778 IGSF3 7,20089E-15 1,242444908 0,548 0,32 l,13039E-10 0,444339998 BMP1 9,09543E-13 1,240063387 0,402 0,156 l,4278E-08 0,155192268 GPRC5C l,44839E-10 1,238384182 0,513 0,242 2,27368E-06 0,44618499 SNCAIP l,29196E-08 1,226680256 0,154 0,085 0,000202812 0,077630837 ZC2HC1A 9,29417E-15 1,218257414 0,591 0,347 l,459E-10 0,48701902 COL4A2 3,94215E-23 1,215679792 0,845 0,583 6,18838E-19 1,133378578 KDM7A 3,80668E-12 1,210274011 0,538 0,265 5,97572E-08 0,427926493 ZNF516 2,86852E-35 1,202266682 0,883 0,546 4,50301E-31 0,454778031 TPM1 l,8927E-55 1,200680004 0,952 0,917 2,97115E-51 2,652374399 PARP14 7,52459E-11 1,193402468 0,372 0,207 l,18121E-06 0,261946523 ITGAV 3,63098E-19 1,192955993 0,755 0,54 5,69992E-15 1,00548803 CHN1 2,64158E-16 1,19284677 0,562 0,458 4,14675E-12 0,576127718 PKN0X1 2,01306E-15 1,191689085 0,478 0,362 3,1601E-ll 0,423834654 ST7 2,36882E-10 1,186561072 0,377 0,209 3,71857E-06 0,245772162 LYN 2,59662E-15 1,184929552 0,456 0,287 4,07617E-ll 0,253923469 AEBP1 6,63198E-16 1,180846895 0,501 0,345 l,04109E-ll 0,30269781 ATP2B1 l,69919E-35 1,176525108 0,978 0,803 2,66739E-31 4,262069965 ANXA6 4,45027E-21 1,174477044 0,76 0,415 6,98603E-17 0,473199486 SEMA5A 9,34986E-11 1,171443211 0,471 0,258 l,46774E-06 0,397981627 FBLN1 l,66161E-66 1,171370782 0,997 0,974 2,60839E-62 5,767418099 DCAF6 2,96159E-12 1,169959741 0,453 0,281 4,64911E-08 0,337533254 FZD8 2,17198E-11 1,169762332 0,292 0,125 3,40958E-07 0,121666326 KIAA1217 4,04608E-12 1,169598869 0,425 0,347 6,35154E-08 0,512216679 DACT1 8,04207E-13 1,16397839 0,437 0,225 l,26244E-08 0,254773733 PPFIBP1 5,75595E-14 1,161525648 0,575 0,38 9,0357E-10 0,48827743 AKAP12 l,79304E-35 1,161166671 0,933 0,83 2,81472E-31 2,909902875 LPGAT1 l,90562E-ll 1,160068012 0,49 0,271 2,99144E-07 0,34610082 CA2 4,09762E-09 1,157012294 0,336 0,252 6,43245E-05 0,254434661 FOSB 2,8256E-15 1,147777936 0,792 0,505 4,43563E-11 1,600144192 RBMS3 3,56049E-10 1,144794533 0,34 0,157 5,58926E-06 0,168098503 CTSL 7,44001E-18 1,144728916 0,67 0,426 1,16793E-13 0,573162648 TCF4 4,45136E-45 1,143846924 0,969 0,856 6,98775E-41 2,328548336 CAP2 8,36742E-13 1,142368605 0,557 0,333 l,31352E-08 0,491378868 GNG2 9,37196E-19 1,14216593 0,544 0,309 1,47121E-14 0,225480978 TMEM51 5,86427E-09 1,142087426 0,355 0,224 9,20573E-05 0,290499446 CBLB 2,47285E-12 1,136206615 0,501 0,361 3,88188E-08 0,461949096 JAK1 3,70284E-ll 1,<h2 style=";text-align:left;direction:ltr">134080738 0.49 0.335 5.81272E-07 0.471686871 MAGI3 3.46256E-11 1.131747075 0.452 0.281 5.43553E-07 0.351076285 VEGFB 7.93637E-12 1.130459076 0.44 0.285 l.24585E-07 0.294171393 TNFAIP8 2.6594E-11 1.125571385 0.326 0.211 4.17473E-07 0.165910555 SLC7A2 6.75778E-10 1.123165078 0.318 0.195 l.06084E-05 0.201117239 ALDH2 8.92863E-21 1.122837967 0.83 0.578 l.40162E-16 1.127165396 CMTM6 4.75143E-24 1.120633149 0.644 0.533 7.4588E-20 0.367436496 MXRA8 2.23442E-11 1.120161909 0.375 0.173 3.5076E-07 0.159374007 LYPD6 8.72077E-08 1.119451614 0.271 0.137 0.001368987 0.163590793 MAST4 2.28028E-08 1.118682295 0.282 0.169 0.000357959 0.190914287 MXD4 3.52218E-16 1.116670458 0.68 0.471 5.52912E-12 0.833177504 BAIAP2L1 1.24594E-18 1.114997499 0.651 0.534 1,95588E-14 0.692167038 SPIN4 3.83637E-21 1.113650058 0.32 0.139 6.02234E-17 0.067006756 LDB2 l.30036E-14 1.113320384 0.534 0.382 2.0413E-10 0.419422202 KCP 3.43768E-09 1.112139554 0.205 0.078 5.39648E-05 0.078613203 MDK 1.2935E-142 1.111478983 1 1 2,0305E-138 9,615669833 TSPAN5 6,72814E-15 1,107695265 0,689 0,454 l,05618E-10 0,943538151 LIFR 2,11061E-09 1,106600477 0,726 0,304 3,31323E-05 1,009789341 SLC4A8 5,22912E-11 1,104460364 0,433 0,29 8,20867E-07 0,406793102 ITGB1 5,74348E-33 1,10304317 0,903 0,783 9,01611E-29 1,327144214 EPHB2 l,72096E-15 1,099060866 0,562 0,345 2,70156E-ll 0,305458778 TNP01 2,05419E-33 1,097053298 0,886 0,758 3,22467E-29 1,185210418 ZBTB8A 2,05298E-12 1,096326192 0,409 0,275 3,22277E-08 0,238307347 WWTR1 l,32425E-10 1,096054907 0,453 0,236 2,07882E-06 0,246617247 RPL18P13 2,87475E-12 1,094420385 0,177 0,066 4,51278E-08 0,047312928 HUNK 8,41495E-09 1,086172735 0,372 0,211 0,000132098 0,267903637 PHACTR2 l,48646E-26 1,081220576 0,849 0,741 2,33344E-22 1,654278224 PLEKHG3 2,06408E-09 1,080503626 0,418 0,264 3,24019E-05 0,303482349 S1PR3 l,09662E-07 1,080397235 0,353 0,175 0,001721466 0,249966146 SLIT3 6,36505E-10 1,07872292 0,267 0,099 9,99185E-06 0,099900146 PPP2R3A 7,73331E-13 1,075716518 0,566 0,384 l,<h2 style=";text-align:left;direction:ltr">21398E-08 0.56438922 CITED2 1.81727E-17 1.073577495 0.559 0.307 2.85275E-13 0.205383533 LAMCl l,08416E-22 1.068383423 0.861 0.678 l,70192E-18 1.524067657 MAP4 2.20008E-25 1.064053247 0.864 0.732 3.45369E-21 1.420178916 ARID3A 2.51263E-36 1.063048477 0.943 0.761 3.94432E-32 1.305688918 ABTB2 4.66959E-14 1.062625233 0.224 0.073 7.33033E-10 0.052098351 LHFPL2 2.96195E-37 1.062303957 0.96 0.835 4.64966E-33 2.102958361 SC5D 3.76269E-20 1.060710369 0.716 0.607 5.90667E-16 0.799979392 CAPN2 2.80636E-15 IDS 1.059252563 3.48674E-13 1.051996437 0.421 0.313 5.47348E-09 0.208890603 CDC42EP3 2.07178E-13 1.051586139 0.491 0.427 3.25228E-09 0,464807617 SGPP1 3.06064E-10 1.045427468 0.33 0.164 4.80459E-06 0.125735127 MALT1 4.58062E-10 1.0441236 0.491 0.327 7.19066E-06 0.418859701 PKIA 7.90795E-12 1.04364575 0.424 0.334 L,24139E-07 0.296503451 NTM 2.4442E-09 1.042366851 0.321 0.238 3,8369E-05 0,<h2 style=";text-align:left;direction:ltr">235305413 B2M 6,44486E-27 1,041294477 0,883 0,753 L,01171E-22 1,547014877 TRIM8 4,34831E-14 1,041253919 0,431 0,29 6.82598E-10 0.18392329 SLC2A13 l,69671E-07 1.039892362 0.287 0.161 0.002663491 0.164483075,<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0367] <h2 style=";text-align:left;direction:ltr"> ITGA5 6.10708E-13 1.038730379 0.6 0.38 9.58689E-09 0.454753247<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0368] <h2 style=";text-align:left;direction:ltr"> LEPROT 6,58127E-14 1,037396868 0,626 0,441 l,03313E-09 0,599405202<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0369] <h2 style=";text-align:left;direction:ltr"> NIDI 5.42733E-13 1.036135906 0.584 0.423 8.51982E-09 0.43948757<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0370] <h2 style=";text-align:left;direction:ltr"> ACBD3 6,79134E-16 1,035331106 0,623 0,478 l,0661E-ll 0,536892013<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0371] <h2 style=";text-align:left;direction:ltr"> LGALS1 6.65316E-09 1.032583141 0.513 0.355 0.000104441 0.485326042<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0372] <h2 style=";text-align:left;direction:ltr"> PRTG 3,2283E-22 1,031570463 1 0,697 5,06778E-18 14,36123362<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0373] <h2 style=";text-align:left;direction:ltr"> DGKH l,24604E-07 1.030347374 0.362 0.231 0.001956032 0.315344392<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0374] <h2 style=";text-align:left;direction:ltr"> AXL 4.57456E-11 1.029395061 0.452 0.309 7.18114E-07 0.32355782<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0375] SH3BP4 l,00008E-09 1,027946062 0,412 0,288 l,56993E-05 0,319861205
[0376] MMP15 2.23079E-09 1.027617602 0.422 0.283 3.50189E-05 0.287405654
[0377] TRPS1 l,53969E-06 1.019867033 0.224 0.106 0.024170094 0.108821643
[0378] TMEM98 l.24504E-28 1.017913543 0.916 0.779 l.95447E-24 2.17380568
[0379] PALLD 7.0347E-14 1.01591375 0.689 0.453 l.10431E-09 0.77796513
[0380] CACNA2D1 7.32995E-08 1.015174322 0.264 0.165 0.001150655 0.131118482
[0381] MIDI 2.71626E-16 1.013354786 0.718 0.537 4.26398E-12 0.918310337
[0382] RBP1 9.71377E-13 1.013036523 0.622 0.471 l.52487E-08 0.763575935
[0383] COL27A1 5.15098E-14 1.012508305 0.635 0.416 8.08601E-10 0.543005283
[0384] KLF5 l.33562E-06 1.012215234 0.26 0.105 0.02096649 0.134667819
[0385] SCMH1 4.48858E-08 1.011412555 0.276 0.161 0.000704617 0.153907673
[0386] ARHGEF12 2,7885E-11 1,010778484 0,581 0,381 4,37739E-07 0,481356194
[0387] MYH10 4,59703E-55 1,010208837 0,985 0,962 7,21641E-51 3,466510881
[0388] MAP4K5 2,53989E-17 1,010057562 0,74 0,56 3,98712E-13 0,794719966
[0389] FNDC3A 2,17575E-11 1,008077571 0,603 0,445 3,4155E-07 0,659357443
[0390] GPC6 2,26595E-09 1,00693171 0,496 0,265 3,55709E-05 0,355078917
[0391] FREM2 9,8514E-11 1,006094463 0,452 0,366 l,54647E-06 0,498089528
[0392] SUCO l,14742E-20 1,004222235 0,836 0,668 l,80122E-16 1,327970134 pct.l Fraction of mesoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes
[0393] Gene Name P value Iog2-fold pct.l pct.2 Adjusted P Average change value expression
[0394] PAX6 5,7543E-132 4,607547238 0,677 0,043 9,0331E-128 0,530598949
[0395] MAP2 8,35646E-84 3,865231406 0,818 0,127 l,3118E-79 0,60335747
[0396] PAX3 8,96809E-64 3,696168507 0,67 0,062 l,40781E-59 0,415988489
[0397] CRABP1 9,7555E-163 3,678356298 0,946 0,411 1,5314E-158 0,82769064
[0398] LHX5-AS1 7,72113E-72 3,675930468 0,508 0,025 l,21206E-67 0,241920089
[0399] ZFHX4 5,76188E-59 3,596966521 0,781 0,184 9,045E-55 0,875481717
[0400] DLK1 4,28071E-57 3,578868085 0,707 0,154 6,71987E-53 0,667215211
[0401] CDH6 2,04471E-60 3,571263152 0,885 0,206 3,20978E-56 1,112776619
[0402] ILDR2 6,59423E-54 3,551316154 0,449 0,034 l,03516E-49 0,245852427
[0403] NR2F1 2,8939E-79 3,528945627 0,649 0,079 4,54284E-75 0,302755605
[0404] SIX3 3,78877E-53 3,469693603 0,39 0,017 5,94761E-49 0,174496295
[0405] EDNRA l,70819E-44 3,398188533 0,495 0,105 2,68152E-40 0,348280993
[0406] <h2 style=";text-align:left;direction:ltr">EFNA5 l,33654E-74 3,37577454 0,79 0,249 2,0981E-70 0,663327506<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0407] <h2 style=";text-align:left;direction:ltr"> FST l,86929E-82 3.348722778 0.991 0.519 2.93441E-78 4.389127097<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0408] <h2 style=";text-align:left;direction:ltr"> TPBG 7,59807E-72 3,217748886 0,779 0,329 l,19274E-67 0,875662219<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0409] <h2 style=";text-align:left;direction:ltr"> GFRA1 6.75438E-54 3.194101325 0.484 0.075 l,0603E-49 0.229963727<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0410] <h2 style=";text-align:left;direction:ltr"> ATP1A2 8,43674E-54 3,16530538 0,672 0,16 l,3244E-49 0,428469889<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0411] <h2 style=";text-align:left;direction:ltr"> PCDH8 l,03073E-45 3.100206336 0.521 0.057 l,61805E-41 0.21892764<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0412] <h2 style=";text-align:left;direction:ltr"> OTX2 9,38714E-50 3,06719557 0,798 0,281 l,47359E-45 1,04941845<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0413] <h2 style=";text-align:left;direction:ltr"> LGI1 8,28696E-30 3,034941656 0,377 0,041 L,30089E-25 0,204046594<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0414] <h2 style=";text-align:left;direction:ltr"> PTN 2.80726E-83 2.956666477 0.948 0.532 4.40684E-79 1.837755718<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0415] <h2 style=";text-align:left;direction:ltr"> LHX5 5.92433E-37 2.918731212 0.356 0.013 9.30002E-33 0.115320232<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0416] <h2 style=";text-align:left;direction:ltr"> MIAT l,19278E-42 2,845034404 0,651 0,229 l,87243E-38 0,53852554<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0417] <h2 style=";text-align:left;direction:ltr">PLCHI l,97204E-31 2.823959018 0.516 0.14 3.0957E-27 0.370902967<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0418] <h2 style=";text-align:left;direction:ltr"> NAV3 2.77688E-27 2.783369379 0.284 0.045 4.35915E-23 0.148734201<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0419] <h2 style=";text-align:left;direction:ltr"> COL2A1 2.03852E-31 2.778490167 0.755 0.188 3.20007E-27 0.803103104<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0420] <h2 style=";text-align:left;direction:ltr"> SP5 l,54122E-37 2,775261607 0,573 0,115 2,4194E-33 0,268886773<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0421] <h2 style=";text-align:left;direction:ltr"> SKIDA1 9,5738E-35 2,764205108 0,555 0,107 l,50289E-30 0,261414256<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0422] <h2 style=";text-align:left;direction:ltr"> SOX2 5,34274E-67 2,702462125 0,907 0,378 8,38704E-63 0,800349122<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0423] <h2 style=";text-align:left;direction:ltr"> RFX4 3.47137E-24 2.692322151 0.297 0.026 5.44935E-20 0.128008027<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0424] <h2 style=";text-align:left;direction:ltr"> DRAXIN l,43817E-34 2.683615565 0.599 0.167 2.25763E-30 0.348604492<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0425] <h2 style=";text-align:left;direction:ltr"> EPHB1 l,63924E-27 2,665503882 0,38 0,078 2,57328E-23 0,18575004<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0426] <h2 style=";text-align:left;direction:ltr"> ZIC2 2.78342E-70 2.641215348 0.855 0.467 4.36941E-66 0.958531672<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0427] <h2 style=";text-align:left;direction:ltr"> PTPRZ1 9.60427E-68 2.640073329 0.876 0.466 l,50768E-63 1.037943371<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0428] SRGAP3 l,71176E-28 2,627161651 0,456 0,113 2,68712E-24 0,244394499
[0429] DPYSL5 2,55923E-38 2,624883056 0,527 0,104 4,01748E-34 0,207328623
[0430] FILIP1 7,43756E-19 2,619952011 0,33 0,06 1,16755E-14 0,196105725
[0431] TFAP2A 3,4979E-29 2,611489501 0,603 0,133 5,491E-25 0,286912363
[0432] GREB1L 2,84194E-44 2,603167695 0,909 0,383 4,46127E-40 1,246766296
[0433] NCALD 4,00151E-22 2,591577784 0,334 0,056 6,28157E-18 0,163555677
[0434] PLP1 3,33544E-41 2,534517052 0,711 0,347 5,23597E-37 0,680485457
[0435] RNF165 2,51144E-31 2,530729456 0,434 0,11 3,94245E-27 0,180986045
[0436] SYT11 6,75778E-29 2,510837188 0,486 0,163 l,06084E-24 0,285706206
[0437] SOX9 4,61774E-26 2,504073655 0,373 0,15 7,24893E-22 0,231216249
[0438] MYLK 2,43593E-27 2,485734168 0,456 0,191 3,82393E-23 0,348884283
[0439] <h2 style=";text-align:left;direction:ltr">FZD3 7,6335E-74 2,48161221 0,963 0,598 l,19831E-69 1,592586778<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0440] <h2 style=";text-align:left;direction:ltr"> SOX5 6,03217E-20 2,472321473 0,438 0,127 9,4693E-16 0,287460745<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0441] <h2 style=";text-align:left;direction:ltr">HS6ST2 2.95015E-23 2.45783979 0.525 0.147 4.63115E-19 0.311224402 0LFM3 l,30925E-20 2.443760348 0.256 0.026 2.05527E-16 0.093173209 TRIL 1.49867E-17 2.394728872 0.328 0.068 2.35261E-13 0.160649855 NLRP1 l,2558E-28 2.39387912 0.49 0.144 l,97136E-24 0.217152744 CASZ1 l,73133E-24 2,382856616 0.338 0.033 2,71785E-20 0.111501727 SDK2 5,39526E-35 2,375017607 0.597 0.176 8,46947E-31 0,233754391 MYEF2 6,39992E-46 2,367315383 0.666 0.285 l,00466E-41 0,326581453 MN1 l,23916E-32 2,340781746 0.466 0.116 l,94524E-28 0,150596428 MAPK10 3,89033E-17 2,337739159 0,466 0,091 6,10704E-13 0,250912881 NRXN3 2,5796E-18 2,336062557 0,397 0,103 4,04946E-14 0,211610868 SLC35F1 8,82747E-24 2,333360986 0,393 0,119 1,38574E-19 0,185334728 NR2F2 6,11377E-23 2,307298322 0.525 0.179 9.5974E-19 0.317719363 SOX11 5.06676E-70 2.306725342 0.978 0.653 7.9538E-66 1.617563975 ENCI 3.03901E-23 2.27384721 0.692 0.276 4.77064E-19 0.759091139 RMST 2.31924E-29 2.264322023 0.328 0.103 3.64075E-25 0.129614642 ZNF521 3.99396E-23 2,<h2 style=";text-align:left;direction:ltr">263402258 0.612 0.21 6.26971E-19 0.419631572 ARL4C 6.09244E-40 2.252815593 0.905 0.486 9.56392E-36 1.48364191 LPAR4 12962E-39 0.85851951 IRX2 4.41041E-35 2.20328805 0.731 0.343 6.92346E-31 0.48768736 CXCR4 1.3298E-14 2.187497727 0.338 0.065 2.08753E-10 0.156857818 PMEL l,59805E-26 2.182747895 0.772 0.316 2.50861E-22 0.943668931 NRCAM 1.22427E-16 2.166343146 0.479 0.149 1.92186E-12 0.340879465 TLE4 4.83533E-46 2.164533701 0.826 0.521 7.5905E-42 0.942902581 CDH4 5.5416E-24 2.160264306 0.354 0.113 8.6992E-20 0.141852917 CELSR2 4.39826E-27 2.12986608 0.514 0.121 6.90439E-23 0.164368515 WSCD1 l.75492E-20 2.129685114 0.341 0.133 2.75487E-16 0.180714974 NR2F1-AS1 3.23893E-13 2.107106153 0.204 0.024 5.08447E-09 0.080584589 CPE l,70284E-21 2.105658884 0.651 0.287 2.67312E-17 0.575859148 POU3F2 1.21373E-14 2.105340831 0.325 0.048 l,90531E-10 0.119976565 GLI3 l,97755E-36 2.10531365 0.813 0.431 3,<h2 style=";text-align:left;direction:ltr">10435E-32 0.685898999 GRAMD1B l,04094E-21 2,09262193 0.325 0.137 l,63407E-17 0.163988882 SYNE2 7,27875E-62 2,09067868 0.965 0.739 l,14262E-57 2,324076667 CDON l,55022E-17 2,086615094 0.523 0.178 2,43354E-13 0,342977832 SLC7A11 6,9299E-35 2,084845643 0.792 0.499 l,08786E-30 1,024996872 FIGN 3,97777E-26 2,084489169 0.803 0.402 6,24431E-22 1,042025781 TMEM132C 3,41956E-14 2,077417536 0.354 0.074 5,36802E-10 0,149961601 LFNG 5,34948E-28 2,074891869 0.547 0.16 8,39762E-24 0,196127415 STOX2 7,13846E-25 2,058106965 0,505 0,254 l,12059E-20 0,31043501 COL9A1 6,24493E-19 2,044849674 0,356 0,085 9,80328E-15 0,122105713 PAX7 l,75037E-14 2,020281087 0,23 0,013 2,74772E-10 0,05576621 PPP1R9A 2,01538E-21 2,018776162 0,542 0,27 3,16375E-17 0,457864232 PEG3 L,33668E-05 0.12054399 SHROOM3 2.72308E-19 1.987126002 0.447 0.21 4.27469E-15 0.264136671 EMX2 9.65216E-18 1.980803085 0.273 0.014 1,5152E-13 0,054169303 IGFBP5 1,36855E-15 1,976068365 0,534 0,187 2,14834E-11 0,366340827 SACS 4,15268E-30 1,972534684 0,757 0,439 6,51887E-26 0,773621256 TOX3 1,21753E-11 1,970911199 0,36 0,129 l,91128E-07 0,223190002 TTYH1 5,2154E-25 1,965469892 0,445 0,099 8,18713E-21 0,123692196 BOC 4,19675E-15 1,949013422 0,351 0,086 6,58806E-ll 0,137259997 EFR3B 2,47725E-14 1,944951711 0,397 0,133 3,88879E-10 0,226915625 FAT3 5,15332E-18 1,922192569 0,471 0,249 8,08968E-14 0,347340536 LSAMP l,09186E-13 1,919521674 0,43 0,154 l,714E-09 0,263353606 0LIG3 7,51897E-11 1,918877431 0,193 0,015 l,18033E-06 0,05573433 YPEL1 4,91375E-12 1,912173874 0,271 0,085 7,7136E-08 0,135710251 N0VA1 l,37101E-24 1,907849252 0,462 0,224 2,15221E-20 0,222992655 JAG1 4,09897E-19 1,885401144 0,573 0,266 6,43456E-15 0,421622017 FHL1 l,91089E-19 1,87424856 0,477 0,246 2,99971E-15 0,278129277 PRRT2 2,29814E-23 1,857295429 0,401 0,118 3,60762E-19 0,118190837 ANK2 8,51361E-17 1,855434203 0,568 0,271 1,33647E-12 0,45565997 FAT1 9,<h2 style=";text-align:left;direction:ltr">54402E-34 1.847112853 0.831 0.584 L,49822E-29 1.172651908 CCDC160 6.176E-13 1.839545726 0.384 0.145 9.69508E-09 0.236473385 SCUBE1 6.22124E-13 1.814606807 0.217 0.052 9.76611E-09 0.080477786 C21orf58 6.84527E-22 1.813615268 0.64 0.338 l,07457E-17 0.548352165 CRABP2 l,22759E-66 1.807370143 0.965 0.794 l,92707E-62 1.408265586 NBEA l,3601E-15 1.801259854 0.462 0.261 2.13509E-ll 0.375357553 CACHD1 7.72384E-22 1.800744547 0.633 0.365 1.21249E-17 0.495822991 E2F7 5.15499E-15 1.780291997 0.456 0.232 8.09231E-ll 0.338683402 SPHK1 1.17294E-13 1.762798801 0.252 0.065 l.84129E-09 0.087320871 VAT1L 7.89096E-15 1.762021016 0.555 0.258 l.23872E-10 0.347138453 KIF5C 3.75886E-31 1.760586131 0.783 0.518 5.90066E-27 0.872362904 NIN 1.4574E-16 1.749981198 0.629 0.318 2.28783E-12 0.551908968 ADGRL3 1.37531E-12 1.741025751 0.44 0.178 2.15896E-08 0.234787215,<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0442] <h2 style=";text-align:left;direction:ltr">TIAM1 2.28507E-14 1.732685441 0.538 0.245 3.5871E-10 0.342604437 AMPH l,09805E-08 1.729800106 0.291 0.089 0.000172372 0.169459404 COL11A2 2.89672E-11 1.724220733 0.187 0.023 4.54726E-07 0.047996769 IL17RD 3.04378E-15 1.723603151 0.471 0.208 4,77813E-11 0.253012352 CNTNAP2 2.52551E-36 1.720741618 0.926 0.667 3.96455E-32 1.698353363 ASPM 4.77044E-35 1.713150905 0.913 0.691 7.48864E-31 1.982514564 GNAZ 2.22855E-16 1.701931319 0.358 0.104 3.49837E-12 0.106341997 EFNB2 5.58334E-16 1.7000324 0.72 0.379 CD47 2.48921E-17 1.689641293 8.76472E-12 0.762945716 SLITRK5 3.96237E-12 1.692130275 0.176 0.048 0.575 0.369 3.90757E-13 0.494363696 EPHA4 3.27439E-15 1.68775914 0.685 0.33 5.14014E-ll 0.819706409 CENPF l,10964E-81 1,686313166 1 0.959 l,74191E-77 7,369481172 NUCKS1 3,0402E-126 1,681803652 1 0.986 4,7725E-122 4,057673823 NCAN 2,7899E-13 1,675149325 0,256 0,034 4,37959E-09 0,059273715 CHML 2,38878E-17 1,650503588 0,525 0,333 3,74991E-13 0,349882732 ERBB3 2,31695E-14 1,<h2 style=";text-align:left;direction:ltr">645960014 0.538 0.333 3.63714E-10 0.575905352 LRP4 4.44338E-12 1.643790093 0.341 0.158 6.97522E-08 0.184095727 KNTC1 7.62975E-22 1.643237598 0.683 0.472 1.19772E-17 0.722275052 NR6A1 9.7155E-65 1.638185864 0.983 0.898 l.52514E-60 2.879248012 PRPF19 l,69384E-32 1,638019337 0,67 0,398 2,659E-28 0,252221989 NOG 6,29121E-16 1,631246827 0,247 0,068 9,87593E-12 0,068532769 RNF157 5,25117E-11 1,629048133 0,416 0,167 8,24329E-07 0,248159846 ZEB2 l,64402E-16 1,624708304 0,79 0,405 2,58078E-12 0,861881214 ADGRV1 7.72172E-14 1.623446188 0.536 0.305 l.21216E-09 0.482362807 0.90216448 PLCB4 3.71855E-11 1.616205265 0.529 0.261 5.83739E-07 0.515179124 CERKL 4.59027E-08 1.609773785 0.171 0.02 0,00072058 0.054296558 CIT 1.41221E-18 1.604221431 0.566 0.347 2.21689E-14 0.369104199 SLC6A8 l.38008E-21 1.592550464 0.603 0.355 2.16645E-17 0.317657087 CCDC152 4.21323E-13 1.592177709 0.395 0.298 6.61393E-09 0.346313032 PLEKHG1 7.32897E-07 1.590672295 0.115 0,<h2 style=";text-align:left;direction:ltr">04 0.011505021 0.065043867 ZNF462 2.71874E-36 1.590391292 0.892 0.655 4.26788E-32 0.964661971 SALL3 6.41039E-13 1.589033579 0.492 0.288 l.0063E-08 0.380819523 WNT2B 7.21364E-09 1.586075041 0.167 0.074 0.00011324 0.092892596 GPC3 1.OO22E-21 1.58205666 0.816 0.604 1.57326E-17 2.013388232 CNKSR3 8.87909E-10 1.576095915 0.443 0.175 L,39384E-05 0.259712937 ZNF829 3.88652E-11 1.575757955 0.269 0.158 6.10106E-07 0.135424935 NEBL 3.01281E-08 1.56706697 0.466 0.189 0.000472951 0.31943455 CCDC88C 3,60577E-16 1.565966094 0.369 0.217 5.66034E-12 0.160287217 ZNRF3 9.84632E-11 1.56512049 0.412 0.197 L,54568E-06 0.226005356 AXIN2 L,08918E-05 0,220217009 DRD4 l,05343E-09 1,553182002 0,187 0,024 l,65367E-05 0,043865738 S0X3 4,86019E-14 1,551588737 0,2 0,056 7,62952E-10 0,0514375 TNFRSF19 l,36552E-09 1,550179239 0,43 0,166 2,1436E-05 0,262126391 ADAMTS19 4,44469E-11 1,549808864 0,514 0,283 6,97727E-07 0,<h2 style=";text-align:left;direction:ltr">402565355 ADAM 23 7.38463E-16 1.549043969 0.443 0.223 1.15924E-11 0.210458369 RTKN2 9.37448E-16 1.547691404 0.443 0.258 1.47161E-11 0.225366361 DNER 6.14648E-11 1.545495742 0.165 0.044 9.64875E-07 0.04984088 B3GAT1 1.26278E-13 1.538416364 0.223 0.067 l,98232E-09 0,063560078 MMS22L 4,04626E-16 1,521973723 0,618 0,41 6,35181E-12 0,570947167 RFX3 3,3344E-10 1,520542561 0,458 0,21 5,23435E-06 0,254723315 HECTD2 l,09457E-09 1,515842494 0,354 0,184 l,71825E-05 0,21097732 PGAP1 l,06752E-15 1,515340152 0,675 0.411 1.67579E-11 0.578680003 EML1 l,04932E-10 1,509275307 0.403 0.224 l,64722E-06 0.266338984 MZF1 l,57537E-10 1,507876779 0.369 0.18 2.47301E-06 0.200474042 CNTRL 6.76689E-11 1,50670662 0.453 0.272 l,06227E-06 0.378248213 DYNLL2 2.21165E-24 1.49642955 0.835 0.564 3.47184E-20 0.688319142 FZD7 4.44107E-23 1.496248458 0.69 0.51 6.97159E-19 0.523107142 NCAPG 5.48402E-15 1.493923497 0.603 0.384 8.60882E-ll 0.476547336 MLLT10 2.10087E-16 1.487519358 0.553 0.417 3.29794E-12 0.522015766 EFNB1 5,73405E-10 1,486233116 0,44 0,24 9,00131E-06 0,27731167 LRIG1 8,55306E-17 1,483082517 0,323 0,195 1,34266E-12 0,121548313 EGFEM1P l,51468E-07 1,48073916 0,167 0,038 0,002377739 0,065252853 ZIC5 7,30169E-15 1,47990082 0,432 0,241 l,14622E-10 0,187147098 BTBD3 2,18556E-14 1,479505112 0,523 0,339 3,4309E-10 0,367275202 SCRG1 7,67475E-07 1,479208596 0,137 0,019 0,012047823 0,036818202 CCND1 l,06711E-19 1,472976152 0,761 0,476 1,67515E-15 0,623832255 STRA6 2,91593E-09 1,472557404 0,505 0,242 4,57743E-05 0,397539445 APLP1 1,64763E-14 1,4679279 0,406 0,241 2,58645E-10 0,201248386 CELF2 1,97614E-11 1,466242577 0,603 0,338 3,10214E-07 0,461006099 NRIP1 3,29426E-11 1,465683756 0,601 0,356 5,17133E-07 0,634847215 CDH2 3,47858E-23 1,462845753 0,931 0,629 5,46068E-19 1,690101225 CPT1C 3,13435E-11 1,462292564 0,495 0,228 4,92031E-07 0,269101878 LRP2 2,5078E-08 1,461524291 0,553 0,281 0,000393675 0,787226726 TIAM2 2,32663E-08 1,458695258 0,351 0,184 0,000365234 0,229611745 RAB11FIP2 2,63353E-11 1,<h2 style=";text-align:left;direction:ltr">454652607 0.423 0.27 4.13412E-07 0.263830495 TUBB2B l,7658E-30 1,449266378 0.918 0.681 2.77196E-26 1,162319603 TRIM2 9,33683E-16 1,447610249 0.651 0.492 1,4657E-11 0,829964874 RCBTB2 l,74358E-09 1,447103088 0.36 0.232 2,73707E-05 0.247088233 PPP1R3E l,1351E-08 1.435467682 0.167 0.071 0.000178188 0.075130329 CLYBL 5.78674E-09 1.435077392 0.356 0.166 9.08402E-05 0.214405789 ITGA6 3.65829E-14 1.429018471 0.605 0.516 5.74278E-10 0.873174712 SAS Hl 2.4202E-20 1.427706767 0.666 0.561 3,79923E-16 0.716278579 PEG10 2.33607E-22 1.427620708 0.805 0.599 3.66716E-18 0.768906101 STK33 2.69504E-08 1.422863163 0.332 0.186 0.000423068 0.241489546 ZDHHC21 l,34454E-09 1.414069657 0.321 0.173 2.11066E-05 0.1663072 TCF12 6.64433E-17 1.41137713 0.714 0.532 l,04303E-12 0.813811528 LMO4 2.19883E-20 1.407783333 0.681 0.522 3.45172E-16 0.494825691 NAVI 3.07479E-17 1.403649098 0.709 0.554 4.8268E-13 0.803608399 NOTCH3 l.03786E-27 1.403564663 0.709 0.522 l.62923E-23 0.347653574 USP49 l.14009E-09 1,402158668 0,343 0,181 l,78972E-05 0,187693936 MMP16 2,04324E-ll 1,39958221 0,445 0,345 3,20747E-07 0,377144121 ROR2 6,06736E-08 1,397580708 0,475 0,193 0,000952454 0,328214105 AFG3L1P 3,55807E-09 1,395229871 0,434 0,238 5,58546E-05 0,275223714 NUP21O 2,01358E-09 1,390944651 0,436 0,221 3,16092E-05 0,297085306 CECR2 l,21485E-23 1,390770461 0,779 0,653 l,90708E-19 0,831798563 AHDC1 2,28944E-14 1,389640804 0,534 0,269 3,59396E-10 0,198621623 PAM l,20117E-13 1,37356826 0,599 0,453 l,8856E-09 0,521936422 LRRC8B 7,24965E-08 1,372337057 0,349 0,208 0,001138051 0,252435371 CEP83 3,55963E-09 1,371487297 0,421 0,279 5,5879E-05 0,359426282 TOP2A 2,29039E-36 1,371484286 0,974 0,904 3,59546E-32 3,729253925 NRP2 7,68841E-15 1,368149016 0,748 0,503 l,20693E-10 0,887162877 NKAIN4 l,85574E-07 1,366799922 0,232 0,077 0,002913144 0,093139532 CACNA1A 1,35466E-12 1,363754434 0,477 0,212 2,12655E-08 0,158474972 EFHC1 l,40478E-08 1,361381615 0,484 0,275 0,000220523 0,425489644 CEP78 5,9896E-19 1,356378873 0,766 0,539 9,40247E-15 0,69535566 ARHGEF2 5,86886E-09 1,355410433 0,351 0,232 9,21294E-05 0,219424692 ADGRL1 2,13463E-20 1,351716854 0,696 0,414 3,35095E-16 0,312385642 BRCA1 1,9379E-14 1,351370355 0,703 0,461 3,04211E-10 0,781218787 APCDD1 l,96541E-07 1,350673336 0,243 0,116 0,003085304 0,120815214 ELK4 3,37582E-08 1,348974756 0,33 0,209 0,000529936 0,203958391 ZNF48 4,08194E-08 1,347200132 0,377 0,228 0,000640783 0,274312327 FEZF1-AS1 l,19403E-08 1,346651428 0,161 0,067 0,000187439 0,061326295 RNFT2 3,77215E-08 1,344795621 0,295 0,151 0,000592151 0,157143064 CDV3 7,08973E-62 1,342992246 0,972 0,956 l,11295E-57 1,602368044 DYNC2H1 3,71761E-11 1,342104186 0,679 0,416 5,8359E-07 0,743523206 CCDC14 3,69222E-24 1,339397281 0,866 0,672 5,79605E-20 1,200722124 CCNG2 2,61793E-11 1,338724374 0,43 0,261 4,10962E-07 0,217849959 NGFR 2,05895E-13 1,336792042 0,284 0,056 3,23215E-09 0,049603068 PDCD7 3,42715E-11 1,336518622 0,425 0,296 5,37994E-07 0,251014835 MDM4 3,41318E-19 1,336171876 0,805 0,635 5,35801E-15 1,214347092 CASP8AP2 4,28263E-15 1,336008752 0,698 0,521 6,72287E-11 0,896915725 GGA1 5,67517E-15 1,336006063 0,636 0,426 8,90888E-ll 0,440560535 ZNF117 1,47915E-11 1,333879729 0,482 0,346 2,32197E-07 0,424452387 CBX5 3,1193E-63 1,333436057 1 0,975 4,89668E-59 4,132119027 ID4 2,21333E-09 1,332958851 0,499 0,275 3,47449E-05 0,385759957 UBE3D l,50929E-08 1,326337917 0,386 0,225 0,000236928 0,251256473 MB0AT2 1,51255E-11 1,325506658 0,536 0,367 2,37441E-07 0,425841205 TARBP1 4,78569E-09 1,320982919 0,497 0,272 7,51258E-05 0,338079365 ETV1 l,40308E-12 1,320842994 0,382 0,324 2,20255E-08 0,26123894 DGCR8 4,42839E-08 1,318283399 0,306 0,171 0,000695168 0,16345614 TNRC6C 4,17474E-14 1,317244838 0,557 0,418 6,5535E-10 0,38641136 ZNF503 2,27441E-11 1,316936504 0,577 0,302 3,57038E-07 0,312278114 KMT2A 3,91356E-31 1,311624267 0,918 0,84 6,1435E-27 1,861826267 ZNF423 l,80104E-15 1,310462567 0,434 0,211 2,82727E-11 0,117753049 MCM2 2,03695E-15 1,310329027 0,703 0,515 3,19761E-11 0,<h2 style=";text-align:left;direction:ltr">690708244 ATAD5 l,92015E-20 1.310206744 0.79 0.659 3.01426E-16 0.970577573 GABBR1 8.4884E-10 1.310197214 0.538 0.314 l,33251E-05 0.378864712 ZNF704 2.12047E-07 1.309938994 0.427 0.241 0.003328714 0.315780401 LING01 1.89179E-12 1.307674687 0.341 0.201 2.96974E-08 0.128231311 NEMPl l,85917E-10 1,306382923 0.358 0.254 2.91852E-06 0.196984248 ROBO1 l,09621E-14 1,305962475 0.627 0.446 l,72082E-10 0.511180063 PNN l,81004E-44 1,305032707 0.985 0.93 2.84141E-40 3.086177543 SPC24 1,48673E-11 1,305030117 0.445 0.248 2.33387E-07 0.216071865 FANCD2 1.19729E-18 1.303828769 0.746 0.606 1.8795E-14 0.917226836 SMC4 7.2578E-33 1.301043381 0.952 0.852 l.13933E-28 2.25550162 RPIA 9.64443E-10 1.300651108 0.232 0.156 l.51398E-05 0.110961107 LUC7L3 5.08652E-97 1.297674203 1 0.998 7.98482E-93 5.352519108 RGS12 4.21457E-08 1.296396114 0.386 0.235 0.000661604 0.256825049 CEP290 2.04759E-13 RRM1 8,<h2 style=";text-align:left;direction:ltr">39889E-27 1.29085699 0.866 0.724 L,31846E-22 1.181318639 VANGL2 8.38641E-20 1.289467196 0.499 0.394 1.3165E-15 0.201795179 GAS1 2.12871E-08 1.287054339 0.358 0.127 0.000334165 0.107553263 RTN 3 l,43295E-27 1.284209963 0.896 0.748 2,24945E-23 1.298401175 CEP295 5.91361E-08 1.282446464 0.434 0.32 0.000928318 0.47752304 DTX4 4.21979E-08 1.281533653 0.527 0.262 0.000662422 0.420860364 QSER1 5.82054E-22 1.28069111 0.805 0.75 9.13709E-18 1.600410945 CEP162 5.03363E-10 1.28050566 0.575 0.406 7.9018E-06 0.656519652 MAGI1 2.50775E-14 1.279833612 0.636 0.488 3.93667E-10 0.547394038 KIF14 2.76837E-10 1.276475632 0.605 0.401 4.34579E-06 0.603540077 RRN3P1 2.03194E-09 1.27479759 0.291 0.162 3.18973E-05 0.135371624 ZSWIM6 l.23946E-07 1.273820198 0.44 0.284 0.001945701 0.378022141 SSBP2 l,95945E-10 1,271619219 0.56 0.379 3,07595E-06 0,484350949 DEK 8,11366E-54 1,268448038 0.993 0.945 l,27368E-49 3,477444643 YLPMl 3,28105E-17 1,2661241 0.774 0.616 5,15059E-13 0,995488944 HNRNPAO 4,98206E-24 1,<h2 style=";text-align:left;direction:ltr">266016281 0.855 0.743 7.82084E-20 0.915029973 TTC28 4.20903E-08 1.263605921 0.434 0.276 0.000660733 0.304216419 ZFHX3 l,61103E-09 1.262353237 0.664 0.359 2.52899E-05 0.432762422 PAX2 7.5769E-07 1.257652208 0.15 0.033 0.011894216 0.039783407 MDCl 2.69822E-13 1.254620466 0.482 0.466 4.23567E-09 0.428374059 GTSE1 4.03026E-ll 1.254411091 0.588 0.421 6.3267E-07 0.634858882 MSL1 3.33746E-15 1.253495481 0.714 0.531 5.23915E-11 0.656115985 MEX3A 3.5777E-26 1.252705691 0.848 0.632 5,61627E-22 0.559438295 IRS2 6.5753E-11 1.252452778 0.451 0.309 l.03219E-06 0.307288537 FYN l.56068E-13 1.251635364 0.614 0.461 2.44995E-09 0.550691583 PASK l.52662E-06 1.250659376 0.234 0.162 0.023964938 0.147316902 FZD1 5.13046E-08 1.247818973 0.191 0.069 0.00080538 0.057952181 HELLS 2.9863E-32 1.246393633 0.957 0.849 4.6879E-28 2.214976705 BRIP1 4.42471E-08 1.242530023 0.425 0.29 0.000694591 0.365350133 ABI2 2.60256E-20 1.237525788 0.844 0.709 4.08549E-16 1.183000742 KIF15 3.15053E-ll 1.237136648 0.586 0.448 4,9457E-07 0,567798597 FUS 3,18614E-50 1,237051751 1 0,962 5,0016E-46 2,520687468 CACFD1 8,91557E-09 1,235197112 0,43 0,27 0,000139957 0,28318218 ZNF608 3,61446E-24 1,234908056 0,839 0,744 5,67397E-20 0,870376074 ZFP91 l,39084E-13 1,234742433 0,475 0,402 2,18334E-09 0,339857014 FGFBP3 2,58681E-11 1,234194678 0,475 0,331 4,06077E-07 0,27607005 ZGRF1 2,51645E-08 1,232184487 0,427 0,297 0,000395032 0,374349027 FAM20B l,44096E-09 1,230350514 0,425 0,301 2,26202E-05 0,293698893 AKAP13 2,10981E-15 1,229535758 0,781 0,594 3,31198E-11 1,212229492 CCDC88A 2,01182E-27 1,224808056 0,905 0,838 3,15816E-23 1,580400518 EZH2 5,63022E-21 1,22447595 0,818 0,676 8,83832E-17 0,876323794 CCNF 2,36056E-10 1,222565288 0,49 0,304 3,7056E-06 0,338562552 HMGN2 1,99162E-61 1,220841166 0,993 0,966 3,12645E-57 1,696454823 SPAG5 2,01459E-13 1,219989324 0,603 0,456 3,1625E-09 0,555056109 KIF11 1,1591E-12 1,214832615 0,62 0,472 l,81956E-08 0,613049832 PCMl 2,31446E-29 1,213866033 0,957 0,854 3,63324E-25 2,321467973 HNRNPH3 l,50597E-43 1,2123963 0,963 0,925 2,36408E-39 1,762191055 HNRNPUL2 2,58329E-12 1,210404443 0,497 0,365 4,05525E-08 0,299801978 ADCY1 7,07426E-07 1,20645669 0,197 0,111 0,011105175 0,092767428 RND2 8,15132E-11 1,205701987 0,527 0,356 l,27959E-06 0,328092182 GPM6B l,60278E-10 1,204784013 0,618 0,453 2,51605E-06 0,578788491 CHD1 2,08526E-18 1,202813238 0,803 0,692 3,27344E-14 1,258199561 KCTD1 7,38275E-08 1,20220885 0,289 0,166 0,001158944 0,122268651 CENPE l,03433E-17 1,201923223 0,859 0,73 1,6237E-13 1,814702046 GPAT4 l,30302E-ll 1,197122313 0,67 0,47 2,04548E-07 0,614095201 PHC2 2,94093E-09 1,194481036 0,484 0,296 4,61667E-05 0,253310052 CROCC 9,77786E-08 1,19423866 0,312 0,169 0,001534929 0,13934453 PRC1 8,70566E-14 1,191488381 0,642 0,539 l,36661E-09 0,763768711 MKI67 6,4832E-27 1,190797703 0,944 0,88 l,01773E-22 2,972961764 XRCC2 4,95788E-07 1,18861066 0,401 0,264 0,007782882 0,319488486 TRIM71 5,6411E-31 1,187167488 0,946 0,891 8,8554E-27 2,307695793 PCNT l,94238E-10 1.186123365 0.623 0.48 3.04915E-06 0.712503967 CNTFR 1.3159E-17 1.18267554 0.343 0.07 2.06571E-13 0.039178317 PHIP 3.40904E-38 1.181589782 0.989 0.955 5.3515E-34 3.69527591 NFATC4 9.67626E-10 1.179797315 0.49 0.224 l.51898E-05 0.18318687 WNK3 2.99229E-10 1.178377089 0.579 0.458 4.6973E-06 0.584955564 B4GALNT4 2.10748E-09 1.177850468 0.495 0.292 3.30832E-05 0.250152603 TTL 3.39013E-14 1.176767168 0.692 0.617 5.32183E-10 0.743847904 NCAPH2 l.91749E-07 1.174802063 0.464 0.292 0.003010081 0.322621241 FGD4 7.48487E-08 1.173228531 0.393 0.268 0.001174976 0.285558184 KPNB1 6.01163E-59 1.170191496 0.993 0.981 9.43706E-55 3.876411743 SCARNA22 2.08898E-21 1.167548861 0.653 0.435 3.27928E-17 0.215165878 ZBTB10 l.98013E-12 1.16592379 0.664 0.529 3.10841E-08 0.669326137 PAXBP1 3.41531E-17 1.165818244 0.813 0.649 5.36136E-13 0.852622947 BCL7A 4.75146E-08 1.164816495 0.369 0.27 0.000745883 0.236011222 RBBP8 l.40905E-12 1.164543618 0.592 0.54 2.21192E-08 0.679037168 CBX2 4.2325E-09 1,<h2 style=";text-align:left;direction:ltr">163251223 0.579 0.377 6.64418E-05 0.445988329 SRSF1 2.48157E-34 1.161472176 0.926 0.891 3.89557E-30 1.112216412 MSI2 7.71104E-15 1.160811487 0.627 0.548 l,21048E-10 0.476939628 MAP3K4 6.08219E-09 1.158097773 0.477 0.383 9.54783E-05 0,426526832 ANKRD36C l,98424E-09 1.156961082 0.67 0.415 3.11486E-05 0.640844994 BL0C1S6 2.01609E-12 1.15653007 0.633 0.515 3.16486E-08 0.6327899 GLI2 l,96882E-06 1.154707521 0.39 0.261 0.030906501 0.270521575 AHI1 4.71555E-09 1.154471474 0.575 0.445 7,40248E-05 0,853421457 PCDH18 l,07647E-10 1.153999004 0.497 0.412 l,68984E-06 0.348782606 ZSCAN18 l,51527E-07 1.152505297 0.416 0.304 0.002378666 0.267419278 FAM13B 2.59928E-06 1.15084293 0.414 0.272 0.040803498 0.332361311 ADGRL2 1.69476E-14 1.14988653 0.746 0.658 2,66043E-10 0.839701391 MSI1 5.89863E-11 1.149646817 0.393 0.252 9.25966E-07 0.143723163 TMPO 3.5687E-20 1.148480432 0.818 0.732 5.60214E-16 1.035004885 CDC5L 1.42687E-15 1.147791087 0.768 0.672 2.2399E-11 1.324661265 CIPC l,80772E-07 1.146922581 0,<h2 style=";text-align:left;direction:ltr">267 0.2 0.002837764 0.145520822 LARGE1 2.99244E-08 1.146124226 0.373 0.266 0.000469753 0.236877562 ARHGAP11A l,99177E-10 EGR1 2,45376E-17 1.143251667 0.922 0.74 3.85192E-13 1.692955405 AGAP1 3.17201E-08 1.14198558 0.358 0.248 0.000497942 0.191851891 PBX3 l,63229E-07 1.141827739 0.536 0.351 0.002562365 0.477851953 BAZ2B 2.28986E-17 1.141741411 0.922 0.772 3.59462E-13 2,073236281 SFRP2 l,75616E-09 1,140887983 0,826 0,439 2,75682E-05 1,510299794 NUF2 7,81469E-10 1,138504663 0,46 0,379 l,22675E-05 0,358315051 POLA1 1,55636E-11 1,137858997 0,727 0,556 2,44317E-07 0,903207789 FKBP5 4,26758E-07 1,134040749 0,423 0,292 0,006699242 0.324620052 GJC1 3.01918E-16 1.133615769 0.805 0.648 4.73951E-12 0.85340215 USP13 3.55447E-07 1.132765805 0.518 0.359 0.005579809 0.504966647 DPY19L3 3.80273E-10 1.127348684 0.557 0.429 5.96953E-06 0.429383339 NUP214 2.3991E-08 1.127134454 0.523 0.406 0,000376611 0,539637951 MCM8 l,77224E-09 1,126186641 0,51 0,389 2,78206E-05 0,399432479 BPTF 4,5529E-35 1,125630872 0,978 0,955 7,14714E-31 3,498254252 CD99L2 4,6716E-08 1,122782878 0,403 0,186 0,000733347 0,137431936 DNAJB2 l,71216E-06 1,121622567 0,453 0,305 0,026877481 0,370944849 DENND5A l,61362E-08 1,119629638 0,451 0,394 0,000253306 0,301605656 AIF1L 9,67635E-15 1,118741313 0,751 0,569 l,51899E-10 0,658169838 RASAL2 4,10914E-08 1,117071898 0,375 0,332 0,000645053 0,281695538 CRNDE l,00116E-07 1,116954704 0,39 0,251 0,001571624 0,218858307 CTBP1 4,12051E-20 1,114714944 0,822 0,718 6,46837E-16 0,670905298 GDF11 l,0877E-07 1,113757126 0,471 0,343 0,001707478 0,377998615 CPXMl 2,12288E-09 1,113540228 0,605 0,323 3,33249E-05 0,335195275 HSP90AA1 l,7904E-lll 1,113479925 1 1 2,8106E-107 23,18319188 MIS18BP1 l,32068E-14 1,111975 0,785 0,682 2,07321E-10 1,199723777 TTBK2 1,23363E-11 1,111247808 0,397 0,396 l,93656E-07 0,225404052 ANP32A 7,93603E-25 1,109008036 0,885 0,856 l,2458E-20 1,<h2 style=";text-align:left;direction:ltr">27176426 SMC2 4.63803E-17 1.108800728 0.811 0.73 7.28077E-13 1.350837126 NHLRC3 l.24013E-06 1.10616243 0.349 0.252 0.019467578 0.28237654 KIF18A 2.02374E-07 1.106151573 0.377 0.292 0.00317687 0.277422551 PNMA1 4.94835E-08 1.104589661 0.328 0.311 0.000776792 0.21669936 BCAT1 2.65515E-29 1.104312998 0.97 0.899 4.16805E-25 2.881659103 FAM210B 5.98714E-08 1.101394971 0.527 0.406 0.000939862 0.553582128 KHDRBS3 3.68528E-09 1.100942094 0.538 0.499 5.78515E-05 0.637142803 LUC7L 8.07379E-16 1,098770753 0.82 0.709 1.26742E-11 1.177219326 FRYL l.00032E-09 1.097603902 0.616 0.479 l.57031E-05 0.728501998 MYCN 2.01335E-10 ADGRA3 1.096139288 0.512 0.424 3.16055E-06 0.353657285 9,45872E-09 1.095397537 0.536 0.424 0.000148483 0.487231312 PCF11 8.23881E-10 1.095229834 0.553 0.461 L,29333E-05 0.616956057 SPEN 3.92438E-14 1.094682873 0.742 0.658 6.1605E-10 1.003961518 CLSPN l,09314E-ll 1.093953858 0.707 0.569 l,71601E-07 0,907031725 EN02 l,23451E-07 1,093202268 0,477 0,38 0,001937929 0,45700228 SPDL1 2,083E-ll 1,091988087 0,588 0,517 3,26989E-07 0,584936909 HDAC5 8,98775E-08 1,091631004 0,416 0,307 0,001410898 0,258424398 NE01 2,18309E-10 1,090995917 0,586 0,464 3,42702E-06 0,497856766 HSPH1 1,1585E-19 1,09075293 0,911 0,818 1,81862E-15 2,163274306 ANKRD26 l,19639E-09 1,089130667 0,722 0,541 l,8781E-05 0,952967372 SLC25A37 3,73728E-12 1,088745981 0,694 0,571 5,86679E-08 0,745182981 CCDC18 2,37304E-08 1,088418146 0,529 0,4 0,00037252 0,515141138 TCAF1 8,56362E-10 1,087724885 0,633 0,448 l,34432E-05 0,471822346 SLC4A7 3,87577E-10 1,087304079 0,601 0,481 6,08418E-06 0,624775254 HP1BP3 7,64479E-23 1,0845503 0,946 0,845 l,20008E-18 1,9685139 FOXD3 l,53254E-09 1,081427844 0,158 0,06 2,40579E-05 0,028342467 BCORL1 3,25231E-07 1,081163725 0,291 0,161 0,005105473 0,105155743 UBN2 l,06765E-09 1,078647943 0,599 0,572 l,676E-05 0,655818627 SPRED1 3,99646E-08 1,078439207 0,482 0,418 0,000627364 0,430642673 ATM l,1924E-10 1,<h2 style=";text-align:left;direction:ltr">078159823 0.729 0.587 l,87183E-06 0.958312471 PLCG1 5.56356E-08 1.077681628 0.43 0.305 0.000873367 0.220843553 RGMB 6.2494E-09 1.076813382 0.26 0.115 9.81031E-05 0.074237938 JAKMIP2 l,47488E-06 1.074832886 0.306 0.222 0.023152645 0,196695775 RPL22 4.83006E-60 1.071264371 0.993 0.986 7.58224E-56 2.359521485 DNMT1 l,57179E-27 1.070791 0.959 0.9 2.4674E-23 2.21315659 MBD3 7.01696E-12 1.070685146 0.696 0.512 l,10152E-07 0.507852566 EP400 5.88074E-09 1.068710944 0.523 0.454 9.23158E-05 0.513096533 L,20942E-37 3.562095815 APBA2 7.41743E-07 1.066562498 0.388 0.243 0.011643875 0.207284689 PDS5B 8.82562E-15 1.06639801 0.796 0.755 l,38545E-10 1,20546086 WRN 4,1708E-10 1,066136383 0,577 0,476 6,54732E-06 0,543238421 ILF3 8,74307E-44 1,064010586 1 0,983 l,37249E-39 4,086891554 DCUN1D4 l,10519E-10 1,063223306 0,51 0,476 l,73493E-06 0,479901707 NES l,90419E-21 1,062703558 0,974 0,862 2,98919E-17 2,302934399 TUBB2A 3,52046E-17 1,061749255 0,796 0,75 5,52642E-13 0,99601899 GABPB1-AS1 l,73566E-08 1,061283243 0,644 0,49 0,000272464 0,739769358 SOX12 1,77268E-14 1,060988797 0,625 0,511 2,78276E-10 0,329471744 GPCPD1 l,75332E-06 1,060653832 0,451 0,373 0,02752366 0,477960709 EFS 9,23924E-09 1,059381924 0,299 0,159 0,000145038 0,094736422 NAT14 4,78909E-07 1,058866355 0,484 0,331 0,00751791 0,347663238 VPS13C 4,09719E-07 1,058845285 0,536 0,398 0,006431763 0,565170122 TIMELESS 2,09757E-09 1,058178187 0,733 0,545 3,29276E-05 0,985147892 CCDC136 2,17058E-07 1,05803767 0,377 0,287 0,003407372 0,252757479 NUP58 2,30955E-08 1,057256495 0,492 0,42 0,000362553 0,380368494 MPDZ 2,4191E-10 1,057082292 0,672 0,518 3,7975E-06 0,690825683 PSIP1 3,48994E-32 1,055816496 0,993 0,93 5,47851E-28 3,137290183 HIP1 3,47108E-ll 1,055781362 0,694 0,559 5,4489E-07 0,7644309 CAMSAP1 2,86922E-07 1,055666329 0,453 0,398 0,0045041 0,437279887 TTK 7,99647E-09 1,055379638 0,549 0,447 0,000125529 0,507399998 NAA40 l,60608E-09 1,054062149 0,56 0,374 2,52122E-05 0,305207704 ZFP36L1 l,18906E-24 1,051596758 0,918 0,864 l,86659E-20 1,260281785 DPYSL2 3,22796E-20 1,050893243 0,883 0,805 5,06726E-16 1,143661125 RAB3B l,08635E-ll 1,050196284 0,709 0,624 l,70536E-07 1,121569452 WDHD1 4,81441E-10 1,049942753 0,638 0,51 7,55766E-06 0,668185765 MCM10 6,08979E-10 1,044798045 0,638 0,517 9,55975E-06 0,643106288 GPR161 2,31767E-07 1,044689575 0,538 0,371 0,003638278 0,470860215 NASP 9,89541E-68 1,044519153 1 0,996 l,55338E-63 6,984075082 LIN28B 4,24654E-13 1,044326724 0,722 0,69 6,66622E-09 0,963719966 POLE 3,72808E-08 1,043047729 0,566 0,417 0,000585233 0,448146592 RIC8B 7,30501E-07 1,042636563 0,358 0,276 0,0114674 0,254541902 UNG 5,20018E-ll 1,04163171 0,607 0,517 8,16324E-07 0,448862319 TNRC6B 6,63521E-21 1,040655329 0,939 0,88 l,04159E-16 1,889602889 GPATCH2L l,6861E-10 1,039866266 0,675 0,552 2,64684E-06 0,843337841 SPAG9 l,0502E-10 1,039842939 0,703 0,629 l,6486E-06 0,81348875 RHOB 4,58687E-15 1,038971031 0,525 0,299 7,20048E-ll 0,121491245 CELF5 l,61709E-06 1,038659096 0,154 0,045 0,025385011 0,035888849 VEZF1 1,81626E-11 1,038045266 0,688 0,592 2,85116E-07 0,725001554 JOSD1 2,73684E-07 1,037918334 0,445 0,396 0,004296298 0,400492754 BTG1 3,03613E-ll 1,037185334 0,722 0,639 4,76612E-07 0,892281662 ZNF518A 2,05572E-12 1,036944841 0,759 0,63 3,22706E-08 1,090575029 SPPL3 l,11378E-08 1,033853523 0,579 0,452 0,000174841 0,472626122 RIF1 2,22717E-22 1,033627428 0,933 0,898 3,49621E-18 2,34794607 TIAL1 l,05599E-12 1,032370991 0,718 0,675 l,65769E-08 0,701878094 MAPK8 4,6525E-08 1,031172748 0,362 0,372 0,000730349 0,274850805 DYRK1A l,65151E-06 1,029666469 0,486 0,417 0,025925399 0,501831074 SFPQ 8,1854E-48 1,028617131 1 0,995 l,28494E-43 5,53949714 RAD21 l,07727E-23 1,028410227 0,978 0,949 1,6911E-19 2,885103635 NRDE2 3,59834E-07 1,028166975 0,456 0,366 0,00564867 0,411043283 DNM1 2,04228E-10 1,027657708 0,373 0,215 3,20598E-06 0,097673219 KLHL42 2,04523E-06 1,<h2 style=";text-align:left;direction:ltr">LRP6 5.68618E-10 1.027099971 0.607 0.553 8.92616E-06 0.58817473 ACVR2B 2.39835E-14 1.025970981 0.846 0.739 3.76492E-10 1,218118219 KNL1 5.43673E-08 1.024610076 0.61 0.46 0.000853457 0.704831432 PARP1 9.45154E-23 1.02176039 0.948 0.867 1.4837E-18 2.244193237 KIF4A l.93299E-07 1.020410039 0.623 0.444 0.003034413 0.733504996 SH3KBP1 3.07427E-06 1.019504557 0.419 0.34 0.048259819 0.308073378 CLU 6.60727E-15 1.019459496 0.881 0.748 l.03721E-10 1.138635231 FANCI l.64854E-09 1.017850582 0.677 0.558 2.58788E-05 0.67742258 ALDH7A1 8.30635E-22 1.014493732 0.907 0.861 l.30393E-17 1.548290099 CDK12 7.48709E-09 1.012963884 0.642 0.5 0.000117532 0.562343611 DLGAP5 1.42764E-11 1.012054664 0.764 0.655 2.24111E-07 1.29048619,<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0443] <h2 style=";text-align:left;direction:ltr"> FZD2 l,72049E-08 1.011951675 0.668 0.446 0.000270082 0.514253209<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0444] <h2 style=";text-align:left;direction:ltr">PHACTR4 1.84734E-12 1.010100903 0.709 0.64 2.89995E-08 0.802454305<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0445] <h2 style=";text-align:left;direction:ltr"> WDR59 l,52916E-06 1,009752474 0,469 0,387 0,024004744 0,45248258<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0446] <h2 style=";text-align:left;direction:ltr"> HEXIM1 3.01032E-06 1.009412197 0.338 0.217 0.047256081 0.176814462<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0447] <h2 style=";text-align:left;direction:ltr"> SMCHD1 l,06658E-09 1,007808164 0,711 0,613 l,67432E-05 0,825268907<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0448] <h2 style=";text-align:left;direction:ltr"> DNMT3A 2.72535E-13 1.007180961 0.839 0.728 4.27825E-09 1.206066585<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0449] <h2 style=";text-align:left;direction:ltr"> PSMA3-AS1 l,02873E-07 1,007134544 0,614 0,483 0,001614903 0,651716103<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0450] <h2 style=";text-align:left;direction:ltr"> SAMD1 3.97654E-15 1.007106095 0.594 0.404 6.24237E-11 0.177383761<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0451] <h2 style=";text-align:left;direction:ltr"> TBL1X 6,75537E-13 1,006328541 0,87 0,75 l,06046E-08 1,3830753<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0452] <h2 style=";text-align:left;direction:ltr"> TPX2 3.83759E-19 1.005941772 0.954 0.857 6.02425E-15 2.71218913<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0453] <h2 style=";text-align:left;direction:ltr"> ZNF664 6.49847E-09 1.005633395 0.664 0.541 0.000102013 0.835472534<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">
[0454] <h2 style=";text-align:left;direction:ltr"> GIGYF1 l,84666E-10 1,002331621 0,512 0,329 2,89888E-06 0,160807234<h2 style=";text-align:left;direction:ltr">
[0455] BAZ1B 5,45068E-20 1,00168113 0,939 0,876 8,55648E-16 2,402258639
[0456] Ml Bl 4,08187E-09 1,00106034 0,584 0,497 6,40772E-05 0,528556222
[0457] R3HDM2 2,32733E-07 1,000677584 0,341 0,32 0,003653444 0,223950656
[0458] CCDC150 8,07384E-07 1,000329985 0,518 0,345 0,012674306 0,454183802
[0459] SDC3 l,12248E-07 1,000194923 0,371 0,189 0,001762064 0,113024214 pct.l Fraction of ectoderm cells expressing marker genes pct.2 Fraction of other cells expressing marker genes
Claims
Patent claims 1 . A method for the qualitative control of at least one specific property of at least one stem cell, comprising: - Isolating at least one nucleic acid molecule of the stem cell; - determining the respective degree of methylation of at least one specific region of the nucleic acid molecule, wherein the specific region comprises at least one CpG dinucleotide; - Determining at least one control value from the determined methylation level; and - Comparing the control value with at least one reference value, whereby the result of the comparison directly indicates the specific property of the stem cell.
2. Method according to claim 1, characterized in that the specific property comprises the pluripotent differentiation potential of the stem cell.
3. Method according to claim 2, characterized in that the control value is determined from the sum of the determined methylation levels.
4. The method according to claim 2 or 3, characterized in that the CpG dinucleotide is selected from the group consisting of the CpG dinucleotides cg00661673, cg00933813 and cg21699252.
5. Method according to one of claims 1 to 4, characterized in that the specific property comprises the germ layer-specific differentiation of the stem cell.
6. Method according to claim 5, characterized in that the control value is determined from the sum of the determined methylation levels less the corresponding averaged methylation levels of undifferentiated stem cells, wherein the values of the determined Methylation levels are taken into account inversely in the case of hypomethylated CpG dinucleotides. Method according to claim 5 or 6, characterized in that the CpG dinucleotide for determining differentiation towards the different germ layers comprises at least one of the following CpG dinucleotides: - Endoderm: cg20548013, cg14521421 and cg08913523; - Mesoderm: cg14708360, cg08826152 and cg11599718; - Ectoderm: cg01907071 , cg18118164 and cg13075942; - Endoderm / mesoderm: cg23385847, cg24919344, and cg11147278. The method according to any one of claims 1 to 7, characterized in that the stem cells are pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), and / or directly reprogrammed cells derived by direct conversion into other cell types. Use of at least one nucleic acid molecule comprising at least one of the CpG dinucleotides cg00661673, cg00933813, and cg21699252 for determining the pluripotent differentiation potential of at least one stem cell. Use of at least one nucleic acid molecule comprising at least one CpG dinucleotide for determining the germ layer-specific differentiation of at least one stem cell, wherein the CpG dinucleotide for determining the differentiation towards one of the different germ layers is selected from one of the following groups: - Endoderm: cg20548013, cg14521421 and cg08913523; - Mesoderm: cg14708360, cg08826152 and cg11599718; - Ectoderm: cg01907071 , cg18118164 and cg13075942; - Endoderm / mesoderm: cg23385847, cg24919344 and cg11147278.