Set of primers, composition of the reaction mixture and method for detecting human respiratory syncytial virus types a and b (rsva and rsvb)
Patent Information
- Application Number
- EP2023865947
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-12
- Filing Date
- 2023-09-11
- Publication Date
- 2025-07-23
AI Technical Summary
Current diagnostic methods for detecting human respiratory syncytial virus (RSV) types A and B are costly, time-consuming, and require specialized equipment, limiting their effectiveness for rapid and accurate point-of-care testing, especially in primary care settings where RSV infections can be life-threatening.
A set of primers specifically designed for the N gene of RSV types A and B, combined with the LAMP method and fluorescent markers, allows for rapid, sensitive, and specific detection of RSV using a portable genetic analyzer, enabling real-time monitoring and reducing the detection limit to as low as 195 copies per reaction.
The method enables rapid detection of RSV within 15 minutes, allowing for timely targeted therapy, with a detection limit of 320 genome copies for RSVA and 195 copies for RSVB, and can be stored at room temperature, making it suitable for point-of-care testing without the need for specialized equipment.
Smart Images

Figure IMGF000005_0001 
Figure 00000027_0000 
Figure 00000027_0001
Abstract
Description
[0001] Set of primers, composition of the reaction mixture and method for detecting human respiratory syncytial virus types A and B (RSVA and RSVB)
[0002] The invention relates to a set of primers for detecting human respiratory syncytial virus types A and B (RSVA and RSVB), a method for detecting RSVA and RSVB using the set of primers, and an application of the set of primers for detecting RSVA and RSVB. The invention is applicable in medical diagnostics.
[0003] RSV is an RNA virus. It belongs to the Paramyxoviridae family, Pneumovirus genus. A distinction is currently made between 2 antigenic types of the virus (A and B). RSV is the main pathogen responsible for respiratory tract infections in older children and the most common cause of lower respiratory tract disease in infants. During outbreaks, the incidence rate is more than 50% (in children's communities such as nurseries, it reaches 100%) and is the cause of 75% of hospitalisations of children with bronchiolitis and 25% with pneumonia. It is also the second leading cause of infant mortality after malaria. In adolescents and adults, the disease is mild, characterised by a high prevalence again in the elderly, especially when residing in community settings such as nursing homes and in immunocompromised individuals.
[0004] In toddlers, RSV infection may refer to the lower respiratory tract and progress into bronchiolitis and pneumonia, less commonly as tracheobronchitis. Upper respiratory tract infections follow a similar course to the common cold, with cough being the main symptom. Very rarely (less than 1%), the first RSV infection is asymptomatic. Without appropriate diagnostics, clinical diagnosis of infection with the described pathogen is not possible, as similar symptoms are observed with infections with other respiratory viruses and atypical bacteria.
[0005] Given the life-threatening nature of RSV infection, it is important that diagnosis is made promptly and that diagnostic methods are characterized by high sensitivity and specificity. One diagnostic method for detecting RSV is virus isolation, but this method is rarely used in routine diagnosis due to the long time required to obtain a result. Another method is the detection of RSV virus antigens. This is the most commonly used detection method and is based on immunofluorescence or the enzyme immunoassay technique (EIA). Detection of viral RNA by RT-PCR in epithelial cells of the upper respiratory tract, with nasopharyngeal lavage, posterior pharyngeal wall swabs or tracheal secretions being the appropriate material for these determinations.
[0006] The methods characterized by the greatest specificity and sensitivity are those involving the detection of RSV nucleic acid in biological material (the so-called NAAT methods - Nucleic Acid Amplification Tests). The most commonly used tests in NAAT technology are assays based on Real-Time RT-PCR method. Many different tests using the Real-Time PCR technique are available on the market, but despite the fierce competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive devices, and the extraction of genetic material from the patient's sample. Furthermore, since cyclic heating and cooling of the reaction mixture is necessary, this method is time-consuming, and the equipment used consumes relatively large amounts of energy to perform the diagnostic process.
[0007] Isothermal methods, including the LAMP (Loop-mediated isothermal amplification) method, are methods that allow to accelerate the diagnostic process and reduce the cost of energy and reagents needed to perform the analysis. Moreover, according to the literature data, these methods are characterized by higher sensitivity and specificity than the aforementioned Real-Time PCR technique, they are also much faster. Their isothermal course does not require specialized equipment.
[0008] Due to the low equipment requirements, isothermal methods are an ideal diagnostic solution both for primary care units (POCT - point-of-care testing), where the test can be performed in the practice of a general practitioner or specialist doctor during the patient's first office visit. Such a solution enables a rapid diagnostic test (in less than 15 minutes), allowing targeted therapy to be selected at the first visit. This is particularly important in the case of RSV infection, due to the rapid progression of the infection, which quickly leads to an immediately life-threatening condition. Delayed diagnosis of RSV infection increases the patient's risk of death, as well as the risk of developing serious complications. On the other hand, the use of freeze-dried reagents allows the tests to be stored at room temperature, without the need to freeze the diagnostic tests.
[0009] The use of primers in the LAMP method for the diagnosis of RSV is known from the patent applications published so far: CN109762942A, CN104419713A, CN104419713A; CN107099619A; KR20220040073A. The LAMP method is disclosed, for example, in patent applications WO0028082, WO0224902. In some of the patent applications, the detection method is not quantitative, and it is an end-point detection with the use of agarose gel or other markers based on the colour change of the reaction mixture upon a positive amplification.
[0010] Therefore, there is still a need to provide a diagnostic method using appropriately refined sets of primers used for the diagnosis of RSV infection (types A and B) with the LAMP method, intended for use in point-of-care testing, which allows for infection detection with a very low detection limit. The use of fluorescent markers allowed a significantly lower detection limit (^ 195 copies). Moreover, the fluorescent dyes allow for Real-Time detection of the reaction product, which significantly reduces the reaction time 20 min) and enables quantitative measurement of the pathogen.
[0011] The first subject of the invention is a set of primers for amplifying the nucleotide sequence of the N (nucleocapsid) gene of RSVA, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) specific for a selected fragment the N gene of RSVA: a) 5' GCACACTAGCATGTCCTAACATAAT 3'- (nucleic sequence SEQ ID NO:
[0012] 5 or its reverse and complementary sequence), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5' CAGGGCAAGTGATGTTACG 3'- (nucleic sequence SEQ ID NO: 3 or its reverse and complementary sequence) b) 5' TGGAACAAGTTGTTGAGGTTTATGA 3'- (nucleic sequence SEQ ID NO:
[0013] 6 or its reverse and complementary sequence), linked at the 3' end, preferably by a TTTT bridge, to the sequence 5' GGTTGTTCAATATATGGTAGAATCC 3'- (nucleic sequence SEQ ID NO: 4 or its reverse and complementary sequence) c) 5' TGTTTATGAATGCCTATGGTG 3' nucleic sequence SEQ ID NO: 1 or its reverse and complementary sequence, and d) 5' GTGAGGAAATTGAGTCAAAG3A' nucleic sequence SEQ ID NO: 2 or its reverse and complementary sequence.
[0014] In a preferred embodiment of the invention, the primer set comprises a set of loop primer sequences comprising nucleic sequences contained in or complementary to the RSVA N gene SEQ ID NO:7 5' TGATTTTGCTAAGACTCCCC3A'C and SEQ ID NO: 8 5' ATGCCCAAAAATTGGGTGGAG 3' or sequences reverse and complementary thereto.
[0015] The second subject of the invention is a set of primers for amplifying the nucleotide sequence of the N (nucleocapsid) gene of RSVB, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) specific for a selected fragment the N gene of RSVB: a) 5' GGACACTAGCATGTCCTAGCATG 3'- (nucleic sequence SEQ ID NO: 13 or its reverse and complementary sequence), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5' GTAATGCTAAGATGGGGAGTT 3'- (nucleic sequence SEQ ID NO: 11 or its reverse and complementary sequence) b) 5' GGAGCAAGTTGTGGAAGTCTATGA 3'- (nucleic sequence SEQ ID NO: 14 or its reverse and complementary sequence), linked at the 3' end, preferably by a TTTT bridge, to the sequence 5' GATTGTTCAATATATGGTAGAATCC 3'- (nucleic sequence SEQ ID NO: 12 or its reverse and complementary sequence) c) 5' TGAATGCCTATGGTTCAGG 3' nucleic sequence SEQ ID NO: 9 or its reverse and complementary sequence, and d) 5' TTGAGTTAATGACAGCAATGA 3' nucleic sequence SEQ ID NO: 10 or its reverse and complementary sequence.
[0016] In a preferred embodiment of the invention, the primer set comprises a set of loop primer sequences comprising nucleic sequences contained in or complementary to the RSVB N gene SEQ ID NO: 15: 5' GCACAGAAGTTGGGAGGAGAAGC 3' or its reverse and complementary sequence. The third subject of the invention is a method for detecting RSVA and RSVB viruses, characterised in that selected regions of the nucleic sequence of the RSVA genome (N - nucleocapsid gene fragment) and the RSVB genome (N - nucleocapsid gene fragment) are amplified using a mixture of primer sets as defined in the first and second subjects of the invention, the amplification method being the RT-LAMP method.
[0017] In a preferred embodiment, the amplification is carried out with a temperature profile: 63°C, 40 min.
[0018] In a further preferred embodiment of the invention, the end- point reaction is carried out with an additional temperature profile of 80°C, 5 min carried out after the amplification step.
[0019] The fourth subject of the invention is a method for detecting an infection caused by RSVA and / or RSVB characterised in that it comprises the detection method defined in the third subject of the invention.
[0020] The fifth subject of the invention is a kit for detecting an infection caused by RSVA and / or RSVB characterised in that it comprises a set of primers as defined in the first and second subjects of the invention.
[0021] In a preferred embodiment of the invention, the infection detection kit comprises 5.0 μL of WarmStart® LAMP (DNA & RNA) Master Mix.
[0022] In a further preferred embodiment of the invention, the kit comprises individual amplification primers as defined in the first and second subjects of the invention, the primers having the following concentrations: 0.13 μM F3RSVA, 0.13 μM B3RSVA, 1.06 μM FIPRSVA, 1.06 μM BIPRSVA, 0.26 μM LoopFRSVA, 0.26 μM LoopBRSVA, 0.13 μM F3RSVB, 0.13 μM B3RSVB, 1.06 μM FIPRSVB, 1.06 μM BIPRSVB, 0.26 μM LoopBRSVB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1.25%; fluorescent marker interacting with double- stranded DNA - EvaGreen ≤1X (Biotium) or Fluorescent Dye (New England Biolabs) in the amount of dl μL or Syto-13 ≤16 μM (ThermoFisher Scientific) or SYTO-82 ≤16 μM (ThermoFisher Scientific) or another fluorescent dye interacting with double- stranded DNA at a concentration that does not inhibit the amplification reaction.
[0023] The advantage of the primer sets of the invention for detecting of RSVA and RSVB, as well as the method for detecting RSVA and / or RSVB infections and the method for detecting the amplification products, is the possibility of using them in medical diagnostics at the point of care (POCT) in the target application with a portable genetic analyser. Freeze-drying of the reaction mixtures of the invention allows the diagnostic kits to be stored at room temperature without reducing the diagnostic parameters of the tests. In turn, the use of a fluorescent dye to detect the amplification product increases the sensitivity of the method, allows to lower the detection limit (down to 320 genome copies / reaction for the RSVA virus and down to 195 genome copies / reaction for the RSVB virus), as well as it enables the measurement of viral load in the test sample.
[0024] Exemplary embodiments of the invention are presented in the drawing, in which Fig. 1 shows the sensitivity characteristics of the method, where a specific signal was obtained with the template: AMPLIRUN® Respiratory syncytial Virus (subtype A) RNA Control - Vircell and RNA AMPLIRUN® Respiratory Syncytial Virus (subtype B) RNA Control over the range of 1000-320 copies / μL, but there was no product in NTC; fig. 2 shows the sensitivity characteristics of the method, where a specific signal was obtained with the template: AMPLIRUN® Respiratory syncytial Virus (subtype B) RNA Control - Vircell over the range of 1000- 195 copies / μL, but there was no product in NTC. The above sensitivity was based on PROBIT statistical calculations of a series of 20 measurements, where Fig. 1: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lane 2: 2000 copies of RSVA; lane 3: 1000 copies of RSVA; lane 4: 500 copies of RSVA; lane 5: 300 copies of RSVA; and lane 6: NTC.
[0025] Fig. 2: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lane 2: 2000 copies of RSVB; lane 3: 1000 copies of RSVB; lane 4: 500 copies of RSVB; lane 5: 320 copies of RSVB; lane 6: NTC; and Fig. 3 shows the sensitivity of the method of the invention as measured by assaying a serial dilution of the AMPLIRUN® Respiratory syncytial Virus (subtype
[0026] A) RNA Control standard over a range of 1000-320 copies / reaction of the RNA standard, where the product amplification was measured in real time. The results of the real-time RSVA detection are presented in Table 1, providing the minimum time required to detect the fluorescence signal; and Fig. 4 shows the sensitivity of the method of the invention as measured by assaying a serial dilution of the AMPLIRUN® Respiratory syncytial Virus (subtype
[0027] B) RNA Control standard over a range of 1000-195 copies / reaction of the RNA standard, where the product amplification was measured in real time. The results of the real-time RSVB detection are presented in Table 2, giving the minimum time required to detect the fluorescence signal; while Fig. 5 shows the specificity of the product obtained after RSVA detection as measured by the melting curve of the amplification product using the AMPLIRUN® Respiratory syncytial Virus (subtype A) RNA Control standard over the range 1000-320 copies / reaction by real-time fluorescence measurement, with a target melting temperature (Tm) of 81.5°C for a specific RSVA reaction product; while Fig. 6 shows the specificity of the product obtained after RSVB detection as measured by the melting curve of the amplification product using the AMPLIRUN® Respiratory syncytial Virus (subtype B) RNA Control standard over the range 1000-195 copies / reaction by real-time fluorescence measurement, with a target dissociation temperature (Tm) of 84°C for a specific RSVB reaction product; and Figs 7, 8 and 9 show the specificity of the method of the invention with standard materials of a number of pathogens potentially present in the tested biological material as natural physiological flora, those which may result from co-infections or those which share similar genomic sequences; and Fig. 7: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 2 and 3: methicillin-sensitive Staphylococcus aureus (MSSA); lanes 4 and 5: Influenza B virus; lanes 6 and 7: Influenza A virus (H1N1); lanes 8 and 9: Influenza A virus (H3N2); lanes 10 and 11: Mycoplasma genitalium; lanes 12 and 13: HPV 16; lanes 14 and 15: Klebsiella pneumoniae; lanes 16 and 17: Bordetella pertussis; lanes 18 and 19: Streptococcus pyogenes; lanes 20 and 21: Staphylococcus aureus (MRSA); lanes 22 and 23: Enterococcus faecalis; lanes 24 and 25: Enterococcus faecium; lanes 26 and 27: Pseudomonas aeruginosa; lanes 28 and 29: Moraxella catarrhalis; lanes 30 and 32: Acinetobacter baumannii; lane 31: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 33 and 34: Listeria monocytogenes; lanes 35 and 36: Haemophilus ducreyi; lanes 37 and 38: Legionella pneumophila; lanes 39 and 40: Mycoplasma hominis; lanes 41 and 42: Haemophilus ducreyi; lanes 43 and 44: Escherichia coli; lanes 45 and 46: Ureaplasma urealyticum; lanes 47 and 48: Campylobacter jejuni; lanes 49 and 50: HPV 18, lanes 51 and 52: Candida albicans; lanes 53 and 54: Mycoplasma pneumoniae; lanes 55 and 56: Chlamydophila pneumoniae; lanes 57 and 58: Haemophilus influenza; lanes 59 and 60: Streptococcus pneumoniae, and Fig. 8 lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 2 and 3: Homo sapiens; lanes 4 and 5: SARS CoV-2 Frankfurt 1; lanes 6 and 7: SARS CoV-2 USA-WA12020; lanes 8 and 9: SARS CoV-2 Isolate USA-WI / 202; lanes 10 and 11: SARS CoV-2 Isolate Hong Kong; lanes 12 and 13: SARS CoV-2 Isolate Italy-INMIl; lanes 14 and 15: NTC, and Fig. 9. lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEnglandBiolabs); lanes 2 and 3:Human Coronavirus, OC43; lanes 4 and 5:SARS-Related Coronavirus 2, Isolate Germany / BavPatl / 2020; lanes6 and 7: SARS CoV-2 NR 52726 Human Coronavirus 229E; lanes 8 and9: Amplirun SARS-CoV-2 B.1.351 RNA Control; lanes 10 and 11:SARS CoV-2 Isolate USA-CA1 / CA2 / CA3 / 2020; lanes 12 and 13: SARSCoV-2 Isolate New York-PVO8410 / 2020; lanes 14 and 15: SARS CoV-2 Isolate USA-IL1 / 2020; lane 16:mass marker (Quick-Load® Purple100 bp DNA Ladder, NewEngland Biolabs); lanes 17 and 18: SARSCoV-2 Isolate Chile / Santiago_op4dl / 2020; lanes 19 and 20: SARSCoV-2 England-1 Stain; lanes 21 and 22: RSVA; lanes 23 and 24:RSVB; lanes 25 and 26: SARS CoV-2 B.1.1.7; lanes 27 and 28:MERSCoronavirus. Example 1. Primer sequences The sequences of the specific oligonucleotides used for thedetection of RSVA and RSVB genetic materialusing LAMP technologyare presented and characterised below. 1. The RSVA NF3 oligonucleotide sequence: 5, TQTTTATGAATGCCTATGGTG 3' is a sequence identical to the RSVAN gene (5'-3' strand). 2. The RSVA NB3 oligonucleotide sequence:5' GTGAGGAAATTGAGTCAAAGA 3' is a complementary fragment of theRSVA N gene (5'-3' strand) 179 nucleotides away from the 3' endof the oligonucleotide 1. 3. The RSVA NF2 oligonucleotide sequence:5' CAGGGCAAGTGATGTTACG 3' is a sequence identical to the RSVA Ngene (5'-3' strand) immediately adjacent to the 3' end of theoligonucleotide 1. 4. The RSVA NQ2 oligonucleotide sequence:5' GGTTGTTCAATATATGGTAGAATCC 3' is a complementary fragment ofthe RSVA N gene (5'-3' strand) 137 nucleotides away from the 3'end of the oligonucleotide 1. 5. The RSVA NFlc oligonucleotide sequence: 5' GCACACTAGCATGTCCTAACATAAT 3' is a complementary fragment of the RSVA N gene (5'-3' strand) 50 nucleotides away from the 3' end of the oligonucleotide 1.
[0028] 6. The RSVA NBlc oligonucleotide sequence: 5' TGGAACAAGTTGTTGAGGTTTATGA 3' is a sequence identical to the RSVA N gene (5'-3' strand) 84 nucleotides away from the 3' end of the oligonucleotide 1.
[0029] 7. The RSVA NLoopF oligonucleotide sequence: 5' TGATTTTGCTAAGACTCCCCAC 3'.
[0030] 8. The RSVA NLoopB oligonucleotide sequence: 5' ATGCCCAAAAATTGGGTGGAG 3'.
[0031] 9. The RSVB NF3 oligonucleotide sequence: 5' TGAATGCCTATGGTTCA3G'G is a sequence identical to the RSVB N gene (5'-3' strand).
[0032] 10. The RSVB NB3 oligonucleotide sequence: 5' TTGAGTTAATGACAGCAATGA 3' is a complementary fragment of the RSVB N gene (5'-3' strand) 166 nucleotides away from the 3' end of the oligonucleotide 9.
[0033] 11. The RSVB NF2 oligonucleotide sequence: 5' GTAATGCTAAGATGGGGAGTT 3' is a sequence identical to the RSVB N gene (5'-3' strand) 4 nucleotides away from the 3’ end of the oligonucleotide 9.
[0034] 12. The RSVB NB2 oligonucleotide sequence: 5' GATTGTTCAATATATGGTAGAATCC 3' is a complementary fragment of the RSVA N gene (5'-3' strand) 133 nucleotides away from the 3' end of the oligonucleotide 9.
[0035] 13. The RSVB NF1C oligonucleotide sequence: 5' GGACACTAGCATGTCCTAGCATG 3' is a complementary fragment of the RSVB N gene (5'-3' strand) 48 nucleotides away from the3' end of the oligonucleotide 9.
[0036] 14. The RSVB NB1c oligonucleotide sequence: 5' GGAGCAAGTTGTGGAAGTCTATGA 3' is a sequence identical to the RSVA N gene (5'-3' strand) 81 nucleotides away from the 3' end of the oligonucleotide 9.
[0037] The sequences of the Flc and F2 oligonucleotides have preferably been linked by a TTTT bridge and used as FTP. The sequences of the Bic and B2 oligonucleotides have preferably been linked by a TTTT bridge and used as BIP.
[0038] 15. The RSVB NLoopB oligonucleotide sequence: 5' GCACAGAAGTTGGGAGGAGAAGC 3'.
[0039] Example 2
[0040] The method of amplifying the N gene of RSVA and RSVB using the oligonucleotides characterized in Example 1 with LAMP technology and the following composition of the reaction mixture:
[0041] 5.0 μL WarmStart LAMP 2X Master Mix
[0042] 0.13 μM RSVA NF3 / 0.13 μM RSVB NF3
[0043] 0.13 μM RSVA NB3 / 0.13 μM RSVB NB3
[0044] 1.06 μM RSVA NFIP / 1.06 μM RSVB NFIB
[0045] 1.06 μM RSVA NBIP / 1.06 μM RSVB NBIP
[0046] 0.26 μM RSVA NLoopF / 0.26 μM RSVB NLoopF
[0047] 0.26 μM RSVA NLoopB / -
[0048] D-(+)-Trehalose dihydrate - 6%
[0049] Mannitol - 1.25%
[0050] Fluorescent marker - EvaGreen (Biotium) ≤1X or Fluorescent dye 50X (New England Biolabs) in the amount of ≤1 μL or GreenFluorescent Dye (Lucigen) in the amount of ≤1 μL or Syto- 13 ≤16 μM or SYTO-82 ≤16 μM or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction. RNA template h 320 copies / reaction for RSVA and RNA tempHate ≥ 195 copies / reaction for RSVB
[0051] Total reaction volume adjusted to 10 μL with DNase- and RNase- free water.
[0052] Example 3
[0053] The method of amplifying the N gene of RSVA and RSVB using the oligonucleotides and the reaction mixture characterized in Example 1 and Example 2 with LAMP technology and the following temperature profile:
[0054] 1) 63°C, 40 min
[0055] 2) preferably for end-point reactions additionally after the above step 80°C, 5 min.
[0056] Example 4
[0057] The method of amplification and detection of the N gene of RSVA and RSVB using the oligonucleotides characterized in Example 1 and Example 2 with LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described below.
[0058] The fluorescent dye used added to the reaction mixture in the amount of 0.5 μL EvaGreen 20X; 0.5 μL or a concentration of ≤1X; ≤16 μM for GreenFluorescent Dye (Lucigen); SYTO-13 and SYTO-82, respectively, before starting the reaction, real-time and / or end-point measurement. Excitation wavelength in the range similar to the FAM dye - 490-500 nm (optimally 494 nm) for EvaGreen; Fluorescent dye 50X (New England Biolabs), GreenFluorescent Dye (Lucigen); SYTO-13 dyes and 535 nm (optimally 541 nm) for the SYTO-82 dye; emission wavelength in the range of 509-530 nm (optimally 518 nm) for EvaGreen; GreenFluorescent Dye (Lucigen); SYTO-13 dyes and 556 nm (optimally 560 nm) for the SYTO-82 dye, the method of detection, change recording time starting from 15 minutes from the start of the reaction for RSVA and RSVB and the negative control.
[0059] Example 5
[0060] The method of preparation and freeze-drying of reagents for detecting the amplification and detection of the N gene of RSVA and RSVB using the oligonucleotides characterized in Example 1 with LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4.
[0061] Example 6 Description of the freeze-drying process
[0062] The reaction components were mixed according to the composition described in Example 2 and Example 3, except the template RNA, to a total volume of 10 μL. The mixture was transferred to 0.2 mL tubes and subjected to the freeze-drying process according to the parameters below.
[0063] The mixture placed in test tubes was pre-cooled to -80°C for 2 hours. Then the freeze-drying process was carried out at the temperature of -25°C for 18 hours under the pressure of 5-2mBar and a further 3 hours 30 minutes at the temperature of 25°C under the same pressure.
[0064] Example 7. Sensitivity of the method
[0065] The sensitivity was determined by assaying serial dilutions of the Respiratory syncytial virus (subtype A) RNA Control standard and Respiratory syncytial virus (subtype B) RNA Control standard with a minimum amount of 320 copies for RSVA and a minimum amount of 195 copies for RSVB per reaction mixture, where the product amplification was measured in real time - Figure 3 and Figure 4 (Real-Time LAMP for serial dilutions) along with recording the dissociation temperature of 81.5°C (Figure 5) for RSVA and 84°C (Figure 6) for RSVB.
[0066] The time required to detect the emitted fluorescence for individual samples is shown in Table 1 for RSVA and in Table 2 for RSVB.
[0067] The characterized primers allow for the detection of RSVA and RSVB by detecting the N gene fragment at a minimum number of 320 genome copies / reaction mixture for RSVA and a minimum number of 195 genome copies / reaction mixture for RSVB.
[0068] Table 1. Time required to detect fluorescence for each dilution of the AMPLIRUN® Respiratory Syncytial Virus (subtype A) RNA Control standard.
[0069] Time to exceed the baseline fluorescence
[0070] Sample [min]
[0071] NTC Indefinite
[0072] RSVA 320 copies 22.2
[0073] RSVA 350 copies 19.7
[0074] RSVA 500 copies 16.5
[0075] RSVA 1000 copies 14.5
[0076] Table 2. Time required to detect fluorescence for each dilution of the AMPLIRUN® Respiratory Syncytial Virus (subtype B) RNA Control standard. Time to exceed the baseline fluorescence
[0077] Sample [min]
[0078] NTC Indefinite
[0079] RSVB 195 copies 21 .6
[0080] RSVB 250 copies 21.0
[0081] RSVB 500 copies 19.2
[0082] RSVB 1000 copies 16.3
[0083] Example 8. Specificity of the method
[0084] The superiority of the amplification method and the oligonucleotides characterized in this patent specification over the tests based on the Real-Time LAMP technology is due to the much higher sensitivity, which is shown in Figure 1, and the reduction of the analysis time shown in Figure 2.
[0085] Sequence listing
[0086] <110> Genomtec S.A.
[0087] <120> Set of primers for detecting RSVA and RSVB, method for detecting RSVA and RSVB using the set of primers and kit for detecting RSVA and RSVB
[0088] <170> Patentin version 3.5
[0089] <210> 1 RSVA NF3
[0090] <211> 21
[0091] <212> DNA
[0092] <213> artificial
[0093] <223> primer
[0094] <400> 1
[0095] TGTTTATGAATGCCTATGGTG 21
[0096] <210> 2 RSVA NB3
[0097] <211> 21
[0098] <212> DNA
[0099] <213> artificial
[0100] <223> primer
[0101] <400> 2
[0102] GTGAGGAAATTGAGTCAAAGA 21
[0103] <210> 3 RSVA NF2
[0104] <211> 19
[0105] <212> DNA
[0106] <213> artificial <223> primer
[0107] <400> 3
[0108] CAGGGCAAGTGATGTTACG 19
[0109] <210> 4 RSVA NB2
[0110] <211> 25
[0111] <212> DNA
[0112] <213> artificial
[0113] <223> primer
[0114] <400> 4
[0115] GGTTGTTCAATATATGGTAGAATCC 25
[0116] <210> 5 RSVA A / Flc:
[0117] <211> 25
[0118] <212> DNA
[0119] <213> artificial
[0120] <223> primer
[0121] <400> 5
[0122] GCACACTAGCATGTCCTAACATAAT 25
[0123] <210> 6 RSVA NBlc
[0124] <211> 25
[0125] <212> DNA
[0126] <213> artificial
[0127] <223> primer <400> 6
[0128] TGGAACAAGTTGTTGAGGTTTATGA 25
[0129] <210> 7 RSVA NLoopF
[0130] <211> 22
[0131] <212> DNA
[0132] <213> artificial
[0133] <223> primer
[0134] <400> 7
[0135] TGATTTTGCTAAGACTCCCCAC 22
[0136] <210> 8 RSVA NLoopB
[0137] <211> 21
[0138] <212> DNA
[0139] <213> artificial
[0140] <223> primer
[0141] <400> 8
[0142] ATGCCCAAAAATTGGGTGGAG 21
[0143] <170> Patentin version 3.5
[0144] <210> 9 RSVB NF3
[0145] <211> 19
[0146] <212> DNA
[0147] <213> artificial
[0148] <223> primer <400> 1
[0149] TGAATGCCTATGGTTCAGG 19
[0150] <210> 10 RSVB NB3
[0151] <211> 21
[0152] <212> DNA
[0153] <213> artificial
[0154] <223> primer
[0155] <400> 2
[0156] TTGAGTTAATGACAGCAATGA 21
[0157] <210> 11 RSVAB NF2
[0158] <211> 21
[0159] <212> DNA
[0160] <213> artificial
[0161] <223> primer
[0162] <400> 3
[0163] GTAATGCTAAGATGGGGAGTT 21
[0164] <210> 12 RSVB NB2
[0165] <211> 25
[0166] <212> DNA
[0167] <213> artificial
[0168] <223> primer
[0169] <400> 4
[0170] GATTGTTCAATATATGGTAGAATCC 25 <210> 13 RSVB NFlc:
[0171] <211> 23
[0172] <212> DNA
[0173] <213> artificial
[0174] <223> primer
[0175] <400> 5
[0176] GGACACTAGCATGTCCTAGCATG 23
[0177] <210> 14 RSVB NBlc
[0178] <211> 24
[0179] <212> DNA
[0180] <213> artificial
[0181] <223> primer
[0182] <400> 6
[0183] GGAGCAAGTTGTGGAAGTCTATGA 24
[0184] <210> 15 RSVB NLoopB
[0185] <211> 23
[0186] <212> DNA
[0187] <213> artificial
[0188] <223> primer
[0189] <400> 7
[0190] GCACAGAAGTTGGGAGGAGAAGC 23 <210> 16 RSVA N gene
[0191] <211> 1301
[0192] <212> DNA
[0193] <213>
[0194] <223> gen
[0195] <400> 8
[0196] ATTTAGTAGCCCTGTTGTTTGCATCTTCTCCATGGAATTCAGGAGCAAACTTTTCCATGATGATTTATTTGCCCC
[0197] ATTTTTTATTAACTCAAAGCTCTACATCATTATCTTTTGGATTAAGCTGATGTTTGATAGCCTCTAGTTCTTCTG
[0198] CTGTCAAGTCTAATACACTGTAGTTAATCACACCATTTTCTTTGAGTTGTTCAGCATATGCCTTTGCTGCATCAT
[0199] ATAGATCTTGATTCCTCGGTGTACCTCTGTACTCTCCCATTATGCCTAGGCCAGCAGCATTGCCTAATACTACAC
[0200] TGGAAAAGTGAGGAAATTGAGTCAAAGATAATAATGATGCTTTTGGGTTGTTCAATATATGGTAGAATCCTGCTT
[0201] CTCCACCCAATTTTTGGGCATATTCATAAACCTCAACAACTTGTTCCATTTCTGCTTGCACACTAGCATGTCCTA
[0202] ACATAATATTTTTAACTGATTTTGCTAAGACTCCCCACCGTAGCATTACTTGCCCTGCACCATAGGCATTCATAA
[0203] ACAATCCTGCAAAAATCCCTTCAACTCTACTGCCACCTCTGGTGGAAGATTGTGCTATACCAAAATGAACAAAAA
[0204] CATCTATAAAGTGGGGATGTTTTTCAAACACTTCATAGAAGCTGTTGGCTATATCCTTGGGTAGTAAGCCTTTGT
[0205] AACGTTTCATTTCATTTTTTAGGACATTATTAGCTCTCCTAATCACGGCTGTAAGACCAGATCTATCCCCTGCTG
[0206] CCAATTTGGTTATTACTAATGCTGCTATACATAATATTATCATCCCACAATCAGGAGAATCATGCCTGTATTCTG
[0207] GAGCTACCTCTCCCATTTCTTTTAGCATTTTTTTGTAGGATTTTCTAGATTCTATCTCAATGTTGATTTGAATTT
[0208] CAGTTGTTAAGCTTGCCAATGTTAACACTTCAAATTTCATTTCTTTCCCATTGATGTCTTGACGATGTGTTGTTA
[0209] CATCTACTCCATTTGCTTTTACATGATATCCCGCATCTCTGAGTATTTTTATGGTGTCTTCTCTTCCTAACCTAG
[0210] ACATAGCATATAACATACCTATTAACCCAGTGAATTTATGATTAGCATCTTCTGTGATTAATAACATGCCACATA
[0211] ACTTATTGATGTGTTTCTGCACATCATAATTAGGAGTATCAATACTATCTCCTGTGCTCCGTTGGATGGTGTATT
[0212] TGCTAGATGACAGAAGTTGATCTTTGTTGAGTGTATCATTCAACTTGACTTTGCTAAGAGCCATCTTTGTATTTG CCCCATCTTCTATCTTATGTCTCTCC
[0213] <210> 17 RSVB N gene
[0214] <211> 1176
[0215] <212> DNA
[0216] <213>
[0217] <223> gen
[0218] <400> 9
[0219] ATGGCTCTTAGCAAAGTCAAGTTAAATGATACATTAAATAAGGATCAGCTGCTGTCATCTAGCAAATACA
[0220] CTATTCAACGTAGTACAGGAGATAATATTGACACTCCCAATTATGATGTGCAAAAACACTTAAACAAACT
[0221] ATGTGGT'ATGCTATTAATCACGGAAGATGCAAATCATAAATTCACAGGATTAATAGGTATGTTATATGCT
[0222] ATGTCCAGGTTAGGAAGGGAAGACACTATAAAGATACTTAAAGATGCTGGATATCATGTTAAAGCTAATG
[0223] GAGTAGATATAACAACATATCGTCAAGATATAAATGGAAAGGAAATGAAATTCGAAGTATTAACATTATC
[0224] AAGCTTGACATCAGAAATACAAGTCAATATTGAGATAGAATCTAGAAAGTCCTACAAAAAAATGCTAAAA
[0225] GAGATGGGAGAAGTGGCTCCAGAATATAGGCATGATTCTCCAGACTGTGGGATGATAATACTGTGTATAG CTGCACTTGTAATAACCAAATTAGCAGCAGGAGATAGATCAGGTCTTACAGCAGTAATTAGGAGGGCAAA
[0226] CAATGTCTTAAAAAACGAAATAAAACGCTACAAGGGCCTCATACCAAAGGATATAGCTAACAGTTTTTAT GAAGTGTTTGAAAAACACCCTCATCTTATAGATGTTTTTGTGCACTTTGGCATTGCACAATCATCCACAA GAGGGGGTAGTAGAGTTGAAGGAATCTTTGCAGGATTATTTATGAATGCCTATGGTTCAGGGCAAGTAAT GCTAAGATGGGGAGTTTTAGCCAAATCTGTAAAAAATATCATGCTAGGACATGCTAGTGTCCAGGCAGAA
[0227] ATGGAGCAAGTTGTGGAAGTCTATGAGTATGCACAGAAGTTGGGAGGAGAAGCTGGATTCTACCATATAT
[0228] TGAACAATCCAAAAGCATCATTGCTGTCATTAACTCAATTTCCTAACTTCTCAAGTGTGGTCCTAGGCAA TGCAGCAGGTCTAGGCATAATGGGAGAGTATAGAGGTACACCAAGAAACCAGGATCTTTATGATGCAGCC AAAGCATATGCAGAGCAACTCAAAGAAAATGGAGTAATAAACTACAGTGTATTAGACTTAACAGCAGAAG AATTGGAGGCCATAAAGCATCAACTCAACCCCAAAGAAGATGATGTAGAGCTCTAA
Claims
Claims1. A set of primers for amplifying the nucleotide sequence of the RSVA N gene, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers comprising the following nucleotide sequences c) and d): a) 5' GCACACTAGCATGTCCTAACATAAT 3'- (nucleic sequence SEQ ID NO:5 or its reverse and complementary sequence), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5' CAGGGCAAGTGATGTTACG 3'- (nucleic sequence SEQ ID NO: 3 or its reverse and complementary sequence) c) 5' TGGAACAAGTTGTTGAGGTTTATGA 3'- (nucleic sequence SEQ ID NO:6 or its reverse and complementary sequence), linked at the 3' end, preferably by a TTTT bridge, to the sequence 5' GGTTGTTCAATATATGGTAGAATCC 3'- (nucleic sequence SEQ ID NO: 4 or its reverse and complementary sequence) d) 5' TGTTTATGAATGCCTATGGTG 3' nucleic sequence SEQ ID NO: 1 or its reverse and complementary sequence, and e) 5' GTGAGGAAATTGAGTCAAAGA 3' nucleic sequence SEQ ID NO: 2 or its reverse and complementary sequence.
2. The set of primers of claim 1, characterized in that it comprises a set of loop primer sequences comprising nucleic sequences contained in or complementary to the RSVA N gene SEQ ID NO: 7 - 5' TGATTTTGCTAAGACTCCCCAC 3a'nd SEQ ID NO: 8: 5' ATGCCCAAAAATTGGGTGGAG 3' or sequences reverse and complementary thereto.
3. A set of primers for amplifying the nucleotide sequence of the RSVB N gene, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) andb), as well as a set of external primers comprising the following nucleotide sequences c) and d): a) 5' GGACACTAGCATGTCCTAGCATG 3'- (nucleic sequence SEQ ID NO:13 or its reverse and complementary sequence), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5' GTAATGCTAAGATGGGGAGTT 3'- (nucleic sequence SEQ ID NO: 11 or its reverse and complementary sequence) b) 5' GGAGCAAGTTGTGGAAGTCTATGA 3'- (nucleic sequence SEQ ID NO:14 or its reverse and complementary sequence), linked at the 3' end, preferably by a TTTT bridge, to the sequence 5' GATTGTTCAATATATGGTAGAATCC 3'- (nucleic sequence SEQ ID NO: 12 or its reverse and complementary sequence) c) 5' TGAATGCCTATGGTTCAGG 3' nucleic sequence SEQ ID NO: 9 or its reverse and complementary sequence, and d) 5' TTGAGTTAATGACAGCAATGA n3u'cleic sequence SEQ ID NO: 10 or its reverse and complementary sequence.
4. The set of primers of claim 1, characterized in that it comprises a loop primer sequence comprising nucleic sequence contained in or complementary to the RSVB N gene SEQ ID NO: 15 - 5' GCACAGAAGTTGGGAGGAGAAGC 3'.
5. A method of detecting RSVA and RSVB in one reaction, characterized in that a selected region of the nucleic sequence of the viral genome is amplified using the set of primers as defined in claims 1, 2, 3 and claim 4, the amplification method being the RT-LAMP method.
6. The method of detecting viruses of claim 5, characterized in that the amplification is carried out with a temperature profile of:SUBSTITUTE SHEET (RULE26)- 63°C, 40 min.
7. The method of claim 5 and 6, characterized in that an endpoint reaction is carried out with an additional temperature profile of 80°C, 5 min following the main step of claim 6.
8. A method for detecting infection caused by RSVA and RSVB, characterized in that it comprises the detection method as defined in claims 5-7.
9. A kit for detecting infection caused by RSVA and / or RSVB, characterized in that it comprises the set of primers as defined in claims 1, 2 and in claims 3 and 4.
10. The kit for detecting infection of claims 5-9, characterized in that it comprises 5.0 μL of WarmStart LAMP Master Mix (NEB).
11. The kit for detecting infection of claims 5-9, characterized in that it comprises the amplification primers as defined in claims 1 and 2 and in claims 3 and 4, wherein the primers have the following concentrations for RSVA: 0.065 μM F3, 0.065 μM B3, 0.53 μM FIP, 0.53 μM BIP, 0.13 μM LoopF, 0.13 μM LoopB and for RSVB: 0.065 μM F3, 0.065 μM B3, 0.53 μM FIP, 0.53 μM BIP, 0.13 μM LoopB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1.25%; fluorescent marker interacting with double-stranded DNA EvaGreen (Biotium) ≤1X or Fluorescent Dye (New England Biolabs) in the amount of ≤0.5 μl or GreenFluorescent Dye (Lucigen) in the amount of ≤1 μl or Syto-13 (ThermoFisher Scientific) ≤16 μM or SYTO-82 (ThermoFisher Scientific) ≤16 μM or another fluorescent dye interacting with double-stranded DNA at a concentration that does not inhibit the amplification reaction.SUBSTITUTE SHEET (RULE26)