Methods for enriching and detecting a target polynucleotide in a sample

Abstract

Disclosed are methods for detecting a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide. The methods may be utilized for detecting with high selectivity a target polynucleotide in a mixture of the reference polynucleotide and the target polynucleotide in which the target polynucleotide represents a low percentage of the mixture. The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the genetic alteration.

Description

[0001] METHODS FOR ENRICHING AND DETECTING A TARGET POLYNUCLEOTIDE IN A SAMPLE

[0002] CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[0003] The present application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 489,426, filed on March 10, 2023, the content of which is incorporated herein by reference in its entirety.

[0004] FIELD

[0005] The field of the invention relates to methods for detecting a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a reference (non-target) polynucleotide. In particular, the field of the invention relates to methods for detecting a target polynucleotide that comprises a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture. The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the genetic alteration.

[0006] BACKGROUND

[0007] Genetic mutations and epigenetic modifications are known to be associated with cancer and other diseases. The ability to detect genetic mutations epigenetic modifications in cell-free DNA using a minimally invasive sample can be used in many different diagnostic areas, such as companion diagnostics, monitoring minimum residual disease, monitoring cancer recurrence, or as a prospective aid in diagnosing cancer.

[0008] Early diagnosis of cancer, cancer recurrence or treatment resistant mutations can improve patient outcomes. Low sensitivity is important for early diagnosis, because mutant DNA represents a small percentage of DNA in biological sample relatively to wild-type DNA. High specificity is also important because of the negative impacts on patient health when a patient undergoes unnecessary cancer treatment, such as chemotherapy based on a false positive diagnosis. One challenge to genetic diagnostics remains accurately determining the presence or absence of a mutation, when the mutant DNA can be present at very low concentrations compared to the wild-type DNA in a sample comprising a mixture of the mutant DNA and wildtype DNA.

[0009] Improving accuracy encompasses both specificity (reducing false-positives), and sensitivity (reducing false-negatives). A threshold is used to define the barrier between a negative sample in which a mutation is absent and a positive sample where a mutation is present. This threshold is used to calculate the specificity and sensitivity of the method being used to detect the mutation. Similarly, the signal to noise ratio can be used to assess the accuracy of a method, where the signal represents the result when the mutation is present, and the noise represents the result when a mutation is absent. A method is more accurate as the separation between the signal and the noise becomes greater.

[0010] One approach to increasing the signal to noise ratio is to enrich the sample for the mutant. Enrichment may involve preferentially inhibiting or preventing the replication of wild type DNA relative to mutant DNA during polymerase chain reaction (PCR). In such enrichment, each cycle of PCR results in the mutant being present at a higher percentage compared to the previous cycle. Many methods have been developed, with some examples being allele-specific PCR, peptide nucleic acid (PNA) clamping, locked nucleic acid (LNA) blocking, and Co-amplification at lower denaturation temperature PCR (COLD-PCR). However, no enrichment methods to date have been able to achieve adequate sensitivity and specificity.

[0011] As such, there remains a need for an accurate detection of a mutant DNA segment when the mutant DNA segment is present at a low percentage. This would benefit patients, particular regarding cancer diagnosis, by using liquid biopsy to determine the presence or absence of certain mutations associated with cancer. This could be applied to the various cancer diagnostic areas, such as companion diagnostics, minimum residual disease, cancer recurrence, or prospective aid in diagnosing cancer.

[0012] SUMMARY

[0013] The present inventor has discovered a method for enriching a target polynucleotide a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a nontarget polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture. The inventor's method can be utilized to selectively enrich a target polynucleotide via amplification relative to the non-target polynucleotide, and to accurately detect the target polynucleotide via sequencing when the target polynucleotide is present at a copy number lower than 10 and when the target polynucleotide represents less than about 0.05% of the mixture comprising the target polynucleotide and the non-target polynucleotide. In some embodiments, the inventor's method achieves an enrichment in which the target polynucleotide represents greater than about 99% of the sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a > 1800-fold enrichment, after the sample has been subjected to the inventor's amplification method and sequenced.

[0014] In some embodiments, the disclosed methods may be performed for detecting a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide in the disclosed methods. The methods may be utilized for detecting with high sensitivity and high selectivity a target polynucleotide in a mixture of the target polynucleotide and the reference polynucleotide in which the target polynucleotide is present at a relatively low concentration in the sample (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture comprising the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05% of the mixture). The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the detected genetic alteration.

[0015] In certain embodiments, the disclosed method includes performing a polymerase chain reaction (PCR) amplification product which is subsequently sequenced in order to detect the target polynucleotide. The PCR reaction typically includes: (i) the sample or a fraction of the sample; (ii) a thermostable DNA polymerase that lacks 5 '- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 10‘6(i.e., a high fidelity DNA polymerase); (iii) a pair of primers that flank the genetic alteration to be detected in the method; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a non-target polynucleotide) at a hybridization site that does not overlap with the hybridization sites for the pair of primers, thereby selective blocking amplification of the reference polynucleotide and enriching amplification of the target polynucleotide. In certain embodiments, the blocker hybridizes at hybridization site that is located at a position that is greater than 5, 10, 15, 20, 25, 30, 40, 50, 60, or 70 base pairs from the terminal nucleotide of the oligonucleotide that is being extended. After amplification has been performed, the amplification product thereby obtained may be subjected to sequencing in order to detect the target polynucleotide. The disclosed methods achieve a remarkable level of enrichment where the target polynucleotide may represent greater than 99% of sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a > 700-fold enrichment.

[0016] Also disclosed herein are kits for performing the disclosed methods. The disclosed kits may comprise one or more components for performing the disclosed methods selected from: (i) a thermostable DNA polymerase that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 1 O’6(i.e., a high fidelity DNA polymerase); (iii) a pair of primers that flank a genetic alteration to be detected in the methods; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a non-target polynucleotide), thereby selective blocking amplification of the reference polynucleotide and enriching amplification of the target polynucleotide.

[0017] The disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder. In particular, the disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject having cancer or suspected of having cancer. Suitable subjects for the disclosed methods may include cancer patients that currently are in remission.

[0018] BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1A illustrates the results of the agarose gel. Samples 1 through 6 are in lanes 1 to 6 respectively. FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C. FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.

[0020] FIG. 2A illustrates the results of the agarose gel. Samples 7 through 12 are in lanes 1 to 6 respectively. FIG. 2B illustrates the results of the Sanger sequencing run for Sample 10, which contained approximately 0.005% KRAS G13D. FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.

[0021] FIG. 3A illustrates the results of the agarose gel. Samples 13 through 18 are in lanes 1 to 6 respectively. FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.

[0022] FIG. 4A illustrates the results of the agarose gel. Samples 19 through 24 are in lanes 1 to 6 respectively. FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.

[0023] DETAILED DESCRIPTION

[0024] The present invention is described herein using several definitions, as set forth below and throughout the application.

[0025] Molecular profiling of tumors obtained from individual patients improves the selection of personalized cancer treatment therapies, patient responses, detection of drug resistance, and monitoring of tumor relapse. Profiling tumors generally involves obtaining resected tumor samples by invasive surgeries. The limitations to such invasive procedures include difficulty in acquiring tumor samples for both tumor quantity and quality. Another drawback is that acquiring biopsy samples by invasive methods throughout treatment to monitor tumor response and relapse pose major challenges in tumor profiling. A further limitation to invasive sampling methods is the heterogeneity of resected tumor samples as a whole. Further, in the case of metastasis, where tumors have spread and constantly evolve both spatially and temporally in response to treatment over time, multiple biopsies may be required. These challenges make it difficult to obtain a holistic image of a tumor.

[0026] Recently, new non-invasive techniques are being developed to address these limitations, such as liquid biopsy (LB). Liquid biopsies consist of isolating tumor-derived entities like circulating tumor cells, circulating tumor DNA, tumor extracellular vesicles, etc., present in the body fluids of patients with cancer, followed by an analysis of genomic and proteomic data contained within them. Liquid biopsies methods permit continuous monitoring by repeated sampling. Further, LB provides enhanced sensitivity in diagnosis and ease of repeated sampling throughout treatment much more conveniently and non-invasively.

[0027] The term "biological fluid" herein refers to a liquid taken from a biological source and includes, for example, blood, serum, plasma, sputum, lavage fluid, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like. As used herein, the terms "blood," "plasma" and "serum" expressly encompass fractions or processed portions thereof. Similarly, where a sample is taken from a biopsy, swab, smear, etc., the "sample" expressly encompasses a processed fraction or portion derived from the biopsy, swab, smear, etc.

[0028] In addition to circulatory fluids like plasma or serum, other body fluids such as saliva and urine can be used as liquid biopsies. Saliva offers practical advantages with regard to ease of access, non-invasiveness, and cost effectiveness in sampling, even more so than plasma or serum. Novel electrochemical sensor-based technologies like an electric field-induced release and measurement (EFIRM) have been shown to detect EGFR mutations (tyrosine kinase domain) from bodily fluids like saliva in patients. Similar EFIRM based technologies have been used in developing salivary biomarkers.

[0029] The completely non-invasive nature of urine sampling, relative to tissue or even blood, makes it a quite useful candidate in LBs, particularly in cases where repeated sampling is required to monitor tumor progression and therapeutic outcomes.

[0030] Circulating tumor cells (CTCs) are initially released from primary tumors in the tissue, travel through the circulatory system and account for the development of metastatic (or secondary) tumors at distant sites in the body. The percentage in the blood is quite low, with nearly one CTC found per million leukocytes. Various technologies have been used to selectively detect viable CTCs to obtain information regarding tumors. One example is the EPISPOT (EPitheliallmmunoSPOT) assay that detects circulating tumor cells up to a single cell. The assay involves the use of membrane-bound antibodies against the epithelial cell adhesion molecule (EpCAM, or CD326) present on tumor cells and their subsequent culturing / expansion in both in vivo and in vivo conditions. Another positive selection / enrichment technology for CTCs obtained from LB samples is the CellSearch system. This technology uses antibody- labeled magnetic beads to pull down CTCs with epithelial lineage markers (like EpCAM). Another immunomagnetic-based enrichment assay of CTCs from LBs is the AdnaTest. In addition to the EpCAM-labeled ferromagnetic beads used in the CellSearch system, AdnaTest includes a polymerase chain reaction (PCR) step to detect tumor-specific mRNA transcripts.

[0031] Alternative approaches include microfluidic devices used to select CTCs in various types of cancers. Devices like the “CTC-Chip,” which contains thousands of small antibody -labeled microposts, have been used to capture CTCs bearing specific tumor antigens from LB blood samples. Certain designs of “CTC-Chips” have been demonstrated to employ patterns of microgrooves, which seem to increase the contact time between antibody -lab eled microposts and CTCs, improving cellular entrapment. CTCs filtered off from LB samples by the chip are then imaged and analyzed.

[0032] Functional assays like the Metastasis-Initiating-Cells (MIC) assay analyze the invasive properties of CTCs obtained from LB into the surrounding matrix in vivo, assisting in their further characterization. These analyses aid in providing a detailed picture of tumor staging / subtypes and in designing novel personalized therapeutic drugs against tumors. In addition to general nuclear and surface-specific markers targeting CTCs, counterstain markers that target cells in exclusion to CTCs such as white blood cells (WBCs), platelets, red blood cells (RBCs), etc., can also be used to enrich CTCs from blood samples. The prominent markers selected for counterstains include CD45 / CD66b (granulocytes), CD235a (RBCs), CD41 / CD61 (platelets), CD4 / CD8 (lymphocytes), CDl lb / CD14 (macrophages) and CD34 (hematopoietic progenitors / endothelial cells). Technologies like the EasySep Depletion Kit (StemCell Technologies) use CD45-labeled magnetic beads to negatively select WBCs, depleting them from the LB samples. Other examples, like the RosetteSep (StemCell Technologies) method, use an additional density gradient centrifugation step for further CTC enrichment.

[0033] Post-enrichment technologies, such as the DEP Array™ System, have also been demonstrated to successfully isolate and recover single CTCs from LB samples of whole blood. Next-generation sequencing (NGS) analysis can be carried out directly on CTCs using technologies such as the Ion Torrent PGM™ system, composed of the Ion AmpliSeq™ Cancer Hotspot Panel, which provides enhanced mutational analysis and avoids the use of error-prone methods like whole genome amplification (WGA), thus improving screening accuracy. In certain embodiments, circulating tumor cells are present in the liquid biopsy; i.e., whole tumor cells are present, and not just DNA fragments.

[0034] In certain embodiments, circulating tumor DNA (ctDNA) is present in the liquid biopsy. Over time, fragments of DNA from the tumor cells can enter a patient’s bloodstream, and this DNA is called circulating tumor DNA (ctDNA). This ctDNA can be from dying tumor cells or as the cancer cells turnover. Circulating tumor DNA (ctDNA) is single- or double-stranded DNA released by the tumor cells into the blood and it thus harbors the mutations of the original tumor. Circulating tumor DNA (ctDNA) is distinguishable from cell-free DNA (cfDNA), in that DNA fragments shed from non-tumor cells are cfDNA, whereas DNA fragments shed from tumors are ctDNA. ctDNA accounts for about 0.01-10% of the total circulating cell-free DNA (cfDNA). ctDNA levels in plasma, however, can vary depending on tumor load, tumor stage, and therapeutic response.

[0035] Two major types of approaches have been considered for ctDNA analysis: targeted approaches that focus on specific gene rearrangements or gene mutations in particular genomic regions that act as “hotspots” for variation in a given tumor type, or untargeted approaches that offer a broader analysis and monitoring of the tumor genome, providing information on nucleotide alterations, copy number aberrations, chromosomal alterations, etc., independent of any prior data on molecular alterations.

[0036] Targeted approaches include PCR-based methods such as droplet digital PCR and BEAMing that have shown remarkable sensitivity of 1 to 0.001% in detecting somatic point mutations. Droplet digital PCR involves partitioning the sample DNA (target and background DNA) into numerous independent partitions or droplets. The target sequence is then amplified by end point PCR in each droplet and relative fractions of positive and negative droplets counted (fluorescent probes) that provide relative quantification of target samples. BEAMing (beads, emulsions, amplification, and magnetics), on the other hand, is a modification of emulsion PCR where several different templates are amplified within a single tube, each in different compartments (or emulsion droplets) but along with primer bound beads that are recovered with the help of a magnetic field or centrifugal force.

[0037] BEAMing and droplet digital PCR do not provide a high enough signal to noise ratio to meet the sensitivity and specificity standards required for regulatory approval as an independent diagnostic of cancer. Diagnosing cancer has a high regulatory threshold because a false positive would result in a healthy patient receiving cancer treatment, such as chemotherapy. Chemotherapy is known to shorten people’s life expectancy along with other serious side effects. BEAMing and droplet digital PCR both have the same short-coming of DNA mismatch hybridization resulting in false positive signal. The use of blocking oligonucleotides overcomes this short-coming because blocking oligonucleotides hybridize to reference DNA, instead of target DNA. Blocking oligonucleotides still mismatch hybridize, but the outcome from this is blocking of the target DNA, instead of the false positive signal in BEAMing or droplet digital PCR.

[0038] Blocking methods have been used most in peptide nucleic acids (PNAs) but also in locked nucleic acids (LNAs) and co-amplification at lower denaturation temperature PCR (COLD-PCR). These methods have not been able to sufficiently enrich low frequency target mutations. Versions of COLD-PCR have reported increasing a target sample from 0.1% to 10.4%, but the reference only sample showed 3.4% mutant, representing a signal to noise ratio of 3.1. A higher signal to noise ratio is required to prevent false positives. Xeno nucleic acids (XNAs), similar to PNAs, enriched on average from a target sample of 0.25% to only 7.5%, with a reference sample showing near 0% mutant. The XNA method demonstrated a high signal to noise ratio, but lacked the sensitivity for detecting ctDNA, which can be below 0.1%.

[0039] Unless otherwise specified or indicated by context, the terms "a", "an", and "the" mean "one or more." For example, "a target nucleic acid" should be interpreted to mean "one or more target nucleic acids."

[0040] As used herein, "about," "approximately," "substantially," and "significantly" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of these terms which are not clear to persons of ordinary skill in the art given the context in which they are used, "about" and "approximately" will mean plus or minus <10% of the particular term and "substantially" and "significantly" will mean plus or minus >10% of the particular term.

[0041] As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising." For example, "a method that includes a step" should be interpreted to mean "a method that comprises a step." The terms "comprise" and "comprising" should be interpreted as being "open" transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms "consist" and "consisting of' should be interpreted as being "closed" transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term "consisting essentially of' should be interpreted to be partially closed and permitting the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.

[0042] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0043] The modal verb "may" refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb "may" refers to an affirmative act regarding how to make or use an aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb "may" has the same meaning and connotation as the auxiliary verb "can."

[0044] As used herein, the term "subject," which may be used interchangeably with the terms "patient" or "individual," refers to one who receives medical care, attention or treatment and may encompass a human subject. As used herein, the term "subject" is meant to encompass a person having and / or at risk for developing a disease or disorder characterized by a nucleic acid alteration in one or more genetic loci that are associated with the disease or disorder, such as a mutation in a gene that is associated with the disease or disorder. The term "subject" is meant to encompass a person having and / or at risk for developing a cell proliferative disease or disorder such as cancer. The term "subject" is meant to encompass a person having been diagnosed with cancer and currently diagnosed as being in remission, that results in methylation status of one or more genes associated with the disease or disorder or characterized by genetic mutations associated with the disease or disorder. The "methylation status" of a gene may include the "methylation status" of the promoter of the gene, for example, relative to a control gene.

[0045] As used herein, a subject in need thereof may include a subject having or at risk for developing a disease or disorder including, but not limited to, a cell proliferative disease or disorder (e.g., cancers such as breast cancer, prostate cancer, colon cancer, lung cancer, gall bladder cancer, brain cancer, uterine cancer, ovarian cancer, head and neck cancer, gastric cancer, liver cancer, leukemias, and lymphomas), a neurodegenerative disease or disorder (e.g., Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease), a psychiatric disease or disorder (e.g., schizophrenia and depression), a metabolic disease or disorder (e.g., type 1 or type 2 diabetes), a cardiovascular disease or disorder (e.g, myocardial infarction or stroke), inflammatory diseases or disorders (e.g. arthritis), and immune diseases or disorders. In some embodiments, the subject has been diagnosed with a cancer and currently is diagnosed as being in remission.

[0046] The disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on detecting an alteration in one or more genetic loci associated with the disease or disorder in a sample obtained from the subject. As used herein the terms "diagnose" or "diagnosis" or "diagnosing" refer to distinguishing or identifying a disease, syndrome or condition or distinguishing or identifying a subject having or at risk for developing a particular disease, syndrome or condition. As used herein the terms "prognose" or "prognosis" or "prognosing" refer to predicting an outcome of a disease, syndrome, condition, or treatment regimen in a subject.

[0047] The disclosed methods may be utilized to treat a subject in need thereof. For example, the disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on methylation status of the promoter region of one or more genes associated with the disease or disorder or characterized by one or more mutations associated with the disease or disorder. Subsequently to the diagnosis or prognosis, the subject may be administered a suitable treatment based on the diagnosis or prognosis of the disease or disorder.

[0048] The disclosed methods may be utilized to characterized nucleic acid in a subject sample. The term "sample" or "subject sample" is meant to include biological samples such as tissues (e.g., tissues obtained from biopsies) and bodily fluids. "Bodily fluids" may include, but are not limited to, blood, serum, plasma, saliva, cerebral spinal fluid, pleural fluid, tears, lactal duct fluid, lymph, sputum, and semen. A sample may include nucleic acid, protein, or both.

[0049] The methods disclosed herein may be applied when performing DNA amplification of a nucleotide sample. In particular, the methods disclosed herein may be applied when performing DNA amplification of a sample comprising a mixture of a target polynucleotide comprising a genetic alteration and a reference polynucleotide lacking the genetic alteration (where the reference polynucleotide is a non-target polynucleotide). Samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wildtype polynucleotide is a non-target polynucleotide).

[0050] The methods disclosed herein may be applied when performing DNA sequence analysis of a nucleotide sample. In particular, the methods disclosed herein may be applied when performing DNA sequence analysis of a sample comprising a mixture of a target polynucleotide comprising a genetic alteration and a reference polynucleotide lacking the genetic alteration (where the reference polynucleotide is a non-target polynucleotide). Samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wild-type polynucleotide is a non-target polynucleotide).

[0051] The methods disclosed herein may be applied when performing methylation analysis. For example, the methods disclosed herein may be applied when amplifying and sequencing a polynucleotide sample after the sample has been treated with an agent that selectively modifies unmethylated cytosine residues and not methylated cytosine residues, such as a bisulfite agent. Bisulfite treatment commonly is performed to convert unmethylated cytosine residues to uracil residues in a polynucleotide sample. The treated polynucleotide sample then can be utilized as a template for DNA synthesis (e.g., in a PCR amplification or in a sequencing reaction) where uracil residues ultimately are converted to thymidine residues. By performing sequencing of the treated polynucleotide sample, detection of a thymidine residue at a given position versus a cytosine residue will be indicative of an unmethylated cytosine in the original sample or a methylated cytosine in the original sample, respectively. As such, samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having a C or T / U at one or more positions as compared to a non-target polynucleotide having a T / U or C at one or more respective positions.

[0052] The methods disclosed herein may be applied to a wide variety of sequencing methods. Sequencing methods may include high-throughput or ultra-high-throughput sequencing methods. DNA sequencing processes suitable or adaptable for the disclosed methods may include, but are not limited to, sequencing by synthesis, single-molecule real-time sequencing, ion semiconductor sequencing, pyrosequencing, sequencing by ligation, chain termination sequencing, massively parallel signature sequencing, Polony sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Nanopore DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, and microscopy -based sequencing techniques. As such, the disclosed methods may be applied to tradition DNA sequencing methods based on the Sanger sequencing method or the Maxam and Gilbert sequencing method, so-called "first-generation" DNA sequencing techniques, as well as methods that are more amenable to high-throughput analysis, so-called "second generation" and "third generation" DNA sequencing techniques." See, e.g., Mardis, Ann. Rev. Genomics and Human Genetics, Vol. 9: 387-402 (2008); Metzker, Genome Research, (2005) 15: 1767-1776; Moorthie et al., Hugo J. v. 5(1-4), Dec. (2011); and Schadt et al., Human Molecular, Genetics, Vol. 19, No. R2, pp. R227-2490, September 21, 2010; and Shendure et aL, Nature Biotechnology 26, 1135-1145 (2008)).

[0053] The disclosed technology relates to nucleic acid and the use of nucleic acid for diagnosing, prognosing, and / or treating diseases and disorders. The terms "nucleic acid" and "oligonucleotide," and "polynucleotide" as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-ribose), polyribonucleotides (containing ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base. As used herein, the terms "A," "T," "C," "G" and "U" refer to adenine, thymine, cytosine, guanine, uracil as a nucleotide base, respectively. There is no intended distinction in length between the terms "nucleic acid," "oligonucleotide," and "polynucleotide," and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. For use in the present invention, an oligonucleotide also can comprise nucleotide analogs in which the base, sugar or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs.

[0054] Oligonucleotides utilized in the disclosed methods may include one or more modified nucleotides. Nucleotide modifications may include, but are not limited to, locked nucleic acids (LNAs) or bridged nucleic acids (BNAs), peptide nucleic acids, glycol nucleic acids, and threose nucleic acids.

[0055] As used herein, a "fragment" of a polynucleotide is a portion of a polynucleotide sequence which is identical in sequence to but shorter in length than a reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides of a reference polynucleotide. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in other embodiments a fragment may comprise no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in further embodiments a fragment may comprise a range of contiguous nucleotides of a reference polynucleotide bounded by any of the foregoing values (e.g., a fragment comprising 20-50 contiguous nucleotides of a reference polynucleotide). Fragments may be preferentially selected from certain regions of a molecule. The term "at least a fragment" encompasses the full-length polynucleotide. A "variant," "mutant," or "derivative" of a reference polynucleotide sequence may include a fragment of the reference polynucleotide sequence.

[0056] A fragment of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide) may be generated via a PCR amplification reaction. An amplification product may comprise amplified fragments of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). An amplification product may comprise a mixture of amplified fragments of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide).

[0057] Regarding polynucleotide sequences, "alteration," "variant," "mutant," or "derivative" may be defined as a nucleic acid sequence having a different nucleic acid sequence relative to a reference sequence, which may include a wild-type sequence. An "alteration," "variant," "mutant," or "derivative" may include a substitution of one or more nucleotides (e.g., a G~>t transversion), a deletion of one or more nucleotides, and / or an insertion of one or more nucleotides.

[0058] A target polynucleotide may comprise an alteration relative to a reference sequence, which is a non-target polynucleotide. For example, a target polynucleotide may comprise a mutation relative to a wild-type reference sequence. In the disclosed methods, the target polynucleotide selectively is amplified and detected relative to non-target polynucleotide, which may be a wild-type reference polynucleotide.

[0059] The nucleic acids disclosed herein may be "substantially isolated or purified." The term "substantially isolated or purified" refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated. In some embodiments, the samples utilized in the disclosed methods may comprise a nucleic acid sample that has been substantially isolated or purified.

[0060] The disclosed methods may utilize a sample comprising nucleic acid from any source, including a source from an animal and / or a source from the environment. In some embodiments, the polynucleotide sample comprises genomic DNA. In further embodiments, the genomic DNA is treated prior to sequencing with a reagent that selectively modifies nonmethylated cytosine residues in the DNA to produce detectable modified residues, but which does not modify methylated cytosine residues. In even further embodiments, the nucleotide at the nucleotide position of the polynucleotide sample is a methylated cytosine or a modified residue and the set of polynucleotide fragments comprises two or more different polynucleotide fragments having a cytosine or a thymine at the nucleotide position of the polynucleotide sample.

[0061] The disclosed methods may utilize primers that are complementary to a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). The disclosed methods also may utilize a blocking oligonucleotide that is complementary to a nontarget polynucleotide and which is not complementary to a target polynucleotide at one or more nucleotide positions. As used herein, the term "complementary" in reference to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair exactly with the second polynucleotide sequence throughout a stretch of nucleotides without mismatch. The term "cognate" may in reference to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair with the second polynucleotide sequence throughout a stretch of nucleotides but may include one or more mismatches within the stretch of nucleotides. As used herein, the term "complementary" may refer to the ability of a first polynucleotide to hybridize with a second polynucleotide due to base-pair interactions between the nucleotide pairs of the first polynucleotide and the second polynucleotide (e.g., A:T, A:U, C:G, G:C, G:U, T:A, U:A, and U:G).

[0062] A “blocking oligonucleotide” as utilized herein may hybridize to a target polynucleotide and / or a non-target polynucleotide at a hybridization site that does not overlap with the hybridization sites to which the primer pairs hybridize. In some embodiments, the blocking oligonucleotide hybridizes at a hybridization site on a target and / or a non-target polynucleotide which is located at a position that is greater than 5, 10, 15, 20, 25, 30, 40, 50, 60, or 70 base pairs from the terminal nucleotide of the oligonucleotide that is being extended, which may be the forward primer of the primer pair.

[0063] The term "hybridization," as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between "substantially complementary" nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as "stringent hybridization conditions" or "sequence-specific hybridization conditions." Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3 / 4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference). Those skilled in the art of nucleic acid technology can determine melting temperature for duplexes.

[0064] Methods for Enriching a Target Polynucleotide in a Mixed Sample

[0065] This method described below provides both sensitivity and a high signal to noise ratio. In some embodiments, the sensitivity is as low as 0.005% with the sample enriched to >99%. In some embodiments the signal to noise ratio is high because a 100% reference sample does not result in a measurable signal.

[0066] The disclosed subject matter relates to methods for enriching a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide lacking the genetic alteration in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, for example, where the reference polynucleotide is a non-target polynucleotide in the sample. The methods may be utilized for detecting with high sensitivity and high specificity the target polynucleotide in the mixture of the reference polynucleotide and the target polynucleotide in which the target polynucleotide is present at a low copy number (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture of the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05%). The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the detected genetic alteration.

[0067] The disclosed methods typically include an amplification step that produces an amplification product, such as a polymerase chain reaction (PCR) amplification. The PCR amplification typically is configured to selectively amplify a genetic alteration present in a target polynucleotide relative to a reference polynucleotide lacking the genetic alteration, where the reference polynucleotide is a non-target polynucleotide. The disclosed methods also typically include a sequencing step in which the amplification product is sequenced, and the genetic alteration of the target polynucleotide is identified.

[0068] In some embodiments, the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (i) the sample or a fraction of the sample; (ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity and that comprises proofreading activity such as 3 '- 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., a polymerase having an error rate of less than about 1 O’6); (iii) a pair of primers that flank the genetic alteration that does not overlap with the blocking oligonucleotide; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample; (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide; (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide; (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).

[0069] DNA polymerase 5 '- 3 ' nuclease activity is commonly used is diagnostic assays for generating signal through the cleavage of a fluorophore. A DNA polymerase lacking this feature may have less diagnostic utility. However, 5 '->3 ' nuclease activity could also cleave or otherwise remove the blocking oligonucleotide. Removing this feature may increases the effectiveness of the blocking oligonucleotide. Adding 3 '- 5' nuclease activity increases the fidelity of the polymerase, which can also increase the signal to noise ratio in highly sensitive diagnostics assays.

[0070] In some embodiments of this method, the primer and blocker do not overlap. Not having the primer and blocker overlap improves blocking efficiency through a variety of mechanisms, such as the blocker (RNA, or RNA-like) nucleotide and the target (DNA) hybridizing in A- form, while the primer (DNA) and target (DNA) hybridize in B-form. In B-form the nucleotides are in the center of the helix, while in A-form the nucleotides are displaced away from the helix. This creates a competing conformation situation. Also, the primer and blocker are not competing exclusively, the polymerase is bound to the primer as well. The binding of the polymerase may dislodge the blocker in a variety of mechanisms, such as (1) increasing the stability of the primer and target DNA duplex above the blocker and target DNA duplex (2) using the finger and thumb domains to force the DNA into a B-form conformation (3) strand displacement ability of DNA polymerase, which is separate and distinct from the nuclease activity. Increasing the nucleotide separation between the primer and blocker may also allow more time for the blocker to hybridize and prevent the extension of the primer.

[0071] In certain embodiments, the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA. Reducing the temperature of the reaction mixture to the “blocker annealing temperature,” which is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide. Further reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide. The blocker annealing temperature allows time for the hybridization reaction to approach equilibrium. Melting temperature is commonly used in PCR, but melting temperature describes the hybridization equilibrium. At the melting temperature of a primer, the primer binds 50% of the reference polynucleotides and the blocker binds to >99% of the reference polynucleotides. However, both reactions still occur at a rate that allows for the primer to bind before the blocker on some reference polynucleotides. A primer that binds before the blocker can be extended prevents blocking from occurring. Having the PCR reaction with two annealing steps, first the blocker annealing and then the primer annealing, allows the blocker to approach a hybridization equilibrium for a sufficient percentage of reference polynucleotides and ensure a higher increase in blocking efficiency.

[0072] Combining a proof-reading DNA polymerase, with a blocker that does not overlap with the primer and a blocker annealing step results in a method with can enrich from 0.05% to >99.8, which is a 1996-fold improvement with the 100% reference sample being undetectable (see, FIG. 1 and FIG. 2). In certain embodiments, the disclosed methods are performed in order to detect a target polynucleotide that represents no more than about 3%, 2%, 1%, 0.5%, 0.25%, 0.125%, or less of the mixture of the target polynucleotide and the reference polynucleotide in the sample. In some embodiments of the disclosed methods, the target polynucleotide represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide in the sample.

[0073] In certain embodiments, the disclosed methods utilize a polymerase that has a relatively low error rate. In some embodiments, the polymerase has an error rate which is less than about 10’5, IO’6, or IO’7

[0074] In certain embodiments, the disclosed methods typically include an amplification step comprising a number of amplification cycles. In some embodiments of the disclosed methods, the methods include a PCR amplification step in which PCR amplification is performed for more than 30, 40, 50, or 60 cycles.

[0075] In certain embodiments, the genetic alteration of the target nucleotide is selectively amplified or enriched. In some embodiments of the disclosed methods, the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the sequenced amplified product. In some embodiments of the disclosed methods, the amplification product is sequenced from multiple reads and the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads.

[0076] In the disclosed methods, the genetic alteration of the target polynucleotide is selectively enriched and detected. In some embodiments of the disclosed methods, the target polynucleotide comprising the generic alteration represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide lacking the genetic alteration in the sample. After the disclosed methods have been performed, in some embodiments the amplification product is sequenced from multiple reads and the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads, representing an enrichment of at least about 1980-fold (z.e., 99% / 0.05% = 1800).

[0077] The disclosed methods typically include sequencing an amplification product. In some embodiments of the disclosed methods, the blocking oligonucleotide is removed from the amplification product prior to sequencing the amplification product.

[0078] In certain embodiments, the method detects a target nucleotide that is present in a mixed sample comprising the target nucleotide and a reference polynucleotide. In some embodiments, the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the mixture at a relative low percentage (e.g., when the target polynucleotide is present in the mixture at a percentage of no more than 0.1%, 0.05%, 0.02%, or 0.01%).

[0079] In certain embodiments, the target polynucleotide may be present at a relative low concentration in the sample. In some embodiments, the target nucleotide may be present in a sample at a copy number of less than about 10000, 1000, 100, 10 or less. In some embodiments, the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the sample at a copy number of less than about 10000, 1000, 100, 10 or less.

[0080] In the disclosed methods, the genetic alteration of the target nucleotide is selectively amplified or enriched. The genetic alteration may be selectively amplified or enriched by configuring the PCR amplification reaction to include a blocking oligonucleotide that selectively hybridizes to the reference polynucleotide to form a blocking duplex, where the reference polynucleotide lacks the generic alteration, and the reference polynucleotide is a non-target polynucleotide. In some embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance the stability of the duplex formed by the blocking oligonucleotide and the reference polynucleotide. In some embodiments the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.

[0081] In certain embodiments, the blocking oligonucleotide forms a first duplex with the reference polynucleotide lacking the genetic alteration (i.e., where the reference polynucleotide is a non-target polynucleotide), where the first duplex has a first melting temperature T1. The blocking oligonucleotide may form a second duplex with the target polynucleotide comprising the genetic alteration, where the second duplex has a first melting temperature T2. In certain embodiments, T1 > T2. In some embodiments, the blocking oligonucleotide is configured such that T1 is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C higher than T2 (i.e., T1 - T2 > than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C).

[0082] In the disclosed methods, the blocking oligonucleotide may comprise or consist of modified nucleotides. Modified nucleotides may include but are not limited to locked nucleic acids (LNAs) or bridge nucleic acids (BNAs), peptide nucleic acids, glycol nucleic acids, and threose nucleic acids. The presence of modified nucleotides in the blocking oligonucleotide may alter T1 or T2. In certain embodiments, the presence of modified nucleotides in the blocking oligonucleotide increases Tl. In certain embodiments, the presence of modified nucleotides in the blocking oligonucleotide increases the difference between Tl and T2.

[0083] In certain embodiments, extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively high percentage of the reference polynucleotide (which is a non-target polynucleotide) in the sample, such as a temperature at which the blocking oligonucleotide is hybridized to greater than about 50%, 60%, 70%, 80%, 90%, 95%, or greater of the reference polynucleotide (which is a non-target polynucleotide) in the sample. In certain embodiments, the extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively low percentage of the target polynucleotide in the sample, such as a temperature at which the blocking oligonucleotide is hybridized to less than about 50%, 40%, 30%, 30%, or lower of the target polynucleotide in the sample.

[0084] The blocking oligonucleotides include locked nucleic acid (LNA), also known as bridged nucleic acid (BNA). An LNA is a modified nucleotide in which the sugar moiety (e.g., ribose) is modified with a bridge connecting the 2' oxygen and 4' carbon (i.e., where the 2'-0 and 4'-C are conjugated via a bridging moiety). The bridge "locks" the sugar moiety in the 3'- endo (North) conformation, which is often found in A-form duplexes. This structure provides for increased stability against enzymatic degradation, and also offers improved specificity and affinity in base-pairing as a constituent of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide. Bridging moi eties of LNA may include alkylene moi eties (e.g., a methylene bridging moiety) and amino alkylene moi eties (e.g., amino methylene bridging moiety). An LNA may be referred to with the following designation: +A, +G, +C, or +T. In some embodiments of the blocking oligonucleotides, all of the nucleotides of the blocking oligonucleotide are LNAs, i.e., the nucleotides of the blocking oligonucleotides may consist of LNAs.

[0085] In certain embodiments, the methods utilize a blocking oligonucleotide that is relatively short in length. In some embodiments, the blocking oligonucleotide has a length that is no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides.

[0086] In certain embodiments, the method is performed to detect a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide. The genetic alteration may include a mutation relative to a wild-type sequence, for example, where the target polynucleotide comprises the mutation and the reference polynucleotide comprises the wild-type sequence and the reference polynucleotide is a non-target wild-type polynucleotide. Genetic alterations that are detected in the disclosed methods may include substitutions, deletions, insertions, or a combination thereof.

[0087] In certain embodiments, the genetic alterations detected in the disclosed methods are present at selected genetic loci. In some embodiments, the genetic alteration is present in a genetic loci selected from one or more of PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF.

[0088] In some embodiments of the disclosed methods, the methods utilize a an additional pair of primers that amplify a control sequence as an internal control. An internal control may be utilized to demonstrate that steps of the disclosed methods are occurring as intended and / or if a blocking oligonucleotide is blocking exponential amplification of the reference polynucleotide as intended.

[0089] The disclosed methods may be configured in order to detect multiple target polynucleotides comprising different genetic alterations relative to a reference polynucleotide. In some embodiments, the disclosed methods are configured for performing a multiplex analysis.

[0090] Methods for Modulating the Enrichment of a Target Polynucleotide

[0091] Enriching a low-frequency target mutation is needed for diagnosing cancer. However, a major short-coming of the method used in Example 1 and Example 2 is that the 100% reference sample failed to generate a result. In FIG. 1 A and FIG. 2A the 100% reference sample (lane 1) is not readily discernable from the sample lacking DNA (lane 6). This is a regulatory and quality control issue if a negative sample cannot be distinguished from an improperly processed sampled. Included a traditional internal control, such as amplifying another polynucleotide can prevent the detection of very low-frequency target polynucleotides by consuming critical reagents.

[0092] In the disclosed method, this issued is solved by exploiting the annealing temperature. In Example 1 and Example 2, the blocker annealing temperature is used to increase efficiency of the blocking. In Example 3 and Example 4, after the enrichment PCR cycling, another round of PCR cycling is performed lacking the blocker annealing temperature. This reduction in blocker efficiency allows samples containing 100% reference polynucleotides to be detected (FIG. 3 A and FIG. 4A). Therefore, this method allows for the enrichment and low-frequency target polynucleotides, while still allowing 100% reference polynucleotide samples to be detected.

[0093] In some embodiments, the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (i) the sample or a fraction of the sample; (ii) a DNA polymerase that lacks 5 '- 3 ' nuclease activity and that comprises proofreading activity such as 3 '- 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., a polymerase having an error rate of less than about 10‘6); (iii) a pair of primers that flank the genetic alteration; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample; (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide; (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide; (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide; (g) steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).

[0094] In certain embodiments, the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA. The temperature then is lowered to the point where the blocking oligonucleotide hybridizes to the reference polynucleotide selectively because the blocking oligonucleotide is configured to have a lower melting temperature when hybridized to the target polynucleotide. As such, a higher percentage of reference polynucleotides are hybridized with the blocking oligonucleotide as compared to the percentage of target polynucleotides. Primer oligonucleotides that flank the position where the blocking oligonucleotide hybridizes then are used to amplify the target oligonucleotide and the reference oligonucleotide. During the PCR amplification, the hybridization of the blocking oligonucleotide to the reference polynucleotide inhibits the extension of the polymerase. Therefore, it is crucial the blocking oligonucleotide hybridizes to the reference polynucleotide prior to the primer hybridizing to the reference polynucleotide. To increase the efficiency of the blocking, the PCR cycle contains a step below the melting temperature of the blocking oligonucleotide and above the primer melting temperature. Holding at this temperature allows the blocking oligonucleotide to approach hybridization equilibrium. As a result, if a target polynucleotide is present, the target polynucleotide is amplified to a higher extent as compared to the reference polynucleotide. As a consequence, after each PCR cycle the amplification product of the target polynucleotide is enriched. Multiple PCR cycles may be performed to increase the total number of copies of the amplification product of the target polynucleotide to a point where sequencing may be performed in order to detect the genetic alteration of the target polynucleotide. After high efficiency enrichment, reducing the efficiency of the enrichment is beneficial. The efficiency of the enrichment can be modulated through removing the blocker oligonucleotide hybridization step in the PCR cycling conditions, such that the PCR cycling conditions do not contain a temperature below the blocker oligonucleotide melting temperature and above the primer melting temperature. Reduced blocking efficiency allows the reference oligonucleotide to replicate at an increased rate. This method allows for both the enrichment of the target polynucleotide and the replication of the reference polynucleotide.

[0095] In certain embodiments, the disclosed methods are performed to detect a target polynucleotide in a sample. In certain embodiments, the samples include, but are not limited to, biological samples or environmental samples.

[0096] In some embodiments, the sample is a blood sample or a blood product sample (e.g., plasma or serum). In some embodiments, the sample is a cell-free sample, such as a cell-free blood sample, for example, wherein the blood sample has been treated to remove cells prior to performing the disclosed methods.

[0097] In certain embodiments, the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide. In some embodiments, the disclosed methods are performed in order to detect methylation in a target polynucleotide relative to a reference polynucleotide. In some embodiments of the disclosed methods, prior to the methods being performed the sample is treated with a reagent that selectively modifies non-methylated cytosine residues to produce detectable modified residues (e.g., uracil residues) but which does not modify methylated cytosine residues, such as a bisulfite reagent. In some methods, the target polynucleotide and the reference polynucleotide differ based on the presence of a detectable modified residue (e.g., uracil or thymidine) versus a methylated cytosine residue.

[0098] In certain embodiments, the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide. In some embodiments, the genetic alteration is associated with cancer in a subject, such as a mutation associated with cancer in a subject. In some embodiments, prior to performing the initial step of the disclosed methods, the methods comprise sequencing a cancer sample from the subject and detecting the genetic alteration in the cancer sample and determining that the cancer is associated with the genetic alteration. In certain embodiments, the disclosed methods then are performed in order to monitor the presence of the genetic alteration in the subject, where the presence of the genetic alteration indicates the progression of cancer in the subject.

[0099] In some embodiments of the disclosed methods, the sample is obtained from a subject that has cancer or is at risk for developing cancer. In some embodiments of the disclosed methods, the subject has been diagnosed with cancer and currently is in remission, for example, after the subject has been treated for the diagnosed cancer. In certain embodiments, the disclosed methods are performed in order to monitor for cancer recurrence in a subject, where detection of the genetic alteration in the subject indicates that the cancer has recurred.

[0100] In certain embodiments, the disclosed methods and kits are utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder. In certain embodiments, the disclosed methods include diagnosing and / or prognosing a subject in need thereof and further may include subsequently administering treatment to the subject in need thereof after diagnosing and / or prognosing the subject. In certain embodiments, the methods herein include: (a) requesting an analysis that detects a target polynucleotide comprising a genetic alteration; and (b) subsequently administering a treatment to a subject based on the results of the analysis.

[0101] In certain embodiments, provided herein is a method for enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product, the method comprising the steps of: (a) preparing a reaction mixture comprising:

[0102] (i) the sample;

[0103] (ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;

[0104] (iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;

[0105] (iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a double-stranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;

[0106] (b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;

[0107] (c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;

[0108] (d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to unblocked reference polynucleotide, if present, and the target polynucleotide;

[0109] (e) extending the primers hybridized to the unblocked reference polynucleotide, if present, or target polynucleotide; and

[0110] (f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide.

[0111] The primer pair hybridizes to a position flanking the target mutation. The primer pair has the same affinity to the target and the reference polynucleotide because the primers hybridize to a region where the target and the reference have 100% homology. Only the blocking oligonucleotide hybridizes to the region where the target and reference are different.

[0112] In certain embodiments, the DNA polymerase is a high-fidelity DNA polymerase that lacks 5 '->3' nuclease activity and comprises 3 '- 5' nuclease activity.

[0113] In certain embodiments, the DNA polymerase has an error rate of less than 10‘5, less than 10‘6, or less than 10‘7. In certain embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.

[0114] In certain embodiments, the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group. In certain embodiments, tall of the nucleotides of the blocking oligonucleotide are LNAs.

[0115] In certain embodiments, the blocking oligonucleotide has a length of between 8 and 20 nucleotides, such as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.

[0116] In certain embodiments, the blocking oligonucleotide has a length of between 10 and 15 nucleotides. An optimal range is the shortest blocking oligonucleotide with a melting temperature of more than 10°C above the primer melting temperature. A shorter blocking oligonucleotide will give a larger melting temperature difference between the target oligonucleotide and the reference oligonucleotide. This in turn gives the blocking oligonucleotide a maximum efficiency, because a lower percentage of target oligonucleotide is hybridized when the reference oligonucleotide is greater than 90% hybridized. The blocking oligonucleotide melting temperature is optimally more than 10°C above the melting temperature of the primers. In certain embodiments the blocking oligonucleotide is designed to have an annealing temperature at the mid-point. For example, a blocking oligonucleotide is designed to have a Tm of 70°C and the primer a Tm of 60°C. In this example, at 65°C the primer does not significantly bind (<1%) but the blocking oligonucleotide does bind (>90%). It is desired to have the blocking oligonucleotide annealing temperature to optimally be 5°C above the primer melting temperature, and to have the blocking oligonucleotide annealing temperature to be 5°C below the blocking oligonucleotide melting temperature.

[0117] In certain embodiments, the genetic alteration comprises a substitution, a deletion, and / or an insertion.

[0118] In certain embodiments, the sample is a liquid biopsy (LB). In certain embodiments, the liquid biopsy is a biological fluid.

[0119] In certain embodiments, provided herein is a method for detecting a double-stranded target polynucleotide in a sample, the method comprising the steps of :

[0120] (a) preparing a reaction mixture comprising:

[0121] (i) the sample; (ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;

[0122] (iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;

[0123] (iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a double-stranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;

[0124] (b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;

[0125] (c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;

[0126] (d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide;

[0127] (e) extending the primers hybridized to the target polynucleotide;

[0128] (f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide; and

[0129] (g) contacting the target polynucleotide with a detection agent.

[0130] In certain embodiments, the detection agent is a DNA binding fluorophore or a probe.

[0131] In certain embodiments, provided herein is a kit for enriching a double-stranded target polynucleotide comprising a genetic alteration in a sample, comprising:

[0132] (a) a DNA polymerase that lacks 5 ' 3 ' nuclease activity;

[0133] (b) a blocking oligonucleotide that hybridizes selectively to a reference polynucleotide and not to the target polynucleotide;

[0134] (c) a pair of primers that flank the genetic alteration and does not overlap with the blocking oligonucleotide;

[0135] (d) instructions that include the steps comprising:

[0136] (i) preparing a reaction mixture comprising:

[0137] (1) the sample; (2) a DNA polymerase that lacks 5'- 3 ' nuclease activity;

[0138] (3) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;

[0139] (4) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a doublestranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;

[0140] (ii) increasing the temperature of the reaction mixture above the melting temperatures of a double stranded reference polynucleotide and the double stranded target polynucleotide;

[0141] (iii) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;

[0142] (iv) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide; and

[0143] (v) extending the primers hybridized to the target polynucleotide.

[0144] In certain embodiments, provided herein is a method for replicating a reference polynucleotide after enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product, the method comprising the steps of:

[0145] (a) preparing a reaction mixture comprising:

[0146] (i) the sample;

[0147] (ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;

[0148] (iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;

[0149] (iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a double-stranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide; (b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;

[0150] (c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;

[0151] (d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide;

[0152] (e) extending the primers hybridized to the target polynucleotide;

[0153] (f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide; and

[0154] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate the reference polynucleotide and the target polynucleotide.

[0155] In certain embodiments, the DNA polymerase is a high-fidelity DNA polymerase which that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.

[0156] In certain embodiments, provided herein is a DNA polymerase has an error rate of less than 1 O’5, less than 1 O’6or less than IO"7

[0157] In certain embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.

[0158] In certain embodiments, provided herein is a blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.

[0159] In certain embodiments, all of the nucleotides of the blocking oligonucleotide are LNAs.

[0160] In certain embodiments, a DNA binding fluorophore is added to the mixture.

[0161] In certain embodiments, the DNA binding fluorophore is sybr green.

[0162] In certain embodiments, an oligonucleotide probe is added to the mixture.

[0163] The following Examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter. EXAMPLE 1

[0164] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.

[0165] DNA for KRAS wild-type (catalog HD710) and KRAS G12C (catalog HD269) were purchased from Horizon Discovery. KRAS G12C (catalog HD269) is heterozygous for the KRAS G12C mutation, so only 50% of the DNA copies contain the KRAS G12C mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).

[0166] The KRAS wild-type sequence is provided by SEQ ID NO:1 :

[0167] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAAC (SEQ ID NO: 1)

[0168] The KRAS G12C sequence is provided by SEQ ID NO:2 and includes a G~>t transversion: GACTGAATATAAACTTGTGGTAGTTGGAGCTtGTGGCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAAC (SEQ ID NO:2)

[0169] Primers were designed as follows:

[0170] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG

[0171] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC

[0172] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:

[0173] Oligonucleotide Blocker (SEQ ID NO: 5):

[0174] +A+C+G+C+C+A+C+C+A+G+C+T

[0175] The total reaction volume of 50 pl was prepared as follows:

[0176] 1stForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)

[0177] 1stReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock) Blocker: 0.1 pM (working concentration (1 pl of 5 pM stock)

[0178] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)

[0179] Water (20 pl)

[0180] Sample (2 pl)

[0181] Sample 1 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 1 was 100% KRAS wild-type.

[0182] Sample 2 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G12C (catalog HD269). Sample 2 was approximately 0.5% KRAS G12C.

[0183] Sample 3 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G12C (catalog HD269). Sample 3 was approximately 0.05% KRAS G12C.

[0184] Sample 4 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G12C (catalog HD269). Sample 4 was approximately 0.005% KRAS G12C.

[0185] Sample 5 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G12C (catalog HD269). Sample 5 was approximately 0.0005% KRAS G12C.

[0186] Sample 6 contained 2 pl of water.

[0187] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.

[0188] The PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 1A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).

[0189] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).

[0190] Samples 1, 4, 5 and 6 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262).

[0191] Samples 2 and 3 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262).

[0192] A second PCR was performed on the amplified first PCR product.

[0193] 2ndForward Primer (SEQ ID NO: 6):

[0194] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGTGG

[0195] TAG

[0196] 2ndReverse Primer (SEQ ID NO:7): GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTGGATCATATTCGTCCAC

[0197] The total reaction volume of 50 pl was prepared as follows:

[0198] 2ndForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)

[0199] 2ndReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)

[0200] Purified PCR product (2 pl)

[0201] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)

[0202] Water (21 pl)

[0203] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).

[0204] Sample 3 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. IB).

[0205] Sample 3 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 1C).

[0206] FIG. 1 A illustrates the results of the agarose gel. Samples 1 to 6 were in lanes 1 to 6 respectively. FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C. FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.

[0207] EXAMPLE 2

[0208] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant was the KRAS G13D mutation, known to be associated with or present in some cancers.

[0209] DNA for KRAS wild-type (catalog HD710) and KRAS G13D (catalog HD270) were purchased from Horizon Discovery. KRAS G13D (catalog HD270) is heterozygous for the KRAS G13D mutation, so only 50% of the DNA copies contain the KRAS G13D mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).

[0210] The KRAS wild-type sequence is provided by SEQ ID NO: 1.

[0211] The KRAS G13D sequence is provided by SEQ ID NO:8 and includes a G- a transition: GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGaCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAAC (SEQ ID NO: 8) The total reaction volume of 50 pl was prepared as follows:

[0212] 1stForward primer (SEQ ID NO:3): 0.1 pM working concentration (1 pl of 5 pM stock) 1stReverse primer (SEQ ID NO:4): 0.1 pM working concentration (1 pl of 5 pM stock) Oligonucleotide Blocker (SEQ ID NO:5): 0.1 pM (working concentration (1 pl of 5 pM stock)

[0213] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)

[0214] Water (20 pl)

[0215] Sample (2 pl)

[0216] Sample 7 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 7 contained 100% KRAS wild-type.

[0217] Sample 8 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G13D (catalog HD270). Sample 8 was approximately 0.5% KRAS G13D.

[0218] Sample 9 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G13D (catalog HD270). Sample 9 was approximately 0.05% KRAS G13D.

[0219] Sample 10 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G13D (catalog HD270). Sample 10 was approximately 0.005% KRAS G13D.

[0220] Sample 11 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G13D (catalog HD270). Sample 11 was approximately 0.0005% KRAS G13D.

[0221] Sample 12 contained 2 pl of water.

[0222] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.

[0223] The PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 2A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).

[0224] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).

[0225] Samples 7, 11 and 12 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262). Samples 8, 9 and 10 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262).

[0226] A second PCR was performed on the amplified first PCR product. The total reaction volume of 50 pl was prepared as follows:

[0227] 2ndForward primer (SEQ ID NO:6): 0.1 pM working concentration (1 pl of 5 pM stock) 2ndReverse primer (SEQ ID NO:7): 0.1 pM working concentration (1 pl of 5 pM stock) Purified PCR product (2 pl)

[0228] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)

[0229] Water (21 pl)

[0230] Sample 10 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 2B).

[0231] Sample 9 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 2C).

[0232] FIG. 2A illustrates the results of the agarose gel. Samples 7 to 12 were in lanes 1 to 6 respectively. FIG. 2B illustrates the results of the Sanger sequencing run for Sample 10, which contained approximately 0.005% KRAS G13D. FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.

[0233] EXAMPLE 3

[0234] This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G12C). In this example the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.

[0235] The setup was the same as described in Example 1, with only a modification to the first PCR protocol.

[0236] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds.

[0237] Sample 13 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 13 was 100% KRAS wild-type. Sample 14 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G12C (catalog HD269). Sample 14 was approximately 0.5% KRAS G12C.

[0238] Sample 15 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G12C (catalog HD269). Sample 15 was approximately 0.05% KRAS G12C.

[0239] Sample 16 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G12C (catalog HD269). Sample 16 was approximately 0.005% KRAS G12C.

[0240] Sample 17 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G12C (catalog HD269). Sample 17 was approximately 0.0005% KRAS G12C.

[0241] Sample 18 contained 2 pl of water.

[0242] Samples 13, 14, 15, 16 and 17 contained enough DNA for Sanger sequencing. Samples 13, 16 and 17 contained the wild-type sequence. Samples 14 and 15 contained the target KRAS G12C sequence.

[0243] FIG. 3A illustrates the results of the agarose gel. Sample 13 to 18 were in lanes 1 to 6 respectively. FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.

[0244] EXAMPLE 4

[0245] This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G13D). In this example the low frequency variant is the KRAS G13D mutation, known to be associated with or present in some cancers.

[0246] The setup was the same as described in Example 2, with only a modification to the first PCR protocol.

[0247] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds. Sample 19 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 19 contained 100% KRAS wild-type.

[0248] Sample 20 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G13D (catalog HD270). Sample 20 was approximately 0.5% KRAS G13D.

[0249] Sample 21 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G13D (catalog HD270). Sample 21 was approximately 0.05% KRAS G13D.

[0250] Sample 22 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G13D (catalog HD270). Sample 22 was approximately 0.005% KRAS G13D.

[0251] Sample 23 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G13D (catalog HD270). Sample 23 was approximately 0.0005% KRAS G13D.

[0252] Sample 24 contained 2 pl of water.

[0253] Samples 19, 20, 21, 22 and 23 contained enough DNA for Sanger sequencing. Samples 19, 22 and 23 contained the wild-type sequence. Samples 20 and 21 contained the target KRAS G13D sequence.

[0254] FIG. 4A illustrates the results of the agarose gel. Samples 19 to 24 were in lanes 1 to 6 respectively. FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.

[0255] Although the foregoing specification and examples fully disclose and enable the present invention, they are not intended to limit the scope of the invention, which is defined by the claims appended hereto.

[0256] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention. The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0257] When used in this specification and the claims as an adverb rather than a preposition, "about" means "approximately" and comprises the stated value and every non-negative value within 10% of that value; in other words, "about 100%" includes 90% and 110% and every value in between.

[0258] Unless stated otherwise, every range or interval includes both endpoints and every value in between.

[0259] The invention has been described as “comprising” certain steps and / or elements, which those of skill in the art also “consist of’ or “consist essentially of’ those steps and / or elements. As used herein, the transitional term “comprising” is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. Where the invention is intended to be more narrowly defined, the terms “consisting of’ or “consisting essentially of’ also are used to describe the invention. As used herein, the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of’ limits the scope of a claim to the specified elements or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, a claim reciting “consisting essentially of’ occupies a middle ground between closed claims reciting a “consisting of’ format and fully open claims that recite “comprising.” Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A method for enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product, the method comprising the steps of:(a) preparing a reaction mixture comprising:(i) the sample;(ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;(iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;(iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a doublestranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;(b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;(c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;(d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to unblocked reference polynucleotide, if present, and the target polynucleotide;(e) extending the primers hybridized to the unblocked reference polynucleotide, if present, or target polynucleotide; and(f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide.

2. The method of claim 1, wherein the DNA polymerase is a high-fidelity DNA polymerase that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.

3. The method of claim 1 or claim 2, wherein the DNA polymerase has an error rate of less than 10‘5.

4. The method of claim 1 or claim 2, wherein the DNA polymerase has an error rate of less than 10‘6.

5. The method of claim 1 or claim 2, wherein the DNA polymerase has an error rate of less than IO"76. The method of any one of claims 1-5, wherein the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.

7. The method of any one of claims 1-6, wherein the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.

8. The method of claim 7, wherein all of the nucleotides of the blocking oligonucleotide are LNAs.

9. The method of any one of claims 1-8, wherein the blocking oligonucleotide has a length of between 8 and 20 nucleotides.

10. The method of any one of claims 1-8, wherein the blocking oligonucleotide has a length of between 10 and 15 nucleotides.

11. The method of any one of claims 1-10, wherein the genetic alteration comprises a substitution.

12. The method of any one of claims 1-10, wherein the genetic alteration comprises a deletion.

13. The method of any one of claims 1-10, wherein the genetic alteration comprises an insertion.

14. The method of any one of claims 1-13, wherein the sample is a liquid biopsy (LB).

15. The method of claim 14, wherein the liquid biopsy is a biological fluid.

16. A method for detecting a double-stranded target polynucleotide in a sample, the method comprising the steps of :(a) preparing a reaction mixture comprising:(i) the sample;(ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;(iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;(iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a doublestranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;(b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;(c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;(d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide;(e) extending the primers hybridized to the target polynucleotide;(f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide; and(g) contacting the target polynucleotide with a detection agent.

17. The method of claim 16, wherein the detection agent is a DNA binding fluorophore or a probe.

18. A kit for enriching a double-stranded target polynucleotide comprising a genetic alteration in a sample, comprising:(a) a DNA polymerase that lacks 5 '3 ' nuclease activity;(b) a blocking oligonucleotide that hybridizes selectively to a reference polynucleotide and not to the target polynucleotide;(c) a pair of primers that flank the genetic alteration and does not overlap with the blocking oligonucleotide;(d) instructions that include the steps comprising:(i) preparing a reaction mixture comprising:(1) the sample;(2) a DNA polymerase that lacks 5'- 3 ' nuclease activity;(3) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;(4) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a double-stranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;(ii) increasing the temperature of the reaction mixture above the melting temperatures of a double stranded reference polynucleotide and the double stranded target polynucleotide;(iii) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;(iv) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide; and(v) extending the primers hybridized to the target polynucleotide.

19. A method for replicating a reference polynucleotide after enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product, the method comprising the steps of:(a) preparing a reaction mixture comprising:(i) the sample;(ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity;(iii) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide and not to the target polynucleotide;(iv) a pair of primers that flank the genetic alteration and do not interfere with the hybridization of the blocking oligonucleotide, wherein the sample comprises the double-stranded target polynucleotide and a doublestranded reference polynucleotide, wherein the target polynucleotide has a genetic alteration relative to the reference polynucleotide;(b) increasing the temperature of the reaction mixture above the melting temperatures of the double stranded reference polynucleotide and the double stranded target polynucleotide;(c) reducing the temperature of the reaction mixture to a temperature that is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but is above the melting temperature of the primer oligonucleotide, wherein the blocking oligonucleotide and the reference polynucleotide form a blocking duplex;(d) reducing the temperature of the reaction mixture, wherein the primer pair hybridizes to the target polynucleotide;(e) extending the primers hybridized to the target polynucleotide;(f) repeating steps (b) through (e) for two or more cycles so as to enrich the target polynucleotide; and(g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate the reference polynucleotide and the target polynucleotide.

20. The method of claim 19, wherein the DNA polymerase is a high-fidelity DNA polymerase which that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.

21. The method of claim 19 or 20, wherein the DNA polymerase has an error rate of less than 10‘5.

22. The method of claim 19 or 20, wherein the DNA polymerase has an error rate of less than 10‘6.

23. The method of claim 19 or 20, wherein the DNA polymerase has an error rate of less than 10‘7.

24. The method of any one of claims 19-23, wherein the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.

25. The method of claim 24, wherein the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.

26. The method of claim 25, wherein all of the nucleotides of the blocking oligonucleotide are LNAs.

27. The method of any one of claims 19-26, wherein a DNA binding fluorophore is added to the mixture.

28. The method of claim 27, wherein the DNA binding fluorophore is sybr green.

29. The method of any one of claims 19-28, wherein an oligonucleotide probe is added to the mixture.

Images