Etx dependent diagnosis and therapy of multiple sclerosis

EP4665874A1Pending Publication Date: 2025-12-24CORNELL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024714294
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-06-22
Filing Date
2024-02-16
Publication Date
2025-12-24

AI Technical Summary

Technical Problem

There is a long-standing need for identifying environmental triggers and causes of multiple sclerosis (MS) to develop effective therapeutic and prophylactic treatments, as current methods lack specificity in detecting biologically plausible environmental agents responsible for disease initiation.

Method used

The method involves detecting the relative abundance of epsilon toxin (ETX) gene-harboring C. perfringens strains in the gut microbiome or epsilon toxin bound to lymphocytes, using Polymerase Chain Reaction (PCR) and flow cytometry, to guide standard-of-care MS evaluations and therapies, with specific thresholds for intervention.

Benefits of technology

This approach enables confirmatory diagnosis, prognosis, monitoring of MS progression, and responsiveness to treatment, as well as prevention and treatment of MS by targeting ETX-harboring strains, potentially reducing symptoms and severity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024016299_22082024_PF_FP
    Figure US2024016299_22082024_PF_FP
Patent Text Reader

Abstract

Provided herein are compositions and methods for monitoring and therapy of patients with Multiple Sclerosis (MS) based on detection of epsilon toxin (ETX) gene / ETX gene-harboring strains of C. perfringens and / or detection of ETX bound to lymphocytes. In some aspects, provided herein are compositions and methods for detection of ETX gene (in particular, quantitative detection of relative abundance of ETX gene-harboring strains of C. perfringens) in fecal samples of a subject, e.g., for identification, monitoring, and treatment of the subject with MS. In some embodiments, provided herein are specific primers for use in such compositions and methods. In other aspects, provided herein are compositions and methods for detection of ETX bound to lymphocytes in blood samples of a subject (such as by use of flow cytometry), e.g., for identification, monitoring, and treatment of the subject with MS. In some embodiments, provided herein are specific therapies for use in MS patients with either elevated level s / abundance of the ETX gene or ETX bound to lymphocytes.
Need to check novelty before this filing date? Find Prior Art

Description

ETX DEPENDENT DIAGNOSIS AND THERAPY OF MULTIPLE SCLEROSISCROSS-REFERENCE TO RELATED APPLICATIONSThis patent application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 522,610, filed June 22, 2023; 63 / 446,677, filed February 17, 2023; and 63 / 446,593, filed February 17, 2023; the contents of each of which are incorporated by reference herein in their entireties.GOVERNMENT SUPPORTThis invention was made with U.S. government support under Grant Number R21 RNS 106581 A awarded by the National Institutes of Health. The government has certain rights in the invention.FIELDThe present invention is generally directed to compositions and methods for identifying patient populations for the prevention and treatment of multiple sclerosis by detecting relative abundance of strains of C. peifringens harboring epsilon toxin gene (ETX) in gut microbiome or detecting epsilon toxin bound to lymphocytes in the blood.BACKGROUNDMultiple Sclerosis (MS) is a complex disease of the CNS. MS lesions are centered on post-capillary venules, and impairment of blood-brain barrier (BBB) function is considered the earliest event in lesion evolution, paving the way for entry of myelin autoreactive lymphocytes. MS disease initiation, and thus lesion formation, is believed to require an environmental trigger in a genetically susceptible individual, but biologically plausible environmental agents responsible for lesion induction have been elusive.There remains a long felt and unmet need for identifying environmental triggers and causes of MS to develop new therapeutic and prophylactic treatments of MS.SUMMARY OF THE INVENTIONAspects of the invention disclosed herein include methods for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, prevention of MS, and / or treatmentAttorney Docket No.: CUW-02625of MS in a human subject at risk for or suffering from MS comprising (a) obtaining a fecalsample from the human subject; (b) detecting, in the obtained fecal sample, byPolymerase Chain Reaction (PCR), optionally Real-Time quantitative Polymerase ChainReaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-harboring C.perfringens strains relative to the abundance of non-ETX strains of C. perfringens in thehuman subject; and if the abundance of ETX-harboring C. perfringens strains is above themedian level for a healthy subject: (i) performing a standard-of-care MS evaluation of thehuman subject, (ii) administering to the human subject a standard-of-care MS therapy,and / or (iii) administering to the human subject a composition comprising an agent thatdirectly or indirectly interferes with ETX or ETX-harboring C. perfringens strains; and ifthe abundance of ETX-harboring C. perfringens strains is below or equal the median levelof a healthy subject: (i) not performing a standard-of-care MS evaluation of the humansubject, (ii) not administering to the subject an MS therapy, and / or (iii) not administering tothe subject a composition comprising an agent that directly or indirectly interferes with ETXor ETX-harboring C. perfringens strains. In some of these embodiments, the inventionprovides a method for confirmatory diagnosis of MS. In some of these embodiments, theinvention provides a method for prognosis of MS. In some of these embodiments, theinvention provides a method for monitoring the progression of MS. In some of theseembodiments, the invention provides a method for monitoring responsiveness totreatment of MS. In some of these embodiments, the invention provides a method forprevention of MS. In some of these embodiments, the invention provides a method fortreatment of MS. In some of these embodiments, the invention further provides amethod for reducing at least one symptom of MS. In some of these embodiments, theinvention further provides a method for reducing the severity of MS. In some of theseembodiments, the invention further provides a method for preventing the progression of MS.In some embodiments, if the relative abundance of ETX-harboring C.perfringens strains is greater than 0.001% (or, e.g., greater than 0.01%, 0.1%, 0.5%,1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%): (i) performing a standard-of-careMS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and / or (iii) administering to the human subject a compositioncomprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.perfringens strains. In some embodiments, if the relative abundance of ETX-harboringC. perfringens strains is greater than 0.001%, the human subject is administered aFH11871214.12Attorney Docket No.: CUW-02625composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains (e.g., any such composition described herein, e.g., ananti-ETX antibody or an antigen binding fragment thereof). In other embodiments, astandard-of-care MS therapy is administered instead or in addition to ETX-specifictherapy. In other embodiments, a standard-of-care MS evaluation of the human subject isperformed instead or in addition to one or more of the treatment methods.In some aspects of the invention, provided herein are methods for detection ofrelative abundance of epsilon toxin (ETX) gene-harboring strains of C. perfringens inthe gut microbiome of a subject comprising (a) obtaining a fecal sample from the humansubject; (b) detecting, in the obtained fecal sample, by Polymerase Chain Reaction(PCR), optionally Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), theabundance of epsilon toxin gene (ETX)-harboring strains of C. perfringens relative tothe abundance of non-ETX strains of C. perfringens, wherein the relative abundance ofETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboringC. perfringens strains is greater than 0.001% (or, e.g., greater than 0.01%, 0.1%, 0.5%,1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%).In some embodiments, the subject is a human subject at risk for or suffering frommultiple sclerosis (MS), and if the abundance of ETX-harboring strains of C. perfringensis detected (e.g., greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%,25%, 30%, 35%, or 40%): (i) performing a standard-of-care MS evaluation of the subject,(ii) administering to the subject a standard-of-care MS therapy, and / or (iii) administering tothe subject a composition comprising an agent that directly or indirectly interferes with ETXor ETX-harboring C. perfringens strains. In some embodiments, if the abundance of ETX-harboring strains of C. perfringens is detected: the human subject is administered acomposition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or an antigen binding fragment thereof). In other embodiments, a standard-of-care MS therapy is administered instead or in addition to ETX-specific therapy. In otherembodiments, a standard-of-care MS evaluation of the human subject is performed insteador in addition to one or more of the treatment methods.In some embodiments, the method further comprises a step of selecting the subjectfor treatment with standard-of-care MS therapy, wherein the subject is at risk for, orsuffering from MS, and wherein the subject is selected for treatment wherein the relativeFH11871214.13Attorney Docket No.: CUW-02625abundance of ETX-harboring strains of C. perfringens is detected if the percentage ofETX-harboring C. perfringens strains is greater than 0.001%.In some embodiments, the relative abundance of ETX-harboring strains of C.perfringens in the human subject is greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%,15%, 20%, 25%, 30%, 35%, or 40%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 0.001%. Insome embodiments, the relative abundance of ETX-harboring strains of C. perfringens inthe human subject is greater than 0.01%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 0.1%. Insome embodiments, the relative abundance of ETX-harboring strains of C. perfringens inthe human subject is greater than 0.5%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 1%. Insome embodiments, the relative abundance of ETX-harboring strains of C. perfringens inthe human subject is greater than 5%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 10%. Insome embodiments, the relative abundance of ETX-harboring strains of C. perfringens inthe human subject is greater than 15%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 20%. Insome embodiments, the relative abundance of ETX-harboring strains of C. perfringens inthe human subject is greater than 25%. In some embodiments, the relative abundance ofETX-harboring strains of C. perfringens in the human subject is greater than 30%.In some embodiments, the abundance of ETX-harboring strains of C. perfringens ismeasured by detection of the ETX gene, and the abundance of ETX-harboring and non-ETX strains of C. perfringens is measured by detection of a gene present in ETX-harboring and non-ETX strains of C. perfringens. The gene present in ETX- and non-ETX harboring strains of C. perfringens may be the CPA gene or 16S rRNA gene (e.g.,C. perfringens-specific 16S rRNA gene). In some embodiments, the gene is CPA gene.In some embodiments, the gene is 16S rRNA gene (e.g., C. perfringens-specific 16SrRNA gene).In some embodiments, the relative abundance of ETX-harboring strains of C.perfringens (ETX+, and CPA+ and / or C. perfringens 16S rRNA+) and non-ETX strainsof C. perfringens (ETX-, and CPA+ and / or C. perfringens 16S rRNA+), in the obtainedfecal sample, is measured. In some embodiments, the relative abundance of ETX-harboringFH11871214.14Attorney Docket No.: CUW-02625strains of C. perfringens (ETX+ and CPA+) and non-ETX strains of C. perfringens(ETX- and CPA+) in the obtained fecal sample, is measured. In some embodiments, therelative abundance of ETX-harboring strains of C. perfringens (ETX+ and C. perfringens16S rRNA+) and non-ETX strains of C. perfringens (ETX- and C. perfringens 16SrRNA+), in the obtained fecal sample, is measured.In certain embodiments, 2–∆∆Ct analysis is used to quantify the relative abundance ofETX-harboring strains (e.g., ETX+, and CPA+ and / or C. perfringens 16S rRNA+) overnon-ETX strains (e.g., ETX-, and CPA+ and / or C. perfringens 16S rRNA+) in the obtainedfecal sample; optionally wherein 2–∆∆Ct value of > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75,0.8, or 0.9 indicates an abundance of ETX-harboring C. perfringens strains, and optionally if2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MStherapy, and / or (iii) administering to the subject a composition comprising an agent thatdirectly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In someembodiments, if 2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, the humansubject is administered a composition comprising an agent that directly or indirectlyinterferes with ETX or ETX-harboring C. perfringens strains (e.g., any such compositiondescribed herein, e.g., an anti-ETX antibody or an antigen binding fragment thereof). Inother embodiments, a standard-of-care MS therapy is administered instead or in addition toETX-specific therapy. In other embodiments, a standard-of-care MS evaluation of thehuman subject is performed instead or in addition to one or more of the treatment methods.In some of these embodiments, 2–∆∆Ct is > 0.1. In some of these embodiments, 2–∆∆Ct is >0.25. In some of these embodiments, 2–∆∆Ct is > 0.5. In some of these embodiments, 2–∆∆Ct is> 0.75.In some embodiments, a 2–∆∆Ct value of > 1 indicates dominance of ETX-harboringC. perfringens strains with increased ETX-plasmid copy numbers, and 2–∆∆Ct value of < 1indicates a higher percentage of non-ETX C. perfringen strains; and optionally if 2–∆∆Ct is >1, (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to thesubject a standard-of-care MS therapy, and / or (iii) administering to the subject acomposition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In some embodiments, if 2–∆∆Ct is > 1, the human subject isadministered a composition comprising an agent that directly or indirectly interferes withETX or ETX-harboring C. perfringens strains (e.g., any such composition described herein,FH11871214.15Attorney Docket No.: CUW-02625e.g., an anti-ETX antibody or an antigen binding fragment thereof). In other embodiments, astandard-of-care MS therapy is administered instead or in addition to ETX-specific therapy.In other embodiments, a standard-of-care MS evaluation of the human subject is performedinstead or in addition to one or more of the treatment methods.In some embodiments, between after the fecal sample is obtained and before the detectionstep (such as between step (a) and step (b)), bacteria is separated from nonmicrobial fecal matterof the obtained fecal sample. In some embodiments, the bacteria is separated from thenonmicrobial fecal matter by density gradient centrifugation.In some embodiments, detecting the abundance of ETX-harboring C. perfringensstrains by PCR (e.g., RT-qPCR) comprises use of at least one ETX-targeting primer orprimer pair comprising, consisting essentially of, or consisting of sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.In some embodiments, detecting the abundance of ETX-harboring C. perfringensstrains by PCR (e.g., RT-qPCR) comprises use of at least one ETX-targeting primer orprimer pair comprising, consisting essentially of, or consisting of sequence 5’-ACTCATACTGTGGGAACTTCGA-3’ and / or 5’-ACTCATCTCCCATAACTGCACT-3’.In some embodiments, detecting the abundance of ETX-harboring C.perfringens strains by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probecomprising, consisting essentially of, or consisting of sequenceAGCAACTGCTAAGTTTACTGTTCCT.In some embodiments, detecting the abundance of ETX-harboring C. perfringensstrains comprises detecting the relative abundance of CPA-harboring C. perfringensstrains by PCR (e.g., RT-qPCR) comprising use of at least one CPA-targeting primer orprimer pair comprising, consisting essentially of, or consisting of sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.In some embodiments, detecting the relative abundance of CPA- harboring C.perfringens strains by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probecomprising, consisting essentially of, or consisting of sequenceTTACTGCCGTTGATAGCGCAGGAC.In some embodiments, detecting the abundance of ETX-harboring C. perfringensstrains comprises detecting the relative abundance of C. perfringens-specific 16S rRNAFH11871214.16Attorney Docket No.: CUW-02625by PCR (e.g., RT-qPCR) comprising use of at least one C. perfringens-specific 16S rRNAprimer or primer pair comprising, consisting essentially of, or consisting of sequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'- GCAAGGGATGTCAAGTGT-3'.In some embodiments, detecting the relative abundance of C. perfringens-specific 16S rRNA by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probecomprising, consisting essentially of, or consisting of sequenceAGAGTGCAGGAGAGGAGAGTGGAA.In some embodiments, detecting the abundance of ETX-harboring C.perfringens strains comprises quantifying the relative abundance of ETX-harboring(ETX+, and CPA+ and / or C. perfringens 16S rRNA+) over non-ETX strains (ETX-,and CPA+ and / or C. perfringens 16S rRNA+) in the obtained fecal sample by PCR(e.g., RT-qPCR) comprising use of an ETX-targeting primer pair comprising,consisting essentially of, or consisting of sequences:5'-CATACTGTGGGAACTTCGATACA-3' and5'- TCTTGTGAAGGGACATTATGAGTAA-3', orsequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and5’-ACTCATCTCCCATAACTGCACT-3’,and optionally a fluorogenic probe comprising, consisting essentially of, orconsisting of sequence AGCAACTGCTAAGTTTACTGTTCCT; and(i) CPA-targeting primer pair comprising, consisting essentially of, orconsisting of sequences:5'- GCATGAGTCATAGTTGGGATGA-3' and5'- CTGATGGATCATTACCCTCTGATAC -3', and optionally a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceTGGGACTATGCAGCAAAGGTAACTTTAGC, and / or(ii) universal 16S rRNA primers comprising, consisting essentially of, orconsisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and5'- TCGTTGTACCAGCCATTGTAG -3', andoptionally a fluorogenic probe comprising, consisting essentially of, orconsisting of sequence CCCTTATGACCTGGGCTACACACG. In someembodiments, the CPA gene is used for comparison in detection of relativeabundance of ETX gene. In some embodiments, the 16S rRNA gene is usedfor comparison in detection of relative abundance of ETX gene.FH11871214.17Attorney Docket No.: CUW-02625In some embodiments of the invention, the methods based on the fecal sampleETX detection further comprise (c) obtaining a blood sample from the human subject;and (d) detecting, in the obtained blood sample, by flow cytometry, the presence and / orabundance of epsilon toxin (ETX) bound to lymphocytes, optionally wherein thelymphocyte is CD4+ lymphocyte, and optionally wherein the detecting by flowcytometry comprises isolating lymphocytes, incubating the isolated lymphocytes with afluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody,and detecting the fluorescently labeled anti-ETX antibody bound to lymphocytes; andoptionally only if the presence and / or abundance of epsilon toxin (ETX) bound tolymphocytes is detected in the human subject (optionally if more than 0.1%, 0.2%, 0.5%or 1% of the lymphocytes are positive for ETX), proceeding to the performing and / oradministering steps. In some embodiments, the performing and / or administering stepsare performed if more than 0.2% of the lymphocytes are positive for ETX. In someembodiments, the performing and / or administering steps are performed if more than0.5% of the lymphocytes are positive for ETX.Aspects of the invention provided herein include methods for confirmatorydiagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression ofMS, monitoring responsiveness to treatment of MS, prevention of MS, and / or treatmentof MS in a human subject at risk for or suffering from multiple sclerosis (MS) comprising(a) obtaining a blood sample from the human subject; (b) detecting, in the obtained bloodsample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte,optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein thedetecting comprises isolating lymphocytes from the blood, incubating the isolatedlymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unboundanti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytespositive for ETX; and if the presence of ETX bound to a lymphocyte is detected,optionally wherein more than 0.1%, 0.2%, 0.5% or 1% of the lymphocytes are positivefor ETX: (i) performing a standard-of-care MS evaluation of the human subject, (ii)administering to the human subject a standard-of-care MS therapy, and / or (iii) administeringto the human subject a composition comprising an agent that directly or indirectly interfereswith ETX or ETX-harboring C. perfringens strains; and if the presence of ETX bound to alymphocyte is not detected or substantially not detected, or wherein less than 0.1% or0.2% of the lymphocytes are positive for ETX: (i) not performing a standard-of-care MSFH11871214.18Attorney Docket No.: CUW-02625evaluation of the human subject, (ii) not administering to the subject an MS therapy, and / or(iii) not administering to the subject a composition comprising an agent that directly orindirectly interferes with ETX or ETX-harboring C. perfringens strains. In some of theseembodiments, the invention provides a method for confirmatory diagnosis of MS. In some ofthese embodiments, the invention provides a method for prognosis of MS. In some of theseembodiments, the invention provides a method for monitoring the progression of MS. Insome of these embodiments, the invention provides a method for monitoringresponsiveness to treatment of MS. In some of these embodiments, the inventionprovides a method for prevention of MS. In some of these embodiments, the inventionprovides a method for treatment of MS. In some of these embodiments, the inventionfurther provides a method for reducing at least one symptom of MS. In some of theseembodiments, the invention further provides a method for reducing the severity of MS. Insome of these embodiments, the invention further provides a method for preventing theprogression of MS. In some embodiments, the performing and / or administering steps areperformed if more than 0.2% of the lymphocytes are positive for ETX. In someembodiments, the performing and / or administering steps are performed if more than0.5% of the lymphocytes are positive for ETX.In some aspects, provided herein are methods for detection of epsilon toxin in theblood of a subject comprising (a) obtaining a blood sample from the subject; (b)detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin(ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte,and optionally wherein the detecting comprises isolating lymphocytes from the blood,incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody,washing off the unbound anti-ETX antibody, and detecting the presence, and optionallypercent, of lymphocytes positive for ETX.In some embodiments, the subject is a human subject at risk for or suffering frommultiple sclerosis (MS), and if the ETX bound to a lymphocyte is detected, optionallywherein more than 0.1%, 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX: (i)performing a standard-of-care MS evaluation of the subject, (ii) administering to the subjecta standard-of-care MS therapy, and / or (iii) administering to the subject a compositioncomprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.perfringens strains. In some embodiments, the performing and / or administering steps areperformed if more than 0.2% of the lymphocytes are positive for ETX. In someFH11871214.19Attorney Docket No.: CUW-02625embodiments, the performing and / or administering steps are performed if more than0.5% of the lymphocytes are positive for ETX.In some embodiments, the method further comprises a step of selecting the subjectfor treatment with standard-of-care MS therapy, wherein the subject is at risk for, orsuffering from MS, and wherein the subject is selected for treatment wherein the relativeabundance of ETX-harboring strains of C. perfringens is detected if the percentage ofETX-harboring C. perfringens strains is greater than 0.001%.In some embodiments, the methods of blood sample ETX detection further comprise(c) obtaining a fecal sample from the human subject; and (d) detecting, in the obtainedfecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), theabundance of epsilon toxin (ETX) gene-harboring C. perfringens strains relative to theabundance of non-ETX strains of C. perfringens in the human subject; and optionallyonly if the abundance of ETX-harboring C. perfringens strains in the human subject isabove the median level for a healthy subject, or wherein the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.001%, 0.01%,0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%, proceeding to theperforming and / or administering steps.In some embodiments, before the obtaining of a sample step (such as before step (a)), thehuman subject is selected, wherein the human subject has MS or has one or more symptomsof MS. In some embodiments, it is contemplated that any of the methods provided herein areperformed on a subject that has been diagnosed with MS. In some embodiments, it iscontemplated that any of the methods provided herein are performed on a subject thatdisplays one, two, three or more symptoms of MS. In some embodiments, it is contemplatedthat any of the methods provided herein are performed on a subject that has relapsed MS oris at risk of relapse or progression of MS. In other embodiments, it is contemplated that anyof the methods provided herein are performed on a subject that is at risk of MS.In some embodiments, if the abundance of ETX-harboring C. perfringens strains isabove the median level for a healthy subject and / or if the presence of ETX bound to alymphocyte is detected, administering to the subject a composition comprising an agent thatdirectly or indirectly interferes with ETX or ETX-harboring C. perfringens strains, therebytreating MS, reducing at least one symptom of MS, reducing the severity of MS, preventingMS, and / or preventing the progression of MS in the human subject.FH11871214.110Attorney Docket No.: CUW-02625In some aspects of the invention, provided herein are methods for treating multiplesclerosis (MS), reducing at least one symptom of MS, reducing the severity of MS, preventing MS,and / or preventing the progression of MS, in a human subject, the method comprising: (a)selecting a subject for treatment, wherein the subject is at risk for, or suffering from MS, andwherein the subject is selected for treatment wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C.perfringens strains is greater than 0.001%, (b) administering to the subject a standard-of-care MS therapy, and / or administering to the subject a composition comprising an agent thatdirectly or indirectly interferes with ETX or ETX-harboring C. perfringens strains, therebytreating MS, reducing at least one symptom of MS, reducing the severity of MS, preventingMS, and / or preventing the progression of MS in the human subject. In some embodiments,the relative abundance of ETX-harboring strains of C. perfringens is detected by: (a) obtaininga fecal sample from the human subject; (b) detecting, in the obtained fecal sample, byPolymerase Chain Reaction (PCR), optionally Real-Time quantitative Polymerase ChainReaction (RT-qPCR), the abundance of epsilon toxin gene (ETX)-harboring strains of C.perfringens relative to the abundance of non-ETX strains of C. perfringens. In someembodiments, the relative abundance of ETX-harboring strains of C. perfringens is detected by(a) obtaining a blood sample from the subject; (b) detecting, in the obtained bloodsample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte,optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein thedetecting comprises isolating lymphocytes from the blood, incubating the isolatedlymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unboundanti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytespositive for ETX. In some of these embodiments, the invention provides a method fortreating MS. In some of these embodiments, the invention provides a method for reducing atleast one symptom of MS. In some of these embodiments, the invention provides a methodfor reducing the severity of MS. In some of these embodiments, the invention provides amethod for preventing MS. In some of these embodiments, the invention provides amethod for preventing the progression of MS.In some embodiments, the standard-of-care MS evaluation comprises magneticresonance imaging (MRI), evoked potentials tests, cerebral spinal fluid analysis, motor skillsassessments, and / or blood tests.FH11871214.111Attorney Docket No.: CUW-02625In some embodiments, administering to the subject a standard-of-care MS therapycomprises administering any one or more of the following therapies: (i) an injectiblemedication, wherein the injectable medication is interferon beta-1a, interferon beta-1b, glatirameracetate, ofatumumab, or peginterferon beta-1a; (ii) an oral medication, wherein the oralmedication is teriflunomide, monomethyl fumarate, dimethyl fumarate, fingolimod, cladribine,Siponimod, ponesimod, fingolimod, diroximel fumarate, or ozanimod; (iii) an infusedmedication, wherein the infused medication is ublituximab, alemtuzumab, mitoxantrone,ocrelizumab, natalizumab-sztn, or natalizumab; and (iv) rituximab or glucocorticoids.In some embodiments, administering to the subject a composition comprising an agentthat directly or indirectly interferes with ETX or ETX-harboring C. perfringens strainscomprises administering to the subject a composition comprising an effective amount of anagent that directly or indirectly interferes with ETX.In some embodiments, the agent that directly or indirectly interferes with ETX is aninhibitor of ETX. In some embodiments, said inhibitor is an antibody against ETX or anantigen binding fragment thereof. In some embodiments, said antibody against ETX or anantigen binding fragment thereof: (a) prevents ETX pore formation, (b) prevents cellcytotoxicity, (c) clears ETX from circulation, (d) targets ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP), (e) neutralizes ETX, inhibits ETX binding to ETX-binding receptor, and / or (f) inhibits or prevents oligomerization of ETX. In someembodiments, said antibody against ETX or an antigen binding fragment thereof: neutralizesETX, inhibits ETX binding to ETX-binding receptor, and / or inhibits or preventsoligomerization of ETX. In some embodiments, said antibody against ETX or an antigenbinding fragment thereof: (a) prevents ETX pore formation, (b) prevents cell cytotoxicity, (c)clears ETX from circulation, and / or (d) targets ETX for phagocytosis or antibody-dependentcellular phagocytosis (ADCP). In some embodiments, said antibody or antigen-bindingfragment thereof is selected from the group consisting of a monoclonal antibody, a polyclonalantibody, and a recombinant antibody; or an antigen-binding fragment thereof. In someembodiments, said antibody is a monoclonal antibody or an antigen-binding fragmentthereof. In some embodiments, said antibody is a human or humanized antibody, or anantigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is ananobody, a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fv fragment, a dAbfragment, a single chain antibody, a single domain antibody, a VHH, a maxibody, aminibody, an intrabody, a diabody, a triabody, a tetrabody, an v-NAR or a bis-scFv. In someFH11871214.112Attorney Docket No.: CUW-02625embodiments, the antigen-binding fragment thereof is a nanobody. In some embodiments, theantigen-binding fragment thereof is an scFv. In some embodiments, the antigen-bindingfragment thereof is a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fv fragment, anadAb fragment, or a VHH.In some embodiments, the agent that directly or indirectly interferes with ETX is aninhibitor or antagonist of an ETX- binding receptor. In some embodiments, the ETX-bindingreceptor is expressed on endothelial cells of blood brain barrier (BBB). In some embodiments,said ETX-binding receptor is a tetraspan integral membrane receptor, wherein the tetraspanintegral membrane receptor is myelin- and-lymphocyte protein (MAL) or Hepatitis A VirusCellular Receptor 1 (HAVcR1). In some embodiments, said agent is a soluble ETX-bindingreceptor protein, wherein the soluble ETX-binding receptor protein is soluble HAVcR1, asoluble MAL, or a fragment thereof.In some embodiments, the agent that directly or indirectly interferes with ETX is a phagelytic enzyme specific for Clostridium perfringens Type B or D bacterial strain. In someembodiments, said phage lytic enzyme is a muramidase derived from strain ATCC 13124(PlyCM). In some embodiments, said agent is a probiotic strain expressing a phage lytic enzymespecific for Clostridium perfringens Type B and / or D bacterial strain.In some embodiments, the agent that directly or indirectly interferes with ETX is avaccine against Clostridium perfringens type B and / or type D, or the ETX producedtherefrom.In some embodiments, the agent that directly or indirectly interferes with ETX is aprobiotic supplement comprising C. peifringens type A or other bacteria type that caneffectively outcompete Clostridium perfringens type B and / or D.In some embodiments, the agent that directly or indirectly interferes with ETX is anantibiotic sufficient to kill C. perfringens type B and / or D.In certain aspects, provided herein are compositions for preventing or treatingmultiple sclerosis (MS) in a patient in need thereof comprising a pharmaceuticallyacceptable excipient and an effective amount of an agent disclosed herein, optionallywherein the composition is for preventing or treating MS after the detecting disclosedherein.In some embodiments of any of the methods provided herein, PCR used isquantitative PCR. In some embodiments of any of the methods provided herein, the subjectis a human subject suffering from or diagnosed with MS. In some embodiments, the subjectFH11871214.113Attorney Docket No.: CUW-02625is a human subject having one, two, three or more symptoms of MS. In some embodiments,the subject is suspected of having MS (e.g., based on preliminary evaluation or presence of oneor more symptoms). In other embodiments, the subject is a human subject at risk of MS. Insome embodiments, the subject is a human subject whose MS has relapsed or at risk ofrelapse or progression.In other aspects of the invention, provided herein are compositions or kits for PCR (e.g.,RT-qPCR) detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, orabundance thereof, comprising at least one ETX-targeting primer or primer paircomprising, consisting essentially of, or consisting of sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.In another aspect of the invention, provided herein are compositions or kits for PCR (e.g.,RT-qPCR) detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, orabundance thereof, comprising at least one ETX-targeting primer or primer paircomprising, consisting essentially of, or consisting of sequence 5’-ACTCATACTGTGGGAACTTCGA-3’ and / or 5’-ACTCATCTCCCATAACTGCACT-3’.In some embodiments, the compositions or kits provided herein furthercomprise a fluorogenic probe comprising, consisting essentially of, or consistingof sequence AGCAACTGCTAAGTTTACTGTTCCT.In yet another aspect of the invention, provided herein are compositions or kits forPCR (e.g., RT-qPCR) detection of CPA-harboring C. perfringens strains, or abundancethereof, comprising at least one CPA-targeting primer or primer pair comprising,consisting essentially of, or consisting of sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.In some embodiments, the compositions or kits provided herein further comprisea fluorogenic probe comprising, consisting essentially of, or consisting of sequenceTTACTGCCGTTGATAGCGCAGGAC.In further aspects of the invention, provided herein are compositions or kits for PCR(e.g., RT-qPCR) detection of C. perfringens-specific 16S rRNA, or abundance thereof,comprising at least one C. perfringens-specific 16S rRNA primer or primer paircomprising, consisting essentially of, or consisting of sequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'- GCAAGGGATGTCAAGTGT-3'.FH11871214.114Attorney Docket No.: CUW-02625In some embodiments, the compositions or kits provided herein furthercomprise a fluorogenic probe comprising, consisting essentially of, or consisting ofsequence AGAGTGCAGGAGAGGAGAGTGGAA.In some aspects of the invention, provided herein are compositions or kits forPCR (e.g., RT-qPCR) detection of relative abundance of epsilon toxin (ETX)gene-harboring strains of C. perfringens comprising an ETX-targeting primer paircomprising, consisting essentially of, or consisting of sequences:5'-CATACTGTGGGAACTTCGATACA-3' and5'- TCTTGTGAAGGGACATTATGAGTAA-3', orsequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and5’-ACTCATCTCCCATAACTGCACT-3’,and optionally comprising a fluorogenic probe comprising, consistingessentially of, or consisting of sequence:AGCAACTGCTAAGTTTACTGTTCCT; and(i) CPA-targeting primer pair comprising, consisting essentially of, or consisting ofsequences:5'- GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC-3', and optionally comprising a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceTGGGACTATGCAGCAAAGGTAACTTTAGC, and / or(ii) universal 16S rRNA primers comprising, consisting essentially of, or consistingof sequences 5'-GCGAGACTGCCGGTAATAAA-3', and5'- TCGTTGTACCAGCCATTGTAG-3', and optionally comprising a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceCCCTTATGACCTGGGCTACACACG.In some embodiments of the compositions and kits provided herein, it is thecomposition (and not a kit). In some embodiments, any of the compositions (for PCRdetection) described herein may further comprise one or more components necessary for thePCR (e.g., RT-qPCR) reaction to proceed. Such components can be any components knownin the art for this purpose, or described herein. In some embodiments of the compositionsand kits provided herein, it is the kit. In some embodiments, any of the kits (for PCRdetection) described herein may comprise the specified components (such as primers andprobes) in one or more containers, together (e.g., mixed together) or separately (comprisedFH11871214.115Attorney Docket No.: CUW-02625in separate containers, e.g., each individual primer in a separate container, and / or each probein a separate container), and may further comprise instructions for use.BRIEF DESCRIPTION OF THE DRAWINGSFigures 1A-1D show the prevalence of etx in the gut microbiome of people with MS and HealthyControls. (A) Workflow of the experimental setup. Fecal bacteria were purified by density gradientcentrifugation in a Nycodenz solution. (B) Initial screen by PCR targeting the 3'-terminal sequence ofetx (542 bp and 390 bp (not shown)) detected more frequent presence of etx in people withMS compared to HC. (C) Subsequent PCRs targeting the 5'-terminal sequence of etx (679bp) confirmed the initial detection results. Detection of C. perfringens-specific 16S rRNAand the chromosomally located alpha toxin (cpa / plc) gene present in all C. perfringensstrains corroborates the source of the etx gene. Participant labels in red indicate negativesfor etx from the initial screen (B), which served as negative controls in the confirmatoryassays. Reference strains including C. perfringens type B (ATCC3626), type D (FD203),and type F (ATCC12915) were included as additional controls. C. perfringens type B and Dare etx-harboring strains and type F is negative for etx. (D) Statistical analysis of etxfrequency by Fisher's exact test.Figures 2A-2I show etx abundance and etx-harboring strains increase in the fecal microbiota ofMS. (A-B) Representative amplification plots (A) and statistical analysis of etx abundance(B) by TaqMan real-time PCR analysis. Of note, the system detected 15 etx-positive MS,fewer than what was detected by standard PCR (19). (C-E) Analysis of cpa abundance byTaqMan real-time PCR shows cpa gene increases in MS. (F) Multiplex PCR revealsdifferent composition of strains in the fecal C. perfringens community from etx-positiveparticipants. Lab strains include etx-negative type A and another three strains shown inFigure 1. Orange asterisks indicate the presence of C. perfringens type E, defined by thepresence of cpa and itx. Blue asterisks indicate cpb, which encodes beta toxin — a virulencedeterminant for C. perfringens type C and is also carried by C. perfringens type B. (G-I)Analysis of etx / cpa ratio by TaqMan real-time PCR using the C. perfringens type B(ATCC3626) and type D (FD203) strains as a calibrator for the quantification of etx-harboring / non-etx strain ratios in the fecal microbiota from etx-positive participants.Quantification of the ratio of etx / cpa by 2-Act (g), etx / cpa against type D culture as calibratorby 2-ΔΔct (H). Estimate of maximum of percentages of etx-harboring / non-etx strain in etx+FH11871214.116Attorney Docket No.: CUW-02625HC and MS (I). The estimates assume participants with 2-ΔΔctabove 1 (type D) contains 100%etx-harboring strains. Mann-Whitney test (non-Gaussian distribution). Black lines in graphsB, C-E, and H indicate medians.Figures 3A-3E show the characterization of patient derived strain SHDS0050 and itscomparison to environmental and laboratory ETX-producing strains. (A) The circular map ofetx+ plasmid (pSHDS0050) from a MS patient-derived SHDS0050 strain is shown with a blackbackbone. Hypothetical and proteins of unknown function ORFs are colored black, thoseinvolved in conjugation are purple, toxin ORFs are red, DNA methylases are green,transposases and recombinases are gray, ribonucleases are pink, plasmid replication ORFs areblue, conserved etx plasmid ORFs are red, and ABC transporters are magenta (reproducedherein in grayscale). The plasmid shows two transposases, a Tn3 and IS1151 upstreamof etx, followed by two IS256 and a mutator transposase downstream. (B) GViewBLAST Atlas map comparing the circular chromosomes of pSHDS0050 as the referencegenome, to the type D strains CN3842, FU17, and NCTC8346, and the type B strainsATCC3626 and NCTC3110. Type D chromosomes are shades of blue, while type B areshades of red. Colored in regions for each genome show where there is a BLAST hit tothe reference genome. Empty slots in the query genomes show where there are nomatching BLAST hits to the reference genome, indicating unique regions in thereference genome. This indicates that the SHDS0050 genome has distinct regions fromthe other etx-encoding strains. (C) Linearized plasmid map comparisons comparingpSHDS0050 with the etx plasmids of two type D collection strains pFU17etx andpNCTC8346etx and two type B strains pATCC3626etx and pNCTC3110etx. Thelinearized maps are color coordinated in the same manner as A, with differenttransposase ORFs having different pattern fillings. The three type D strains share thesame gene content and share many of the same genes with both type B strains, however,the type B strains are larger and have genes not present in their type D counterparts. (D)Western blot analysis for proETX (pETX) production from C. perfringens strains grownovernight in TGY broth. 10ng pETX spiked into PBS or broth were used as positivecontrols. Broth only was used as a negative control. (E) Susceptibility of CHO cellsexpressing human MAL (hMAL-CHO) or GFP control (GFP-CHO) to ETX producedby C. perfringens strains. To activate ETX, harvested broth was activated with trypsin.To determine if cell death was ETX mediated, activated broth was pretreated with aFH11871214.117Attorney Docket No.: CUW-02625neutralizing anti-ETX antibody (.1004). Broth alone was used as a negative control. Celldeath was determined by PI staining. n = 3. p < 0.0001 determined by two-way ANOVA withSidak's multiple comparisons test.Figures 4A-4C show the comparison of ETX- and PTX-EAE in the spinal cord using the classicalscoring scale. (A) Classical EAE score time-course of mice from indicated experimental groups.Pertussis toxin (PTX, 5µg / kg b.w,), ETX at 50 ng / kg b.w.(low, Lo) or 500 ng / kg b.w.(high, Hi)was injected intraperitoneally on day 0 and day 1 following CFA / M0G35_55 immunization.(B) ETX- EAE mice exhibit demyelination in the spinal cord in a pattern similar to that ofPTX-EAE model. Mice immunized with CFA / PBS or CFA / M0G35_55 followed with twoinjections of 5 µg / kg bw PTX (top row) or 500 ng / kg bw ETX (bottom row) on day 0 andday 1, then sacrificed at day 30. Shown on the left panel are representative slides from thelumbar spinal cord stained with Luxol Fast Blue (LFB) for myelin visualization. Both PTXand ETX induce limited focal demyelination in the dorsal column (red circles) and severediffusive demyelination in lateral and ventral funiculus (arrow heads). Dashed red linesdemarcate the border of lesions in ventral white matter (WM) tracts. Quantification (middlepanel) of LFB intensity within WM reveals a similar degree of demyelination in both ETXand PTX models. Right panels are representative binary images generated by applying asame threshold across all treatment groups that were used for quantification. Myelinintegrity is defined by the ratio of LFB-stained area within the WM (pixel with thresholding)over the total area of the WM (pixel without thresholding) as a percentage. (C) Thin sectionelectron microscopy shows demyelination and decompaction of myelin sheath in ETX-EAEmice. Mice immunized with CFA / PBS or CFA / M0G35_55 followed with ETX injections.Shown are representative 75 nm-thick sections taken from the ventral funiculus of lumbarspinal cord. Red asterisks indicate demyelinated axons. Regions framed with yellowrectangles illustrate ultrastructural changes of myelin sheath at a high magnification. Cyanarrowhead points to a myelin sheath segment in decompaction; yellows arrowheads point tosplitting myelin sheath and debris; a red arrow points to expanded space between an axon(A in blue) and myelin sheath. Quantification of the number of unmyelinated axons per unitarea (middle panel) and the percentage of unmyelinated axons with each field (right panel).Data in A, the left panel, are means ± SEM; data in in A, the right panels, and in B representmedian ± range; Kruscal-Wallis test (non-parametric); ns, not significant; n = 4 mice forcontrols (PBS>PTX; PBS>ETX-Hi), n = 6 mice for MOG>EAE-Lo, and n = 8 mice forFH11871214.118Attorney Docket No.: CUW-02625groups including MOG>PTX and MOG>ETX-Hi. Data in C represent mean ± SD; unpairedt-test; *** p < 0.001; n = 24 fields from 2 mice. Scale bars, 1 mm in B, 500 nm (top panels)and 200 nm (lower panels) in C. Similar results were achieved in two independentlyrepeated experiments.Figures 5A-5C show ETX-EAE is characterized by multifocal demyelination in the CNS.(A) ETX-EAE mice developed atypical EAE, which is characterized by ataxia, along withclassical EAE symptoms defined by ascending paralysis. (B) ETX targets broader brainregions compared to PTX. ETX-EAE mice (left column) exhibit significantly more focaldemyelinating lesions (arrowheads and red dashed circles) in the cerebellum (top row) andcorpus callosum (cc, lower row) within WM tracts when compared to PTX-EAE mice (rightcolumn). Asterisk indicates cc. Black arrows indicate borders of a cc lesion, which is alsoframed with a red dashed rectangle). A corresponding location in PTX- EAE mice (rightcolumn) is indicated by white arrows. (C) Quantification of lesions in the cerebellum andcorpus collosum. Data in A are means ± SEM, and data in C represent median ± range;Kruscal-Wallis test (non-parametric). n = 4 mice for controls (PBS>PTX; PBS>ETX-Hi),n = 6 mice for MOG>ETX-Lo, and n = 8 mice for groups including MOG>PTX andMOG>ETX-Hi. ns, not significant. Scale bars, 1 mm in B and 100 p.m in the inserts. Similarresults were achieved in two independently repeated experiments.Figures 6A-6F show ETX-EAE mice show increased CD4+ lymphocyte infiltration in thecerebellum and thalamus compared to PTX-EAE. Sections from mice sacrificed at day 30 post-immunization with CFA / M0G35_55 and followed by either ETX or PTX were immunostainedwith anti-CD4 antibody. (A-C) are representative micrographs of CD4 staining in the CNS.The majority of CD4+ cells were found in the spinal cord (A) and to a much lesser degree, inbrain regions including cerebellum (B) and thalamus (C). In the spinal cord (A), CD4+ cellsare localized to the white matter (arrowheads). In the cerebellum (B) of ETX-EAE mice,markedly stained CD4+ cells are frequently found in prominent perivascular cuffs andsurrounding parenchyma (area 1), indicative of active infiltration. By contrast, CD4+ cells fromthe cerebellum of PTX-EAE mice are either localized to perivascular space (area 1') or in ascattered manner (area 2'). A high magnification micrograph (1-s1) shows membranelocalization of CD4 (brown stain, black arrow). CD4+ cells are also found in the white matterof the thalamus (C), including optic tracts (1, 1'), medial lemniscus (2, 2'), and posteriorFH11871214.119Attorney Docket No.: CUW-02625commissure (3, 3') in ETX-EAE but not PTX-EAE mice (1'-3') except optic tracts. In eachpanel, boxed regions are shown at higher magnifications below corresponding images. Sectionswere counter stained with hematoxylin to reveal cell I nuclei and overall morphology. (D)Image J-generated binary drawings on CD4+ distribution (black dots) in the white matter (WM)of spinal cord (SC, orange arrows)) and cerebellum (Ceb). Orange arrowheads in Ceb point toCD4+ cells that appear to be confined to a single layer in the meninges (area 1). Area 2 showsperivascular localization of CD4+ cells in the Ceb. GM, grey matter. Scale bars, 1 mm (A andB, top rows), 2 mm (C, top row), 200 p.m (A and C, bottom rows; B, middle row), 500 p.m (D,left column), 100 p.m (D, right column), 50 p.m (B, bottom left panel). (E and F) Statisticalanalysis of total CD4+ cell counts (E) and CD4+ perivascular cuffs in the three CNS regions.Data represent median ± range; Kruscal-Wallis test (non-parametric). ns, not significant. n = 4and 8 mice for controls (Control: CFA / PBS>PTX; ETX: CFA / PBS>ETX-Hi) and EAE groups(PTX-EAE: CFA / MOG>PTX; ETX-EAE: CFA / MOG / ETX-Hi), respectively.Figures 7A-7E show ETX-EAE mice show increased CD68+ microglia in the cerebellum ofETX-EAE mice compared to PTX-EAE mice, despite similar activation in the spina cord and acomparable profile of transcription factor NJFKB p65 in both models. (A) Representativesections from mice sacrificed at day 30 post-immunization with CFA / M0G35_55 and followedby either ETX or PTX were immunostained with anti-CD68 antibody or anti-phospho-NFB p65(Ser 276). A rectangle-framed region in each condition in panel A is shown at a highermagnification beneath the corresponding section. Ceb, cerebellum; SC, spinal cord. Scale barsrepresent 500 and 50 p.m for the spinal cord and 1 mm and 20 p.m for the cerebellum at low-magnification and high magnification, respectively. (B-E) Statistical analysis of stainingintensity for CD 68 (A and B) and phosphor-NFKB p65 (D and E) in the spina cord (B andD) and cerebellum (C and E), respectively. Data represent median ± range; Kruscal-Wallistest (non-parametric). ns, not significant. n = 4 and 8 mice for controls (Control:CFA / PBS>PTX; ETX: CFA / PBS>ETX-Hi) and EAE groups (PTX-EAE: CFA / MOG>PTX;ETX-EAE: CFA / MOG / ETX-Hi), respectively.Figures 8A-G show transcriptome analysis of ETX and PTX treated CNS endothelial cells fromspinal cord. (A) Principal-component (PC) analysis of RNA-seq data, based on the top 1000 mostvariable genes. Each symbol represents a biological replicate, and each component is indicatedwith the amount of variation that it explains. (B) Venn diagram showing extent of overlapFH11871214.120Attorney Docket No.: CUW-02625between genes differentially expressed in ETX or PTX treated samples relative to control(PBS). (C) Correlation analysis of log2 fold-changes between genes that change in both ETXand PTX displayed as a scatterplot, R2 = 0.96. (D) Heat map of DEGs of interest relevant toimmune privilege (FDR < 0.10) in ETX or PTX. (E) Heat map of DEGs induced by ETXand / or PTX reported by Munji (101) in a BBB dysfunction module. (F) Heat map of all DEGsby ETX and / or PTX relative to PBS control. (G) Selected pathways predicted to be activatedin ETX treated cells by Ingenuity Pathway Analysis (p < 0.05 and z-score >= 1) based on thedifferentially expressed genes compared to PBS cells.Figures 9A and 9B show the geographic location of participants in HITMS. Participantsgeographic locations were mapped using their home zip codes at the time of fecal sample donation.Individual participants are shown in red for MS (A), and purple for HC (B). The majority ofparticipants in both groups, MS and HC, were from the New York metropolitan area. Each grouphad one participant from the Washington DC metropolitan area. The MS group had one participantfrom Ithaca (not shown). Maps were created using mapline.Figures 10A-10D show cpa incidence is increased in MS. (A) PCR detection of cpa / plc (402 bp)from healthy control (HC) and MS. (B) Distribution of HC and MS subjects according to etx / cpapresence (+) and absence (-). (C-D) Statistical analysis of cpa incidence in the overall cohorts (c)and etx+ / etx- subgroups (d) of HC and MS. Fisher's exact test.Figures 11A-11D show C. perfringens abundance is increased in MS. (A) TaqMan real-time PCRanalysis of C. perfringens abundance by simultaneously detecting C. perfringens-specific anduniversal 16s rRNA genes in healthy control and MS. (B-D) Quantification of the percentage of C.perfringens over total fecal bacteria from the overall cohorts (B), or etx+ (C), and etx- (D)subgroups from HC and MS. The vertical line in b depicts the published range of C. perfringenspercentage in human fecal microbiota. Mann-Whitney test (non-Gaussian distribution).Figures 12A-12D show Analysis of etx abundance and composition of etx-harboring strainsover C. perfringens communities from etx+ healthy control (HC) and MS participants. (A)Representative amplification plots of simultaneous detection of etx and C. perfringens (CP)-specific 16S rRNA by TaqMan real-time PCR. Mann-Whitney test (non-Gaussian distribution).FH11871214.121Attorney Docket No.: CUW-02625Black lines in c indicate medians. (B) etx abundance normalized to C. perfringens (CP)-specific16s rRNA. (C) Quantification of normalized etx abundance over type D strain culture. (D).Figures 13A-13D show etx isolated from humans carries predominantly a minor SNP variant inthe receptor binding domain that results in a synonymous mutation. Reference sequences werefrom organisms isolated from ruminant animals with one notable exception — a recently annotatedsequence from whole genome sequencing of human fecal samples (Bethesda (MD): NationalLibrary of Medicine (US), National Center for Biotechnology Information;

[1988] . AccessionNo. NZ CABPRN010000010.1). Analysis identified 6 SNP sites in the etx CDS. Among the 6SNPs, 4 are located in the signal peptide, which is removed upon export of the protoxin(proETX), and one is located to the C-terminal, which is removed upon activation via proteolyticcleavage (A) Single nucleotide variants (SNV / SNP) in the coding sequence (CDS) of the etxgene. Shaded line indicates the least conserved mutation among 6 SNPs. (B) The scheme showslocation of mutations and key features of ETX, with numbers above indicating nucleotideposition (referring to CDS) and numbers below indicating to amino acid residuals. Of note, fiveSNPs, including four mutations in the signal peptide and one mutation in the C-terminal, areremoved from the activated toxin (ETX). (C) Alignment of etx reference sequences withcomplete CDS shows the region (nt 745-777) in which site 762 is centered. Of note, the onlyetx sequence isolated from a human source (fecal samples) carries a minor variant at 762 (G).Names of the reference sequences are organized as such: gene name, GeneBank# / NCBIReference#, toxinotype of C. perfringens form which etx was sequenced, and followed byanimal from which the organism was isolated. (D) Alignment of sequences of PCR productsfrom HITMS samples, with the nucleotide corresponding to 762 at the center. PCR productsfrom two reference strains were also included in the sequencing and alignment analysis. Of note,two PCR products yielded short sequences, which were sufficient for confirming etx homologybut failed to cover site 762, were excluded from the alignment analysis. HC, healthy control.Figures 14A-14G show ascending paralysis and ataxia behaviors are better correlated in ETX-mice than PTX-mice. Clinical behaviors of classical (A and B) and atypical (C and D) EAE.Shown are time-course (A and C) and quantification of accumulative scores (B and D). Ofnote, atypical EAE (C and D) was not scored after day 21. As mice experienced ascendingparalysis (A and B), it became from increasingly inaccurate and uncertain to assess ataxia, thehallmark of atypical EAE. Thus, the end point of atypical EAE assessment in this experimentFH11871214.122Attorney Docket No.: CUW-02625was set at day 21. Thick lines in time-course graphs (A and C) indicate mean scores of all micewithin the indicated groups (PBSmean; PTXmean; ETXmean) at each daily observing timepoints. Thin lines depict individual mouse (PBS1-6; PTX1-12; ETX1-12). Note that one mousefrom the control group, which received MOG35-55 in CFA but not subsequent injections ofeither toxin, developed mild EAE. Data in B and D are median ± range; Kruscal-Wallis test(non-parametric). ns, not significant; **** p<0.0001. n = 6 and 12 mice for the control(CFA / MOG>PBS) and experimental groups (CFA / MOG>PTX; CFA / MOG>ETX),respectively. (E and F) Analysis on correlation between classical EAE and atypical EAEbehaviors in PTX-EAE mice (E, CFA / MOG>PTX) and ETX-EAE mice (F, CFA / MOG>ETX).Data included in E and F were from day 12 / 13, when at least one type of the clinical phenotypes(classical or / and atypical EAE) initiated, to day 21, when assessment of atypical EAE ended.Spearman correlation analysis; PTX-EAE, r (108) = 0.6463, p < 0.0001; ETX-EAE, r (120) =0.7019, p < 0.0001. Orange lines indicate simple linear regression; PTX-EAE, R2 = 0.3147;ETX-EAE, R2 = 0.5352. Note that many scores are overlapping, resulting fewer datavisualization, indicated by circles, in E and F. (G) Representative micrographs of Luxol fastblue (LFB)-stained spinal cord (SC) and cerebellum (Ceb) from all three groups of mice.Orange lines in SC micrographs indicate the edge of spinal cord and the border between graymatter (GM) and white matter (WM). Arrows in SC point to demyelinating area in the ventralfuniculus. Asterisks in Ceb indicate demyelination in the white matter. Scale bars, 500 p.m.Figures 15A-15E show ETX-EAE model is characterized by perivascular demyelinationassociated with lymphocyte infiltrates. (A) Representative sections from spinal cords andcerebellum from MOG35_55 immunized mice followed by ETX injections were stained with Luxolfast blue (LFB) and consecutive slides were stained with hematoxylin and eosin (HE). Note thatsome of the same mice are also shown in Figures 4 and 5 . In the spinal cord micrographs, dashedpink dashed lines in LFB stained sections demarcate demyelination lesion in the ventral WM,while dashed blue lines in HE stained sections indicate areas of infiltrating inflammatory cells.High magnification views boxed low-magnification micrographs showing perivascular lesions(red asterisks) in ventral funiculus (vf) and dorsal column (dc). Arrowheads in vf point to theglia limitans or their basement membranes. An arrow points to perivascular space. Thecerebellum shows multiple perivascular demyelinating lesions (red asterisks). Boxed regionsshowing a lesion are depicted at a higher magnification in below. Black lines in le indicate theborder between granular cell layer (GL) and WM. (B and C) Quantification of LFB intensityFH11871214.123Attorney Docket No.: CUW-02625and lymphocyte density from the same fields within WM areas in the spinal cord (B) andcerebellum (C) shows the two variables are negatively correlated by Pearson's correlationanalysis. B, r (96) = - 0.666, p < 0.0001; C, r (149) = - 0.623, p < 0.0001. Best fit curves (orangelines) suggest that LFB signal decays exponentially as the density of lymphocytes increases inthe spinal cord WM (B), whereas the two variables are inversely proportional in the cerebellum(C). B, nonlinear regression based on one-phase decay model, R2 = 0.463; C, simple linearregression, R2 = 0.389. Inserts in B and C are binary images generated by thresholding. Inserts:left panel, binary images from hematoxylin-stained sections; right panel, from LFB-stainedsections. (D and E) Quantification of lymphocyte density (D) and LFB intensity (E) as afunction of radial distance from the center of perivascular lesions in WM tracts in the cerebellumconfirms an inverse relationship between myelin content and the number of infiltratinglymphocytes. Arrows point to a distance where the perivascular cuff is located. Insert showinga superimposed image of LFB and HE stains illustrates the scheme for quantification. ML,molecular layer, GL, granular cell layer. Note that ML and GL are excluded from theFigures 16A-16C show a similar number of CD45-positive cells infiltrate lesions in the spinalcord and cerebellum from ETX-EAE and PTX-EAE mice. (A) Representative sections frommice sacrificed at day 30 post-immunization with CFA / M0G35_55 and followed by either ETXor PTX were immunostained with anti-CD45 antibody. Control mice were immunized withCFA / PBS and followed by either ETX or PTX. A rectangle-framed region in each condition inpanel A is shown at a higher magnification beneath the corresponding section. Ceb, cerebellum;SC, spinal cord. Scale bars represent 500 and 50 p.m for the spinal cord and 1 mm and 20 p.mfor the cerebellum at low-magnification and high magnification, respectively. (B and C)Statistical analysis of staining intensity for CD 45 in the spinal cord (B) and cerebellum (C). Datarepresent median ± range; Kruscal-Wallis test (non-parametric). ns, not significant = 4 and 8 micefor controls (Control: CFA / PBS>PTX; ETX: CFA / PBS>ETX-Hi) and EAE groups (PTX-EAE:CFA / MOG>PTX; ETX-EAE: CFA / MOG / ETX-Hi), respectively.Figures 17A-17E show ETX-EAE model shows a stronger correlation between demyelinationand lymphocyte infiltration than in the PTX-EAE model. (A and B) Shown are micrographs andbinary images of spinal cords (A) and cerebella (B) from MOG35_55 immunized mice followedwith PTX injections. Note that a perivascular region in the cerebellum (framed with a rectangle)is shown at a higher magnification to illustrate morphologies of infiltrating cells. Binary imagesFH11871214.124Attorney Docket No.: CUW-02625were generated by thresholding. Red, LFB stain; blue, hematoxylin stain. GL, granular cell layer;GM, grey matter; WM, white matter. Scale bars, 1 mm (A), 500 [tm (B, lower magnification),100 [tm (B, higher magnification). (C and D) Quantitative analyses of demyelination andlymphocyte infiltrates in the spinal cord (C) and cerebellum (D). Pearson's correlation analysisreveals a negative correlation between demyelination and lymphocyte infiltrates in both spinalcord (A) and cerebellum (B). C, r (105) = - 0.615, p < .0001; D, r (154) = - 0.406, p < .0001.Best fit curves (orange lines) suggest a much weaker correlation of the two variables in thecerebellum (D) compared to the spinal cord (C). C, nonlinear regression based on one-phasedecay model, R2 = 0.395; D, simple linear regression, R2 = 0.165. (E) Slope analyses of myelinintensity versus infiltrating cell density in the spinal cord and cerebellum from ETX-EAE andPTX-EAE mice.Figures 18A-18D show ETX does not alter MOGp-specific CD4 T cell cytokine responses duringactive EAE immunization. (A-D) Schematic of experiment and analysis of MOGp-specific T cellresponses (A). Naive MOGp-specific CD4 T cells (2D2) were pre-transferred into recipient wild-type B6 mice 24 hours prior to induction of active EAE by subcutaneous immunization withcomplete Freund's adjuvant (CFA) and MOGp35-55, followed by intraperitoneal injection with:PBS, 10 ug / kg pertussis Toxin (PTX), or 500 ng / kg Epsilon toxin (ETX) immediately afterimmunization and 48 hours later. Clinical scores were tracked until onset of clinical disease inPTX and ETX treated mice (B) and at day 14 post-immunization, single cell suspensions wereisolated from indicated tissues and analyzed by flow cytometry for frequency of cytokineproducing 2D2 T cells (Thy1.11 at time of takedown (C) or separately re-stimulated ex vivo withMOGp35_55 for 72 hours to determine antigen-recall induced cytokine production (D). Data inB-D are pooled from two independent experiments with similar results (n = 10 mice / group pooledfrom N = 2). Results are shown as mean ± SD. Statistics are calculated by two-way analysis ofvariance (ANOVA) with Sidak's multiple comparisons test. Resultant P-values reported as ns(non-significant), *p <0.05, or **p <0.01.Figure 19 shows real-time quantitative PCR (RT-qPCR) analysis of MAL gene expression inprimary human lymphocytes. MAL transcripts levels were quantified in cDNAs obtained fromisolated populations of CD4+, CD8+, and B cells. Relative MAL expression in isolated CD4+,CD8+, and B cells. B-actin was used as a reference gene. ** p < 0.01 determined by One-wayANOVA with post hoc Tukey HSD Test. Results are expressed as the mean performed in triplicate.FH11871214.125Attorney Docket No.: CUW-02625Figures 20A-20F show ETX binds to CD4+, CD8+, and CD19+ lymphocytes with a preferencefor CD4+ cells. PBMNCs were incubated with 0 nM or 50 nM pETX-647 for 2 hours, and bindingto CD4+, CD8+, and CD19+ cells was examined by flow cytometry. An example of the gatingstrategy for examination of CD4+, CD8+, and CD19+ lymphocytes is depicted in SupplementaryFigure S2. Representative scatter plots (A) and histogram analysis (B) of pETX-647 fluorescentintensity from three separate donors performed in triplicate. (C) PBMNCs were incubated with 25nM pETX-647 for indicated time points and binding determined by flow cytometry. Results areexpressed as the percent of CD4+, CD8+, or CD19+ cells positive for pETX (% pETX+). Resultsare the means of three separate donors performed in triplicate. (D) PBMNCs were incubated with0 nM or 1 nM pETX-647 for 2 h. Results are expressed as the percentages of CD4+, CD8+, orCD19+ cells positive for pETX (% pETX+). Results are the means of two separate donorsperformed in triplicate. (E) Anti-ETX antibody inhibits binding to CD4+ cells. Media containing50 nM pETX-647 was pretreated with or without an antibody known to block ETX binding for 30min before treating PBMNC for 2 h and evaluated by flow cytometry. Percent of pETX+lymphocytes when cells are incubated without pETX-647 (CT), with pETX-647 (pETX), or pETX-647 pretreated with anti-ETX antibody (pETX + anti-ETX). (F) PBMNCs were treated with 25nM of unlabeled pETX or ETX for 2 h. Untreated cells were used as controls. pETX and ETXbindings to lymphocytes was determined using an affinity-purified anti-ETX polyclonal rabbitantibody and PE-conjugated anti-rabbit IgG. Results expressed as percent CD4+ lymphocytespositive for ETX or pETX (% Positive). Data points are the mean performed in triplicate. * p <0.05, ** p < 0.01, determine by One-way ANOVA with post hoc Tukey HSD Test.Figures 21A-21E show ETX bindings to lymphocytes are time and dose dependent. To determineif ETX bindings were dose dependent, PBMNCs were incubated with indicated doses of pETX-647 for 15 (A) and 120 min (B), and pETX-647 binding was determined by flow cytometry. Resultsare expressed as percent pETX positive (% pETX+) cells for CD4+, CD8+, and CD19+ cells. * p< 0.05 and ** p < 0.001 compared to untreated controls (0 nM), as determined by One-way ANOVAwith post hoc Tukey HSD Test. For a more detailed analysis of p values for all pETX doses, referto supplementary Table S1. To determine if ETX was time dependent, PBMNCs were incubatedwith 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, or 50 nM pETX-647 for indicated time points (C–E). Thepercentages of ETX positive cells were determined by flow cytometry for CD4+ cells (C), CD8+cells (D), and CD19+ cells (E). * p < 0.01 and ** p < 0.001 were determined by One-way ANOVAFH11871214.126Attorney Docket No.: CUW-02625with post hoc Tukey HSD Test. All results are the mean results of three donors performed intriplicate.Figures 22A-22G show active ETX kills human CD4+ cells in a dose- and time-dependent manner.PI inclusion was used to evaluate cell viability via flow cytometry. PI positive cells are considereddead. Results are expressed as the number of PI positive cells out of the total specific populationand expressed as percent cell death (% cell death). (A,B) Representative scatter plots of totallymphocytes stained with PI to evaluate cell death after treatment with 0 nM (A) or 50 nM (B)ETX for 4 h. (C) Total lymphocyte cell death after four hours of incubation with indicated ETXdoses. (D) Media containing 50 nM ETX were pretreated with or without a neutralizing anti-ETXantibody for 30 min before treating lymphocytes for 2 h. Cell death was evaluated by PI inclusionvia flow cytometry. Percent cell death when lymphocytes are treated in media alone (CT), mediacontaining 50 nM ETX (ETX), media pretreated with anti-ETX antibody (CT + anti-ETX), andmedia containing 50 nM ETX pretreated with anti-ETX antibody (ETX + anti-ETX). (E) Percentcell death of different lymphocyte subsets at indicated ETX doses after 4 hours of treatment. (F)Cell death was evaluated in CD4+ cells after four hours of treatment at indicated ETX doses. Thesedata are the same data depicted in Figure 4E with different statistical analyses. ETX-induced celldeath of CD4+ cells is dose dependent. (G) ETX-induced cytotoxicity in CD4+ cells over time atvarious time points. Data are the mean of a single donor in triplicate. Data are representative ofmultiple donors. * p < 0.05, ** p < 0.01, determined by One-way ANOVA with post hoc TukeyHSD Test.Figures 23A and 23B show ETX cytotoxicity is mediated by pore formation in PBMNC. (A)PBMNCs were treated with indicated doses of ETX for 2 h. Cells were extensively washed in PBS,and whole-cell lysates were examined via Western blot for detection of the 150kDa oligomerizedpore complex or 27 kDa bound ETX monomer. In total, 1 ng of ETX and whole-cell lysates fromrMAL-CHO cells treated with or without 50 nM ETX were used as controls. (B) PBMNCs weretreated with 50 nM of ETX for the indicated time points and examined for via Western blot fordetection of the 150 kDa oligomerized pore complex or 27 kDa bound monomer.Figures 24A-24F depict confirmation of MAL gene expression in primary human lymphocytesfrom publicly available datasets. (A) MAL gene expression in CD4+, CD8+, and CD19+ cellsdetermined via RNAseq analysis. Data was obtained from The Human Protein Atlas (available onFH11871214.127Attorney Docket No.: CUW-02625the internet) and exported into Microsoft Excel and Prism 7 software. Results are expressed aspTPM and are from six separate donors. Cells isolated via FACS sorting. CD4 cells include naïveCD4 cells (CD3+, CD4+CD45RA+), memory CD4 cells (CD3+, CD4+, CD45RA-) and t regs(CD3+, CD4+, CD35+ CD127low, CCR4+, CD25+). CD8 cells include naïve CD8 cells (CD3+CD4- CD8a+ CD45RA+) and memory CD8 cells (CD3+ CD4- CD8a+ CD45RA-). CD19 cellsinclude naïve B cells (CD3- CD19+ CD27-) and memory B cells (CD3- CD19+ CD27+). ** p<0.01determine by One-way ANOVA with post-hoc Tukey HSD Test. (B) MAL gene expression inCD4+, CD8+, and CD19+ cells determined via RNAseq analysis. Data was obtained from theonline data portal “Haemosphere” and exported into Microsoft Excel and Prism 7 software. Resultsare expressed as Log2(tpm+1) and are from 3 to 5 donors. Cells isolated via FACS sorting. CD4cells are CD3+ CD19- CD56- CD4+. CD8 cells are CD3+ CD19- CD56- CD8+. CD19 cellsinclude Naïve B cells (CD3- CD19+ CD27-) and memory B cells (CD3- CD19+ CD27+). **p<0.01 determine by One-way ANOVA with post-hoc Tukey HSD Test. (C) MAL gene expressionin CD4+, CD8+, and CD19+ cells determined via microarray analysis. Data was obtained fromHaemosphere and exported into Microsoft Excel and Prism 7 software. Results expressed as log 2and are from seven separate donors. CD4+, CD8+, and CD19+ cells were isolated using automatedmagnetic labeling protocol. ** p<0.01 determine by Oneway ANOVA with post-hoc Tukey HSDTest. (D-F) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via scRNAseqanalysis. Five pooled healthy donor PBMNC output files in csv format were exported from single-cell-gene-expression datasets from 10xgenomics (Dataset: 6K_PBMCs from a Healthy Donor,Single Cell Immune Profiling Dataset by Cell Ranger 1.1.0, 10xGenomics). Files were importedinto SeqGeq v1.6 software (BD Biosciences) for scRNA-Seq data analysis. Quality control wasperformed in tandem by first eliminating doublets, housekeeping genes and lowly dispersed geneparameters followed by Seurat v3 plugin eliminating genes outside desired expression forphenotyping use. The data was log normalized and adjusted to a clustering resolution of 0.3 toavoid subpopulations unnecessary for this comparison. Seurat returned eight clustered populationswhich were characterized and plotted on a t-Distributed Stochastic Neighbor Embedding (t-SNE)graphic (D). The output characterized t-distributed Stochastic Neighbor Embedding (t-SNE)clusters into PBMNC cell types based on previous predictive models. (E) Confirmation ofunsupervised phenotyping by established marker genes were visualized by mode normalizedheatmaps. In addition to canonical phenotype markers, MAL expression is included. (C)Lymphocyte clusters (CD4+, CD8+, and B-cells) were then examined for relative MAL expressionFH11871214.128Attorney Docket No.: CUW-02625using the Violin box plugin available from TomKellyGenetics on github. Results are presented ona Log2Expression scale evaluated by Mann-Whitney pairwise U-test. **p<0.01,**p<0.0001 determined by Mann-Whitney pairwise U-test.Figures 25A-25E show the Gating strategy for lymphocyte populations. PBMNC were isolatedfrom peripheral blood using density gradient separation. (A) Lymphocyte and monocytepopulations were identified using FSC and SSC profiles. The lymphocyte population was furthercharacterized using cell surface markers to identify CD4+ cells (B), CD8+ cells (C), and CD19+cells (D). Red lines indicate further analysis of gated populations. (E) Examples of scatter plotswhen PBMNC are incubated with 0nM or 50nM pETX-647 for 1 hour. The same data was used inFigure 20A. Results are representative from three separate donors performed in triplicate.Figure 26 shows STX binding to CD4+, CD8+, and CD19+ cells. To demonstrate pETX-647binding to human primary lymphocytes is specific and not a result of unspecific binding due tofluorescent labeling, PBMNC were incubated with 50nM of Alexa Fluor 647 labeled Shiga Toxin(STX-647) for 2 hours at 37°C. STX was labeled with Alexa Fluor 647 Protein Labeling Kit(Life Technologies) as per manufacturer's instructions. Labeled toxin was stored in a 50%glycerol stock (10uM) at -20°C until use. Binding was determined by flow cytometry. Results areexpressed as the percent of CD4+, CD8+, or CD19+ cells positive for STX-647 (% STX+). **p<0.01, determine by One-way ANOVA with post-hoc Tukey HSD Test. Results are the mean ofone donor performed in quadruplet.Figure 27 shows additional time points for dose response evaluation in lymphocyte subsets. Todetermine if ETX binding was dose dependent, PBMNC were incubated with indicated doses ofpETX-647 for 30 and 60 minutes. pETX-647 binding was evaluated by flow cytometry aspreviously described. Results are expressed as percent ETX positive cells for each lymphocytepopulation; CD4+, CD8+, and CD19+. * p<0.05 and ** p<0.001 compared to untreated controls(0nM) as determined by ANOVA. Results are the mean results of three donors performed intriplicate.Figures 28A-28F show ETX Detection on CD4+ Lymphocytes. Peripheral blood mononuclearcells were isolated from whole blood and analyzed for bound epsilon toxin (ETX) via flowcytometry. (A) Gating strategy for identification of lymphocytes (top) and CD4+ cells via flow.FH11871214.129Attorney Docket No.: CUW-02625(B) Detection of bound ETX on CD4 cells when were stained with an anti-ETX monoclonalantibody (right) versus an isotype control antibody (IgG CT, left). Representative dot blots from ahealthy control (HC) and three separate MS donor (MS1, MS2, and MS3). ETX binding to CD4cells was examined in 15 HC donors and 40 MS donors. (C) The percent of CD4+ cells positivefor ETX isolated from HC donors or MS donors. Results displayed as box and whiskers plot witheach dot represents an individual donor. p value determined by unpaired t test. (D) The percent ofHC or MS donors with ETX+ CD4 cells determined by indicated gating strategy. The p value wasdetermined by Fisher’s exact test. (E) ETX Median fluorescent intensity of CD4 cells. Resultsdisplayed as box and whiskers plot with each dot represents an individual donor. (F) The percentof HC or MS donors with ETX+ CD4 cells determined by ETX median fluorescence intensity. pvalue determined by Fisher’s exact test.Some of the data and descriptions provided herein are also provided in a publication by theinventors of the present disclosure, Ma et al., 2023, J. Clin. Invest. 133(9):e163239,https: / / doi.org / 10.1172 / JCI163239, which is incorporated by reference herein in its entirety,including its supplementary materials.Some of the data and descriptions provided herein are also provided in a publication by theinventors of the present disclosure, Shetty et al., 2023, Toxins 15, 423,https: / / doi.org / 10.3390 / toxins15070423, which is incorporated by reference herein in its entirety,including its supplementary materials.DETAILED DESCRIPTION OF THE INVENTION Provided herein are compositions and methods for monitoring and therapy of subjects (suchas human subjects) at risk for, suffering from or diagnosed with Multiple Sclerosis (MS) based onthe detection of the relative abundance of epsilon toxin (ETX) gene or ETX gene-harboring strainsof C. perfringens and / or detection of epsilon toxin bound to lymphocytes.In some aspects, provided herein are compositions and methods for detection of the relativeabundance of ETX gene or ETX gene-harboring strains of C. perfringens in a fecal sample of asubject, e.g., for identification, monitoring (e.g., monitoring the progression of disease or treatmentof disease), prevention, treatment, or assessment of responsiveness to treatment of the subject withMS. In some embodiments, after obtaining of the fecal sample and before the detection, bacteria isseparated from nonmicrobial fecal matter by any method known in the art or described herein. Insome embodiments, bacteria is separated from nonmicrobial fecal matter by density gradientcentrifugation. In some embodiments, provided herein are specific primers and fluorogenic probesFH11871214.130Attorney Docket No.: CUW-02625(such as specific primers for detection of the ETX gene, as well as for detection of one or moreother, non-ETX-harboring-strains-specific, C. perfringens genes for purposes of quantifyingrelative abundance of ETX gene-harboring strains of C. perfringens), for use in such compositionsand methods. In some embodiments, provided herein are specific quantitative methods (inparticular, quantitative PCR-based methods) for determining the abundance of ETX gene (andthus, ETX gene-harboring strains of C. perfringens) relative to the abundance of another gene orgenes found in, and specific to, ETX gene-harboring and non ETX C. perfringens (e.g., 16S orCPA genes). In some embodiments, the abundance of ETX gene is compared to the abundance ofanother gene found in and specific to C. perfringens types A, B and D (e.g., 16S or CPA genes).In some embodiments, the abundance of ETX gene is compared to the abundance of another genefound in and specific to all seven (7) toxinotypes of C. perfringens, C. perfringens A-G. In someembodiments, the abundance of ETX+CPA+ or ETX+16S rRNA+ C. perfringens strains iscompared to the abundance of ETX-CPA+ or ETX-16S rRNA+ C. perfringens strains. In someembodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e.,type B or D C. perfringens strains) greater than 0.001% is treated for MS as described herein (e.g.,using standard-of-care MS therapy, and / or using a therapy targeting ETX gene or protein,interaction of ETX with its receptor (such as MAL), or using a therapy targeting C. perfringenstype B and / or D strains). In some embodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.01% is treatedfor MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.1% is treatedfor MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 1% is treatedfor MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 5%, 10%, 15%,20%, 25%, 30%, 35% or 40% is treated for MS as described herein. In some embodiments, 2-ΔΔCtanalysis, described herein and known in the art, is used to quantify the abundance of ETX gene-harboring C. perfringens strains (e.g., ETX+, CPA+ and / or ETX+, 16S+) relative to the abundanceof C. perfringens strains that do not harbor ETX (e.g., ETX-, CPA+ and / or ETX-, 16S+). In someembodiments, if the 2-ΔΔCt value is more than 0.1 (which indicates presence of ETX gene-harboringstrains), the MS patient is treated for MS as described herein (e.g., using standard-of-care MStherapy, and / or using a therapy targeting ETX gene or protein, interaction of ETX with its receptor(such as MAL), or using a therapy targeting C. perfringens type B and / or D strains). In someFH11871214.131Attorney Docket No.: CUW-02625embodiments, if the 2-ΔΔCt value is more than 0.25 (which indicates presence of ETX gene-harboring strains), the MS patient is treated for MS as described herein. In some embodiments, ifthe 2-ΔΔCt value is more than 0.5% (which indicates presence of ETX-harboring strains), the MSpatient is treated for MS as described herein. In some embodiments, if the 2-ΔΔCt value is more than0.75% (which indicates presence of ETX-harboring strains), the MS patient is treated for MS asdescribed herein. In some embodiments, if the 2-ΔΔCt value is more than 1 (which indicatesdominance of ETX-harboring strains), the MS patient undergoes an MS evaluation (e.g., standard-of-care MS evaluation) and / or the MS patient is treated for MS as described herein (e.g., usingstandard-of-care MS therapy, and / or using a therapy targeting ETX gene or protein, interaction ofETX with its receptor (such as MAL), or using a therapy targeting C. perfringens type B and / or Dstrains).In some aspects, provided herein are composition and methods for detection of epsilontoxin protein bound to lymphocytes in a blood sample of a subject, e.g., for identification,monitoring (e.g., monitoring the progression of disease), prevention, treatment, or assessment ofresponsiveness to treatment of the subject with MS. Any methods for detection of proteins boundto cells known in the art can be used for detection of epsilon toxin protein bound to lymphocytes.In some embodiments, provided herein are specific methods (in particular, flow cytometrymethods) for determining the presence and / or abundance of epsilon toxin bound to lymphocytes.In some embodiments, the lymphocyte is a CD4+ lymphocyte. In some embodiments, thedetermining of the presence and / or abundance of epsilon toxin bound to lymphocytes comprises(i) isolating peripheral blood mononuclear cells from whole blood, and (ii) detection ofbound ETX via flow cytometry. In some embodiments, the detection of cell-bound ETXvia flow cytometry comprises incubating the isolated cells with a fluorescently labeledanti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting thepercent of CD4+ cells positive for ETX. Such methods can be used as alternative methods fordetection of ETX or together with the methods for identifying an ETX gene or ETX gene-harboringstrain in a fecal sample. The blood sample detection methods can be used to verify the relevanceof ETX to MS, monitor ETX bound to lymphocytes, and / or monitor the impact of treatmentdesigned to remove ETX from blood described herein (e.g., an anti-ETX neutralizing antibody,neutralizing nanobody, or a soluble neutralizing receptor). In some embodiments, whereisolated lymphocytes (e.g., CD4+ lymphocytes) positive for ETX are detected, or morethan 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.75%, 1%, or 1.5% of the isolated lymphocytes arepositive for ETX, the subject is treated for MS as described herein. In some embodiments, theFH11871214.132Attorney Docket No.: CUW-02625initial detection of ETX gene-harboring strains (e.g., using qPCR of fecal samples), is followed byadministration of ETX-specific treatment, and further followed by monitoring (e.g., by detectionof lymphocyte-bound ETX in the blood) of treatment progression (e.g., in a subject afflicted withMS).In some aspects, provided herein are specific therapies for use in an MS patient afterdetection of either elevated abundance of the ETX gene or ETX gene-harboring C. perfirgensstrains (such as in a fecal sample) or epsilon toxin bound to lymphocytes (such as in the plasmaserum). In some embodiments, the specific therapy is an agent that directly or indirectly interfereswith ETX, e.g., an inhibitor or antagonist of ETX. In some embodiments, the inhibitor or antagonistof ETX is an antibody against ETX or an antigen-binding portion thereof (e.g., a neutralizingantibody (NAB), a neutralizing nanobody, an antibody inhibiting or preventing oligomerization ofETX, or an antibody inhibiting or preventing the binding of ETX to an ETX-binding receptor on acell). In some embodiments, the specific therapy is an agent that directly or indirectly interfereswith an ETX-binding receptor, e.g., an inhibitor or antagonist of ETX-binding receptor (MAL orHAVcR1). In some embodiments, the inhibitor or antagonist of ETX-binding receptor is anantibody against ETX-binding receptor or an antigen-binding portion thereof (e.g., an antibodyinhibiting or preventing the binding of ETX to an ETX-binding receptor on a cell). In someembodiments, a soluble ETX-binding receptor protein, e.g., a soluble HAVcR1, a solubleMAL, or a fragment thereof, can also be used. In some embodiments, the specific therapy is anagent that directly or indirectly interferes with ETX gene-harboring C. perfringens strains. In someof these embodiments, C. perfringens strains can be targeted or killed with anti-microbial agents,such as antibiotics. In some embodiments, anti-microbial treatment may be followed by a fecalmicrobiome transfer using healthy donors with defined gut microbiome taxonomy. In some ofthese embodiments, C. perfringens strains can be selectively targeted or killed with a bacteriophageendolysin specific to C. perfringens Type B or D bacterial strain alone or in conjunction withanother therapy (e.g., an epsilon toxin specific antibody or nanobody or soluble epsilon toxinreceptor). Other ETX-specific therapies can also be used following the detection methodsdescribed herein. The therapy can be chosen based on whether ETX is detected in, and thus it isdesirable to target ETX in, the gut microbiome or the blood of the subject. For example, detectionof ETX gene-harboring C. perfringens in a fecal sample, may be followed by administration of anMS therapy targeting gut microbiome (e.g., C. perfringens strains can be targeted or killed withantibiotics followed by a fecal microbiome transfer). Similarly, detection of ETX bound toFH11871214.133Attorney Docket No.: CUW-02625lymphocytes in a blood sample, may be followed by administration of MS therapy into systemiccirculation (e.g., parenteral administration of anti-ETX neutralizing antibodies).In some aspects, any ETX-specific therapies can be used in conjunction with any standard-of-care MS therapy known in the art or described herein (e.g., an oral therapy or an injectibletherapy). In other embodiments, only ETX-specific therapy is administered an MS patient afterdetection of either elevated abundance of the ETX gene or ETX gene-harboring C. perfirgensstrains (such as in a fecal sample) or epsilon toxin bound to lymphocytes (such as in the plasmaserum).TerminologyUnless defined otherwise, all scientific and technical terms used herein have the samemeaning as commonly understood by one of ordinary skill in the art to which this inventionbelongs. Further, unless otherwise required by context, singular terms shall include pluralities andplural terms shall include the singular. Generally, nomenclatures utilized in connection with, andtechniques of, chemistry, biochemistry, molecular biology, pharmacology and toxicology are thosewell-known and commonly used in the art.All publications mentioned herein are incorporated herein by reference for the purpose ofdescribing and disclosing devices, compositions, formulations and methodologies which aredescribed in the publication and which might be used in connection with the present disclosure.Where values are described as ranges, it will be understood that such disclosure includesthe disclosure of all possible sub-ranges within such ranges, as well as specific numerical valuesthat fall within such ranges irrespective of whether a specific numerical value or specific sub-rangeis expressly stated.The term “about,” as used herein, refers to a range of + / - 10% of the stated value. In someembodiments, the range is + / - 5%, 3%, 2%, 1%, 0.5%, or 0.1% of the stated value.A “patient,” “subject,” or “individual” are used interchangeably and refer to either a humanor a non-human animal. These terms include mammals, such as humans, primates, livestockanimals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) androdents (e.g., mice and rats).“Administering” or “administration of” a substance, a compound or an agent to a subjectcan be carried out using one of a variety of methods known to those skilled in the art. For example,a compound or an agent can be administered, intravenously, arterially, intradermally,intramuscularly, intraperitoneally, subcutaneously, ocularly, sublingually, orally (by ingestion),FH11871214.134Attorney Docket No.: CUW-02625intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g.,through a skin duct). In some embodiments, the administration is parenteral. In someembodiments, the administration is enteral or oral. Administering can also be performed, forexample, once, a plurality of times, and / or over one or more extended periods. Appropriatemethods of administering a substance, a compound or an agent to a subject will also depend, forexample, on the age and / or the physical condition of the subject and the chemical and biologicalproperties of the compound or agent (e.g., solubility, digestibility, bioavailability, stability andtoxicity).An ”effective amount” or a “therapeutically effective amount” of a drug or agent is anamount of a drug or an agent that, when administered to a subject will have a therapeutic effect.The full therapeutic effect does not necessarily occur by administration of one dose, and may occuronly after administration of a series of doses. Thus, a therapeutically effective amount may beadministered in one or more administrations. The precise effective amount needed for a subjectwill depend upon, for example, the subject’s size, health and age, and the nature and extent of thecondition being treated.The phrase “pharmaceutically acceptable carrier,” as used herein, refers to anypharmaceutically acceptable material, composition or vehicle, such as a diluent, excipient, solvent,dispersion media, coatings, or encapsulating material useful for formulating a drug or agent formedicinal or therapeutic use.The term “treating” a disease or condition in a subject, as used herein, refers toadministering a medicament to the subject having or suspected of having a disease or condition(i.e., after the onset of the disease or condition), such that at least one symptom of the disease orcondition is decreased or prevented from worsening. Desirable effects of treatment includedecreasing the rate of progression, ameliorating or palliating the pathological state, and remissionor improved prognosis of a particular disease, disorder, or condition. An individual is successfully“treated,” for example, if one or more symptoms associated with a particular disease, disorder, orcondition are mitigated or eliminated.The term “preventing” a disease or condition in a subject, as used herein, refers toadministering a medicament to the subject prior to the onset of the disease or condition, whenadministration of the medicament to a statistical sample prior to the onset of the disease orcondition reduces the occurrence of the disease or condition in the treated sample relative to anuntreated control sample, or delays the onset or reduces the occurrence or severity of one or moresymptoms of the disease or condition relative to the untreated control sample.FH11871214.135Attorney Docket No.: CUW-02625The terms "decrease", "reduced", "reduction", or "inhibit" are all used herein to mean adecrease by a statistically significant amount. In some embodiments, "reduce," "reduction" or"decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level(e.g., the absence of a given ligand) and can include, for example, a decrease by at least about 10%,at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%,at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%,at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%,at least about 95%, at least about 98%, at least about 99%, or more.Epsilon toxin and its detection in MSGut dysbiosis is common in MS, but specifically causative species are unknown. Toaddress this gap in knowledge, sensitive and quantitative PCR detection was used asdescribed herein to surprisingly demonstrate for the first time that people with MS are morelikely to harbor and show a greater abundance of epsilon toxin (ETX)-producing strains ofC. perfringens within their gut microbiomes compared to healthy controls (HC). C. perfringens ETX is a unique candidate environmental trigger for MS because thisbloodborne neurotoxin specifically targets CNS endothelial cells, leading to disruption ofBBB integrity. C. perfringens is a gram-positive anaerobe categorized into 7 toxinotypesbased on production of one or more of 6 major toxins. The type B and D strains carry theplasmid-encoded ETX gene (etx). In the gastrointestinal tract of mammals, C. perfringenstypes B and D exist in the small intestine where they produce ETX episodically during log-phase growth. Human exposure to C. perfringens strains is broad since they are present inour food chain, pets, and are found in multiple ecological niches including farm runoff,sewage, marine sediment, soil, and the gastrointestinal tracts of fish, birds, and mammals. Asa spore-forming anaerobe, once C. perfringens enters an environment it tends to persistdue to resistance of spores to heat, chemicals, radiation, and pressure. Following environmentalexposure and oral ingestion, colonization of the small intestine may be dependent on host genetics,microbiome composition, and additional factors such as prior antibiotic use.ETX is a member of the aerolysin-family of pore-forming toxins. ETX is synthesizedas a 32.9 kDa inactive pro-toxin that is secreted and cleaved in the gut by host serineproteases and carboxypeptidases or occasionally by bacterially-derived lambda proteaseinto a 27 kDa active toxin, resulting in 1000 fold increase in ETX's toxicity. The ETX monomercrosses the small intestine without causing injury or enteritis. The myelin and lymphocyteFH11871214.136Attorney Docket No.: CUW-02625protein (MAL) was identified as the receptor for ETX, required for binding and for allknown biologic activity. MAL is localized to lipid rafts and ETX binding to MAL bringsmonomers in proximity, favoring self-assembly into a heptameric pre-pore complex thatthen inserts into the plasma membrane of host cells. In vivo, ETX induces BBBpermeability. In the bloodstream, ETX has access to all vascularized tissues, but its bindingis restricted to CNS endothelial cells, since they are enriched for expression of the ETXreceptor, MAL. In both natural and experimental infections, ETX preferentially accumulates inthe brains and kidneys of animals. In the brain, ETX selectively binds to brain endothelial cells,myelinated structures, and mature oligodendrocytes, the myelinating cells of the CNS. In thekidney, ETX preferentially binds to distal and collecting tubules. ETX preferences for thesespecific cell types are most likely due to the expression of the ETX receptor MAL.Reported herein is that MS patient-derived isolates produced functional ETX and hada genetic architecture typical of highly conjugative plasmids. Thus, an association betweenETX-producing strains of C. perfringens and MS in clinical samples was identified. The dataprovided herein also discloses that people with MS have increased abundance of ETX-producingstrains of C. perfringens in their gut microbiome compared to healthy controls; that ETX issufficient to induce multifocal, inflammatory demyelination in the context of activeimmunization with MOG35-55; that ETX-induced inflammatory demyelination, in activeEAE, more closely resembles the lesion distribution observed in MS when compared tothe traditional PTX model; and that, in CNS endothelial cells, ETX induces expression ofgenes known to overcome CNS immune privilege.In the active immunization model of experimental autoimmune encephalomyelitis(EAE), where pertussis toxin (PTX) is used to overcome CNS immune privilege, ETX cansubstitute for PTX. In contrast to PTX-induced EAE, where inflammatory demyelination islargely restricted to the spinal cord, ETX-induced EAE caused demyelination in the corpuscallosum, thalamus, cerebellum, brainstem, and spinal cord, more akin to theneuroanatomical lesion distribution in MS. Transcriptional profiles from CNS endothelialcells revealed ETX-induced genes that are known to play a role in overcoming CNS immuneprivilege. Together, the findings presented herein suggest that ETX-producing strains of C.perfringens are biologically plausible pathogens in MS that trigger inflammatorydemyelination in the context of circulating myelin autoreactive lymphocytes.Also disclosed herein, is demonstration that ETX preferentially binds to humanlymphocytes expressing increased levels of the myelin and lymphocyte protein MAL. UsingFH11871214.137Attorney Docket No.: CUW-02625flow cytometry, ETX binding was determined to be time and dose dependent and was highestfor CD4+ cells, followed by CD8+ and then CD19+ cells. Similar results were seen withETX-induced cytotoxicity. To determine if ETX preference for CD4+ cells was related toMAL expression, MAL gene expression was determined by RT-qPCR. CD4+ cells had thehighest amount of Mal gene expression followed by CD8+ and CD19+ cells. The dataindicate that primary human cells are susceptible to ETX binding and support the hypothesisthat MAL is a main receptor for ETX. ETX bindings to human lymphocytes suggest that ETXmay influence immune response in multiple sclerosis.Described herein is ETX as a possible environmental cause of multiple sclerosis (MS) inhumans, and methods of detection thereof. Multiple sclerosis patients are more likely to becolonized by ETX-producing C. perfringens toxinotypes versus healthy controls, and incolonized individuals, the relative abundance of ETX producing strains is significantly higher inMS patients versus HC. Histopathological, active MS lesions are characterized by overt blood-brain-barrier permeability, demyelination, and robust CNS immune infiltration. Using both invitro and in vivo models, it is demonstrated herein that ETX specifically causes BBBpermeability, demyelination, and loss of CNS-immune privilege. This specificity is mediated bythe selective expression of the ETX receptor, the myelin and lymphocyte protein MAL, on CNSendothelial cells, mature oligodendrocytes, and human lymphocytes. Pathogenic lymphocytes,including both T cells and B cells, play an important role in MS pathogenesis. Provided hereinis data demonstrating the binding of ETX to primary human lymphocytes expressing MAL.ETX detection methodsIn certain aspects of the invention, provided herein are methods for identifying a subset ofsubjects afflicted with MS for epsilon toxin treatment. In some aspects, provided herein aremethods to detect and quantify the epsilon toxin gene from fecal samples. In some embodiments,the method comprises obtaining a fecal sample from said subjects and detecting the relativeabundance of epsilon toxin gene (ETX)-harboring C. peifringens in the fecal sample from saidsubject. Such detection methods are known in the art and include quantitative PCR techniques,such as Real-Time quantitative Polymerase Chain Reaction (RT-qPCR). In some embodiments,the abundance of the ETX gene is determined relative to a control gene, such as the cpa / plc gene,common to all C. perfringens strains, and / or the 16S ribosomal RNA gene specific to C.perfringens. A subject is identified as suitable for epsilon toxin treatment when the abundance ofthe ETX gene in the fecal sample exceeds a predetermined threshold derived from healthy controlFH11871214.138Attorney Docket No.: CUW-02625fecal samples. For exemplary purposes, the percentage of ETX-harboring strains based onquantitation of etx and C. perfringens-specific 16S (relative abundance) were measured in Table1.In some embodiments, said methods may be used for identifying patients to be treated withanti-epsilon toxin strategies. Notably, it is uncommon to detect the epsilon toxin gene in healthycontrols, though it is occasionally present. Thus detection of the gene alone is not sufficient tosupport a pathophysiologic role of this agent in MS, but may be used to identify a patient or sub-populations of patients afflicted with MS that may benefit from epsilon toxin therapy. In someembodiments, the patient subjected to detection methods described herein has already beendiagnosed with MS or is suspected to have MS. In some embodiments, the patient subjected todetection methods described herein has been diagnosed with MS (e.g., using standard-of-care MSevaluation methods, such as those described herein). In some embodiments, the patient subjectedto detection methods described herein is suspected to have MS (e.g., based on preliminaryevaluation or presence of one or more symptoms). In some embodiments, the patient subjected todetection methods described herein shows one, two, three or more symptoms of MS.In some embodiments, detection of the ETX gene alone may support evaluation of such apatient for MS (e.g., diagnostic assessment for MS) using criteria known in the art (e.g., theMcDonald criteria), employing those methods known in the art (e.g., medical history, neurologicexamination, magnetic resonance imaging (MRI), cerebrospinal fluid analysis, motor skillsassessments, and blood tests) in case of unidentified or asymptomatic MS, or otherwise at risk ofdeveloping a form of MS.Using quantitative PCR, as disclosed herein, it was determined that the abundance of theepsilon toxin gene, and thus epsilon toxin-encoding strains of C. perfringens, was dramaticallyelevated in subjects with MS relative to healthy controls. In some embodiments, a threshold or“cut-off” value may be used to define patients recommended for epsilon toxin treatment. Forexemplary purposes, the percentage of etx-harboring strains based on quantitation of etx and C.perfringens-specific 16S (relative abundance) were measured as provided in Table 1.Table 1: Relative abundance of etx gene (etx / 16s) in healthy controls and MS patientsFH11871214.139Attorney Docket No.: CUW-02625The median percentage of healthy controls that are etx+ was determined by the inventors tobe 0.001%, while the median value among multiple sclerosis patients was determined by theinventors to be 42.5%. Thus, in some embodiments, the threshold for epsilon toxin treatment of asubject is based on a predetermined value derived from healthy controls. In some suchembodiments, the subject tested as a potential candidate for epsilon toxin treatment is afflictedwith, suspected of being afflicted with, or is at risk of being afflicted with MS. In some suchembodiments, the subject has a clinical diagnosis of MS. In some embodiments, the threshold valuefor administering epsilon toxin treatment is greater than 0.001%. In some embodiments, thethreshold value for administering epsilon toxin treatment is at least or greater than 0.01%. In someembodiments, the threshold value for administering epsilon toxin treatment is at least or greaterthan 0.1%. In some embodiments, the threshold value for administering epsilon toxin treatment isat least or greater than 1%. In some embodiments, the threshold value for administering epsilontoxin treatment is at least or greater than 5%. In some embodiments, the threshold value foradministering epsilon toxin treatment is at least or greater than 10%.In some aspects of the invention, the presence of epsilon toxin bound to lymphocytes inblood samples is determined. Epsilon toxin bound to lymphocytes can be detected using anymethods known in the art or described herein. In some embodiments, flow cytometry is used todetect epsilon toxin bound to lymphocytes, as described herein. Epsilon toxin is secreted from C.perfringens types B or D in the gut as a 32.5 kDa protoxin that is then cleaved in the gut byproteases into the active toxin, ranging from 27-29 kDa, which traverses the gut epithelium andenters the bloodstream. Once in the blood stream epsilon toxin can exist as free toxin in blood orcan be bound to lymphocytes. In some embodiments, ETX is bound predominantly to CD4+ and / orCD8+ T cells. Free ETX is rapidly removed from blood by binding specifically to CNS endothelialcells (e.g., luminal vascular walls) which represent a huge sink for ETX binding as the CNSmicrovasculature of the human brain consists of 15-25 meters2 of surface area. In addition, thekidney also removes ETX from blood, non-specifically, via glomerular filtration and then uptakeFH11871214.140Attorney Docket No.: CUW-02625and degradation in proximal renal tubule cells. As a consequence of these two processes, specificand non-specific removal of epsilon toxin from blood, the detection of free epsilon toxin in plasmaor serum is highly unlikely (unless sampling occurred almost daily). However, the life span oflymphocytes in blood is about 60 days. Thus, as provided herein, the epsilon toxin bound tolymphocytes is relatively long lived in blood when compared to free epsilon toxin and the use offlow cytometry to detect epsilon toxin bound to lymphocytes may be used for detecting disease(MS) and monitoring treatment / progression of the disease (MS). In some aspects, such methodscan be used to verify the relevance of ETX to MS or confirm an MS diagnosis. In certainembodiments, such methods may be used to monitor the progression of MS and / or the impact oftreatment designed to remove epsilon toxin from blood (e.g., a neutralizing antibody, neutralizingnanobody, or a soluble neutralizing receptor) by monitoring epsilon toxin bound to lymphocytes.In some embodiments, fecal sample ETX detection methods and blood sample ETXdetection methods are used together before determination to proceed with MS evaluation is made.In some embodiments, fecal sample ETX detection methods and blood sample ETX detectionmethods are used together before determination to proceed with MS treatment is made. In someembodiments, fecal sample ETX detection methods and blood sample ETX detection methods areused together before determination to proceed with ETX-targeting MS treatment is made. In someembodiments, fecal sample ETX detection methods and blood sample ETX detection methods areused together before determination to proceed with standard-of-care MS treatment is made.In some embodiments, only fecal sample ETX detection methods or only blood sampleETX detection methods is used before determination to proceed with MS evaluation is made. Insome embodiments, only fecal sample ETX detection methods or only blood sample ETX detectionmethods is used before determination to proceed with MS treatment is made. In someembodiments, only fecal sample ETX detection methods or only blood sample ETX detectionmethods is used before determination to proceed with ETX-targeting MS treatment is made. Insome embodiments, only fecal sample ETX detection methods or only blood sample ETX detectionmethods is used before determination to proceed with standard-of-care MS treatment is made.In some embodiments, fecal sample ETX detection methods and blood sample ETXdetection methods can be used sequentially or at different stages of patient care or monitoring. Forexample, fecal sample ETX detection methods can be used at initial diagnosis (such asconfirmatory diagnosis) or at the initial instance when treatment decision is to be made, followedby use of blood sample ETX detection methods to monitor the progression of MS and / or the impactof treatment designed to remove epsilon toxin from blood.FH11871214.141Attorney Docket No.: CUW-02625Methods for the prevention and treatment of MS when ETX is detectedAny methods known in the art for use in decreasing or eliminating C. perfringens types Band / or D, or for use in inhibiting or antagonizing ETX or a receptor of ETX, can be used in theETX-specific treatment methods provided herein.In some embodiments, the present disclosure provides methods and techniques formodulating the gut microbiome to limit or eliminate toxinotypes of C. perfringens, particularlytypes B and D. There are 7 toxinotypes of C. perfringens, i.e., types A-G. The epsilon toxinproducing strains are the type B and D strains. The type A strain is a commensal in the human gutmicrobiome but does encode cpa / plc which is a hemolysin that functions to hydrolyze phosphatidylcholine and sphingomyelin. The type B and D strains encode and produce epsilon toxin. The typeA strain is the dominant strain numerically in the human gut microbiome and as a result, limits theability of other toxinotypes, such as the B and D strains, from occupying this ecologic niche.Aspects of the disclosed invention include methods to effectively eliminate or reduce the presenceof C. perfringens type B and D strains. Without being bound by theory or methodology, suchmethods may include killing all C. perfringens strains with antibiotics. In some such embodiments,treatment is followed by a fecal microbiome transfer from healthy donors with defined gutmicrobiome taxonomy. In certain embodiments, C. perfringens is selectively killed with abacteriophage endolysin specific to C. perfringens. Such lysins are known in the art (see, e.g.,Gervasi et al. Application of Lactobacillus johnsonii expressing phage endolysin for control ofClostridium perfringens. Lett Appl Microbiol. 2014 Oct;59(4):355-61; Ha et al. Clostridiumperfringens Virulent Bacteriophage CPS2 and Its Thermostable Endolysin LysCPS2. Viruses2018, 10, 251; Swift et al. A Thermophilic Phage Endolysin Fusion to a Clostridium perfringens-Specific Cell Wall Binding Domain Creates an Anti-Clostridium Antimicrobial with ImprovedThermostability. Viruses 2015, 7, 3019-3034; Nariya et al. Identification and characterization of aputative endolysin encoded by episomal phage phiSM101 of Clostridium perfringens. ApplMicrobiol Biotechnol 90, 1973–1979 (2011); Gervasi et al. Expression and delivery of anendolysin to combat Clostridium perfringens. Appl Microbiol Biotechnol 98, 2495–2505 (2014);and Shin et al. Characterization of thermostable bacteriophage CPD2 and its endolysin LysCPD2as biocontrol agents against Clostridium perfringens. Food Sci Biotechnol 32, 2069–2077 (2023),each of which is incorporated by reference herein, in its entirety). In some embodiments, thetreatment may be performed in conjunction with (before, concomitantly, or after) administeringFH11871214.142Attorney Docket No.: CUW-02625another epsilon toxin specific therapy (e.g., an anti-ETX antibody or nanobody or soluble epsilontoxin receptor).In other embodiments, the subject is treated with any MS therapy known in the art (e.g.,standard-of-care treatment and off-label use of therapeutics). The subject can be treated with anyMS therapy before, during, and after the detection methods described herein. In someembodiments, after the detection of a clinically relevant level of relative abundance of the ETXgene-harboring strain in gut microbioma or a fecal sample of a subject, or detection of ETX boundto lymphocytes in a blood sample of a subject, the ETX-specific treatment is administered to thesubject conjointly or concomitantly with a standard-of-care MS therapy. For example, and withoutlimitation, such MS therapies may include Avonex® (interferon beta-1a), Betaseron® (interferonbeta-1b), Copaxone® (glatiramer acetate), Extavia® (interferon beta-1b), Glatiramer AcetateInjection (glatiramer acetate -generic equivalent of Copaxone 20 mg and 40 mg doses), Glatopa®(glatiramer acetate - generic equivalent of Copaxone 20mg and 40mg doses), Kesimpta®(ofatumumab), Plegridy® (peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio®(teriflunomide), Bafiertam™ (monomethyl fumarate), Dimethyl Fumarate (dimethyl fumarate -generic equivalent of Tecfidera), Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent®(siponimod), Ponvory™ (ponesimod), Tascenso ODT® (fingolimod), Tecfidera® (dimethylfumarate), Vumerity® (diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab),Lemtrada® (alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko®(natalizumab-sztn), Tysabri® (natalizumab), Rituximab, and / or Glucocorticoids (oral or IV). Insome embodiments of the invention, the testing (e.g., qPCR of fecal samples), subsequentadministering of epsilon toxin treatment, and optional monitoring (e.g., detection of lymphocyte-bound toxin) of treatment progression (e.g., in a subject afflicted with MS) is done conjointly orconcomitantly with any MS therapy known in the art (e.g., standard-of-care MS treatment and off-label use of therapeutics for MS).Without being bound by any particular theory or methodology, a combination of therapies,e.g., the therapies disclosed herein, may be administered to the subject that meets the predeterminedthreshold. The combination and administration of such therapies may also be informed, at least inpart, by the methods disclosed herein. In some such embodiments, the combination (e.g., MStherapy and epsilon toxin treatment) may be administered in the same formulation or in separateformulations, either concomitantly or sequentially. Thus, a subject that receives such apersonalized treatment may benefit from a combined effect.FH11871214.143Additional disclosure of ETX-specific methods for the prevention and treatment of MSIn some embodiments, provided herein are ETX-specific methods and agents forpreventing or treating multiple sclerosis (MS) in a human subject in need thereof, after the step ofdetection of the relative abundance of ETX gene-harboring C. perfringens strain or detection ofepsilon toxin bound to lymphocytes. In this regard, U.S. Patent No. 9,758,573 is specificallyincorporated by reference herein in its entirety. All of the methods and agents for preventing ortreating multiple sclerosis (MS), and in particular all agents that directly or indirectly interferewith ETX or ETX-harboring C. perfringens strains, disclosed in U.S. Patent No. 9,758,573,are specifically incorporated by reference herein in their entirety. In particular, U.S. Patent No.9,758,573 is specifically incorporated by reference for its disclosure of various anti-ETXantibodies and antigen-binding fragments thereof.The methods for treating a subject having MS with epsilon toxin therapy contemplatedherein include: a) directly or indirectly interfering with epsilon toxin (ETX) of Clostridiumperfringens type B or type D; b) directly or indirectly interfering with ETX interacting receptor,such as MAL and / or a virus cellular receptor-1 (HAVcR-1); c) directly and / or indirectly interferingwith the interaction of ETX with its linking receptor, as well as downstream signaling activities;and / or d) directly or indirectly interfering, inhibiting or killing Clostridium perfringens.In some embodiments, provided herein are methods for preventing or treating multiplesclerosis (MS) in a human subject in need (e.g., a human subject with MS identified by the methodsdisclosed herein) comprising: administering to said human subject a composition comprising aneffective amount of an agent that directly or indirectly interferes with epsilon toxin (ETX) producedby Clostridium perfringens type B or type D bacterial strain, an ETX-binding receptor, or aninteraction of ETX with its binding receptor so as to inhibit or suppress ETX modulated receptorsignaling pathway. In certain embodiments, said agent is an inhibitor of ETX or its binding receptorexpressed on endothelial cells of blood brain barrier (BBB), blood retinal barrier (BRB),oligodendrocytes, or myelin for which ETX is a ligand. In certain embodiments, the ETX-bindingreceptor is a tetraspan integral membrane receptor MAL, which is expressed in myelin, and byCNS endothelial cells, oligodendrocytes, intestinal epithelium lymphocytes. In otherembodiments, the ETX-binding receptor is HAVcR-1 receptor.In some embodiments, described herein are antibodies against ETX, or its binding receptor,such as MAL and / or HAVcR-1, or a functional fragment thereof, e.g., antigen binding fragment orantigen-binding portion. Methods of generating antibodies against ε-toxin (ETX) of C.perfringens are well known in the art. Examples of antibodies and antibody responses againstepsilon toxin of C. perfringens are described, for example, in U.S. Patent No.9,758,573, Bentancoret al. (J Infect Dev Ctries 2009, 3(8):624-627); Laine et al. (Veterinary Immunology andImmunopathology 125, 2008, 198-202); Uzal et al. (Veterinary Research Communications, 23,1999, 143-150); Percival et al. (Infection and Immunity, 1990, 2487-2492); Veschi et al. (VetImmunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and Linden et al. Antibodies ( 2018Dec; 7(4): 37), the entire contents of each of which are incorporated by reference herein.Antigen-binding portions of anti-ETX antibodies are also provided herein. Examples of an“antigen-binding portion” of an antibody include a Fab fragment, a F(ab′)2 fragment, a Fd fragment,an Fv fragment, a dAb fragment (Ward et al., (1989) Nature 341:544 546), or a single chainantibody. Antibody fragments also include single domain antibodies, maxibodies, minibodies,nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g.,Hollinger and Hudson (2005) Nature Biotechnology 23:1126-1136). These antibody fragments canbe obtained using conventional techniques known to those with skill in the art, and the fragmentsare screened for utility in the same manner as are intact antibodies.In some embodiments, the antibody is any known neutralizing antibody against ETXprotein. Examples of such ETX antibodies are described in U.S. Patent No. 9,758,573, Bentancoret al., Percival et al., Uzal et al., Veschi et al., and Linden et al. (2018), the entire content of eachof which references is incorporated by reference herewith. In certain embodiments, the neutralizingantibody against ETX protein comprises an amino acid sequence at least about 71%, 75%, 80%,85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%, 98%, 99%, 99.5%, or 99.9% or more identicalto a polypeptide(s) of any known or later developed ETX antibodies.In some embodiments, provided herein for use in any of the ETX-specific treatmentmethods or steps is any one or more antibodies against ETX described in U.S. Patent No.9,758,573, Bentancor et al. (J Infect Dev Ctries 2009, 3(8):624-627); Laine et al. (VeterinaryImmunology and Immunopathology 125, 2008, 198-202); Uzal et al. (Veterinary ResearchCommunications, 23, 1999, 143-150); Percival et al. (Infection and Immunity, 1990, 2487-2492);Veschi et al. (Vet Immunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and / or Linden et al.Antibodies ( 2018 Dec; 7(4): 37), or any antibody or antigen-binding fragment having CDRs, orlight chain variable domain or heavy chain variable domain, thereof. In some embodiments,provided herein for use in any of the ETX-specific treatment methods or steps is any one or moreantibodies against ETX described in U.S. Patent No.9,758,573, or any antibody or antigen-bindingfragment having CDRs, or light chain variable domain or heavy chain variable domain, thereof. Insome embodiments, provided herein for use in any of the ETX-specific treatment methods or stepsis any one or more antibodies against ETX described in Linden et al. Antibodies ( 2018 Dec; 7(4):37), or any antibody or antigen-binding fragment having CDRs, or light chain variable domain orheavy chain variable domain, thereof. In some embodiments, provided herein for use in any of theETX-specific treatment methods or steps are specific neutralizing antibodies against ETX such asA5C12 described in Percival et al, 1990, mAbs 4D7 and / or 5B7 described in McClain and Cover2007, or any antibody or antigen-binding fragment having CDRs, or light chain variable domainor heavy chain variable domain, thereof.An antibodies' activity in inhibiting binding of ETX to its binding receptor can bedetermined by testing the ability of the antibody from blocking the binding of ETX to its bindingreceptor. Without being bound by theory or methodology, a competition ELISA assay in thepresence of a labeled ligand and / or the antibody may be used.In certain embodiments, the agent described herein comprises an isolated polypeptide ofETX, its binding receptor, MAL or HAvR-1, and biologically active portions thereof. In someembodiments, the polypeptides of the invention, and biologically active portions thereof comprisesoluble ETX-binding receptors, e.g., a soluble MAL, which reduces the bioavailability of ETXand, thus, prevents binding of ETX with the cognate receptors in the subject.In certain embodiments, the agent describe herein is an inhibitor of a receptor to whichepsilon toxin (ETX) binds, such as the MAL receptor. In certain embodiments, the agent describedherein is an inhibitor of the receptor on the blood brain barrier (BBB), such as HAVcR-1, whichcan also be therapeutic candidates for protecting and / or treating MS. Examples of such inhibitorsare described in U.S. Patent No. 9,758,573 and Lewis et al. (Toxins 2010, 2, 1825-1847), the entirecontent of which is incorporated by reference herein. Agents that have been found to potentiallyinhibit ETX binding to MAL or HAVcR-1 include, but are not limited to, the mutant epsilon toxins(ETX-Y29E, ETX-Y30E, ETX-Y36E and ETX-Y196E).In certain embodiments, the agent described herein comprises a phage lytic enzyme specificfor Clostridium perfringens Type B or D bacterial strain. In some embodiments, such phage lyticenzyme is a muramidase PlyCM derived from strain ATCC 13124.In certain embodiments, the agent is a probiotic supplement comprising C. perfringens typeA or other bacteria type that can effectively outcompete Clostridium perfringens type B or D, withno other C. perfringens toxinotype. In certain embodiments, the probiotic supplement contains C.perfringens type A bacterial strain since its toxinotype has been shown to outcompete C.perfringens type B. Typical bacteria strains included in probiotic supplement preparations include,but are not limited to, Lactobacillus acidophilus, L. bulgaricus, L. casie, L. fermentum, L.Plantarum, Rhodoseudomonas palustris, Saccharomyces cerevisiae, and Steptococcusthermophiles.In certain embodiments, the bacteriophage lytic enzyme described herein is for delivery ina probiotic organism by genetically engineering that organism to expressed enzymes specificallylytic to Clostridium perfringens.In certain embodiments, the agent is a bacteriophage therapy. C. perfringens specificbacteriophages eliminate C. perfringens in the host with little or no consequence on the healthymicrobiota. C. perfringens specific bacteriophages include, but are not limited to, Siphoviridae,and with short noncontractile tails, members of the family Podoviridae.In some such embodiments, the bacteriophage is bacteriophage ΦCPV1 and multivalentbacteriophage cocktail designated. In other embodiments, the bacteriophage comprises a phagelytic enzyme, e.g., a lysin, that is specific for C. perfringens types B and / or D. One such lysin, amuramidase from strain ATCC 13124 (termed PlyCM) has been identified.32 Lysins specificfor Clostridium perfringens can also be delivered to subjects through genetically engineeredprobiotics. Probiotic strains expressing lysin genes that specifically hydrolyze the peptidoglycanor other components of the Clostridium perfringens cell wall can be utilized to kill Clostridiumperfringens.In certain embodiments, the agent is a vaccine against Clostridium perfringens type B ortype D bacterial strain, or the epsilon toxin (ETX) produced therefrom. Several anti-ETX vaccineshave been developed and employed to protect animals from Clostridium perfringens infections,and recombinant forms are in development. Vaccines and / or methods of making thereof,for Clostridium perfringens bacterial strains are well known in the art and / or described, forexample, in U.S. Patent No. 9,758,573, U.S. Pat. No. 6,403,094 to Titball et al.; Titball (Vaccine27, 2009, D44-D47); and other literatures, for instance, Chandran et al. (Clinical and VaccineImmunology, 2010, p. 1013-1016); and de la Rosa et al. (J ANIM Sci 1997, 75: 2328-2334), theentire contents of each of which are incorporated by reference in its entirety.In certain embodiments, the agent described herein comprises antibiotics sufficient to killoff C. perfringens type B or D bacterial strain. Antibiotics found to be effective against C.perfringens include, but are not limited to, penicillin, ampicillin, amoxicillin, metronidazole,erythromycin, and tylosin.U.S. Patent No. 9,758,573 is also specifically incorporated by reference herein for its disclosure ofmethods of administration of relevant therapeutic agents. U.S. Patent No. 9,758,573 is alsospecifically incorporated by reference herein for its disclosure of pharmaceutical compositions(including excipients).Any agent described herein can be administered alone or in combination with any suitablesecond agent to enhance the effect for prevention and / or treatment of MS in human, and / or reduceany symptoms associated with MS.In some embodiments, administering an epsilon toxin treatment agent is done conjointlywith (e.g., before, concomitantly, or after) any MS therapy known in the art (e.g., standard-of-caretreatment and off-label use of therapeutics). For example, and without limitation, such MStherapies may include Avonex® (interferon beta-1a), Betaseron® (interferon beta-1b), Copaxone®(glatiramer acetate), Extavia® (interferon beta-1b), Glatiramer Acetate Injection (glatirameracetate -generic equivalent of Copaxone 20 mg and 40 mg doses), Glatopa® (glatiramer acetate -generic equivalent of Copaxone 20mg and 40mg doses), Kesimpta® (ofatumumab), Plegridy®(peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio® (teriflunomide), Bafiertam™(monomethyl fumarate), Dimethyl Fumarate (dimethyl fumarate - generic equivalent of Tecfidera),Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent® (siponimod), Ponvory™(ponesimod), Tascenso ODT® (fingolimod), Tecfidera® (dimethyl fumarate), Vumerity®(diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab), Lemtrada®(alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko® (natalizumab-sztn) , Tysabri® (natalizumab), Rituximab, and / or Glucocorticoids (oral or IV). Purely forexemplary purposes, a subject afflicted with MS, or otherwise suspected of having MS, may beidentified as a candidate for epsilon toxin treatment by the methods disclosed herein (e.g., detectionof the ETX gene in a fecal sample from the subject as described herein). Epsilon toxin treatmentwith the agent(s) and methods disclosed herein may be performed in conjunction (e.g., (before,concomitantly, or after) with any MS therapy known in the art (e.g., standard of care treatment andoff-label use of therapeutics for MS). In some embodiments of the invention contemplated herein,treatment (e.g., epsilon toxin treatment and / or MS treatment) may be evaluated or otherwisemonitored by the methods disclosed herein (e.g., detection of lymphocyte-bound ETX in a bloodsample from the subject as described herein).Subjects / Patient Populations and MSIn some embodiments of any of the methods provided herein, the subject is a subjectsuffering from or diagnosed with MS. In some embodiments, the subject is a subject havingone, two, three, four, five or more symptoms of MS (e.g., any of the symptoms describedherein). In some embodiments, the subject is suspected of having MS (e.g., based on preliminaryevaluation or presence of one or more symptoms). In other embodiments, the subject is a subjectat risk of MS. In some embodiments, the subject is a subject whose MS has relapsed. In someembodiments, the subject is a subject whose MS at risk of relapse or progression. In particular,in some embodiments, the detection methods described herein are performed after the subjectis selected based on one of the above-mentioned parameters (such as diagnosis of MS,suspicion of MS, or having one or more symptoms of MS). In some embodiments, the subjectis a mammal. In some embodiments, the subject is a human. The MS of the subject may besufficiently dramatic so as to physically impair the patient or so mild as to not cause the patient toseek medical attention.MS may be stratified into several general disease courses: (1) relapsing / remitting MS(RRMS), characterized by self-limiting attacks of neurological dysfunction manifesting acutely,over the course of days to weeks, followed by a period of recovery, sometimes incomplete, overseveral months; (2) secondary progressive MS (SPMS), evolving from RRMS but changing suchthat the clinical course becomes characterized by steady deterioration in function unrelated to acuteattacks; (3) primary progressive MS (PPMS), characterized by a steady decline in function fromonset, with no acute attacks; and (4) progressive / relapsing MS (PRMS), also beginning with aprogressive course, with occasional attacks superimposed on the progressive decline in function.Clinically isolated syndrome (CIS) is a further term that describes the first clinical onset ofpotential multiple sclerosis (MS), typically applied to young adults with episodes of acute orsubacute onset, which reaches a peak quite rapidly within 2–3 weeks. Recovery from attacksgenerally occurs within weeks to several months from the peak of symptoms, although rarely somerecovery may continue for 2 or more years. MS may also be described as inactive MS,characterized by fixed neurologic deficits of variable magnitude.Common symptoms of MS include, without limitation, sensory disturbances (e.g., in thelimbs), an abnormal feeling of pain motor dysfunction (such as walking or gait dysfunction),muscle weakness in one or more limbs, spasticity, fatigue, optic nerve dysfunction (e.g., visualblurring due to optic neuritis), diplopia, pyramidal tract dysfunction, bladder dysfunction, boweldysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxia. In someembodiments, the detection methods described herein are practiced on MS patient who has one ormore of any of the symptoms known in the art or described herein or known in the art. In someembodiments, the detection methods described herein are practiced on MS patient who has one ormore of: sensory disturbances (e.g., in the limbs), motor dysfunction (such as walking or gaitdysfunction), muscle weakness in one or more limbs, spasticity, fatigue, optic nerve dysfunction(e.g., visual blurring due to optic neuritis), diplopia, pyramidal tract dysfunction, bladderdysfunction, bowel dysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxiaPatients having MS are typically evaluated using a motor skills assessments known in theart, and with an MRI. Motor skills assessments include the Expanded Disability Status Scale(EDSS), the Scripps Neurological Rating Scale (SNRS), the Ambulatory Index, and the MultipleSclerosis Functional Composite score (MSFC). Progression of MS may also be assessed by adetermination of the attack rate, and by magnetic resonance imaging (MRI), which can detectneural lesions associated with MS (e.g., new lesions, enhancing lesions, or combined unique activelesions).In some embodiments, provided herein is a method of treating a patient having MS, e.g.,an individual who has been diagnosed with MS and identified as a suitable recipient of epsilontoxin therapy by the methods disclosed herein, comprising administering to the individual an agentdisclosed herein. In some such embodiments, the administering epsilon toxin therapy detectablyimproves or stabilizes one or more symptoms of MS in the patient. For example and withoutlimitation, epsilon toxin therapy may improve or stabilizes a motor skills assessment score and / orlesion evaluation by MRI.SPECIFIC NUMBERED EMBODIMENTSSpecific embodiments of the disclosure are set forth in the following numbered paragraphs.1. A method for diagnosis or prognosis of a human subject at risk for multiplesclerosis (MS) comprising:a) obtaining a fecal sample from said human subject;b) detecting the relative abundance of epsilon toxin gene (ETX)-harboringand alpha toxin gene (CPA)-harboring strains of C. perfringens in the fecalsample from said human subject by Real-Time quantitative PolymeraseChain Reaction (RT-qPCR) to determine a cycle threshold for the ETXand CPA genes, wherein 2–∆∆Ct analysis is used to quantify the relativeabundance of ETX-harboring (CPA+, ETX+) over non-ETX strains (CPA+, ETX-) in the sample; andc) diagnosing the subject at risk of multiple sclerosis, wherein a 2–∆∆Ct value of > 1indicates dominance of ETX-encoding strains with increased ETX-plasmid copynumbers and 2–∆∆Ct value of< 1 indicates a higher percentage of non-ETX strainsof C. perfringens.2. A method for assessing the risk of a subject developing MS comprising:a) obtaining a fecal sample from said human subject;b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring andalpha toxin gene (CPA)-harboring strains of C. perfringens in the fecalsample from said human subject by Real-Time quantitative PolymeraseChain Reaction (RT-qPCR) to determine a cycle threshold for the ETX andCPA genes, wherein 2–∆∆Ct analysis is used to quantify the relativeabundance of ETX-harboring (CPA+, ETX+) over non- ETX strains (CPA+,ETX-) in the sample, wherein a 2–∆∆Ct value of > 1 indicates dominance ofETX-encoding strains with increased ETX-plasmid copy numbers and 2–∆∆Ctvalue of < 1 indicates a higher percentage of non-ETX strains of C. perfringens; andc) performing a standard-of-care MS evaluation on the human subject if 2–∆∆Ct is >1.3. A method for assessing the risk of worsening, relapsing, or progressing ina subject developing MS comprising:a) obtaining a fecal sample from said human subject;b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring and alphatoxin gene (CPA)-harboring strains of C. perfringens in the fecal sample fromsaid human subject by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) to determine a cycle threshold for the ETX and CPA genes, wherein 2–∆∆Ctanalysis is used to quantify the relative abundance of ETX-harboring (CPA+,ETX+) over non-ETX strains (CPA+, ETX-) in the sample, wherein a 2–∆∆Ct valueof > 1 indicates dominance of ETX-encoding strains with increased ETX-plasmidcopy numbers and 2–∆∆Ct value of< 1 indicates a higher percentage of non-ETXstrains of C. perfringens; andc) performing a standard-of-care MS evaluation on the human subject if 2–∆∆Ct is > 1.4. The method of paragraph 2 or 3, wherein a standard-of-care MS evaluationcomprises magnetic resonance imaging (MRI), evoked potentials tests,cerebral spinal fluid analysis, and / or blood tests.5. The method of paragraph 2 or 3, wherein no standard-of-care MSevaluation is performed if 2–∆∆Ct is < 1.6. A method for preventing or treating multiple sclerosis (MS) in a humansubject in need thereof comprising, the method of any one of paragraphs 1to 3 and administering to the subject a composition comprising an effectiveamount of an agent that directly or indirectly interferes with epsilon toxin(ETX) produced by the ETX- strains of C. perfringens if 2–∆∆Ct is > 1.7. The method of paragraph 6, wherein said agent is an inhibitor of ETX.8. The method of paragraph 7, wherein said inhibitor is an antibody against ETXor a functional component thereof.9. The method of paragraph 8, wherein said antibody is selected from the groupconsisting of a monoclonal antibody, a polyclonal antibody, and arecombinant antibody.10. The method of paragraph 8 or 9, wherein said antibody is a human orhumanized antibody.11. The method of any one of paragraphs 8 to 10, wherein said antibody is aneutralizing antibody against ETX or a functional component thereof.12. The method of paragraph 6, wherein said agent is an inhibitor or antagonist ofan ETX-binding receptor.13. The method of paragraph 12, wherein said ETX-binding receptor is expressedon endothelial cells of blood brain barrier (BBB) for which ETX is a ligand.14. The method of paragraph 12, wherein said ETX-binding receptor is atetraspan integral membrane receptor.15. The method of paragraph 14, wherein the tetraspan integral membranereceptor is myelin- and-lymphocyte protein (MAL) or Hepatitis A VirusCellular Receptor I (HAVCRI).16. The method of paragraph 6, wherein the agent is a soluble ETX-bindingreceptor protein.17. The method of paragraph 16, wherein the soluble ETX-binding receptorprotein is soluble HAVCRI or a fragment thereof.18. The method of paragraph 16, wherein the soluble ETX-binding receptorprotein is soluble MAL or a fragment thereof.19. The method of paragraph 6, wherein said agent is a phage lytic enzymespecific for Clostridium perfringens Type B or D bacterial strain.20. The method of paragraph 19, wherein said phage lytic enzyme is amuramidase derived from strain ATCC 13124, such as PlyCM.21. The method of paragraph 6, wherein said agent is a vaccine againstClostridium perfringens type B or type D, or the ETX produced therefrom.22. The method of paragraph 6, wherein said agent is a probiotic supplementcomprising C. peifringens type A or other bacteria type that can effectivelyoutcompete Clostridium perfringens type B or D, with no other C. perfringenstoxinotype.23. The method of paragraph 6, wherein said agent is an antibiotic sufficient tokill off C. perfringens type B and / or D.24. The method of paragraph 6, wherein the agent is not administered to the subjectif 2–∆∆Ct is <1.25. A method for determining the relative abundance of epsilon toxin (ETX)-producing strains of C. perfringens within the gut microbiome of a subjectcomprising:a) obtaining a fecal sample from said human subject;b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring andalpha toxin gene (CPA)-harboring strains of C. perfringens in the fecal samplefrom said human subject by Real-Time quantitative Polymerase ChainReaction (RT-qPCR) to determine a cycle threshold for the ETX and CPAgenes, wherein 2–∆∆Ct analysis is used to quantify the relative abundance ofETX-harboring (CPA+, ETX+) over non-ETX strains (CPA+, ETX-) in thesample;wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-encoding strainswith increased ETX-plasmid copy numbers and 2–∆∆Ct value of < 1 indicatesa higher percentage of non-ETX strains of C. perfringens.26. The method of any one of paragraphs 1 to 25, wherein detecting therelative abundance of ETX-harboring strains of C. perfringens comprisesRT-qPCR employing at least one ETX-targeting primer selected from 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.27. The method of paragraph 26, wherein detecting the relative abundance ofETX-harboring strains of C. perfringens comprises RT-qPCR employingeach of ETX-targeting primers 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3'.28. The method of paragraph 26 or 27, wherein detecting the relativeabundance of ETX- harboring strains of C. perfringens comprises RT-qPCR employing a fluorogenic probe comprising sequenceAGCAACTGCTAAGTTTACTGTTCCT.29. The method of any one of paragraphs 1 to 28, wherein detecting the relativeabundance of CPA-harboring strains of C. perfringens comprises RT-qPCRemploying at least one CPA-targeting primer selected from 5'-CTTGGAGAGGCTATGCACTATTT-3' and 5'-TTGCAACCTGCTGTGTTTATTT-3'.30. The method of any one of paragraphs 1 to 29, wherein detecting the relativeabundance of CPA-harboring strains of C. perfringens comprises RT-qPCRemploying each of CPA- targeting primers 5'-CTTGGAGAGGCTATGCACTATTT-3' and 5'-TTGCAACCTGCTGTGTTTATTT -3'.31. The method of paragraph 29 or 30, wherein detecting the relative abundance ofCPA- harboring strains of C. perfringens comprises RT-qPCR employing afluorogenic probe comprising sequence TTACTGCCGTTGATAGCGCAGGAC.32. The method of any one of paragraphs 1 to 31, wherein detecting the relativeabundance of ETX-harboring and CPA-harboring strains of C. perfringenscomprises RT-qPCR for C. perfringens abundance employing at least one C.perfringens-specific 16S rRNA primer selected from 5'-AGATGGCATCATCATTCAAC-3'and 5'- GCAAGGGATGTCAAGTGT-3'.33. The method of any one of paragraphs 1 to 32, wherein detecting the relativeabundance of ETX-harboring and CPA-harboring strains of C. perfringenscomprises RT-qPCR for C. perfringens abundance employing each of C.perfringens-specific 16S rRNA primers 5' - AGATGGCATCATCATTCAAC-3'and 5'-GCAAGGGATGTCAAGTGT-3'.34. The method of paragraph 32 or 33, wherein detecting the relative abundanceof ETX- harboring and CPA-harboring strains of C. perfringens comprisesRT-qPCR for C. perfringens abundance employing a fluorogenic probecomprising sequence AGAGTGCAGGAGAGGAGAGTGGAA.35. The method of any one of paragraphs 1 to 34, wherein quantifying the relativeabundance of ETX-harboring (CPA+, ETX+) over non-ETX strains (CPA+,ETX-) in the sample comprises RT-qPCR employingETX-targeting primer pair: 5'-CATACTGTGGGAACTTCGATACA-3' and5'- TCTTGTGAAGGGACATTATGAGTAA-3', and fluorogenic probecomprising sequence: AGCAACTGCTAAGTTTACTGTTCCT; and CPA-targeting primer pair: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC -3', and fluorogenic probecomprising sequence TGGGACTATGCAGCAAAGGTAACTTTAGC.36. The method of any one of paragraphs 1 to 35, wherein RT-qPCR comprisesemploying Universal 16S rRNA primers 5'-GCGAGACTGCCGGTAATAAA -3',and 5'- TCGTTGTACCAGCCATTGTAG -3', and fluorogenic probe comprisingsequence CCCTTATGACCTGGGCTACACACG.37. A composition for preventing or treating multiple sclerosis (MS) in a patientin need comprising a pharmaceutically acceptable excipient and an effective amountof the agent of any one of paragraphs 6 to 24.EXAMPLESExample 1: The MS gut microbiome harbors ETX-producing C. perfringens strains.Based on a statistical power calculation (Methods), 62 participants were recruitedunder the IRB protocol: Harboring the Initial Trigger of Multiple Sclerosis (HITMS),consented, and received instruction on self-collection of fecal samples. Healthy controls(HC) and MS participants were matched for age, gender, body-mass index, location ofresidence at time of fecal sample donation, and ancestry / ethnicity (Figure 9). Inclusion intothe MS arm required a diagnosis of confirmed MS based on the 2010 revised McDonaldcriteria (65). Participants having a 1st or 2nd degree relative with a diagnosis of MS, or aclinically isolated syndrome were excluded from the HC arm. Full inclusion and exclusioncriteria are detailed herein.It was recognized that ETX-producing strains of C. perfringens would likely be inrelative low abundance in human fecal samples based on the results of previous surveys andbecause the ecological niche of these mucosal-adherent bacteria is in the small intestine, asite known to be vastly underrepresented in fecal samples. Low abundance in fecal sampleslikely renders C. perfringens types B or D undetectable by metagenomics sequencingcommonly utilized in MS microbiome studies. PCR was therefore utilized, a more sensitiveapproach for gene detection than shot-gun metagenomics, to examine whether the etx geneis present in human gut microbiota. Density gradient centrifugation, Nycodenz, was usedbecause separation of bacteria from non-microbial fecal matter removes PCR inhibitors,provides a more accurate representation of bacterial composition, and enhances recoveryof the Phylum Bacillota (Firmicutes), and in particular the Class Clostridia (Figure 1A).The initial screen detected an occurrence of etx in 61% of MS patients and 13% of controls(Figure 1B). To confirm etx-positive study participants, an independent PCR was conducted,targeting a different region of the etx gene (Figure 1C). The identities of all PCR productswere verified by Sanger sequencing. The cpa / plc gene, common to all C. perfringens strains,and the 16S ribosomal RNA gene specific to C. perfringens, were also detected in those etx-positive participants (Figure 1C), as anticipated, since only C. perfringens are known tonaturally encode the etx gene. A Fisher's exact test of independence showed that etx issignificantly associated with disease status (MS vs. HC) with p = 0.0002 (Figure 1D). Theodds ratio of etx-positivity, MS vs HC, is 10.7, 95% CI: 2.9871 to 38.2381, p = 0.0003. Amultivariable logistic regression with etx- or etx+ status as a binary outcome was furtherconducted to determine if disease status (MS vs. HC) as a whole or stratified by diseasemodifying treatment is associated with etx status, independent of sex. It was found that thedisease status was independently associated with etx status, even when adjusting for sex. Inaddition, the disease status (MS vs. HC), with or without treatment, was independentlyassociated with etx status, adjusting for sex.The prevalence of fecal etx positivity in our analysis is consistent with a previouslyreported frequency of ETX immunoreactivity in sera from people with clinically definite MS(43%) and age-matched controls (16%). This suggests a high translation rate of the C.perfringens type B / D virulence factor, etx, and that the human gastrointestinal tract is asuitable environment for C. perfringens types B / D growth.The relative abundance of etx in fecal microbiota harvested from people with MS andHC was next assessed. Quantitative analysis of etx abundance relative to universal 16S byTaqMan real-time PCR was performed using a modified 2-ΔCt method. The 2-ΔCt methodallows normalization of real-time, quantitative PCR data to an internal reference. Theabundance of etx relative to universal 16S in MS and HC was assessed and it was found thatetx abundance is significantly increased in fecal microbiota harvested from people with MScompared to HC (Figure 2, A and B).C. perfringens type A strains, defined by presence of the chromosomally encoded alphatoxin gene, cpa, but none of the other major toxin genes, are human intestinal commensals. C.perfringens type B strains carry the cpa, cpb, and etx toxin genes, whereas C. perfringens typeD strains carry the cpa and etx genes. PCR analysis identified cpa in 74% of MS patientscompared to 45% of controls (Figure 10, A-C). When cpa prevalence was analyzed insubgroups of participants, according to the presence or absence of etx, cpa is coexistent withthe etx gene in etx+ participants (Figure 10D). Notably, cpa prevalence among etx-negativeparticipants is essentially indistinguishable between people with MS and HCs (Figure 10D).These results suggest non-etx strains (cpa+, etx-) are unlikely to be involved in MS. TaqManreal-time PCR showed a significant increase in cpa abundance for MS compared to controls(Figure 2C). No statistical difference for cpa abundance was found among subgroupsaccording to etx presence / absence (Figure 2, D and E). Neither prevalence nor abundance ofcpa from etx-negative participants differed between MS and HC, ruling out a role for non-etxstrains in MS pathogenesis. However, an increase in cpa prevalence in the MS group (etx- andetx+ combined) compared to HC suggests that people with MS may have a more suitablegastrointestinal environment for the survival and growth of C. perfringens.Quantification by TaqMan real-time PCR simultaneously targeting genes encodingC. perfringens-specific 16S rRNA and universal 16S rRNA confirmed an increase of C.perfringens abundance in MS compared to controls (Figure 11A). Using the 2-ΔΔCt methodwith pure reference strains as calibrators, MS participants trended toward higherpercentages of C. perfringens in fecal microbiota when compared to controls but this didnot achieve statistical significance (Figure 11, B-D). Of note, the estimates agree with thepreviously reported range (0.000001 - 0.01%) of C. perfringens abundance in fecalmicrobiota from healthy humans, confirming the organism's low-abundance.The 2018 revised classification scheme for C. perfringens defines 7 distincttoxinotypes based on carrying one or more of six major toxin genes (plc / cpa, cpb, etx, lap andlab, cpe, and netB). Multiplex PCR was performed for the major toxins used to characterizeC. perfringens toxinotypes. The majority of etx+ MS participants harbor C. perfringens typeD strains (etx+, cpa+) with fewer type B (etx+, cpa+, cpb+) strains detected (Figure 2F).C. perfringens enterotoxin (cpe), which is the main agent of C. perfringens-mediated humanfood poisoning, was not detected. Notably, unlike the more sensitive singleplex PCR(Figure 1C), etx and cpa appear to be absent in some participants by multiplex PCR, likelydue to issues of annealing temperature compatibility among individual primer pairs in themultiplex PCR system. The apparent variations of etx / cpa band intensity ratios amongparticipants, which differ from that of reference strains, suggest some participants likelyharbor a community of combined type A strains (cpa+) and type B / D strains (cpa+, cpb+,etx+ or cpa+, etx+).The significance of etx-positivity in the healthy controls was next examined. Themultiplex PCR result suggests that there is a distinctive lack of or weakened etx band in thegroup of four etx-positive HC participants (Figure 2F) despite etx being clearly detectedin singleplex PCR (Figure 1, B and C). To understand this phenomenon, a sensitiveTaqMan real-time PCR was developed to simultaneously target etx and cpa genes and usedthe 2-ΔΔCt analysis to quantify the relative abundance of etx-producing (cpa+, etx+) overnon-etx strains (cpa+, etx-) from etx+ positive MS and HC groups (Figure 2G). The 2-ΔCtvalue was computed to quantify fold changes of the etx / cpa ratio when a pure type D (cpa+,etx+) culture was used as a calibrator. A value of 1 was set as the 2-ΔΔCt for the type Dcalibrator. We reasoned that 2-ΔΔCt> 1 indicates the dominance of etx-encoding strains withincreased etx-plasmid copy numbers, and that 2-ΔΔCt < 1 indicates a higher percentage of C.perfringens type A (cpa+) in the bacterial community. The results revealed significantlyincreased 2-ΔΔCt values for the etx / cpa ratio in people with MS compared to controls (Figure2H).Since a 2-ΔΔCt value 1 would suggest that 100% of a participant's C. perfringens strainsare etx-harboring (i.e., type B and / or type D), a maximum estimate of the average percentageof etx-harboring strains in the C. perfringens community for MS or HC was then obtained.The analysis shows that etx+ MS participants contain 32% etx-harboring strains and 68%non-etx C. perfringens strains (Figure 21). In contrast, etx+ healthy controls contain 0.002%etx-harboring strains and nearly 100% non-etx C. perfringens strains. Analysis from adifferent perspective by quantifying the abundance of etx over C. perfringens-specific 16SrRNA yielded a higher estimate of the percentage of etx-harboring strains; 43% in MS and alower percentage, 0.001%, in controls (Figure 12).Together, these data consistently show that people with MS are more likely to becolonized by etx+ strains of C. perfringens in their gut microbiome than are age and gendermatched HCs. The data suggest that there is likely a yet-to-be-defined threshold of relativeabundance of ETX-producing strains, with relative abundance beyond this thresholdcontributing to MS. The complex dynamic between C. perfringens type A strains and theetx-encoding strains is likely important since type A strains compete with other C.perfringens strains for resources and because conjugative transfer between etx plasmid-harboring type D and etx-negative type A has been previously demonstrated in vitro.Example 2: Comparison of patient-derived, laboratory, and environmental isolates.To determine if MS patient-derived isolates shared features with knownenvironmental isolates and if they produced functional ETX, whole genome sequencing ofan MS patient derived isolate (SHDS0050), several environmental isolates, including type Dstrains isolated from ruminants, and the laboratory type B strain was conducted. A closed54.5 kb MS patient-derived plasmid, pSHDS0050 (Figure 3A) was successfully sequenced.This plasmid contained 63 ORFs and an etx locus flanked by mobile genetic elements. Aswith other etx plasmids, pSHDS0050 had a Tn3 (in the opposite orientation) and an IS1151transposase upstream of etx, but had two IS256 and a mutator type transposase directly after(Figure 3C). The plasmid resembled other highly conjugative plasmids of the pCW3 familythat are found in C. perfringens strains, as it contained the tcp locus and other genesassociated with conjugation and the central control region containing the parMRCpartitioning system. The plasmid lacked other toxin genes such as cpe or cpb. Whencomparing the MS patient derived type D plasmid to the other etx-containing type B and Dplasmids sequenced in herein, pSHDS0050 maintained the same conserved genes such asregB, pemK, amidoligase, permease, RICIN domain containing genes, and a radical SAMgene (Figure 3C). Interestingly, pSHDS0050 had identical plasmid architecture to the sheepisolate NCTC8346 and the goat isolate FU17 (Figure 3C), which suggests ruminants may bea potential vector for infecting humans as originally hypothesized previously. Althoughsharing much of the same genomic content, these type D plasmids were neither as large asthe 64.7 kb etx plasmids sequenced herein from type B strains ATCC3626 and NCTC3110nor the published type B strain, NCTC8533 (Figure 3C). pSHDS0050 lacked genes such ascpb2, thiF and pri present in those plasmids.The circularized chromosomes of the type D strains CN3842, NCTC8346, andFU17, and the type B strains ATCC3626 and NCTC3110 were then compared to ensurethat patient strain SHDS0050 was not a collection strain contamination. A GView BLASTatlas plot reveals that the patient-derived strain has multiple unique regions within itschromosome, distinguishing it from the other isolates (Figure 3B).To evaluate proETX production and pathogenicity, SHDS0050 was cultured, theATCC type B strain, and a ATCC type F strain in TGY broth, under anaerobic conditions,and then the supernatants assessed for proETX by Western blot. The MS patient-derivedstrain produced an —32.9 kDa proETX protein of similar mobility to the ATCC type B strain(Figure 3D). The ATCC type F strain was negative for ETX production, as anticipated. Toevaluate cytotoxicity, harvested supernatants were treated with trypsin to activate ETX.Next, CHO cells expressing the human ETX receptor, MAL (hMAL-CHO), or control CHOcells expressing GFP (GFP-CHO) were treated with trypsin-activated supernatants. Celldeath was determined by propidium iodide (PI) exclusion assay. To confirm that thecytotoxic effects were ETX mediated, trypsin-activated supernatants were also treated witha neutralizing anti-ETX antibody prior to hMAL-CHO cell treatment. Only the trypsin-activated supernatants from the Lab type B and MS patient-derived type D strain,SHDS0050, induced hMAL-CHO cell death (Figure 3E). Cell death was not observed inhMAL-CHO cells treated with broth alone, and GFP-CHO cells were insensitive to alltreatment conditions (Figure 3E). Anti-ETX antibody treatment inhibited hMAL-CHO celldeath, indicating the supernatant cytotoxicity was ETX mediated. Collectively, these dataindicate that the patient-derived C. perfringens type D strain possesses typical type D plasmidarchitecture, is competent to produce functional ETX, and conceivably could have arisen from aruminant source.Single nucleotide polymorphisms (SNPs) in bacteria genes have been linked tomicrobial fitness and the ability of pathogens to cause disease. Large-scale genomic analyseshave identified abundant SNPs in the C. perfringens genome. To characterize these variants,17 etx genes were collated with coding DNA sequences (CDS) available through theNational Center for Biotechnology Information (NCBI) database and performed acomparative alignment analysis. The SNP at site 762, carries the least conserved SNP amongthe 6 that we identified, and is the only SNP present in the coding sequence of activatedETX. At the 762 site, G substitutes for A as the minor allele regardless of C. perfringenstoxinoptype (Figure 13C).The etx genes isolated from the human fecal samples as described hereinpredominantly carry the minor allele at site 762 (95%, 20 / 21), 762G (Figure 13D). Thisvariant results in a synonymous mutation at residue 254 (Ser, corresponding to residue 222in activated ETX) in the receptor binding domain. Emerging evidence indicates thatsynonymous mutations, previously assumed to be phenotypically neutral, contribute tomicrobial fitness. Furthermore, synonymous mutations can impact mRNA secondarystructure, protein translation and protein folding.Example 3: ETX overcomes CNS immune privilege.Circulating myelin-autoreactive lymphocytes are common in the generalpopulation. Despite the prevalence of myelin autoreactive lymphocytes amongst humans,widespread autoimmunity is minimized by mechanisms of peripheral tolerance and CNSbarriers to preserve immune privilege. The importance of CNS barriers in maintainingimmune privilege is well-demonstrated in active immunization models of EAE. In thismodel system, animals are immunized with a myelin antigen, typically a myelin specificprotein or peptide, in complete Freund's adjuvant (CFA). In most paradigms, immunizedanimals do not develop clinical or histologic CNS disease unless they also receive PTX,which targets CNS endothelial cells at the BBB. Similarly, in many myelin peptide-specific T cell receptor (TCR) transgenic models, EAE occurs infrequently unless animalsreceive PTX, despite the TCR repertoire being biased toward unusually high frequenciesof autoreactive clones. Although PTX is extensively used in EAE to overcome immuneprivilege, it is clinically irrelevant to MS.Knowing that blood-borne ETX specifically targets CNS endothelial cells, whetherETX was sufficient to breach CNS immune privilege in the presence of circulating myelinautoreactive lymphocytes was tested, and a widely-used immunization model of EAE usingthe immunodominant peptide in the myelin oligodendrocyte glycoprotein (MOG) wasadapted. On day 0, female C57BL / 6 mice received a subcutaneous (SC) injection of 200 µgof synthesized mouse MOG35-55, emulsified in 50 µl of CFA. On days 0 and 2, mice receivedeither PTX at 5µg / kg body weight (`~100 ng per mouse), ETX at 50 ng / kg body weight (~1ng per mouse), or ETX at 500 ng / kg body weight (~10 ng per mouse), all deliveredintraperitoneally (IP). ETX, like PTX, was sufficient to induce clinical disease in miceimmunized with MOG35-55 (Figure 4A). In the absence of either toxin, MOG35-55 immunizedanimals remained healthy, without an observable phenotype. Disease activity induced byETX occurred at doses significantly lower than that of PTX (5 ng / kg or 50 ng / kg for ETX,and 5µg / kg for PTX). Onset, temporal course, and peak clinical deficits were similar forETX- and PTX-induced EAE when using the classical EAE scoring scale (Figure 4A). Themagnitude of demyelination in the spinal cord and the ultrastructural characteristics ofdemyelination were similar comparing ETX-induced EAE to PTX induced EAE (Figure 4,B and C). These results indicate that ETX is a potent inducer of EAE in the context of aMOG35-55 / CFA immunization paradigm.Example 4: ETX-EAE induces multi focal demyelinationETX-EAE groups displayed a wider array of behavioral deficits when compared toPTX-EAE, including ataxia, head tilt, imbalance, axial rotation, and left / right leaning, ascaptured by the atypical EAE scoring scale (Figure 5A and Figure 14). Demyelination inPTX-EAE mice was largely restricted to the spinal cord (Figures 4 and 5). In contrast,ETX-EAE mice developed multifocal demyelination more typical of MS (Figure 5B).Compared to PTX-EAE, ETX-EAE mice had nearly twice as many lesions in thecerebellum, and lesions in the corpus callosum were only observed in the ETX-EAE group(Figure 5C). ETX-induced EAE showed perivenular cuffs of mononuclear cells andmononuclear infiltrates that correlated with demyelination (Figure 15).Comparison of the immune infiltrates in brain and spinal cord between the ETX-andPTX-EAE models was made. Histologic sections in ETX-EAE, PTX-EAE, and controlswere examined for infiltrating CD4+ lymphocytes. While both models induce similardemyelination in the spinal cord, PTX-EAE showed significantly more infiltrating CD4+ Tcells in the spinal cord compared to ETX (Figure 6, A and E). For the cerebellum, thereare significantly more infiltrating CD4+ lymphocytes and more CD4+ lymphocytes inperivascular cuffs in the ETX-EAE model compared to PTX-EAE (Figure 6, B-F). In thethalamus, there was a similar trend toward more peri-venular CD4+ T cell infiltrates inETX-EAE when compared to PTX-EAE (Figure 6, C-F). In the spinal cord, similaractivation of inflammatory processes was observed in both models at peak disease, basedon immunohistochemical analysis of phospo-NFKB p65, CD68, and CD45 (Figure 7 andFigure 16). In the cerebellum, however, CD68 is significantly increased in ETX-EAE butnot PTX-EAE mice (Figure 7, A-C). A similar trend was also observed in the cerebellumfor phospo-NFKB p65 and CD45, but this did not achieve statistical significance (Figure7 and Figure 16). These results, collectively with data from Figures 4 and 5, indicate thatETX induces multifocal, inflammatory demyelination in a neuroanatomic distribution moreconsistent with MS, and with a stronger correlation between immune infiltrates anddemyelination in the ETX-EAE model compared to PTX-EAE (Figure 17).Human lymphocytes, but not mouse lymphocytes, express the ETX receptor, MAL.While it seemed unlikely that ETX functions to induce active EAE by affecting peripheralimmunity, this possibility was, nevertheless, tested through tracking MOGp-specific T cellcytokine responses via antigen recall experiments. To track the fate of MOGp-specific Tcell responses in vivo, naïve, purified MOGp35_55-specific CD4+ T cells were transferredfrom 2D2 transgenic mice into recipient wild-type B6 mice 24 hours prior to induction ofactive EAE by subcutaneous immunization with MOGp35-55 in CFA. Immunized mice thenreceived either PBS, 10 µg / kg PTX, or 500 ng / kg ETX immediately after immunization and48 hours later (Figure 18A). Mice were monitored for onset of clinical disease (Figure 18B)and fourteen days following immunization, single cell suspensions were generated frominguinal lymph nodes, cervical lymph nodes and from the CNS (brain and spinal cord) andprocessed for either 1) direct analysis of basal cytokine production by flow cytometry(Figure 18C) or 2) for ex vivo re-stimulation with MOGp35-55 for 72 hours to determinecytokine production after antigen recall (Figure 18D). For both sets of experimentsintracellular cytokine production was assessed by flow cytometry. MOGp-specific 2D2 werepositively defined as CD45+, CD3 / 5+, CD4+, and Thy1.1+. Frequencies of TNFa, IFNy, orGM-CSF positive CD4+ T cells did not significantly differ between PBS controls and ETX-treatment in cervical or inguinal lymph nodes, except for a small difference in the frequencyof TNFa positive T cells from inguinal lymph nodes, following 72 hours of re-stimulationwith MOG35-55 (Figure 18D). In CNS tissue, there were no differences noted in thefrequencies of TNFa, IFNy, or GM-CSF positive CD4+ T cells between the ETX and PTXtreatment groups. These results support the conclusion that ETX is not functioning throughsignificant effects on peripheral immunity and does not impact MOGp-specific T cellresponses during the induction of active EAE.Example 5: ETX and PTX alter the CNS endothelial cell transcriptome to induce genesinvolved in BBB dysfunction.To gain insight into mechanisms for how ETX and PTX might function inovercoming immune privilege at the CNS endothelial barrier, bulk RNA-seq wasconducted on CNS endothelial cells isolated from animals treated with ETX, PTX, or PBSand compared transcriptional profiles.Mice were treated with PBS, ETX (0.5 µg / kg b.w.), or PTX (5 µg / kg b.w) on twoconsecutive days followed by isolation of CNS endothelial cells from spinal cord for bulkRNA-seq. CNS endothelial cells were isolated from spinal cords, as previously described 16hours after the second toxin dose. Bulk RNA-seq was performed and analyzed using thelimma-voom workflow. Principal-component analysis (Figure 8A) revealed separation bytreatment. PC1 distinguished control from both ETX and PTX, whereas PC2 distinguishedETX from PTX, indicating that the ETX and PTX transcriptomes are more like each otherthan PBS controls. Identification of 798 differentially expressed genes (DEGs) was madebetween ETX and PBS treated samples, and 905 DEGs between PTX and PBS treatedsamples (FDR q-values < 0.10). Of these DEGs, 595 changed in response to both ETX andPTX treatments (Figure 8B). Comparing the fold changes (FC) of the overlapping genesrevealed a remarkable consistency in direction and magnitude of differential expressionbetween ETX and PTX treatments (Figure 8C). Considering that PTX is an A-B toxin thatfunctions through ADP-ribosylation of G-proteins and that ETX is a pore forming toxin ofthe aerolysin family, the consistency in induced and suppressed genes was both intriguingand unexpected. A heat map displaying genes of interest revealed induction of protease,signal transduction, cytokine, and transcription factor genes potentially relevant toovercoming CNS immune privilege (Figure 8D). In Figure 8E, a heat map of genesdifferentially expressed by ETX and PTX that also were identified by Munji et al. ascomponents of a core set of genes is shown to be involved in BBB dysfunction. The overallgene induction in endothelial cells isolated form PTX or ETX-treated mice shares a greatdegree of overlap (Figure 8F). Further analysis with of the RNA-seq data identifiedsignaling pathways preferentially activated by ETX (Figure 8G).Example 6: Discussion of Examples 1-5It was presumed that the factors responsible for the formation of the initial lesionsin MS are the same factors responsible for new lesion formation throughout the course ofthe disease. That is, environmental triggers for MS likely do not occur once at diseaseinitiation, but rather, arise repeatedly throughout the course of disease. The episodic natureof MS disease activity aligns well with the ETX hypothesis. ETX production occurs whenC. perfringens types B or D enter log-phase growth and is thus tied to increased abundanceof these strains in the gut microbiome. Brief cycles of log-phase growth, followed by longperiods of quiescence, would account for episodic ETX production. MS disease activity islinked to an increased relative abundance of Bacillota (Firmicutes), which includes theGenus Clostridium, suggesting that the MS gut microbiome episodically favors growth ofthis Phylum. In addition to our findings, it is notable that the species, C. perfringens, isthe most highly associated bacteria with neuromyelitis optica; an immune-mediated,demyelinating disorder affecting the spinal cord and optic nerve.C. perfringens type D is responsible for enterotoxemia in sheep, goats, and lessfrequently, in cattle. The disease has worldwide distribution and can be acute, sub-acute,chronic, or fatal. Although enterotoxemia type D is an infectious disease that can occur inthe form of small outbreaks via the oral-fecal route, it is not a typical contagious disease.A variable number of ruminants harbor C. perfringens type D in their small intestine, butmicroorganism numbers are generally small and clinical disease does not occur unless theintestinal microbial balance is disrupted. When large quantities of readily fermentablecarbohydrates are fed to these animals, undigested starch passes into the small intestine andprovides a substrate for C. perfringens to proliferate rapidly. This is followed by productionof large amounts of ETX, which is then absorbed into the systemic circulation. The bacteriaare passed by feces into the environment and can survive for several months in the soil.Neonates and older animals become infected via the fecal-oral route.The Epstein Barr Virus (EBV) has been proposed as an environmental trigger forMS, potentially functioning through molecular mimicry. In humans, EBV is significantlyassociated with MS, but seroconversion is itself not sufficient to induce MS as ~94% of thegeneral population is seropositive by age 24, yet MS risk remains relatively low. Thissuggests that while EBV may play a role in MS pathogenesis, an additional, but less widelydistributed causal factor may be required, which we propose to be C. perfringens type B orD. Attorney Docket No. CUW-02661In summary, a strong clinical association was found between a specific bacterium,its toxin, and a diagnosis of MS. In addition, the abundance of ETX-producing strains ofC. perfringens was found to be significantly elevated in the MS gut microbiome. Providedherein is a biologically plausible mechanism by which ETX functions in the multistepprocess of CNS autoimmunity.Example 7: Materials and Methods of Examples 1-5Statistical AnalysisStatistical analysis was performed using GraphPad Prism (v.9; GraphPad) andMicrosoft Excel (2016; Microsoft). Data of Gaussian distribution are represented as mean± SEM (standard error of the mean) or SD (standard deviation) wherever appropriate. Dataof non-Gaussian distribution are represented as median ± range. Unpaired two-tailed t-test(for Gaussian distribution) or Mann-Whitney test (non-Gaussian distribution) were used tocompare two datasets for statistical significance. For multiple datasets, one-way ANOVAfollowed by post hoc Tukey's multiple comparisons test (for Gaussian distribution), orKruskal-Wallis test followed by post hoc Dunn's multiple comparisons test (for non-Gaussian distribution) were carried out to determine statistical significance. For EAE timecourse analysis, non-parametric Friedman test followed by post hoc Dunn's test wasperformed. Pearson's correlation analysis was performed to examine whether the density ofCNS infiltrating lymphocytes correlates with the extent of demyelination. One phase decaymodel was employed for curve fitting. Multivariable logistic regression was used to test thedifference while adjusting for covariates. Statistical significance of all analyses are statedin figures or legends.Data and materials availability C. perfringens chromosome and plasmid sequences were deposited into GenBankunder the following accession numbers (chromosome, plasmid for each strain): C.perfringens type D CN3842 (CP116428, CP116429), C. perfringens type D NCTC8346(CP116430, CP116431), C. perfringens type D FU17 (CP116432, CP116433), C.perfringenstype D SHDS0050 (CP116434, CP116435), C. perfringens type B NCTC3110(CP116436, CP116437), and C. perfringens type B ATCC3626 (CP116438, CP116439).The RNA-seq data have been deposited in NCBI's Gene Expression Omnibus(Edgar et al., 2002) and are accessible through GEO Series accession number GSE223137Reagents and Resources Reagent Source Identifier Chemicals, peptides, and recombinant proteins Epsilon protoxin, from Clostridium perfringens, BEI Resources* NR-856Strain 34 (Type B)Immobilized TPCK Trypsin Thermo Scientific 20230AnaSpec Cat# AS-60130-5 Lyophilized rat / mouse MOG 35-55 peptide(Ac / Amide)List Biological Cat# 181Bordetella pertussis toxin, lyophilizedBD Difco Cat# BD231141Heat-killed M tuberculosis H37 Ra (TB)BD Difco Cat# 263810 Mbutyricum-containing complete Freund'sadjuvant4% ParaformaldehydeEM fixative NYU EM CoreNycodenz Alere Technologie s Cat# 1002424Phenol: Chloroform: Isoamyl alcohol Thermo Fisher Cat# BP1752LProteinase K Sigma Cat# P2308Lysozyme Thermo Fisher Cat# 89833RNase A Thermo Fisher Cat# EN0531Rabbit anti-CD4 monoclonal antibody Abcam Ab183685[EPR19514]Rat anti-CD45 monoclonal antibody [13 / 2.3] Abcam Ab10588Rabbit anti-CD68 polyclonal antibody Abcam Ab125212Rabbit anti-p-NFkB p65 (Ser 276) polyclonal GeneTex GTX55113antibodyExperimental models: organisms / strainsMouse: C57BL / 6J The Jackson Laboratory RRID: IMSRJAX:000664Clostridium perfringens type D patient isolate, Vartanian SHDS0050LaboratoryClostridium perfringens type B The Uzal Laboratory ATCC3626 Clostridium perfringens type B The Uzal Laboratory NCTC3110 Clostridium perfringens type D The Uzal Laboratory NCTC8346 Clostridium perfringens type D The Uzal Laboratory CN3842 Clostridium perfringens type D FU17Recruitment of study participants and IRBHarboring the Initial Trigger of Multiple Sclerosis (HITMS) IRB# 1003010940:Patients were prospectively screened for eligibility for the HITMS study by Weill Cornell MSCenter Research Coordinators and eligible participants were provided with the study synopsisand the informed consent form to review. HC were recruited by advertising through flyers,website announcements, and recruiting friends of patients (genetically unrelated). Participantswishing to join the study completed and signed the informed consent in the presence of IRBapproved personnel within the MS Center. Enrolled participants were assigned a study number,provided a fecal collection kit consisting of two biohazard bags, 6 x 50 ml sterile conicalpolypropylene tubes, one freezer box, a blue pad, a fecal collection toilet hat, sterile tonguedepressors, and instructions on self-collection of fecal samples.Criteria for inclusion / exclusion of study participants and sample sizeHarboring the Initial Trigger of Multiple Sclerosis (HITMS) IRB# 1003010940: Patientswere prospectively screened for eligibility for the HITMS study by Weill Cornell MS CenterResearch Coordinators and eligible participants were provided with the study synopsis and theinformed consent form to review. HC were recruited by advertising through flyers, websiteannouncements, and recruiting friends of patients (genetically unrelated). Participants wishingto join the study completed and signed the informed consent in the presence of IRB approvedpersonnel within the MS Center. Enrolled participants were assigned a study number, provideda fecal collection kit consisting of two biohazard bags, 6 x 50 ml sterile conical polypropylenetubes, one freezer box, a blue pad, a fecal collection toilet hat, sterile tongue depressors, andinstructions on self-collection of fecal samples.Inclusion criteria: 1. Participants with clinically definite multiple sclerosis (MS) (1) — maleand female participants 18 years of age or older who have been accurately diagnosed with MSbased on revised McDonald criteria (1). These subjects must have the ability to provide consentand be willing to participate in the study. 2. Healthy controls were enrolled for comparison.Exclusion criteria: Any participant who met the criteria below was excluded fromparticipating in this study: 1. Inability to provide informed consent(2). 2. Any form of dementia orcognitive impairment (2). 3. Current or chronic use of anticoagulants. 4. Pregnancy. 3. Body massindex greater than or equal to 39 or less than or equal to 17.5.5. Use of the following medicationswithin the last 6 months: a) Systemic antibiotics (intravenous, intramuscular, or oral) for greaterthan 3 days, b) Amylase inhibitors, c) Commercial probiotics consumed at cfu's > 108 organismsper day). 6. Chronic immunodeficiency, renal, metabolic, pancreatic, hepatic, gastrointestinal(Crohn's Disease, Ulcerative colitis), pulmonary, or cardiovascular disease requiring ongoingtreatment. 7. Hematologic disease, derangements, blood dyscrasias, unrelated to standard ofcare MS treatments. 8. Major dietary changes (e.g., omnivore to vegan, vegan to omnivore) inthe 3 months prior to fecal sample collection. 7. Chronic alcohol consumption defined as morethan 5 oz (or 5 drinks) or ethanol per day. 8. Any history of fecal microbiota transfer. Many ofthe above criteria were based on the NIH Human Microbiome Project Core MicrobiomeSampling Protocol A. Sample size: the power calculation was based on a dichotomous resultof being etx- positive or negative. Estimation of the incidence of being etx-positive was 10%in the HC group and 40% in the MS group. The Alpha was set at 0.05, Beta at 0.2, and a Powerof 0.8. This resulted in a calculated sample size of 62 participants with 1:1 enrolment of 31 HCand 31 MS participants.Fecal microbiota separation and DNA extractionStool samples were collected from 31 MS patients and 31 healthy donors and stored ina locked 80°C freezer. Frozen samples were thawed in a Whitley A35 HEPA workstation set at37°C with 40% humidity for an hour. A part of each stool sample was subjected to Nycodenzdensity gradient for separating the microbiota from other fecal materials, and each fecal samplewas sampled at minimum 3 times. Two grams of feces were aseptically transferred with a steriletongue depressor to 18 mL of 0.9% NaCl prepared in ultrapure water, containing 16, 2 mmsterile metal beads, and homogenized by vortexing for 2 minutes. 10.5 mL of homogenizedfeces were added onto the top of 3.5 mL of 80% (w / v) Nycodenz in ultrapure water, andcentrifuged at 10,000 g for 1 hour at 4 °C. The layer corresponding to microbiota was collected,washed twice with 1 mL PBS, and resuspended in 1 mL PBS. Bacteria were digested withlysozyme, RNase A, and proteinase K, lysed with sodium sarkosyl. From lysates DNA wasextracted with phenol, precipitated with 100% ethanol, and finally re-suspended in sterileultrapure water for subsequent standard PCR and quantitative PCR analyses. C. perfringensreference strains, including ATCC 3626, ATCC 13124, ATCC12915, and FD203, were grown onRapid Perfringens Medium (RPM) overnight. Bacteria were harvested by centrifugation at 4000rpm for 10 min at 4 °C and followed by total DNA extraction as descried above. DNA fromreference strains were included in both standard PCR and quantitative PCR analyses as controls orcalibrators.Detection of the etx gene and toxinotyping of C. perfringens communitiesFor the detection of etx and other genes indicated in the study, simplex and multiplex PCRswere performed with DNAs extracted from fecal microbiota using Platinum II Hot Start OCRMaster Mix kit (Thermo Fisher # 14000014) following the manufacture's instructions and usingthe PCR primers and parameters that follow.Primers and parameters on PCR analysisFor the detection of etx and other genes indicated in the study, simplex PCR includes thefollowing primers:etx (3' terminal; 542 bp), forward: 5'-ACTGCAACTACTACTCATACTGTG-3',reverse: 5'- CTGGTGCCTTAATAGAAAGACTCC-3' ;etx (3' terminal; 390bp), forward: 5'- ACTGCAACTACTACTCATACTGTG-3',reverse: 5'- CTGGTGCCTTAATAGAAAGACTCC-3' ;etx (5' terminal; 679 bp), forward: 5'-GCATCAGCGGTGATATCCATC-3', reverse:5' -TCTCTCCCCATTCACTTCCAC-3';cpa / plc, forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'-CATGTAGTCATCTGTTCCAGCATC-3';Universal 16S rRNA, forward (8F): 5'-AGAGTTTGATCCTGGCTCAG-3', reverse(1492R): 5'-GGTTACCTTGTTACGACTT-3';C. perfringens-specific 16S rRNA, forward: 5'-AGATGGCATCATCATTCAAC-3',reverse: 5'-GCAAGGGATGTCAAGTGT-3'.Toxinotyping of C. perfringens in the fecal microbiota was performed using amodified multiplex protocol based on a recent report. Primers included in the multiplexPCR include the following:etx (5'-terminal): etx (5' terminal, 697 bp), forward: 5'-GCATCAGCGGTGATATCCATC-3', reverse: 5'-TCTCTCCCCATTCACTTCCAC-3';cpa / plc (402 bp), forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'- CATGTAGTCATCTGTTCCAGCATC-3' ;cpb (236 bp), forward: 5'-ACTATACAGACAGATCATTCAACC-3', reverse: 5' -TTAGGAGCAGTTAGAACTACAGAC-3';itx (317 bp): forward, 5' -GCGATGAAAAGCCTACACCACTAC-3', reverse, 5' -GGTATATCCTCCACGCATATAGTC-3';cpe (506 bp), forward: 5'-GGGGAACCCTCAGTAGTTTCA-3', reverse: 5'-ACCAGCTGGATTTGAGTTTAATG-3'.For both simplex and multiplex PCRs, C. perfringens reference strains, includingATCC 3626 for type B and FD203 for type D, were used as the positive control for etx,whereas reference strains, including ATCC 13124 for type A and ATCC 12915 for type F,served as the negative controls for etx.The amplification program used for all assays started with 94 °C for 5 min and followedby 35 cycles of 45 sec at 94 °C, 1 min at 50-58 °C (for simplex PCRs: 57 °C for 5'-etx, 53 °Cfor 3'-etx, 58 °C for cpa, 50 °C for universal 16S rRNA, 55 °C for C. perfringens-specific 16SrRNA; for multiplex PCR: 55°C ), 1 min at 68 °C, and a final extension step of 10 min at 68°C. . The PCR products were electrophoresed on 1.2% agarose gel and visualized by an Azurec200 Gel Imaging System.Quantitative analysis of etx gene abundance and proportion of etx-harboring C. perfringens in thefecal microbiotaQuantitative PCR (qPCR) was performed on an Applied Biosystems QuantStudio 6 FlexReal-Time PCR System (Thermo Fisher) using PerfecTa Multiplex qPCR SuperMix kit(Quanta Bio # 95108-200) following the manufacture's instruction. Custom-designed target-specific TaqMan probes labeled with FAM / VIC and quenched with TAMRA / MGBNFG wereutilized. In each qPCR system, amplicons were designed to be of similar sizes, and primers forthe target sequences having similar melting temperatures were elected to achieve comparableamplification efficiency. Universal 16S rRNA served as a reference gene in most cases. Allmeasurements were performed in triplicate. The specificity of each qPCR system was testedand verified by using etx-harboring or non-etx C. perfringens reference strains as positive andnegative controls. Relative abundance of etx, cpa, and C. perfringens-specific 16S rRNA geneswas determined by setting universal 16S rRNA as a reference gene using cycle of threshold(Ct) and a 2' algorithm (3). Further, percentage of C. perfringens among fecal microbiota wascomputed using lab reference strain culture (100%) as calibrators based on a 2' algorithm(3).Similarly, ratios of etx-harboring strains over non-etx strains were assessed using etx / cpa froma reference etx-harboring strain (type D). PCR primers and parameters for qPCR analysisfollow.Primers and parameters on qPCR analysisqPCR for ebc abundance include the following primers and fluorogenic probes:ebc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM-AGCAACTGCTAAGTTTACTGTTCCT-TAMRA;Universal 16S rRNA, forward, 5'-GCGAGACTGCCGGTAATAAA -3', reverse, 5'-TCGTTGTACCAGCCATTGTAG -3', probe: VIC -CCCTTATGACCTGGGCTACACACG — MGBNFQ.A PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62 °C, and 30 sec at68 °C for 40 cycles.qPCR for cpa abundance include the following primers and fluorogenic probes:cpa, forward: 5'- CTTGGAGAGGCTATGCACTATTT -3', reverse: 5'-TTGCAACCTGCTGTGTTTATTT 3', probe: 6-FAM-TTACTGCCGTTGATAGCGCAGGAC-TAMRA;Universal 16S rRNA, forward, 5'- GCGAGACTGCCGGTAATAAA -3', reverse, 5'-TCGTTGTACCAGCCATTGTAG -3', probe: VIC -CCCTTATGACCTGGGCTACACACG —MGBNFQ.APCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62°C, and 30 sec at68 °C for 40 cycles.qPCR for C. perfringens abundance include the following primers and fluorogenicprobes:C. perfringens-specific 16S rRNA, forward: 5'-AGATGGCATCATCATTCAAC-3',reverse: 5'-GCAAGGGATGTCAAGTGT-3', probe: 6-FAM-AGAGTGCAGGAGAGGAGAGTGGAA - TAMRA;Universal 16S rRNA, forward, 5'- GCGAGACTGCCGGTAATAAA -3', reverse, 5'-TCGTTGTACCAGCCATTGTAG -3', probe: VIC - CCCTTATGACCTGGGCTACACACG—MGBNFQ.APCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 58 °C, and 1 min 15 secat 68 °C for 40 cycles.qPCR for etx / cpa ratio include the following primers and fluorogenic probes:ebc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM-AGCAACTGCTAAGTTTACTGTTCCT-TAMRA;cpa, forward: 5'- GCATGAGTCATAGTTGGGATGA -3', reverse: 5'-CTGATGGATCATTACCCTCTGATAC -3', probe: VIC-TGGGACTATGCAGCAAAGGTAACTTTAGC -MGBNFQ.A PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62 °C, and 30 sec at 68°C for 40 cycles.Bacterial strains and cultureMultiple C. perfringens strains were utilized in this study. The type B strain, ATCC3626,was purchased from ATCC. Four other collection strains were provided by Francisco Uzal: 3 typeD strains, CN3842, NCTC8346, and FU17, and 1 type B strain NCTC3110. The type D strainFU17 was isolated from the gut of a goat with clinical enterotoxemia, including brain perivascularedema (4). All strains, including the type D strain SHDS0050 isolated in this study, were grownand maintained at 37°C with 40% humidity in a Whitley A35 HEPA anaerobic workstation in rapidperfringens media (RPM) (3% fluid thioglycolate medium, 6% gelatin, 0.5% peptone, 0.5%dextrose, 0.5% potassium phosphate dibasic. 0.3% yeast extract, 0.15% sodium chloride 0.05%ferrous sulfate, 440mg / mL D-cycloserine) (5).Genome sequencing preparation and analysisTo understand the etx plasmid architecture of the SHDS0050 strain and compare it to otheretx-producing strains, pure cultures of C. perfringens strains ATCC 3626, CN 3842, FU17, NCTC3310, NCTC 8346, and SHDS0050, were grown overnight in RPM, and total genomic DNA wasisolated from each strain. DNA library preparations were made for both Illumina (short reads) andOxford Nanopore sequencing (long reads) with 50X coverage for each. Illumina libraries weregenerated using the Nextera Flex Protocol (now renamed Illumina DNA Prep).250ng of genomic DNA for each sample was diluted into l0ul and taken into library prep.DNA was fragmented, cleaned, and amplified using IDT indexes for multiplexing. Sampleswere run on a NovaSeq S4 Flow Cell at PE150 and reads were demultiplexed using IlluminaBaseSpace software. Nanopore libraries were generated using the LSK-109 ligation sequencingkit from Oxford Nanopore and run on the PromethlON sequencing device. Briefly, 1µg of DNAwas diluted into 48µ1 and taken into library prep using the LSK-109 kit from Oxford Nanopore.Adapters were ligated to the DNA, followed by motor proteins. This library was loaded onto aPromethlON Flow Cell PRO-002 and allowed to run for 64 hours. Reads were demultiplexedusing Guppy software from Oxford Nanopore built in to the PromethlON device. Nanoporereads were assembled using the Flye 2.8 assembler, with 10 iterations. Medaka 1.0.3 (OxfordNanopore Technologies Ltd.) was used to polish the Flye assemblies with the Nanopore reads.To further clean the assemblies, Illumina reads were trimmed and quality controlled via Fastp0.20.0 and were mapped onto the Medaka polished genome using the Burrows-Wheeler Aligner(BWA) 0.7.17. These alignments were used to further polish the genome with Pilon 1.23. Further,both Illumina and Nanopore reads were assembled in a hybrid assembly with SPAdes 3.13.Chromosomes were circularized using Circlator 3.0 or by aligning the SPAdes assemblies to themore contiguous Flye assemblies. To ensure that plasmids were circular, plasmid sequences fromthe polished Flye assemblies were aligned to the SPAdes assemblies using Mauve, and theSPAdes assembly was used to fill in the gaps to circularize the plasmids. Chromosomeassemblies were compared using the BLAST Atlas function of GView.Bacterial culture conditions for pETX productionFrozen cultures stored at -80°C in 50% RPM / 50% glycerol stocks were streaked ontoBBLTM Schaedler Agar with Vitamin K1 and 5% Sheep Blood (BD) and placed in BD GasPakEZ anaerobe pouch system grown at 37°C for at least 48 hours. Large inoculums were used tostart 13mL RPM cultures incubated at 37°C for six hours under anerobic conditions. 3mL ofthe 6-hour RPM cultures were used to inoculate 10mL of TGY broth (3% tryptic soy broth, 1%yeast extract, 0.1% sodium thioglycolate). TGY cultures were incubated overnight at 37°C. Toharvest conditioned media, overnight TGY cultures were centrifuged at 12,000rcf for tenminutes and supernatant carefully collected without disturbing bacterial pellets. Harvestedmedia was stored at -20°C until use. Sterile broth was used as negative controls. Note, whenthis protocol was used, a direct inoculation into TGY broth did not result in growth.Western blot analysis of proETX productionA total of 10µl of conditioned TGY broth were loaded onto gels. 10µl of sterile TGY brothwas used as a negative control.10ng of pETX in 110µl of PBS or TGY broth were used as positivecontrols. All samples were prepared in 2X Laemmli Sample Buffer (Bio-Rad) containing 5% 2-Mercaptoethanol (Bio-Rad) and heated at 95°C for 5 min before loading onto 4-20% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad). 5u1 per lane of WesternSure Pre-stainedChemiluminescent protein ladder (Licor) were used as molecular weight standards. Gels were runin Tris / Glycine SDS Buffer (Bio-Rad) at 200 V for 30 min. Semi-dry transfers were performed intransfer Tris / Glycine Buffer (Bio-Rad) using the Trans-Blot SD Semi-Dry ElectrophoreticTransfer Cell system (Bio-Rad) at 15 V for 15 min. Blots were blocked in 5% Blotting-GradeBlocker nonfat milk (Bio-Rad) in Tris Buffered Saline with Tween 20 (TBS-T, Cell SignalingTechnology) for 30 minutes at room temperature. Blots were then incubated with anti-ETXantibody JL008 (16) at 0.211g / mL in blocking solution overnight at 4°C. Blots were washedwith TBS-T at room temperature and incubated with secondary antibody peroxidase-conjugated Affinipure Goat Anti-Rabbit IgG H + L (Jackson ImmunoResearch) at 0.0241.tg / mL in blocking solution for 1 hour at RT. Blots were washed again in TB S-T anddeveloped for 5 min at room temperature in SuperSignal West Dura Extended DurationSubstrate (ThermoFisher Scientific). The developed blots were visualized on 5x7 CL-XPosureFilms (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX-101Afilm processor.ETX activationEpsilon protoxin purified from culture supernatants of C. perfringens strain 34 (type B) orfrom culture supernatants was activated with immobilized TPCK Trypsin following themanufacture's protocol. Each batch of activated ETX was normalized for activity by the assessmentof cytoxicity using a CHO cell line that expresses rMAL. Epsilon Protoxin, from C. perfringens,Strain 34 (Type B), NR-856 was obtained through BEI Resources, NIAID, NIH.hMAL-CHO cell sensitivity assayHarvested TGY broth was incubated with equal amounts 0.25% Trypsin-EDTA solution(Gibco) for 2 hours at 37°C. Sterile TGY broth was used as a control. Trypsin activity was stoppedby the addition of FBS to a total FBS percentage of 25% (i.e. 25uL FBS added to 100u1 ofTGY / Trypsin solution). 50µl of trypsin treated TGY broth were used to treat confluent hMAL-CHO cells seeded in 200 µl of CHO cell media (Dulbecco's Modified Eagle's Medium / Ham's F12medium (Life Technologies) with 10% heat-inactivated fetal bovine serum, Glutamax, and 50units / ml penicillin and 50 µg / ml streptomycin) in 96 well plates. Portions of the trypsin treatedTGY broths were treated with neutralizing anti-ETX antibody JL004 at 50 µg / mL for 20 minutesprior to CHO cell treatment. CHO cells were treated overnight at 37°C . To access cell death, cellswere treated with 50 µg / mL of propidium iodide (PI, Sigma). Live images of randomly chosenfields in each well were acquired under an inverted fluorescence microscope (Nikon, Minato,Tokyo, Japan) equipped with a Charged Coupled Device (CCD) camera (Carl Zeiss, Oberkochen,Germany) imaged with Spot software and were then imported into ImageJ64 in 8-bit gray format.For quantification of PI-positive cells, the images were converted into binary images by applyingthe same threshold value to all images collected from the same experiment. Analyze Particlesfunction was selected to automatically count the particle numbers Data were exported and analyzedin Excel (Microsoft) and Prism version 9.0.2 (Graphpad).EAE induction and clinical scoring8-10-week-old female C57BL / 6 mice received subcutaneous (s.c.) injection of 200 µgsynthesized mouse / rat MOG35-55 (MEVGWYRSPFSRVVHLYRNGK) emulsified in 5011.1 ofcomplete Freund adjuvant and supplemented with 200 µg heat-inactivated M tuberculosis H37Ra(TB). On day 0 and 2, 150 ng pertussis toxin or ETX at 50 or 500 ng / kg b.w. was administeredvia intraperitoneal injection. Animals were weighed and scored daily. Assessment of classicalEAE was based on a previously published scale and as follows: 0 refers no physical signs ofdisability; 0.5, loss of tail tone or distal tail limpness; 1, complete tail limpness; 2, both limp tailand weakness / dragging of hind limbs; 3, hind limb paralysis, 4, complete paralysis of hind limbsand partial paralysis of forelimbs; 5, moribund or death. Peak, average, and accumulative scoreswere calculated to assess EAE severity.Assessment of atypical EAE was carried out separately from the classical EAE symptomdescribed above, and based on previously published scales with modifications, Specifically: 0,no disease; 1, hunched appearance, stiff tail, slight head tilt; 2, staggered walking, scruffy coat;3, staggering irregularly and lurching from side to side, obvious impaired balance / ambulation,slight axial rotation; 4, Severe axial rotation, spinning, severe body lean, fall; 5, moribund. Asdiseased mice experienced ascending paralysis, it became increasingly impossible and lesscertain to evaluate ataxia, the hallmark of atypical EAE. Thus, the end point of atypical EAEassessment was set at a time when classical EAE has reached the peak, which ranged from 17-21 days.Histological analysisMice were anesthetized with ketamine / xylene cocktail and followed by transcardiacperfusion with PBS and 4% PFA. Brains and spinal cords were removed, processed for paraffin-embedding and sectioned at 5µm thickness. Sections were stained with hematoxylin and eosinto evaluate the overall morphology and lymphocyte infiltration. The inflammatory parameterswere assessed on the following scale: 0, no sign of inflammation; 1, scattered inflammatorycells; 2, some inflammatory cells and karyopyknosis; 3, perivascular inflammatory cellinfiltrate; and 4, marked inflammatory cell infiltration into the parenchyma. Consecutivesections were stained with Luxol Fast Blue (LFB) for myelin. The size of demyelinated areaand the number of infiltrating inflammatory cells were measured using ImageJ software(National Institutes of Health, USA). A universal threshold was applied to the images across allsections in all conditions. Area of LFB staining intensity was limited to threshold, while thetotal area of white matter was measured without thresholding. Myelin integrity is defined by theratio of LFB-stained area within the WM (pixel with thresholding) over the total area of theWM (pixel without thresholding) and expressed as percentage.Immunohistochemical analysisParaffin-embedded sections from EAE and control mice were submitted to Histowiz (NewYork NY) for immunohistochemical staining for CD4, CD45, CD68, and phosho-NFKBexpression. Quantification of staining signal was performed with Image J software (NationalInstitutes of Health, USA) and integrated intensity was used for statistical analysis with Prism 9.Electron microscopyMice were anesthetized with ketamine / xylene cocktail, transcardiacally perfused with 0.1M PB and EM fixative 4%PFA, 2.5% glutaraldehyde, 0.1M sucrose in 0.1MP. Immediately afterperfusion, brains and lumbar spinal cords were removed and cut into 2 mm-thick brain slices andspinal cord segments. The trimmed tissues were Immersed in the above fixative for two days beforetissue processing at the Electron Microscopy Core of New York University. Semi-thin sections at1 µm thickness were cut and stained with toulidine to identify target regions using lightmicroscopy. The target regions were then trimmed and reoriented and embedded in epoxy resin.Ultrathin (70 nm) cross sections were cut and stained with uranyl acetate and lead citrate, andimaged under transmission electron microscope (JEOL, MA).Structural analysis on myelinElectron microscopy analysis was performed to determine changes of myelin sheath inEAE and control mice following a standard protocol. Tissues processing, preparation of semi-thin and ultrathin sections, and imaging were performed at the Electron Microscopy Core ofNew York University. For quantification, 30-40 electron micrographs from 12 randomly chosenfields from each mouse were imaged at both low (4000 X) and high magnifications (40000 X),among which 12 micrographs of adequate quality were used for analysis with Image J.Parameters used to evaluate demyelination included counts of unmyelinated / demyelinatedaxons, and morphological abnormalities of myelin sheaths and axons.Unmyelinated / demyelinated axons were defined as an axon of appropriate diameter without atleast one complete wrap of an oligodendrocyte process. Demyelination was expressed as anaverage number of unmyelinated axons per field as well as per area unit (mm2) measured usingImage J. Axon degeneration was assessed based on a previously published classificationscheme(21). According to this scheme, degenerated axons are identified as a) myelin profilesthat lack an axon (axolysis, either due to vacuolization or to condensation); b) swollen axonslacking organelles and neurofilaments; c) axons that contain swollen mitochondria ormitochondria with disrupted cristae; d) axonal profiles with electron dense cytoplasm likely dueto increased cytoskeletal or neurofilament density. Quantification of staining signal wasperformed with Image J software (National Institutes of Health, USA) and integrated intensitywas used for statistical analysis with Prism 9.Isolation of cells from lymph nodes and CNS of mice and antigen-recall assayMice were euthanized and lymph nodes (cervical and inguinal), central nervous system(CNS, brain and spinal cord) were immediately collected by dissection and held on completeRPMI media containing 10% FBS, Penicillin-Streptomycin, L-glu, HEPES, and P-mercaptoethanol. Lymph nodes were dissociated using a syringe plunger passed through cellstrainer (70 p.m). The CNS was finely minced with a razor blade and digested for 20 minutes at37°C in incubator shaker with collagenase D (2 mg / ml; Roche Diagnostics) and DNase1 (0.1mg / ml; Sigma) in HBSS (Sigma Aldrich). Mononuclear cells were further purified by passagethrough cell strainer (70 p.m) and enriched by 30 over 70% Percoll gradient centrifugation (GEHealthcare). Where indicated, to determine antigen-recall response, bulk cell suspensions werecultured at 37°C for 72 hours with exogenous MOGp35-55 (50 ug / mL) prior to analysis ofcytokine production by flow cytometry.CNS endothelial isolation, RNA extraction, sequencing, and RNA-sequencing analysisMice were treated with PBS, ETX (0.51.tg / kg b.w.), or PTX (51.tg / kg b.w) on twoconsecutive day. 16 hours after the second dose, CNS endothelial cells were isolated from spinalcords or brains with the cerebellum removed as previously described. Brefily, CNS tissue wasenzymatically dissociated with a papain solution followed by vigorous trituration and a seconddissociation with collangese and dispase solution. Myelin was removed using Miltenyi BiotecMyelin Removal Beads II per the manufacturer's instructions. Isolated cells were stained withanti-CD31 clone 390, anti-CD45 clone 30-F11 (, and CD1 lb clone M1 / 70, anti-CD13 clone R3-242, anti-PDGFbeta clone APB%, and DAPI. Viable endothelial cells (DAPI-) positive forCD31 only (CD31+, CD45-, CD1 lb-, CD13-, and PDGFbeta -) were sorted via FACS using aBD Biosciences FACSAria II Cell Sorter. RNA was extracted from sorted endothelial cellsusing Qiagen's RNeasy Plus Micro Kit per the manufacturer's instructions. Total RNA integritywas checked using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). The cDNAsynthesis and amplification were performed by SMART-Seq v4 ultra low input RNA kit (TakaraBio USA, Mountain View, CA, USA) starting with less than 1 ng of total RNA from eachsample. 150 pg of qualified full-length double-strand cDNA was used and processed forIllumina library construction with the Nextera XT DNA Library Preparation Kits (Illumina, SanDiego, CA). Then the normalized cDNA libraries were pooled and sequenced on IlluminaNovaSeq6000 sequencer with pair-end 100 cycles. The raw sequencing reads in BCL formatwere processed through bcl2fastq 2.19 (Illumina) for FASTQ conversion and demultiplexing.Raw reads were quality checked with FastQC v0.11.7. Reads were aligned to the mousereference genome (GRCm38.p6) using STAR v2.7.6a with default parameters. Geneabundances were calculated with featureCounts v2.0.1 using composite gene models fromGencode release vM25. Differential expression analysis was performed in R using limma(v3.50.3), after removing lowly expressed genes with the filterByExpr function from edgeR(v3.36.0). In brief, linear models were fitted with treatment information to create the designmatrix, followed by empirical Bayes moderation of t-statistics. Raw P-values were adjusted formultiple testing using the Benjamini & Hochberg method, and only genes with an adjusted p <0.10 were considered differentially expressed. Differentially expressed genes for the ETX vs.PBS contrast were analyzed using Ingenuity Pathway Analysis (IPA, QIAGEN Inc., pathway-analysis, version 0121-03). Core Analysis settings included all available data sources fromhuman, mouse, or rat species. Expression heatmaps were generated with pheatmap (R packageversion 1.0.12.) using log2 counts per million (CPM), with the values centered and scaled byrow. All scripts and code used for generating the bulk RNA-seq based figures can be foundonline at github (abcwcm / Vartanian2023).Example 8: Primary Human Lymphocytes Express MalTo confirm Mal gene expression in the T cell lineage, real-time quantitative PCR (RT-qPCR) for human Mal was performed on isolated CD4+, CD8+, and B cells (Figure 19A). Malgene expression was normalized to CD4+ cells. RT-qPCR analysis confirmed that CD4+ cellshad the highest amount of Mal gene expression compared to isolated CD8+ and B cells (Figure19A). In addition, CD8+ cells showed a trend towards expressing significantly more Mal than Bcells.To determine if the low Mal expression observed in our isolated B cells populations werea result of T cell contamination, Mal expression results were compared to those of other publiclyavailable datasets using a variety of cell isolation and gene expression techniques (SupplementalFigure S1). Isolation methods included FACS sorting (Figure 24A,B), positive magnetic selection(Figure 24C), and single-cell RNAseq analysis (Figure 24D–F), whereas Mal expression wasevaluated using RNAseq (Figure 24A,B,D) and a microarray (Figure 24C). The examination ofthese four independent datasets confirmed significantly higher Mal gene expression in CD4+ cells,followed by CD8+ cells, and, finally, CD19+ / B cells. These results also demonstrated a low butstill detectable level of Mal transcripts in CD19 / B cells, consistent with the RT-qPCR resultsdisclosed herein. Based on these findings, it was believed the RT-qPCR results were accurate.Example 9: ETX Binds to Human Lymphocytes with a Preference for CD4+ CellsTo determine if the ETX bound to human lymphocytes expressed MAL, the PBMNCs wereprobed with 50 nM of Alexa Fluor 647 pETX (pETX-647) for 2 h, and the binding to CD4+, CD8+,and CD19+ cells was evaluated by multicolor flow cytometry (Figure 20A–C). pETX was used tostudy ETX binding because pETX bound with a similar affinity as active ETX but did notoligomerize and form pores, preventing endosome recycling and the possible cell surfacerearrangement of MAL. Untreated cells (0 nM) were used as negative controls. Scatter plots(Figure 20A) and histogram analyses of pETX-647 fluorescent intensities (Figure 20B) revealedthat CD4+ cells bound more toxins than CD8+ and CD19+ cells. In addition, CD8+ cells boundmore toxins than CD19+ cells.To quantify ETX bindings to target cells, pETX-647 binding was quantified via flowcytometry after 2 h of incubation with 25 nM of pETX-647. Significantly more CD4+ cells werepositive for pETX-647 compared to CD8+ and CD19+ cells; 82.3%, 60.3%, and 24.7%,respectively (Figure 20C). Even when cells were incubated with 25 nM of pETX-647 for 15 min,50.1%, 30.0%, and 18.2% of CD4+, CD8+, and CD19+ cells were positive for pETX-647,respectively. This trend was observed for all investigated time points.Prototoxin ETX-647 could be observed binding to CD4+ cells at concentrations as low as1 nM (Figure 20D). PBMNCs were incubated with 1 nM of pETX-647 for 2 h, and percent positivecells were evaluated by flow cytometry. Untreated cells (0 nM) were used as negative controls. Nosignificant differences were observed in CD8+ or CD19+ when cells were treated with or without1 nM pETX-647. In comparison, significantly more CD4+ cells were positive for pETX-647 whentreated with 1 nM pETX-647 than without, 0.34% versus 0.07%, respectively.To confirm that pETX bindings to lymphocytes were pETX-specific, pETX-647 waspretreated with an anti-ETX antibody shown to block ETX binding. Binding to total lymphocyteswas inhibited when media containing pETX-647 was pre-treated with the anti-ETX antibody(Figure 19E). To ensure that the fluorescent signal observed in lymphocytes was not due to excessfluorophore from the pETX-647 labeling process, PBMNCs were treated with shiga toxin (STX)fluorescently conjugated with Alexa Fluor 647 using the exact same labeling process (STX-647)(Figure 26). When PBMNCs were incubated with 50 nM of STX-647 for 2 h, only a smallpercentage of lymphocytes bound STX-647, less than 2%. Importantly, the percentage of CD19+cells positive for STX-647 was significantly higher than CD4+ or CD8+ cells: 1.64%, 0.19%, and0.01%, respectively, confirming previous results that B cells had increased affinity for STX. Thelow percentage of STX-647-positive cells indicated that the contamination of lymphocytes byexcess dye when treated with Alexa Fluor conjugated 647 toxin was minimal.Finally, we sought to confirm that probing cells with pETX was a reliable marker for ETXbinding. PBMNCs were probed with 25 nM ETX or pETX for 2 h, and bindings were determinedusing affinity purified anti-ETX polyclonal rabbit antibody and PE-conjugated anti-rabbit IgG andexamined by flow cytometry (Figure 20F). Cells treated without ETX were used as controls. Nosignificant differences in ETX and pETX bindings were observed. Similar results were obtainedwhen cells were probed with 5 nM, 10 nM, and 50 nM of ETX or pETX as well (data not shown).This confirmed the previously published results that pETX and ETX bound similarly to target cells.Taken together, this data indicates that ETX specifically binds to human primarylymphocytes, with a preference for CD4+ cells, followed by CD8+ and then CD19+ cells.Importantly, ETX binding positively associates with Mal gene expression.Example 10: ETX Bindings to Human Lymphocytes Is Dose and Time DependentTo determine if the ETX bindings to lymphocyte subsets were dose and time dependent,PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM of pETX-647 for 15,30, 60, and 120 min. After 15 min of incubation, pETX was observed binding to CD4+, CD8+, andCD19+ cells in a dose-dependent manner (Figure 21A). For a full breakdown of p values betweendifferent doses, please refer to Supplementary Table S1. After 15 min, significantly more CD4+cells were positive for ETX when treated with 10 nM (11%), 25 nM (50%), and 50 nM (75%)compared to untreated controls (0%) (Figure 21A). In comparison, a significant increase in ETX-positive CD8+ and CD19+ cells was not observed until treatment with 25 nM pETX-647. WhenPBMNCs were incubated for 120 min with pETX-647, significantly more CD4+ cells werepositive for ETX at 5 nM (41%), 10 nM (62%), 25 nM (83%), and 50 nM (90%) compared tountreated controls (0%) (Figure 21B). In contrast, a significant increase in pETX-647 positiveCD8+ and CD19+ cells was not observed until cells were treated with 10 nM pETX-647. A similartrend was observed when cells were incubated with pETX-647 for 30 and 60 min (SupplementalFigure 27A and 27B, respectively). These data indicated that the ETX bindings to all lymphocytesubsets were dose dependent and reaffirmed that ETX preferentially bound to CD4+ compared toCD8+ and CD19+ cells.For CD4+ cells, significant differences in ETX bindings at different time points wereobserved when cells were treated with 1 nM, 5 nM, 10 nM, or 25 nM pETX-647 (Figure 21C).Remarkably, after 1 nM treatment for 15 min, 0.021% of CD4+ cells were positive for ETX. After60 and 120 min, significantly more CD4+ cells were positive for pETX: 0.060% and 0.067%,respectively. In comparison, with 5 nM treatment, 3.2%, 8.1%, 23.8%, and 40.9% of CD4+ cellswere positive for pETX after 15-, 30-, 60-, and 120-minute incubations, respectively. Similar trendswere seen for 10 nM and 25 nM doses. At 50 nM pETX-647 treatment, pETX binding to CD4+cells appeared to be saturated, as there were no significant differences between any of the timepoints. Similar results were observed in CD8+ cells (Figure 21D), with the clearest time-dependentbinding occurring with 10 nM pETX-647 treatment. In total, 4.4%, 17.2%, 21.6%, and 34.2% ofCD8+ cells were positive for pETX after 15-, 30-, 60-, and 120-minute incubations, respectively.Again, pETX binding appeared to be saturated for all time points at 50 nM treatment for CD8+cells. Although ETX binding was observed on CD19+ cells, binding did not appear to be timedependent under these conditions (Figure 21E). These data indicated that the ETX bindings toCD4+ and CD8+ cells were time dependent and, again, reaffirmed that ETX preferentially boundto CD4+ cells, compared to CD8+ and CD19+ cells.Example 11: ETX Induces Cytotoxicity in Human Lymphocytes, Especially CD4+ CellsTo determine if ETX bindings to human lymphocytes conferred cytotoxicity, totallymphocytes were evaluated for cell death by propidium iodide (PI) inclusion via flow cytometry(Figure 22 A & B). Cells positive for (PI+) were considered dead. After 4 hours of active ETXtreatment, only a small percentage of cell death was observed: 1.4% (Figure 22C). A significantincrease in total lymphocyte cell death was observed at ETX doses of 25 nM and 50 nM: 11.5%and 17.8%, respectively. Importantly, pretreatment of ETX with a neutralizing antibody thatblocked ETX-cytotoxicity inhibited ETX-induced cell death (Figure 22D).To determine if lymphocyte populations expressing higher levels of MAL were moresusceptible to ETX-induced cytotoxicity, cell death was evaluated in CD4+, CD8+ and CD19+cells by flow cytometry (Figure 22E). When treated with 25 nM of ETX for 4 h, cell death wassignificantly higher in CD4+ cells compared to CD8+ and CD19+ cells when with PBMNCs:19.6%, 6.5%, and 3.0%, respectively. Similar results were seen when cells were treated with 50nM ETX with CD4+, CD8+, and CD19+ cells, exhibiting 35.1%, 13.9%, and 1.9% cell death,respectively. In addition, CD8+ cell death was significantly higher than CD19+ cell death. Takentogether, these data demonstrated that active ETX induced cell death in CD4+ and CD8+ cells andwas positively associated with Mal gene expression.Example 12: ETX-Induced Cytotoxicity in Human CD4+ Cells Is Time and Dose DependentTo determine if ETX-induced cytotoxicity in CD4+ cells was dose dependent, PBMNCswere incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM of active ETX for four hours(Figure 22F). Significant increases in percent cell death compared to untreated controls (0.82%)were observed at 25 nM (19.6%) and 50 nM (35.1%) doses. Cell death at 50 nM was significantlyhigher than at 25 nM treatment. This indicated that ETX-induced cell death of CD4+ cells wasdose dependent.To determine if ETX-induced cell death of CD4+ cells was time-dependent, PBMNCs wereincubated with indicated doses of ETX for 30, 60, 120, and 240 min (Figure 22G). At a dose aslow as 1 nM, a significant increase in CD4+ cell death was observed between 30 min and fourhours: 0.55% and 1%, respectively. At a dose of 5 nM, a significant increase in CD4+ cell deathwas observed between 30 min and four hours: 0.47% and 1.21%, respectively. Cell death wasconsiderably higher at larger ETX doses. At 50 nM ETX treatment, cell death was 0.84%, 2.06%,18.06%, and 35.07% after 30 min, 60 min, 2 h, and 4 h of treatment, respectively. This dataindicated that ETX caused CD4+ cell death in a time-dependent manner.Example 13: ETX-Induced Cytotoxicity in Human Lymphocytes Is Mediated by Pore FormationETX-induced cell death has been proposed to be mediated by pore formation in sensitivecell lines. To determine if ETX pore formation occurs in primary human lymphocytes, whole-celllysates from PBMNC treated with 0 nM, 10 nM, 25 nM, or 50 nM ETX for two hours wereevaluated by Western blot (Figure 23A). Lysates from control and ETX-treated rMAL-CHO cells,known to form a 150 kDA ETX pore complex, were used as positive controls. The 150 kDA porecomplex was only observed when PBMNCs were treated with 50 nM ETX (Figure 23A). Inaddition, a band at 27 kDA could be observed in all cell lysates treated with 50 and 25 nM ETX,indicating bound ETX monomers, as all cells were thoroughly washed in PBS prior to lysis. Poreformation appeared to be time dependent when cells were treated with 50 nM of ETX for 30, 60,and 120 min (Figure 23B). This indicated that ETX-mediated cytotoxicity of PBMNCs wasmediated by pore formation.Example 14: Discussion of Examples 8-13ETX Binding and Cytotoxicity Positively Associates with Mal Expression in Human LymphocytesDisclosed herein is demonstration that ETX binding and cytotoxicity to primary humanlymphocyte populations positively associate with Mal gene expression. Specifically, CD4+ cellshad the highest amount of MAL gene expression, followed by CD8+ and then B cells. Accordingly,ETX preferentially binds to and kills CD4+ cells, followed by CD8+ and then CD19+ cells.Mal expression in CD4+, CD8+, and B cells was first confirmed using RT-qPCR. Theresults demonstrated that CD4+ had the highest amount of Mal gene expression, followed by CD8+cells and then CD19+ cells. Increased Mal gene expression in CD4+ cells was also confirmed usingpublicly available datasets. Secondly, it was demonstrated that ETX bound to human lymphocyteswith a preference that positively associated with Mal expression. When lymphocytes wereincubated with 25 nM of pETX-647 for two hours, 82.8% of CD4+, 60.3% of CD8+, and 24.7%of CD19+ cells were bound to pETX. In addition, pETX binding occurred in a dose- and time-dependent manner. Finally, it was demonstrated that ETX induced lymphocyte cell death. Whenlymphocytes were incubated with 50 nM of active ETX for four hours, 35.1% of CD4+ and 13.9%of CD8+ exhibited cell death; no significant amount of cell death was observed in CD19+ cells.ETX-induced cell death of CD4+ cells was also dose and time dependent. Taken together, this dataindicated that ETX binding and cytotoxicity to human lymphocytes were positively associated withMal expression. Alternatively, ETX’s increased binding to and activity on CD4+ cells may havealso been a result of CD4 expression itself. In a single experiment, ETX was observed to bind torecombinant human CD4 immobilized on Dynabeads, raising the possibility that CD4+ affinityand sensitivity to ETX may be a combination of both CD4 and MAL expression. Importantly, otherETX-sensitive cell lines, including MDCK and ACHN cells, also express MAL. Taken together,these observations supported the theory that MAL is the main receptor for ETX.MAL Expression in Human LymphocytesMAL expression in CD4+ and CD8+ cells was consistent with previously published results,looking at both peripheral blood lymphocytes and various cell lines of the T- and B-cell lineage.By using a privately generated anti-MAL antibody, Copie-Bergman et al. demonstrated that 65–90% of CD4+ and 22–39% of CD8+ cells were positive for MAL via flow cytometry. Incomparison, the authors did not detect a significant amount of MAL expression on B cells fromperipheral blood, tonsils, or spleens: 0–0.6%, 1.5–2%, and 0.6–0.7%, respectively. They did,however, observe the occasional MAL-positive plasma cell via immunohistochemistry in tonsilsor reactive lymph nodes. In addition, other groups have observed MAL expression in various Tcell lines but not B cell lineages. Conflicting results for MAL detection in B cells may have beena result of technical differences in experimental approaches and sensitivity (for example, proteinexpression versus gene expression). However, results consistently indicated that B cells expressedsignificantly lower to no MAL compared to T cells.MAL’s Function in Different Lymphocyte PopulationsThe reason for the differential expression of MAL in specific lymphocyte populations isunknown. MAL’s function in lymphocytes has only been extensively studied in the T cell lineage.In general, MAL appears to play an important role in lipid raft formation and stabilization andprotein trafficking to the apical plasma membrane in polarized cells. In human T cells, MAL isselectively present in glycolipid-enriched membrane microdomains (also known as detergent-resistant membranes) and appears to play an important role in T cell activation, mainly through itsinteractions with Lck, a src-like kinase.Src-like kinases, especially Lck, play an essential role in T cell activation and maturation.Previous studies have shown that MAL and Lck co-immunoprecipitate with each other in a lipid-dependent interaction in T cells. If the expression of MAL is lost, Lck targeting to the plasmamembrane becomes dysfunctional. As such, the loss of MAL results in the defective polarizationof the T cell receptor for antigen (TCR) and the organization of the immunological synapse (IS).MAL targets Lck to the plasma membrane via vesicle movement along microtubule tracks andrequires participation of Inverted Formin2 (INF2) as well as Cdc42 and Rac1. MAL has also beenshown to be necessary for proper receptor and signaling protein assembly at the IS in thesupramolecular activation cluster (SMAC). The incorrect localization of MAL results in Lck beingtransported to the wrong part of the SMAC. In addition, more recent publications have alsodemonstrated that MAL plays an important role in endosome trafficking and exosome secretionfrom T cells.Although MAL’s function in B cells is unknown, it is possible that MAL could play asimilar role in lipid raft-protein organization and signaling in B cells. Lipid rafts play a role in Bcell activation and can act as platforms for B cell receptor (BCR) signaling and possibly antigentrafficking. MAL may play a similar role in Lck or other src-like kinase trafficking in B cells.Interestingly, MAL is highly expressed in mediastinal large B cell lymphoma and a subset ofHodgkin lymphoma with poor prognosis.ETX-Induced Cell Death PathwaysIt is generally accepted that ETX causes cell death via the formation / oligomerization of aheptameric pore. ETX pore formation occurs in three sequential steps: (1) ETX binding to itsreceptor, (2) oligomerization of the pre-pore complex on the cell surface, and (3) the pore insertioninto the cell membrane. Pore formation results in a rapid decrease in transmembrane resistance andthe rapid depletion of intracellular K+ and Cl−. This is followed by a slower intracellular increasein Na+ and Ca2+. ETX also causes a rapid depletion of ATP and causes mitochondrial membranepermeabilization and translocation of an apoptotic-inducing factor to the nucleus.The ETX treatment of PBMNCs disclosed herein resulted in ETX oligomerization / poreformation, as detected by Western blot. However, the majority of the ETX detected in the PBMNClysates was observed as bound monomers, not in the pore complex. It is interesting to note that90% of CD4+ cells were positive when PBMNCs were probed with 50 nM of pETX-647 for 2 h.However, when cells were treated with 50 nM of active ETX for 4 hours, only 35% of the CD4+cells died, indicating a large discrepancy in ETX binding versus cell death in CD4+ cells for thisdose and time point. Alternatively, in rMAL-CHO cells, a highly ETX-susceptible cell line, wesaw a closer correlation of ETX binding and ETX cytotoxicity. When rMAL-CHO cells weretreated with ETX, the vast majority of cells bound to ETX and also died. For example, when treatedwith 50 nM of ETX, cell viability decreased to almost 0%. In addition, pore formation happenedrapidly (within 5 min, when cells were treated with 50 nM ETX) and at very low doses (within 30min after cells were treated with 1 nM ETX), with the majority of ETX detected in the poorcomplex, not as bound monomers. This indicated that the low amount of cell death observed inCD4+ cells despite the high binding percentage may have been due to the low amount of ETXoligomerization / pore formation observed in these cells.Possible Role of ETX-Lymphocytes Interactions in MS PathogenesisWithout being bound by theory or methodology, based on the limited amount of ETX-induced cell-death observed in human lymphocytes, despite a significantly higher degree of ETXbinding, ETX bindings to lymphocytes may influence other cellular behaviors in addition to celldeath, including various immune functions. ETX bindings to MAL on human lymphocytes atsublethal doses may modify immune function, possibly influencing lymphocyte activity inimmune-mediated diseases such as MS. CD4+, CD8+, and B cells have all been implicated in MSpathogenesis, although the exact mechanisms by which they influence MS pathogenesis is stillunclear. It is believed that pathogenic lymphocytes, including autoreactive and proinflammatorylymphocytes, are stimulated in the periphery, prior to the infiltration of these cells into the CNS.Histopathological examination of active MS lesions reveals dense lymphocytic infiltration into theCNS perivascular space with more limited extravasation into the CNS parenchyma. Theseinfiltrates are heavily dominated by the presence of CD4+ and CD8+ with a much lower presenceof B cells. Based on these observations, MS pathology has historically been viewed as being T celldriven; however, the wide success of B cell depleting therapies in treating MS has highlighted theimportance of B cells in MS pathogenesis as well. Due to MAL’s role in T cell activation and theimportant role it plays at the immunological synapse, it seems possible that ETX bindings to MALmay initiate a wide array of signaling cascades. Indeed, other pore-forming toxins have been shownto induce numerous cell signaling cascades not related to membrane permeabilization. However,more examination into ETX’s impact on lymphocyte function is needed and is an area of ongoingresearch. ETX binding and cytotoxicity to human lymphocytes positively associates with MALgene expression, further confirming that MAL is the main receptor for ETX.Example 15: Materials and Methods of Examples 8-13Peripheral Blood Isolation from Healthy ControlsPeripheral blood samples were collected from healthy controls via the cubital vein usingBD Vacutainer K2 EDTA 7.2 mg Blood Collection tubes in accordance with Institutional ReviewBoard, protocol number 1003010940. At the time of donation, healthy controls were free of anychronic or acute disease, were both male and female, ranged in age from 18 to 59 years old, andlived in the New York City metropolitan area.Isolation of CD4+, CD8+, and B Cells from Human Peripheral Blood for RT-qPCR AnalysisPeripheral blood samples were collected from healthy controls via the cubital vein usingBD Vacutainer K2 EDTA 7.2 mg Blood Collection tubes. Subsets were isolated using RossetteSepimmunodensity negative selection cocktails (Stem Cell Technologies). CD4+, CD8+, and B cellswere isolated using RosetteSep™ Human CD4+ T Cell Enrichment Cocktail, RosetteSep™Human CD8+ T Cell Enrichment Cocktail, and RosetteSep™ Human B Cell Enrichment Cocktail,respectively, per manufacturer’s instructions.Real-Time Quantitative PCR (RT-qPCR) AnalysisComparative RT-qPCR was performed in an ABI Taqman 7900HT Fast Real-Time PCRmachine (Applied Biosystems, CA), using the PowerUpÔ SYBRÔ Green Master Mix (AppliedBiosystems, CA, #A25742). Briefly, PCR was carried out in a 10 μL volume in a finalconcentration of 1X SYBRÔ Green Master Mix containing 300 nM forward and reverse primersand 10 ng cDNA. The primer sequences were as follows: human MAL, F 5′-GGGTGATGTTCGTGTCTGTG-3′, R 5′-ACTGAGGCGCTGAGGTAAAA-3′; human b-actin, F5′-CACCAACTGGGACGACAT-3′, R 5′-ACAGCCTGGATAGCAACG-3′. The PCR reactionsteps were as follows: 50 °C for 2 min, 95 °C for 2 min, and 40 cycles of 95 °C for 15 s followedby 60 °C for 1 min. A subsequent dissociation curve measurement from 60 °C to 95 °C was carriedout. All samples were run in triplicate. PCR data were analyzed using the 7900 SDS v2.4.1 software(Applied Biosystems, CA). Relative gene expression was quantified by performing double deltaCt analysis (2−ΔΔCt). B-actin Ct values were used as internal controls, and the gene of interest (GOI)expression was normalized to CD4+ cell expression.Preparation of Fluorescently Labeled pETXpETX was provided by BEI at a minimum >95% purity at 0.5 mg / mL (Epsilon Protoxin,from Clostridium perfringens, Strain 34 Type B, NR-856). pETX was labeled with Alexa Fluor647 Protein Labeling Kit (Life Technologies) per manufacturer’s instructions. Labeled toxin wasstored in a 50% glycerol stock (10 uM) at −20 °C until use.Activation of ETXpETX provided by BEI was activated in house using immobilized trypsin, TPCK Treated,agarose resin (Thermo Fischer Scientific). Briefly, 125 μL resin was washed three times in sodiumphosphate buffer (pH 7.98). Resin was suspended in 200 μL sodium phosphate buffer andcombined with 500 uL of BEI pETX (0.5 mg / mL) for two hours at 37 °C with gentle agitation. Thesolution was centrifuged at 18,000 rcf for 10 min, and the supernatant containing the activatedETX was collected. ETX activation was confirmed by the treatment of rMAL-CHO cells to in-house controls. Activated toxin (~11 μM) was aliquoted and stored at −80 °C until use.PBMNC Isolation from Human Peripheral Blood for ETX Binding and Cytotoxicity StudiesBlood samples were collected from healthy controls via the cubital vein using BDVacutainer K2 EDTA 7.2 mg Blood Collection tubes. Samples reached room temperature and werethen diluted with an equal volume of Phosphate Buffered Saline (PBS) +2% Fetal Bovine Serum(FBS). Diluted blood was layered on top of Ficoll-Paque PLUS (GE Healthcare Bio-Sciences,Uppsala, Sweden). Tubes were centrifuged at 1200 rcf for 20 min at room temperature (withoutbrakes). Buffy coat containing peripheral blood mononuclear cells (PBMNCs) was collected usinga sterile transfer pipet. Buffy coat was washed with 20 mL of PBS + 2% FBS and centrifuged at250 rcf for 10 min at 4 °C. The supernatant containing platelets was removed by aspiration. Cellpellet was washed with 20 mL of PBS + 2% FBS and centrifuged at 500 rcf for 10 min at 4 °C.The supernatant was aspirated, and cells were re-suspended in CTS™ OpTmizer™ T CellExpansion Media (A1048501) supplemented with Glutamax and 5% FBS. Cells were enumeratedusing a hemocytometer and adjusted to 1.5 × 106 cells / mL. Cells were kept on ice until use.Evaluation of pETX-647 Binding to Lymphocyte SubsetsTo determine ETX binding, PBMNC (1.5 × 106 cells / mL) were incubated with pETX-647at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 15, 30, 60, and 120 min at 37 °C. In selectexperiments, media containing 50 nM pETX-647 was pretreated with or without an anti-ETXantibody (JL004) for 30 min before treating cells for 2 h. At selected time points, 100 uL of cellswere transferred to round bottom plates containing PBS + 2% FBS and immediately washed withPBS to remove unbound pETX-647. Cells were centrifuged at 500 rcf for 5 min. Cells wereresuspended in Cell Staining buffer (Biolegend) containing 5% Human TruStain FcX™ FcReceptor Blocking Solution (BD Bioscience) for 10 min. Cells were then probed with FITCconjugated anti-CD4 Multiclone SK3 and SK4 (Biolegend), PE-conjugated anti-CD8β Clone2ST8.5H7 (BD Bioscience), and V450 conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for20 min at room temperature. Cells were washed and resuspended in PBS and analyzed using a BDFACSVerse Flow Cytometer. From pETX-647 treatment to analysis via flow cytometry, cells werewashed a total of three times. Data were collected using FACSuite™ software and analyzed usingFlowJo software.Evaluation of ETX-Induced Cytotoxicity in Lymphocyte SubsetsTo determine ETX-induced cytotoxicity, PBMNC (1.5 × 106 cells / mL) were treated withactivated ETX at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 30, 60, 120 and 240 min at 37°C. In select experiments, media containing 50 nM ETX was pretreated with or without an anti-ETX antibody (JL008) for 30 min before treating cells for 2 h. At selected time points, 100 µL ofcells were transferred to round bottom plates containing ice cold PBS + 2%FBS to stop ETXactivity. Cells were immediately washed to remove unbound ETX and centrifuged at 500 rcf for 5min at 4 °C. Cells were resuspended in Cell Staining buffer (Biolegend) containing 5% HumanTruStain FcX™ Fc Receptor Blocking Solution (BD Bioscience) for 10 min. Cells were thenprobed with FITC conjugated anti-CD4 Multiclone SK3 and SK4 (Biolegend), APC anti-CD8clone SKI (Biolegend), and V450 conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for 20 minat room temperature. Cells were washed and resuspended in PBS containing 2 ug / mL of PI andanalyzed using a BD FACSVerse Flow Cytometer. Data were collected using FACSuite™ softwareand analyzed using FlowJo software.Evalution of Pore Formation by Western Blot AnalysisPBMNC (1.5 × 106 cells / mL) were incubated with activated ETX at 0 nM, 10 nM, 25 nM,and 50 nM for 120 min at 37 °C. Alternatively, cells were treated with 50 nM of ETX for 30, 60,or 120 min. As a positive control for pore formation, rMAL-CHO cells treated with or without 50nM active ETX for 30 min were used as controls. After treatment, cells were immediately movedto ice, then washed three times with ice cold PBS. Cells were lysed in ice-cold RIPA buffer (50mM Tris-HCl (pH 8.0), 150 mM NaCl, +1% NP-40, 0.1% Sodium dodecyl sulfate, 0.5% SodiumDeoxycholate) with proteinase and phosphatase inhibitors (Cell Signaling Technologies) for 10min. Samples were centrifuged at 5000 rcf for 5 min to pellet nuclei and DNA. Supernatants werecollected and used for Western blot analysis. All samples were prepared in 2X Laemmli SampleBuffer (Bio-Rad) containing 5% 2-Mercaptoethanol (Bio-Rad) and heated at 95 °C for 5 min beforeloading onto 4–20% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad). Gels were run inTris / Glycine SDS Buffer (Bio-Rad) at 200 V for 35 min. Semi-dry transfers were performed intransfer Tris / Glycine Buffer (Bio-Rad), using the Trans-Blot SD Semi-Dry ElectrophoreticTransfer Cell system (Bio-Rad) at 15 V for 15 min. Blots were blocked in 5% Blotting-GradeBlocker nonfat milk (Bio-Rad) in Tris Buffered Saline with Tween 20 (TBS-T, Cell SignalingTechnology) for one hour at room temperature. Blots were then incubated with primary antibodiesanti-ETX antibody JL004 at 0.34 µg / mL in blocking solution overnight at 4 °C. Blots were washedthree times for 5 min in TBS-T at room temperature and incubated with secondary antibodyperoxidase-conjugated Affinipure Goat Anti-Rabbit IgG H + L (Jackson ImmunoResearch) at0.024 µg / mL in blocking solution for 2 h at room temperature. Blots were washed three times for5 min in TBS-T and developed for 5 min at room temperature in SuperSignal West Dura ExtendedDuration Substrate (ThermoFisher Scientific). The developed blots were visualized on 5 × 7 CL-XPosure Films (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX-101A film processor.StatisticsOne-way ANOVA with post hoc Tukey HSD test was used to determine significance whencomparing three or more data points. Unpaired Student’s t-tests were used to determinesignificance when comparing only two data points. These instances are indicated in figure legends.The disclosure is not limited to the exemplary embodiments and applications presentedherein or to the manner in which the exemplary embodiments and applications operate or aredescribed herein.It should be understood that any use of subheadings herein are for organizational purposes,and should not be read to limit the application of those subheaded features to the variousembodiments herein. Each and every feature described herein is applicable and usable in all thevarious embodiments discussed herein and that all features described herein can be used in anycontemplated combination, regardless of the specific example embodiments that are describedherein. It should further be noted that exemplary description of specific features are used, largelyfor informational purposes, and not in any way to limit the design, subfeature, and functionality ofthe specifically described feature.INCORPORATION BY REFERENCEThe disclosures of each of the references cited herein, such as patents, patent applicationpublications, and non-patent publications, are hereby incorporated by reference herein in theirentireties.EQUIVALENTSThose skilled in the art will recognize, or be able to ascertain using no more than routineexperimentation, many equivalents to the specific embodiments of the invention describedherein. Such equivalents are intended to be encompassed by the following claims.

Claims

What is claimed is:

1. A method for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS,monitoring the progression of MS, monitoring responsiveness to treatment ofMS, prevention of MS, and / or treatment of MS in a human subject at risk for orsuffering from multiple sclerosis (MS) comprising:a) obtaining a fecal sample from the human subject;b) detecting, in the obtained fecal sample, by Real-Time quantitativePolymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin(ETX) gene-harboring C. perfringens strains relative to the abundanceof non-ETX strains of C. perfringens in the human subject;and if the abundance of ETX-harboring C. perfringens strains is above themedian level for a healthy subject: (i) performing a standard-of-care MSevaluation of the human subject, (ii) administering to the human subject astandard-of-care MS therapy, and / or (iii) administering to the human subject acomposition comprising an agent that directly or indirectly interferes with ETXor ETX-harboring C. perfringens strains;and if the abundance of ETX-harboring C. perfringens strains is below or equalthe median level of a healthy subject: (i) not performing a standard-of-care MSevaluation of the human subject, (ii) not administering to the subject an MStherapy, and / or (iii) not administering to the subject a composition comprisingan agent that directly or indirectly interferes with ETX or ETX-harboring C.perfringens strains.

2. The method of claim 1, wherein if the relative abundance of ETX-harboring C.perfringens strains is greater than 0.001%: (i) performing a standard-of-care MSevaluation of the human subject, (ii) administering to the human subject astandard-of-care MS therapy, and / or (iii) administering to the human subject acomposition comprising an agent that directly or indirectly interferes with ETX orETX-harboring C. perfringens strains.

3. A method for detection of relative abundance of epsilon toxin (ETX) gene-harboring strains of C. perfringens in the gut microbiome of a subject comprising:a) obtaining a fecal sample from the human subject;b) detecting, in the obtained fecal sample, by Real-Time quantitativePolymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxingene (ETX)-harboring strains of C. perfringens relative to the abundanceof non-ETX strains of C. perfringens,wherein the relative abundance of ETX-harboring strains of C. perfringensis detected if the percentage of ETX-harboring C. perfringens strains isgreater than 0.001%.

4. The method of claim 3, wherein the subject is a human subject at risk for or sufferingfrom multiple sclerosis (MS), and if the abundance of ETX-harboring strains of C.perfringens is detected: (i) performing a standard-of-care MS evaluation of thesubject, (ii) administering to the subject a standard-of-care MS therapy, and / or (iii)administering to the subject a composition comprising an agent that directly orindirectly interferes with ETX or ETX-harboring C. perfringens strains.

5. The method of claim 3 or claim 4, further comprising a step of selecting the subjectfor treatment with standard-of-care MS therapy, wherein the subject is at risk for, orsuffering from MS, and wherein the subject is selected for treatment wherein therelative abundance of ETX-harboring strains of C. perfringens is detected if thepercentage of ETX-harboring C. perfringens strains is greater than 0.001%.

6. The method of any one of claims 2-5, wherein the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.01%,0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%.

7. The method of any one of claims 1-6, wherein the abundance of ETX-harboring strainsof C. perfringens is measured by detection of the ETX gene, and the abundanceof ETX-harboring and non-ETX strains of C. perfringens is measured bydetection of a gene present in ETX-harboring and non-ETX strains of C.perfringens.

8. The method of claim 7, wherein the gene present in ETX- and non-ETX harboringstrains of C. perfringens is CPA gene or C. perfringens-specific 16S rRNA gene.

9. The method of any one of claims 1-8, wherein the relative abundance of ETX-harboringstrains of C. perfringens (ETX+, and CPA+ and / or C. perfringens 16S rRNA+)and non-ETX strains of C. perfringens (ETX-, and CPA+ and / or C. perfringens16S rRNA+), in the obtained fecal sample, is measured.

10. The method of any one of claims 1-9, wherein 2–∆∆Ct analysis is used to quantify therelative abundance of ETX-harboring strains (ETX+, and CPA+ and / or C.perfringens 16S rRNA+) over non-ETX strains (ETX-, and CPA+and / or C. perfringens 16S rRNA+) in the obtained fecal sample;optionally wherein 2–∆∆Ct value of > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or0.9 indicates an abundance of ETX-harboring C. perfringens strains, and optionally if2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, (i) performing astandard-of-care MS evaluation of the subject, (ii) administering to the subject astandard-of-care MS therapy, and / or (iii) administering to the subject a compositioncomprising an agent that directly or indirectly interferes with ETX or ETX-harboringC. perfringens strains.

11. The method of claim 10, wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-harboring C. perfringens strains with increased ETX-plasmid copy numbers, and 2–∆∆Ct value of < 1 indicates a higher percentage of non-ETX C. perfringen strains; andoptionally if 2–∆∆Ct is > 1, (i) performing a standard-of-care MS evaluation of thesubject, (ii) administering to the subject a standard-of-care MS therapy, and / or (iii)administering to the subject a composition comprising an agent that directly orindirectly interferes with ETX or ETX-harboring C. perfringens strains.

12. The method of any one of claims 1-11, wherein, between step (a) and step (b), bacteria isseparated from nonmicrobial fecal matter of the obtained fecal sample.

13. The method of claim 12, wherein the bacteria is separated from the nonmicrobial fecalmatter by density gradient centrifugation.

14. The method of any one of claims 1-13, wherein detecting the abundance of ETX-harboring C. perfringens strains by RT-qPCR comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting ofsequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.

15. The method of any one of claims 1-14, wherein detecting the abundance of ETX-harboring C. perfringens strains by RT-qPCR comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting ofsequence 5’-ACTCATACTGTGGGAACTTCGA-3’ and / or 5’-ACTCATCTCCCATAACTGCACT-3’.

16. The method of any one of claims 1-15, wherein detecting the abundance ofETX-harboring C. perfringens strains by RT-qPCR comprises use of afluorogenic probe comprising, consisting essentially of, or consisting ofsequence AGCAACTGCTAAGTTTACTGTTCCT.

17. The method of any one of claims 1-16, wherein detecting the abundance ofETX-harboring C. perfringens strains comprises detecting the relative abundanceof CPA-harboring C. perfringens strains by RT-qPCR comprising use of at leastone CPA-targeting primer or primer pair comprising, consisting essentially of, orconsisting of sequence 5'- CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.

18. The method of claim 17, wherein detecting the relative abundance of CPA-harboring C. perfringens strains by RT-qPCR comprises use of a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceTTACTGCCGTTGATAGCGCAGGAC.

19. The method of any one of claims 1-18, wherein detecting the abundance of ETX-harboring C. perfringens strains comprises detecting the relative abundance of C.perfringens-specific 16S rRNA by RT-qPCR comprising use of at least one C.perfringens-specific 16S rRNA primer or primer pair comprising, consistingessentially of, or consisting of sequence 5'-AGATGGCATCATCATTCAAC-3'and / or 5'- GCAAGGGATGTCAAGTGT-3'.

20. The method of claim 19, wherein detecting the relative abundance of C.perfringens-specific 16S rRNA by RT-qPCR comprises use of a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceAGAGTGCAGGAGAGGAGAGTGGAA.

21. The method of any one of claims 1-20, wherein detecting the abundance ofETX-harboring C. perfringens strains comprises quantifying the relativeabundance of ETX-harboring (ETX+, and CPA+ and / or C. perfringens 16SrRNA+) over non-ETX strains (ETX-, and CPA+ and / or C. perfringens 16SrRNA+) in the obtained fecal sample byRT-qPCR comprising use of:ETX-targeting primer pair comprising, consisting essentially of, or consistingof sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and 5’-ACTCATCTCCCATAACTGCACT-3’, and optionally a fluorogenic probecomprising, consisting essentially of, or consisting of sequence:AGCAACTGCTAAGTTTACTGTTCCT; and(i) CPA-targeting primer pair comprising, consisting essentially of, or consistingof sequences: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'-CTGATGGATCATTACCCTCTGATAC -3', and optionally a fluorogenicprobe comprising, consisting essentially of, or consisting of sequenceTGGGACTATGCAGCAAAGGTAACTTTAGC, and / or(ii) universal 16S rRNA primers comprising, consisting essentially of, orconsisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and 5'-TCGTTGTACCAGCCATTGTAG -3', and optionally a fluorogenic probecomprising, consisting essentially of, or consisting of sequenceCCCTTATGACCTGGGCTACACACG.

22. The method of any one of claims 1-21, wherein the method further comprises:(c) obtaining a blood sample from the human subject; and(d) detecting, in the obtained blood sample, by flow cytometry, the presenceand / or abundance of epsilon toxin (ETX) bound to lymphocytes, optionallywherein the lymphocyte is CD4+ lymphocyte, and optionally wherein thedetecting by flow cytometry comprises isolating lymphocytes, incubatingthe isolated lymphocytes with a fluorescently labeled anti-ETX antibody,washing off the unbound anti-ETX antibody, and detecting thefluorescently labeled anti-ETX antibody bound to lymphocytes;optionally only if the presence and / or abundance of epsilon toxin (ETX)bound to lymphocytes is detected in the human subject, optionally whereinmore than 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX,proceeding to the performing and / or administering steps.

23. A method for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS,monitoring the progression of MS, monitoring responsiveness to treatment ofMS, prevention of MS, and / or treatment of MS in a human subject at risk for orsuffering from multiple sclerosis (MS) comprising:(a) obtaining a blood sample from the human subject;(b) detecting, in the obtained blood sample, by flow cytometry, the presence ofepsilon toxin (ETX) bound to a lymphocyte, optionally wherein thelymphocyte is CD4+ lymphocyte, and optionally wherein the detectingcomprises isolating lymphocytes from the blood, incubating the isolatedlymphocytes with a fluorescently labeled anti-ETX antibody, washing off theunbound anti-ETX antibody, and detecting the presence, and optionallypercent, of lymphocytes positive for ETX.and if the presence of ETX bound to a lymphocyte is detected, optionallywherein more than 0.2%, 0.5% or 1% of the lymphocytes are positive forETX: (i) performing a standard-of-care MS evaluation of the human subject, (ii)administering to the human subject a standard-of-care MS therapy, and / or (iii)administering to the human subject a composition comprising an agent thatdirectly or indirectly interferes with ETX or ETX-harboring C. perfringensstrains;and if the presence of ETX bound to a lymphocyte is not detected orsubstantially not detected, or wherein less than 0.1% or 0.2% of thelymphocytes are positive for ETX: (i) not performing a standard-of-care MSevaluation of the human subject, (ii) not administering to the subject an MStherapy, and / or (iii) not administering to the subject a composition comprisingan agent that directly or indirectly interferes with ETX or ETX-harboring C.perfringens strains.

24. A method for detection of epsilon toxin in the blood of a subject comprising:(a) obtaining a blood sample from the subject;(b) detecting, in the obtained blood sample, by flow cytometry, thepresence of epsilon toxin (ETX) bound to a lymphocyte, optionallywherein the lymphocyte is CD4+ lymphocyte, and optionally wherein thedetecting comprises isolating lymphocytes from the blood, incubating theisolated lymphocytes with a fluorescently labeled anti-ETX antibody,washing off the unbound anti-ETX antibody, and detecting the presence,and optionally percent, of lymphocytes positive for ETX.

25. The method of claim 24, wherein the subject is a human subject at risk for or sufferingfrom multiple sclerosis (MS), and if the ETX bound to a lymphocyte is detected,optionally wherein more than 0.2%, 0.5% or 1% of the lymphocytes are positivefor ETX: (i) performing a standard-of-care MS evaluation of the subject, (ii)administering to the subject a standard-of-care MS therapy, and / or (iii) administeringto the subject a composition comprising an agent that directly or indirectly interfereswith ETX or ETX-harboring C. perfringens strains.

26. The method of claim 24 or claim 25, further comprising a step of selecting the subjectfor treatment with standard-of-care MS therapy, wherein the subject is at risk for, orsuffering from MS, and wherein the subject is selected for treatment wherein therelative abundance of ETX-harboring strains of C. perfringens is detected if thepercentage of ETX-harboring C. perfringens strains is greater than 0.001%.

27. The method of any one of claims 23-26, wherein the method further comprises:(c) obtaining a fecal sample from the human subject; and(d) detecting, in the obtained fecal sample, by Real-Time quantitative PolymeraseChain Reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-harboring C. perfringens strains relative to the abundance of non-ETX strains ofC. perfringens in the human subject;optionally only if the abundance of ETX-harboring C. perfringens strains in thehuman subject is above the median level for a healthy subject, or wherein therelative abundance of ETX-harboring strains of C. perfringens in the humansubject is greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%,25%, 30%, 35%, or 40%, proceeding to the performing and / or administeringsteps.

28. The method of any one of claims 1-27, wherein before step (a), the human subject isselected, wherein the human subject has MS or has one or more symptoms of MS.

29. The method of any one of claims 1-28, wherein, if the abundance of ETX-harboring C.perfringens strains is above the median level for a healthy subject and / or if thepresence of ETX bound to a lymphocyte is detected, administering to the subject acomposition comprising an agent that directly or indirectly interferes with ETX orETX-harboring C. perfringens strains,thereby treating MS, reducing at least one symptom of MS, reducing the severity ofMS, preventing MS, and / or preventing the progression of MS in the human subject.

30. A method for treating MS, reducing at least one symptom of MS, reducing the severity ofMS, preventing MS, and / or preventing the progression of MS, in a human subject, themethod comprising:a. selecting a subject for treatment, wherein the subject is at risk for, or sufferingfrom MS, and wherein the subject is selected for treatment wherein therelative abundance of ETX-harboring strains of C. perfringens is detectedif the percentage of ETX-harboring C. perfringens strains is greater than0.001%,b. administering to the subject a standard-of-care MS therapy, and / oradministering to the subject a composition comprising an agent that directly orindirectly interferes with ETX or ETX-harboring C. perfringens strains,thereby treating MS, reducing at least one symptom of MS, reducing the severity ofMS, preventing MS, and / or preventing the progression of MS in the human subject.

31. The method of claim 30, wherein the relative abundance of ETX-harboring strains of C.perfringens is detected by:a. obtaining a fecal sample from the human subject;b. detecting, in the obtained fecal sample, by Real-Time quantitativePolymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxingene (ETX)-harboring strains of C. perfringens relative to the abundanceof non-ETX strains of C. perfringens.

32. The method of claim 30 or 31, wherein the relative abundance of ETX-harboring strainsof C. perfringers is detected by:a. obtaining a blood sample from the subject;b. detecting, in the obtained blood sample, by flow cytometry, the presence ofepsilon toxin (ETX) bound to a lymphocyte, optionally wherein thelymphocyte is CD4+ lymphocyte, and optionally wherein the detectingcomprises isolating lymphocytes from the blood, incubating the isolatedlymphocytes with a fluorescently labeled anti-ETX antibody, washing offthe unbound anti-ETX antibody, and detecting the presence, and optionallypercent, of lymphocytes positive for ETX.

33. The method of any one of the preceding claims, wherein the standard-of-care MSevaluation comprises magnetic resonance imaging (MRI), evoked potentials tests,cerebral spinal fluid analysis, and / or blood tests.

34. The method of any one of the preceding claims, wherein the administering to the subjecta standard-of-care MS therapy comprises administering any one or more of thefollowing therapies:(i) an injectible medication, wherein the injectable medication is interferon beta-1a,interferon beta-1b, glatiramer acetate, ofatumumab, or peginterferon beta-1a;(ii) an oral medication, wherein the oral medication is teriflunomide, monomethylfumarate, dimethyl fumarate, fingolimod, cladribine, Siponimod, ponesimod,fingolimod, diroximel fumarate, or ozanimod;(iii) an infused medication, wherein the infused medication is ublituximab,alemtuzumab, mitoxantrone, ocrelizumab, natalizumab-sztn, or natalizumab; and(iv) rituximab or glucocorticoids.

35. The method of any one of the preceding claims, wherein the administering to the subjecta composition comprising an agent that directly or indirectly interferes with ETX orETX-harboring C. perfringens strains comprises administering to the subject acomposition comprising an effective amount of an agent that directly or indirectlyinterferes with ETX.

36. The method of claim 35, wherein said agent is an inhibitor of ETX.

37. The method of claim 36, wherein said inhibitor is an antibody against ETX or anantigen binding fragment thereof.

38. The method of claim 37, wherein said antibody against ETX or an antigen bindingfragment thereof:a. prevents ETX pore formation,b. prevents cell cytotoxicity,c. clears ETX from circulation,d. targets ETX for phagocytosis or antibody-dependent cellular phagocytosis(ADCP),e. neutralizes ETX, inhibits ETX binding to ETX-binding receptor, and / orf. inhibits or prevents oligomerization of ETX.

39. The method of claim 37 or 38, wherein said antibody or antigen-binding fragmentthereof is selected from the group consisting of a monoclonal antibody, a polyclonalantibody, and a recombinant antibody; or an antigen-binding fragment thereof.

40. The method of any one of claims 37-39, wherein said antibody, or antigen-bindingfragment thereof, is a human or humanized antibody, or antigen-binding fragmentthereof.

41. The method of any one of claims 37-40, wherein the antigen-binding fragmentthereof is a nanobody, a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fvfragment, a dAb fragment, a single chain antibody, a single domain antibody, a VHH,a maxibody, a minibody, an intrabody, a diabody, a triabody, a tetrabody, an v-NARor a bis-scFv.

42. The method of claim 35, wherein said agent is an inhibitor or antagonist of an ETX-binding receptor.

43. The method of claim 42, wherein the ETX-binding receptor is expressed onendothelial cells of blood brain barrier (BBB).

44. The method of claim 42 or 43, wherein said ETX-binding receptor is a tetraspanintegral membrane receptor, wherein the tetraspan integral membrane receptor ismyelin- and-lymphocyte protein (MAL) or Hepatitis A Virus Cellular Receptor 1<sub>(HAVcR1).

45. The method of claim 35, wherein said agent is a soluble ETX-binding receptorprotein, wherein the soluble ETX-binding receptor protein is soluble HAVcR1, asoluble MAL, or a fragment thereof.

46. The method of claim 35, wherein said agent is a phage lytic enzyme specific forClostridium perfringens Type B or D bacterial strain.

47. The method of claim 46, wherein said phage lytic enzyme is a muramidase derivedfrom strain ATCC 13124 (PlyCM).

48. The method of claim 35, wherein said agent is a probiotic strain expressing a phage lyticenzyme specific for Clostridium perfringens Type B or D bacterial strain.

49. The method of claim 35, wherein said agent is a vaccine against Clostridiumperfringens type B or type D, or the ETX produced therefrom.

50. The method of claim 35, wherein said agent is a probiotic supplement comprising C.peifringens type A or other bacteria type that can effectively outcompete Clostridium perfringens type B or D.

51. The method of claim 35, wherein said agent is an antibiotic sufficient to kill C.perfringens type B and / or D.

52. A composition for preventing or treating multiple sclerosis (MS) in a patient in needthereof comprising a pharmaceutically acceptable excipient and an effective amountof the agent of any one of claim 35-51, optionally wherein the composition is forpreventing or treating MS after the detecting of any one of claims 1-32.

53. A composition for PCR detection of epsilon toxin (ETX) gene-harboring strains ofC. perfringens, or abundance thereof, comprising at least one ETX-targeting primeror primer pair comprising, consisting essentially of, or consisting of sequence 5'-CATACTGTGGGAACTTCGATACA-3' and / or 5'-TCTTGTGAAGGGACATTATGAGTAA-3'.

54. A composition for PCR detection of epsilon toxin (ETX) gene-harboring strains ofC. perfringens, or abundance thereof, comprising at least one ETX-targeting primeror primer pair comprising, consisting essentially of, or consisting of sequence 5’-ACTCATACTGTGGGAACTTCGA-3’ and / or 5’-ACTCATCTCCCATAACTGCACT-55. The composition of any one of claims 53 or 54, further comprising afluorogenic probe comprising, consisting essentially of, or consisting ofsequence AGCAACTGCTAAGTTTACTGTTCCT.

56. A composition for PCR detection of CPA-harboring C. perfringens strains, orabundance thereof, comprising at least one CPA-targeting primer or primer paircomprising, consisting essentially of, or consisting of sequence 5'-CTTGGAGAGGCTATGCACTATTT-3' and / or 5'-TTGCAACCTGCTGTGTTTATTT-3'.

57. The composition of claim 56, further comprising a fluorogenic probe comprising,consisting essentially of, or consisting of sequenceTTACTGCCGTTGATAGCGCAGGAC.

58. A composition for PCR detection of C. perfringens-specific 16S rRNA, orabundance thereof, comprising at least one C. perfringens-specific 16S rRNAprimer or primer pair comprising, consisting essentially of, or consisting ofsequence 5'-AGATGGCATCATCATTCAAC-3' and / or 5'-GCAAGGGATGTCAAGTGT-3'.

59. The composition of claim 58, further comprising a fluorogenic probecomprising, consisting essentially of, or consisting of sequenceAGAGTGCAGGAGAGGAGAGTGGAA.

60. A composition for PCR detection of relative abundance of epsilon toxin(ETX) gene-harboring strains of C. perfringens comprising:ETX-targeting primer pair comprising, consisting essentially of, or consistingof sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'-TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and 5’-ACTCATCTCCCATAACTGCACT-3’, and optionally comprising afluorogenic probe comprising, consisting essentially of, or consisting ofsequence: AGCAACTGCTAAGTTTACTGTTCCT; and(i) CPA-targeting primer pair comprising, consisting essentially of, orconsisting of sequences: 5'- GCATGAGTCATAGTTGGGATGA-3'and 5'- CTGATGGATCATTACCCTCTGATAC -3', and optionallycomprising a fluorogenic probe comprising, consisting essentially of,or consisting of sequenceTGGGACTATGCAGCAAAGGTAACTTTAGC, and / or(ii) universal 16S rRNA primers comprising, consisting essentially of, orconsisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and5'- TCGTTGTACCAGCCATTGTAG -3', and optionally comprisinga fluorogenic probe comprising, consisting essentially of, orconsisting of sequence CCCTTATGACCTGGGCTACACACG.