Methods for altering gene expression for genetic disorders

Abstract

To provide methods for altering gene expression for genetic disorders.SOLUTION: The invention provides methods and compositions for modifying the expression of endogenous genes or modifying a coding sequence of endogenous genes using rare-cutting endonucleases and transposases. In one aspect, the methods described herein provide novel approaches for treating gain-of-function disorders, where the pathogenic allele(s) and non-pathogenic allele(s) are silenced, and protein expression is replaced using a silencing-resistant coding sequence.SELECTED DRAWING: None

Description

[Technical field]

[0001] REFERENCE TO RELATED APPLICATIONS This application claims priority to earlier and copending applications USSN 62 / 754,548, filed November 1, 2018, USSN 62 / 755,755, filed November 5, 2018, USSN 62 / 756,175, filed November 6, 2018, and USSN 62 / 799,615, filed January 31, 2019, the contents of each of which are incorporated by reference in their entirety herein.

[0002] Sequence Listing This application contains a Sequence Listing that was submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy is named SEQ_LISTING_BA2018-5_P12988, created on October 29, 2019, and is 507,904 bytes in size.

[0003] This document is in the field of genome editing and gene therapy. More specifically, this document relates to targeted modification of endogenous genes or reduction of endogenous gene expression along with gene expression from a transgene. [Background technology]

[0004] Monogenic disorders are caused by one or more mutations in a single gene, examples of which include sickle cell disease (hemoglobin-β gene), cystic fibrosis (cystic fibrosis transmembrane conductance regulator gene), and Tay-Sachs disease (β-hexosaminidase A gene). Monogenic disorders have generated increased interest in gene therapy because replacing the defective gene with a functional copy may provide therapeutic benefit. However, one impediment to generating effective therapies is the size of the functional copy of the gene. Many delivery methods, including those using viruses, have size limitations that prevent the delivery of large transgenes. In addition, many genes have alternative splicing patterns that result in a single gene that codes for multiple proteins. Methods to correct regions of the defective gene may provide additional avenues for treating monogenic disorders. Summary of the Invention [Means for solving the problem]

[0005] Although gene editing holds promise for correcting mutations found in inherited disorders, many challenges remain in creating effective therapies for individual disorders, including those caused by gain-of-function mutations or those requiring precise repair. These challenges are seen in disorders such as spinocerebellar ataxia 2 and Parkinson's disease, which are associated with gain-of-function mutations.

[0006] In one aspect, the methods described herein provide a novel approach to treat gain-of-function disorders, where the pathogenic allele(s) and non-pathogenic allele(s) are silenced and protein expression is replaced using a silencing-resistant coding sequence. These methods can be used for genes that produce one or more isoforms. In one embodiment, a rare-cutting endonuclease or transposon can be used to incorporate a transgene containing a silencing sequence and a silencing-resistant full or partial coding sequence into an endogenous gene (Figures 12-17). When the transgene contains a silencing-resistant partial coding sequence, the transgene can further contain a splice acceptor or splice donor operably linked to the partial coding sequence. The transgene can further contain a promoter operably linked to the silencing-resistant coding sequence (when targeting the 5' region of the gene) or a terminator operably linked to the silencing-resistant coding sequence (when targeting the 3' region of the gene). Gain-of-function mutations are found in HD (Huntington's disease), SBMA (Spinal and bulbar muscular atrophy), SCA1 (Spinocerebellar ataxia type 1), SCA2 (Spinocerebellar ataxia type 2), SCA3 (Spinocerebellar ataxia type 3 or Machado-Joseph disease), SCA6 (Spinocerebellar ataxia type 6), SCA7 (Spinocerebellar ataxia type 7), Fragile X syndrome, Fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy type 1, myotonic dystrophy type 2, and spinocerebellar muscular atrophy (SCA). The mutation may result in a disease selected from the group consisting of spinocerebellar ataxia type 8, spinocerebellar ataxia type 12, spinal-bulbar muscular atrophy, JPH3, amyotrophic lateral sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow channel congenital myasthenic syndrome, PRPS1 overactivity, Parkinson's disease, tubule aggregate myopathy, achondroplasia, rubus X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa.

[0007] In another aspect, the methods described herein provide a novel approach to correct mutations found at the 5' end of genes. The methods are based in part on the design of a bimodule, bidirectional transgene that is compatible with integration through multiple repair pathways. The transgenes described herein can be integrated into genes by the homologous recombination (HR) pathway, the non-homologous end joining (NHEJ) pathway, or both homologous recombination and non-homologous end joining pathways, or through transposition. Furthermore, the outcome of integration in any case (HR, NHEJ forward, NHEJ reverse, forward transposition, or reverse transposition) can result in precise correction / modification of the protein product of the target gene. The transgenes described herein can be used to fix or introduce mutations in the 5' region of a gene of interest. These methods are particularly useful when precise editing of a gene is required or when the mutated endogenous gene being targeted cannot be "replaced" by a synthetic copy because it exceeds the size capacity of standard or viral vectors. The methods described herein can be used for applied research (eg, gene therapy) or basic research (eg, creating animal models or understanding gene function).

[0008] The methods described herein are compatible with current in vivo delivery vehicles (e.g., adeno-associated viral vectors and lipid nanoparticles) and address several challenges by achieving precise modification of gene products, particularly those with gain-of-function mutations and those that produce multiple isoforms.

[0009] In one embodiment, this document features a method for integrating a transgene into an endogenous gene. The method can include delivery of a transgene, the transgene carrying a first and second splice donor sequence, a first and second coding sequence, and one bidirectional promoter, or a first and second promoter (Figure 1). In another aspect, the transgene can also include a first and a second terminator. In some embodiments, the first and second terminators can be replaced with a single bidirectional terminator. The method further includes administering a rare-cutting endonuclease that targets a site within the endogenous gene. The method results in the transgene being integrated with the endogenous gene, and regardless of orientation (e.g., forward or reverse), the integration will result in precise modification of the amino acid sequence of the protein produced from the endogenous gene (Figures 3 and 4). The method can include the use of any suitable rare-cutting endonuclease, including CRISPR, TAL effector nuclease, zinc finger nuclease, or meganuclease. The rare-cutting endonuclease can target a sequence within an intron or exon of an endogenous gene. The endogenous gene can include an ATXN2 gene, and the rare-cutting endonuclease can target intron 1 or exon 1 of the ATXN2 gene. In some embodiments, the CRISPR nuclease can be a CRISPR / Cas12a nuclease or a CRISPR / Cas9 nuclease. In other embodiments, the first and second coding sequences can code for a reporter gene, a purification tag, or an amino acid that is homologous to an amino acid encoded by an endogenous gene. The first and second coding sequences code for the same amino acid by possessing the same nucleic acid sequence or by possessing different nucleic acid sequences (e.g., using codon degeneracy). The transgene can be synthesized on a viral vector (e.g., an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector), or the transgene can be synthesized on a non-viral vector.The embodiments described above can result in targeted integration of the transgene in either the forward or reverse orientation, while both products still produce the desired result.

[0010] In one embodiment, this document features a method for integrating a transgene into an endogenous gene. The method may include delivery of a transgene, the transgene carrying a first and / or second homology arm, a first and second rare-cutting endonuclease target site, a first and second promoter or one bidirectional promoter, a first and second splice donor sequence, a first and second coding sequence, and optionally a first and second terminator. In some embodiments, the first and second terminators can be replaced with a single bidirectional terminator. The method further includes administering a rare-cutting endonuclease that targets a site in the endogenous gene and two sites in the transgene. The method results in the transgene being integrated with the endogenous gene, and regardless of orientation (e.g., forward or reverse), the integration will result in a precise modification of the amino acid sequence of the protein produced from the endogenous gene. The method can include the use of any suitable rare-cutting endonuclease, including CRISPR, TAL effector nuclease, zinc finger nuclease, or meganuclease. The rare-cutting endonuclease can target a sequence within an intron or exon of an endogenous gene. The endogenous gene can include an ATXN2 gene, and the rare-cutting endonuclease can target intron 1 or exon 1 of the ATXN2 gene. In some embodiments, the CRISPR nuclease can be a CRISPR / Cas12a nuclease or a CRISPR / Cas9 nuclease. In other embodiments, the first and second coding sequences can code for a reporter gene, a purification tag, or an amino acid that is homologous to an amino acid encoded by an endogenous gene. The first and second coding sequences code for the same amino acid by possessing the same nucleic acid sequence or by possessing different nucleic acid sequences (e.g., using codon degeneracy). The transgene can be synthesized on a viral vector (e.g., an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector), or the transgene can be synthesized on a non-viral vector.The embodiments described above can result in targeted integration of the transgene in either the forward or reverse orientation, while both products still produce the desired result.

[0011] In further embodiments, this document features a double-stranded polynucleotide. The double-stranded polynucleotide can include a first and a second splice donor sequence, a first and a second coding sequence, a bidirectional promoter, or a first and a second promoter. The double-stranded polynucleotide can further include a first and / or a second homologous arm, a first and a second rare-cutting endonuclease target site, and a first and a second terminator. In some embodiments, the first and the second terminator can be replaced with a single bidirectional terminator. The coding sequences on the double-stranded polynucleotide can be in a reverse complementary orientation. The coding sequences can code for the same amino acid sequence. The coding sequences can be composed of the same nucleotide sequence, or different nucleic acid sequences (e.g., due to codon degeneracy). The first and the second promoters can be in a reverse complementary orientation to each other.

[0012] In a further embodiment, this document features a method of integrating a transgene into ATXN2. The method may include administering a polynucleotide encoding a rare-cutting endonuclease that targets a site in the ATXN2 gene and a transgene that is integrated into the ATXN2 gene after cleavage by the rare-cutting endonuclease. In another embodiment, the rare-cutting endonuclease may be delivered in the form of a protein (e.g., Cas9 or Cas12a protein, or TALEN protein), or a ribonucleoprotein complex (e.g., Cas9 or Cas12a together with the corresponding gRNA). The transgene may be integrated into cells including induced pluripotent stem cells, Purkinje cells, granule cells, neuronal cells, or glial cells. The transgene integrated into the ATXN2 gene may carry the coding sequence of exon 1 of the ATXN2 gene. The transgene may be integrated into intron 1 or exon 1 of the ATXN2 gene. The transgene may further include a promoter upstream of the coding sequence. The integration of the transgene can be promoted by using any suitable rare-cutting endonuclease, including CRISPR, TAL effector nuclease, zinc finger nuclease, or meganuclease.The transgene can be synthesized on a viral vector (e.g., adenoviral vector, adeno-associated viral vector, or lentiviral vector).Alternatively, the transgene can be synthesized on a non-viral vector.

[0013] In another embodiment, this document features a method of modifying expression of an endogenous gene, the method comprising administering a transgene, the transgene comprising a first and a second promoter, or a bidirectional promoter, a first nucleic acid sequence that reduces expression of the endogenous gene, and a second nucleic acid sequence that encodes a protein having homology to a protein produced by the endogenous gene. The second nucleic acid sequence may comprise a different nucleic acid sequence compared to the first nucleic acid sequence (e.g., due to codon degeneracy or lack of sequence). The transgenes described herein may further comprise a first and a second terminator operably linked to the first and the second nucleic acid sequences. The transgene may be used when at least one allele comprises a gain-of-function mutation. Gain-of-function mutations are found in HD (Huntington's disease), SBMA (Spinal and bulbar muscular atrophy), SCA1 (Spinocerebellar ataxia type 1), SCA2 (Spinocerebellar ataxia type 2), SCA3 (Spinocerebellar ataxia type 3 or Machado-Joseph disease), SCA6 (Spinocerebellar ataxia type 6), SCA7 (Spinocerebellar ataxia type 7), Fragile X syndrome, Fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy type 1, myotonic dystrophy type 2, and spinocerebellar muscular atrophy (SCA). The mutation may result in a disease selected from the group consisting of myelocerebellar ataxia type 8, spinocerebellar ataxia type 12, spinal-bulbar muscular atrophy, JPH3, amyotrophic lateral sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow channel congenital myasthenic syndrome, PRPS1 overactivity, Parkinson's disease, tubule aggregate myopathy, achondroplasia, rubus X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa. The transgene may be carried on a viral vector, including an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. The transgene may be 4.7 kb or less in size. The transgene may be on a non-viral vector. The transgene may be integrated into the genome of the cell.

[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention pertains.The present invention can be carried out using methods and materials similar or equivalent to those described herein, but the preferred methods and materials are described below.All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will take precedence.In addition, the materials, methods, and examples are merely illustrative and are not intended to be limiting.

[0015] The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will become apparent from the description and the claims. In an embodiment of the present invention, for example, the following items are provided: (Item 1) 1. A method for integrating a transgene into an endogenous gene, comprising: a. administering a transgene, said transgene comprising: i. first and second splice donor sequences, ii. a first and a second partial coding sequence; and iii. administering a transgene comprising a bidirectional promoter, or a first and a second promoter; administering at least one rare-cutting endonuclease that targets a site within the endogenous gene; The method, wherein the transgene is integrated into the endogenous gene. (Item 2) 2. The method of claim 1, wherein the first splice donor is operably linked to the first partial coding sequence and the second splice donor is operably linked to the second partial coding sequence. (Item 3) 3. The method of claim 2, wherein the first partial coding sequence is operably linked to the first promoter and the second partial coding sequence is operably linked to the second promoter. (Item 4) 3. The method of claim 2, wherein the first and second partial coding sequences are operably linked to a bidirectional promoter. (Item 5) 4. The method of claim 3, wherein the first and second splice donors, the first and second partial coding sequences, and the first and second promoters are oriented in a head-to-head orientation. (Item 6) 6. The method of claim 5, wherein the transgene further comprises first and second target sites for one or more rare-cutting endonucleases, the target sites flanking the first and second splice donors. (Item 7) 6. The method of claim 5, wherein the transgene further comprises first and second homology arms flanking the first and second splice donors. (Item 8) 6. The method of claim 5, wherein the transgene is carried in an adeno-associated virus vector. (Item 9) 8. The method of claim 7, wherein the transgene further comprises first and second target sites for the one or more rare-cutting endonucleases, the target sites flanking the first and second splice donors. (Item 10) 10. The method of claim 9, wherein the first and second target sites are flanked by the first and second homology arms. (Item 11) 2. The method of claim 1, wherein the transgene is integrated within an intron or at an exon-intron junction of the endogenous gene. (Item 12) 2. The method of claim 1, wherein the transgene is integrated within an intron or at an exon-intron junction of the ATXN2 or SNCA gene. (Item 13) 13. The method of claim 12, wherein the transgene comprises first and second partial coding sequences encoding a peptide produced by exon 1 of the non-pathogenic ATXN2 gene. (Item 14) 13. The method of claim 12, wherein the transgene comprises first and second partial coding sequences encoding a peptide produced by exon 2 of the non-pathogenic SNCA gene. (Item 15) 2. The method of claim 1, wherein the nuclease is a CRISPR / Cas12a nuclease or a CRISPR / Cas9 nuclease. (Item 16) 2. The method of claim 1, wherein the first and second partial coding sequences encode the same amino acid. (Item 17) 2. The method of claim 1, wherein the first and second coding sequences differ in nucleic acid sequence but encode the same amino acid. (Item 18) 2. The method according to item 1, wherein the transgene is carried in a vector, and the form of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. (Item 19) 20. The method of claim 18, wherein the viral vector is selected from an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. (Item 20) 20. The method of claim 19, wherein the transgene is 4.7 kb or less. (Item 21) 2. The method of claim 1, wherein the endogenous gene is a wild-type gene of the partial coding sequence. (Item 22) 22. The method of claim 21, wherein the endogenous gene is abnormal or pathogenic and the partial coding sequence encodes a partial protein produced from a functional version of the endogenous gene. (Item 23) 23. The method of claim 22, wherein the first and second partial coding sequences differ in nucleic acid sequence compared to the corresponding endogenous genes. (Item 24) 2. The method of claim 1, wherein the endogenous gene is selected from SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72. (Item 25) 2. The method of claim 1, wherein the transgene further comprises a first and a second terminator. (Item 26) 1. A method for integrating a transgene into an endogenous gene, comprising: a. administering a transgene, said transgene comprising: i. a splice donor sequence, ii. a partial coding sequence; iii. promoter; iv. one RNA interference cassette, and v. administering a transgene, optionally including a first and second homology arm or left and right transposon ends; b. administering at least one rare-cutting endonuclease or transposase that targets a site within the endogenous gene; The method, wherein the transgene is integrated into the endogenous gene. (Item 27) 1. A method for integrating a transgene into an endogenous gene, comprising: a. administering a transgene, said transgene comprising: i. Left and right transposon ends, ii. a first and a second splice donor sequence; iii. a first and a second partial coding sequence; iv. one bidirectional promoter, or a first and a second promoter, and v. administering a transgene, optionally including a first and a second terminator; b. administering a transposase; The method, wherein the transgene is integrated into the endogenous gene. (Item 28) 1. A method for integrating a transgene into an endogenous gene, comprising: a. administering a transgene, said transgene comprising: i. a splice acceptor sequence, ii. a partial coding sequence; iii. Terminator, and iv. one RNA interference cassette, and v. administering a transgene, optionally including first and second homology arms, or left and right transposon ends; b. administering at least one rare-cutting endonuclease or transposase that targets a site within the endogenous gene; The method, wherein the transgene is integrated into the endogenous gene. [Brief description of the drawings]

[0016] [Figure 1] 1 is a diagram of an exemplary transgene for targeted insertion into an endogenous gene and repair of the 5' end: TS1: target site 1, SD1: splice donor site 1, CDS1: coding sequence 1, P1: promoter 1, TS2: target site 2, SD2: splice donor site 2, CDS2: coding sequence 2, P2: promoter 2, HA1: homology arm 1, HA2: homology arm 2, T1: terminator 1, T2: terminator 2, AS1: additional sequence 1, AS2: additional sequence 2. [Diagram 2] Figure 1 shows the integration of a transgene into an intron of an exemplary gene. The transgene contains two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2), and two promoters. Integration proceeds via non-homologous end joining (NHEJ). ATG: start codon, TAA: stop codon [Diagram 3]1 shows an exemplary transgene integration into a gene. The transgene contains two homologous arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2), and two promoters. Integration proceeds via either homologous recombination (HR) or non-homologous end joining (NHEJ). [Figure 4] 1 shows an exemplary gene integration of a transgene. The transgene contains two homologous arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2), and two promoters. Integration proceeds via either homologous recombination (HR) or non-homologous end joining (NHEJ). [Diagram 5] 1 is a diagram of gene products produced after integration of the transgene described herein. When the first and second partial coding sequences in the transgene are homologous to the coding sequence of the endogenous gene, RNA hairpins and dsRNAs can be formed (top). When the first and second partial coding sequences are codon-adjusted to reduce homology to the coding sequence of the endogenous gene, RNA pairing can be reduced (bottom). T1: transcript 1, T2: transcript 2, T3: transcript 3, +1: RNA synthesis start site, S: sense, AntiS: antisense. [Figure 6] Diagram of exons 1 to 3 of the ATXN2 gene. The transgenes in pB1012-D1 and pBA1141 for integration into the ATXN2 gene are also shown. [Figure 7] FIG. 13. Diagram of the integration results of the transgene of pB1012-D1 or pBA1141 within the ATXN2 gene. [Figure 8] 1 shows the integration of a transgene into the exon of an exemplary gene. The transgene contains two homologous arms, two target sites for one or more rare-cutting endonucleases, two splice donor sequences, two coding sequences (1.1 and 1.2), and two promoters. Integration proceeds via either homologous recombination (HR) or non-homologous end joining (NHEJ). [Figure 9] 1 is a diagram of a transgene that includes a silencing sequence and a silencing-resistant coding sequence. Two scenarios are shown. Scenario 1 is a diagram of an approach to silence both alleles of an endogenous gene while producing a replacement of the WT protein. Scenario 2 is a diagram of an approach to silence two alleles while producing a replacement of the protein, one allele with a gain-of-function mutation and the other with the WT sequence. The silencing sequence can be an RNAi cassette. The silencing-resistant CDS can have a mutation in the silencing target sequence to prevent binding. Alternatively, the CDS can remove the sequence. [Figure 10] 1 shows the structure of a transgene for silencing SOD1 alleles in cells carrying a gain-of-function mutation in one allele. The transgene also contains codon regulatory sequences for expressing a replacement SOD1 protein. [Figure 11] FIG. 1 shows examples of transgene constructs for silencing and replacing the protein product of an exemplary endogenous gene. [Figure 12] 1 shows a general approach to silencing gain-of-function alleles while replacing protein production. A partial coding sequence with a mutation to prevent silencing by an RNAi cassette is integrated into a gene. When integrated into the 5' or 3' end of a gene, the results may be: Result 1: Silencing of the endogenous gene; Result 2: Modification of one of the alleles in the endogenous gene; Result 3: Production of a new protein from the integration event, where the mRNA is resistant to silencing and the protein product contains the same or different sequence as the original gene. [Figure 13]Schematic of transgene for silencing expression of endogenous gene and replacing protein production. CDS1 and CDS2 can be partial coding sequences of endogenous gene. CDS can contain mutations or sequences are omitted in the corresponding target of RNAi cassette. Target for integration can be within intron but after endogenous splice donor sequence of intron. Target for integration can also be at intron-exon junction. [Figure 14] Schematic of transgene for silencing expression of endogenous gene and replacing protein production. CDS1 and CDS2 can be the complete coding sequence of endogenous gene. CDS can contain mutation or exclude sequence in corresponding target of RNAi cassette. Target for integration can be within intron but after endogenous splice donor sequence of intron. Target for integration can also be at intron-exon junction. [Figure 15] Schematic diagram of transgene for silencing expression of endogenous gene and replacing protein production. CDS1 and CDS2 can be the complete coding sequence of endogenous gene. CDS can contain mutation or exclude sequence in corresponding target of RNAi cassette. Target for integration can be within exon. [Figure 16] Schematic of a transgene for silencing the expression of an endogenous gene and replacing protein production. CDS1 and CDS2 can be the complete coding sequence of the endogenous gene. The CDS can contain a mutation or exclude a sequence in the corresponding target of the RNAi cassette. The target for integration can be within the 5'UTR. The target for integration can be an intron within the 5'UTR region, but requires a splice acceptor operably linked to the CDS. [Figure 17]Schematic diagram of transgene for silencing expression of endogenous gene and replacing protein production.CDS1 and CDS2 can be partial coding sequences of endogenous gene.CDS can contain mutation or exclude sequence in corresponding target of RNAi cassette.Target of integration can be anywhere between start codon and stop codon, but not within endogenous splice acceptor or downstream of last endogenous splice acceptor. [Figure 18] 1 is an image of a gel detecting integration of a transgene described herein. 1: 1 kb ladder, 2: 3'HR junction of pBA1141 with expected size of 1594 bp, 3: 3'HR junction of pBA1141 with expected size of 1775 bp, 4: 3'HR junction of pBA1141 with expected size of 1775 bp, 5: 3'NHEJ reverse of pBA1141 with expected size of 2067 bp, 6: 3'NHEJ of pBA1142 with expected size of 813 bp. Forward junction, 7: 3'HR junction of pBA1143 with expected size of 1225bp, 8: 3'HR junction of pBA1143 with expected size of 1407bp, 9: 3'HR junction of pBA1143 with expected size of 1225bp, 10: 3'HR junction of pBA1143 with expected size of 1407bp, 11: 1kb ladder, 12: primers oNJB201+oNJB190 1: WT DNA control with primers oNJB202+oNJB191; 2: WT DNA control with primers oNJB197+oNJB191; 3: WT DNA control with primers oNJB202+oNJB211; 4: WT DNA control with primers oNJB202+oNJB211; 5: WT DNA control with primers oNJB202+oNJB211; 6: 1 kb ladder; 7: genomic DNA control with pBA1141+Cas9 transfection; 8: genomic DNA control with pBA1142 transfection; 9: genomic DNA control with pBA1143+Cas9 transfection; 10: genomic DNA control with pBA1141+Cas12a transfection; 11: genomic DNA control with pBA1142+Cas12a transfection; 12: genomic DNA control with pBA1143+Cas12a transfection; 13: WT DNA control with primers oNJB202+oNJB191; 14: WT DNA control with primers oNJB197+oNJB191; 15: WT DNA control with primers oNJB202+oNJB211; 16: 1 kb ladder; 17: genomic DNA control with pBA1141+Cas9 transfection; 18: genomic DNA control with pBA1142 transfection; 19: genomic DNA control with pBA1143+Cas9 transfection; 20: genomic DNA control with pBA1141+Cas12a transfection; 21: genomic DNA control with pBA1142+Cas12a transfection; 22: genomic DNA control with pBA1143+Cas12a transfection; 23: WT control; 24: DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] Methods and compositions are disclosed herein for modifying the coding sequence of endogenous genes.In some embodiments, the methods include inserting a transgene into an endogenous gene, the transgene providing a partial coding sequence that replaces the coding sequence of the endogenous gene.Also disclosed herein are methods and compositions for expressing a replacement protein and reducing the expression of endogenous genes.

[0018] In one embodiment, this document features a method of integrating a transgene into an endogenous gene and modifying the mRNA or protein product. The method includes administering a transgene, the transgene including a first and a second splice donor sequence, a first and a second partial coding sequence, a bidirectional promoter or a first and a second promoter, and optionally a first and a second terminator, the transgene being administered with at least one rare-cutting endonuclease that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The endogenous gene may be in a eukaryotic cell, including a human cell. The transgene may have a first splice donor operably linked to the first partial coding sequence, and the second splice donor may be operably linked to the second partial coding sequence. Also, the first partial coding sequence may be operably linked to the first promoter, and the second partial coding sequence may be operably linked to the second promoter. Alternatively, the first and second partial coding sequences may be operably linked to a bidirectional promoter. The transgene having the first and second splice donors, the first and second partial coding sequences, and the first and second promoters may be oriented in a head-to-head orientation. These transgenes may be carried in an adeno-associated virus vector and integrated into an endogenous gene via NHEJ-mediated integration into a targeted double-stranded break. The transgene may further comprise a first and a second target site of one or more rare-cutting endonucleases, the target sites flanking the first and second splice donors. Alternatively, the transgene may further comprise left and right homologous arms flanking the first and second splice donors. The transgene may have both a first and a second target site of one or more rare-cutting endonucleases, the target sites flanking the first and second splice donors. The first and second target sites can be flanked by first and second homology arms.The transgene described in the method can be integrated within an intron or at an exon-intron junction of the endogenous gene.The endogenous gene may be ATXN2 or SNCA, and the site for integration may be within an intron or at an exon-intron junction of the ATXN2 or SNCA gene. When integrated into ATXN2, the transgene may include a first and a second partial coding sequence that encodes a peptide produced by exon 1 of the non-pathogenic ATXN2 gene. When integrated into SNCA, the transgene may include a first and a second partial coding sequence that encodes a peptide produced by exon 2 of the non-pathogenic SNCA gene. Integration may occur through the use of CRISPR / Cas12a nuclease or CRISPR / Cas9 nuclease. The first and the second partial coding sequence may encode the same amino acid. The first and the second coding sequence may differ in nucleic acid sequence (e.g., through codon degeneracy) but still encode the same amino acid. The transgene described in the present method may be carried in a vector, and the format of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene may be carried by a viral vector selected from an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. The transgene may have a total length of 4.7 kb or less. The method may include using a transgene having a partial coding sequence that encodes a peptide produced by a target endogenous gene. The partial coding sequence may be a WT version of the target endogenous gene, and the target endogenous gene may be an abnormal gene, or a gene that contains a pathogenic mutation. The host gene is, in one embodiment, a gene in which the expression of a protein is abnormal, in other words, the protein is not expressed, is expressed at a lower or higher level than a functional protein, or is expressed such that the protein or a portion thereof is non-functional and causes a disorder in the host. The transgene used in this method may have a first and a second partial coding sequence that differ in nucleic acid sequence compared to the corresponding endogenous gene. In other words, the partial coding sequence may be modified (through codon degeneracy) to have minimal homology to the endogenous gene.The method can be used to modify genes involved in gain-of-function disorders including SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0019] In another embodiment, this document features a method of integrating a transgene into an endogenous gene and modifying an mRNA or protein product. The method includes administering a transgene, the transgene including left and right transposon ends, a first and second splice donor sequence, a first and second partial coding sequence, a bidirectional promoter or a first and second promoter, and optionally a first and second terminator, the transgene being administered with at least one transposase that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The endogenous gene may be in a eukaryotic cell, including a human cell. The transgene may have a first splice donor operably linked to the first partial coding sequence, and the second splice donor may be operably linked to the second partial coding sequence. Also, the first partial coding sequence may be operably linked to the first promoter, and the second partial coding sequence may be operably linked to the second promoter. Alternatively, the first and second partial coding sequences may be operably linked to a bidirectional promoter. The transgene with the first and second splice donors, the first and second partial coding sequences, and the first and second promoters may be oriented in a head-to-head orientation. The transgene may further comprise left and right transposon ends flanking the first and second splice donors. The transposase may be a CRISPR transposase, and the CRISPR transposase comprises a Cas12k or Cas6 protein. These transgenes may be carried in an adeno-associated virus vector. The transgene described in this method may be integrated into an intron or an exon-intron junction of an endogenous gene. The endogenous gene may be ATXN2 or SNCA, and the site for integration may be into an intron or an exon-intron junction of the ATXN2 or SNCA gene. When integrated into ATXN2, the transgene can include first and second partial coding sequences that encode a peptide produced by exon 1 of the non-pathogenic ATXN2 gene.When integrated into SNCA, the transgene can include a first and a second partial coding sequence that encodes a peptide produced by exon 2 of the non-pathogenic SNCA gene. The first and the second partial coding sequence can encode the same amino acid. The first and the second coding sequence can be different in nucleic acid sequence (e.g., through codon degeneracy), but still encode the same amino acid. The transgene described in the present method can be carried in a vector, and the form of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene can be carried in a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene can have a total length of 4.7 kb or less. The present method can include using a transgene having a partial coding sequence that encodes a peptide produced by a target endogenous gene. The partial coding sequence can be a WT version of the target endogenous gene, and the target endogenous gene can be an abnormal gene, or a gene containing a pathogenic mutation. The transgene used in this method can have a first and a second partial coding sequence that are different in nucleic acid sequence compared to the corresponding endogenous gene.In other words, the partial coding sequence can be modified (through codon degeneracy) to have minimal homology to the endogenous gene.This method can be used to modify the genes involved in gain-of-function disorders, including SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0020] This document also features a method of integrating a transgene into an endogenous gene and modifying an mRNA or protein product. The method includes administering a transgene, the transgene including a splice acceptor sequence, a partial coding sequence, a terminator, and an RNA interference cassette, the transgene being administered with at least one rare-cutting endonuclease or transposase that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The partial coding sequence can include a mutation that prevents silencing by the RNAi cassette. The endogenous gene can be in a eukaryotic cell, including a human cell. The transgene can have a splice acceptor operably linked to the partial coding sequence. Also, the partial coding sequence can be operably linked to a terminator. The endogenous gene can be in a eukaryotic cell, including a human cell. The transgene can have a splice acceptor operably linked to the partial coding sequence. Also, the partial coding sequence can be operably linked to a terminator. These transgenes can be carried in adeno-associated virus vectors and integrated into endogenous genes via integration into targeted double-strand breaks mediated by NHEJ or through homologous recombination. The transgene can further comprise left and right homologous arms. The transgene described in this method can be integrated into the intron or intron-exon junction of endogenous genes. The RNAi cassette can be a promoter operably linked to a sequence with homology to the endogenous gene. The RNAi cassette can generate shRNA or siRNA. The RNAi cassette can include a sequence with homology to the endogenous gene, and the partial coding sequence in the transgene can include the same sequence as the endogenous gene, but the target site of the RNAi cassette can be mutated to prevent silencing of expression by the integrated transgene (e.g., with synonymous single nucleotide polymorphism, insertion or deletion). Integration can occur through the use of CRISPR / Cas12a nuclease or CRISPR / Cas9 nuclease, or through the use of CRISPR-associated transposase.When a CRISPR-associated transposase is used, the transgene may include left and right transposon ends instead of homologous arms. The CRISPR-associated transase may include Cas6 protein or Cas12k protein. The transgene described in the method may be carried in a vector, and the format of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene may be carried in a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene may have a total length of 4.7 kb or less. The method may include using a transgene with a partial coding sequence that codes for a peptide produced by a target endogenous gene. The partial coding sequence may be a WT version of the target endogenous gene, and the target endogenous gene may be an abnormal gene or a gene containing a pathogenic mutation. The method can be used to modify genes involved in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0021] This document also features a method of integrating a transgene into an endogenous gene and modifying the mRNA or protein product. The method includes administering a transgene, the transgene comprising a splice acceptor sequence, a first and a second partial coding sequence, a terminator, and an RNA interference cassette, the transgene being administered with at least one rare-cutting endonuclease or transposase that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The first and second partial coding sequences can comprise a mutation that prevents silencing by the RNAi cassette. The endogenous gene can be in a eukaryotic cell, including a human cell. The transgene can have a first splice acceptor operably linked to the first partial coding sequence, and a second splice acceptor operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to a first terminator, and the second partial coding sequence can be operably linked to a second terminator. The partial coding sequence can be in tail-to-tail orientation, with an RNAi cassette between the two terminators. These transgenes can be carried in adeno-associated virus vectors and integrated into endogenous genes via NHEJ-mediated integration into targeted double-strand breaks or homologous recombination. The transgene can further comprise left and right homologous arms. The transgene described in this method can be integrated into an intron or an intron-exon junction of an endogenous gene. The RNAi cassette can be a promoter operably linked to a sequence that has homology to an endogenous gene. The RNAi cassette can generate shRNA or siRNA. RNAi cassette can contain sequences that are homologous to endogenous genes, and the partial coding sequence in transgene can contain the same sequence as endogenous genes, but the target site of RNAi cassette can be mutated to prevent silencing.Integration can occur through the use of CRISPR / Cas12a nuclease or CRISPR / Cas9 nuclease, or through the use of CRISPR-associated transposase.When CRISPR-associated transposase is used, the transgene may contain left and right transposon ends instead of homologous arms. CRISPR-associated transposase may contain Cas6 protein or Cas12k protein. The transgene described in the method may be carried in a vector, and the format of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene may be carried in a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene may have a total length of 4.7 kb or less. The method may include using a transgene with a partial coding sequence that codes for a peptide produced by a target endogenous gene. The partial coding sequence may be a WT version of the target endogenous gene, and the target endogenous gene may be an abnormal gene or a gene containing a pathogenic mutation. The method can be used to modify genes involved in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0022] This document also features a method of incorporating a transgene into an endogenous gene and modifying the mRNA or protein product. The method includes administering a transgene, the transgene including a splice donor sequence, a partial coding sequence, a promoter, and an RNA interference cassette, the transgene being administered with at least one rare-cutting endonuclease or transposase that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The partial coding sequence can include a mutation that prevents silencing by the RNAi cassette. For example, if the RNAi cassette is designed to target a sequence in a transcript produced by an endogenous gene, the partial coding sequence (found in the transgene) may include the same coding sequence as the endogenous gene and the corresponding RNAi target, thereby subjecting the modified endogenous gene to the same interference by the RNAi cassette. The partial coding sequence in the transgene can be mutated to minimize or prevent silencing of the modified endogenous gene. The endogenous gene can be in a eukaryotic cell, including a human cell. The transgene may have a splice donor operably linked to the partial coding sequence. The partial coding sequence may also be operably linked to a promoter. These transgenes may be carried in adeno-associated virus vectors and integrated into endogenous genes via NHEJ-mediated integration into targeted double-strand breaks or homologous recombination. The transgene may further comprise left and right homologous arms. The transgene described in the present method may be integrated into an intron or exon-intron junction of an endogenous gene. The RNAi cassette may be a promoter operably linked to a sequence with homology to the endogenous gene. The RNAi cassette may generate shRNA or siRNA. The RNAi cassette may comprise a sequence that is homologous to the endogenous gene, and the partial coding sequence in the transgene may comprise the same sequence as the endogenous gene, but the target site of the RNAi cassette may be mutated to prevent silencing.The endogenous gene may be ATXN2 or SNCA, and the site for integration may be within an intron or at an exon-intron junction of the ATXN2 or SNCA gene. When integrated into ATXN2, the transgene may include a partial coding sequence that encodes a peptide produced by exon 1 of the non-pathogenic ATXN2 gene. The RNAi cassette may be designed to target a transcribed sequence from exon 1 of the ATXN2 gene, and a corresponding sequence within the partial coding sequence may be mutated to prevent silencing. When integrated into SNCA, the transgene may include a partial coding sequence that encodes a peptide produced by exon 2 of the non-pathogenic SNCA gene. The RNAi cassette may be designed to target a transcribed sequence from exon 2 of the SNCA gene, and a corresponding sequence within the partial coding sequence may be mutated to prevent silencing. Integration may occur through the use of CRISPR / Cas12a nuclease or CRISPR / Cas9 nuclease, or through the use of a CRISPR-associated transposase. When CRISPR-associated transposase is used, the transgene may contain left and right transposon ends instead of homologous arms. CRISPR-associated transposase may contain Cas6 protein or Cas12k protein. The transgene described in the method may be carried in a vector, and the format of the vector is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene may be carried in a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene may have a total length of 4.7 kb or less. The method may include using a transgene with a partial coding sequence that codes for a peptide produced by a target endogenous gene. The partial coding sequence may be a WT version of the target endogenous gene, and the target endogenous gene may be an abnormal gene or a gene containing a pathogenic mutation.The method can be used to modify genes involved in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0023] This document also features a method of integrating a transgene into an endogenous gene and modifying the mRNA or protein product. The method includes administering a transgene, the transgene including a first and a second splice donor sequence, a first and a second partial coding sequence, a first and a second promoter (or a bidirectional promoter), and an RNA interference cassette, the transgene being administered with at least one rare-cutting endonuclease or transposase that targets a site in the endogenous gene, and the transgene being integrated into the endogenous gene. The partial coding sequence can include a mutation that prevents silencing by the RNAi cassette. The endogenous gene can be in a eukaryotic cell, including a human cell. The transgene can have a first splice donor operably linked to the first partial coding sequence and a second splice donor operably linked to the second partial coding sequence. Also, the first partial coding sequence can be operably linked to a first promoter, and the second partial coding sequence can be operably linked to a second promoter. The partial coding sequences can be in a head-to-head orientation, and the RNAi cassette can be placed between the first and second promoters. These transgenes can be carried in adeno-associated virus vectors and integrated into endogenous genes via NHEJ-mediated integration into targeted double-strand breaks or homologous recombination. The transgene can further comprise left and right homologous arms. The transgenes described in this method can be integrated into introns or exon-intron junctions of endogenous genes. The RNAi cassette can be a promoter operably linked to a sequence with homology to the endogenous gene. The RNAi cassette can generate shRNA or siRNA. The RNAi cassette can include a sequence that is homologous to the endogenous gene, and the partial coding sequence in the transgene can include the same sequence as the endogenous gene, but the target site of the RNAi cassette can be mutated to prevent silencing. The endogenous gene may be ATXN2 or SNCA, and the site for integration may be within an intron or at an exon-intron junction of the ATXN2 or SNCA gene.When integrated into ATXN2, the transgene can include a partial coding sequence that encodes a peptide produced by exon 1 of the non-pathogenic ATXN2 gene. The RNAi cassette can be designed to target the transcribed sequence from exon 1 of the ATXN2 gene, and the corresponding sequence in the partial coding sequence can be mutated to prevent silencing. When integrated into SNCA, the transgene can include a partial coding sequence that encodes a peptide produced by exon 2 of the non-pathogenic SNCA gene. The RNAi cassette can be designed to target the transcribed sequence from exon 2 of the SNCA gene, and the corresponding sequence in the partial coding sequence can be mutated to prevent silencing. Integration can occur through the use of CRISPR / Cas12a nuclease or CRISPR / Cas9 nuclease, or through the use with CRISPR-associated transposase. When CRISPR-associated transposase is used, the transgene can include left and right transposon ends instead of homologous arms. The CRISPR-associated transposition may include Cas6 protein or Cas12k protein. The transgene described in the method may be carried in a vector, and the format of the vector may be selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The transgene may be carried in a viral vector selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The transgene may have a total length of 4.7 kb or less. The method may include using a transgene having a partial coding sequence that encodes a peptide produced by a target endogenous gene. The partial coding sequence may be a WT version of the target endogenous gene, and the target endogenous gene may be an abnormal gene, or a gene that contains a pathogenic mutation. The transgene used in the method may have a first and a second partial coding sequence that differ in nucleic acid sequence compared to the corresponding endogenous gene. In other words, the partial coding sequence may be modified (through codon degeneracy) to have minimal homology to the endogenous gene.The method can be used to modify genes involved in gain-of-function disorders, including CACNA1A, ATXN3, SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, or C9orf72.

[0024] The practice of the method, in addition to the preparation and use of the compositions disclosed herein, employs conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields within the art, unless otherwise indicated. These techniques are fully described in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and the third edition of 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and the regularly updated series METHODS IN ENZYMOLOGY, Academic Press, San Francisco, CA, 1997. Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998, METHODS IN ENZYMOLOGY, Vol. 304, "Chromatin" (P M Wassarman and A P Wolfe, eds.), Academic Press, San Diego, 1999, and METHODS IN MOLECULAR BIOLOGY, Vol. 119, "Chromatin Protocols" (P B Becker, ed.) Humana Press, Totowa, 1999.

[0025] As used herein, the terms "nucleic acid" and "polynucleotide" can be used interchangeably. Nucleic acid and polynucleotide can refer to deoxyribonucleotide or ribonucleotide polymers in either linear or circular conformation and in single-stranded or double-stranded form. These terms should not be interpreted as limiting with respect to the length of the polymer. The term can encompass known analogues of natural nucleotides, as well as nucleotides that are modified at the base, sugar, and / or phosphate moiety.

[0026] The terms "polypeptide," "peptide," and "protein" may be used interchangeably to refer to both covalently linked amino acid residues. The term also applies to proteins in which one or more amino acids are chemical analogues or modified derivatives of the corresponding naturally occurring amino acids.

[0027] The terms "operatively linked" or "operably linked" are used interchangeably and refer to the proximity of two or more components (such as sequence elements) such that the components are positioned to allow both components to function normally and the possibility that at least one of the components may mediate the function of at least one of the other components. By way of illustration, a transcriptional regulatory sequence (e.g., a promoter) is operably linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulators. A transcriptional regulatory sequence is generally operably linked in cis with a coding sequence, but need not be directly adjacent to the coding sequence. For example, an enhancer is a transcriptional regulatory sequence operably linked to a coding sequence even though they are not contiguous.

[0028] As used herein, the term "cleavage" refers to the breakage of the covalent backbone of a nucleic acid molecule. Cleavage can be initiated by a variety of methods, including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Cleavage can refer to both single-stranded nicks and double-stranded breaks. Double-stranded breaks can result from two different single-stranded nicks. Nucleic acid cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, rare-cutting endonucleases are used for cleavage of target double-stranded or single-stranded DNA.

[0029] "Exogenous" molecules can refer to small molecules (e.g., sugars, lipids, amino acids, fatty acids, phenolic compounds, alkaloids), or macromolecules (e.g., proteins, nucleic acids, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides), or any modified derivatives of the above molecules, or any complex that is produced or present outside of a cell or that does not normally exist within a cell and includes one or more of the above molecules. Exogenous molecules can be introduced into cells. Methods for introducing exogenous molecules into cells include lipid-mediated delivery, electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran mediated delivery, and viral vector mediated delivery.

[0030] An "endogenous" molecule is a small molecule or macromolecule that is present in a particular cell at a particular developmental stage under particular environmental conditions. An endogenous molecule may be a nucleic acid, a chromosome, a mitochondrial, chloroplast or other organelle genome, or a naturally occurring episomal nucleic acid. Additional endogenous molecules may include proteins, such as transcription factors and enzymes.

[0031] As used herein, "gene" refers to the DNA region that codes for a gene product, including all DNA regions that regulate the production of the gene product.Thus, gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix binding sites, and locus control regions.

[0032] "Endogenous gene" refers to the region of DNA normally present in a particular cell that encodes a gene product, as well as all regions of DNA that regulate the production of the gene product.

[0033] "Gene expression" refers to the conversion of information contained in a gene into a gene product. A gene product can be a direct transcription product of a gene. For example, a gene product can be, but is not limited to, an mRNA, a tRNA, an rRNA, an antisense RNA, a ribozyme, a structural RNA, or a protein produced by translation of an mRNA. Gene products also include RNAs that are modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins that are modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0034] "Encoding" refers to the conversion of information contained in a nucleic acid into a product, which may result from the direct transcription product of a nucleic acid sequence. For example, the product may be, but is not limited to, an mRNA, a tRNA, an rRNA, an antisense RNA, a ribozyme, a structural RNA, or a protein produced by translation of an mRNA. Gene products also include RNA that is modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins that are modified, for example, by methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0035] A "target site" or "target sequence" is a nucleic acid sequence to which a binding molecule binds when sufficient conditions for binding exist, for example, when an endonuclease or transposase, including a rare-cutting endonuclease or a CRISPR-associated transposase, is present. A target site may be an endogenous gene, and may be native or heterologous to a cell.

[0036] As used herein, the term "recombination" refers to the process of exchange of genetic information between two polynucleotides. The term "homologous recombination (HR)" refers to a special form of recombination that can occur, for example, during repair of double-strand breaks. Homologous recombination requires nucleotide sequence homology present on a "donor" molecule. The donor molecule can be used by a cell as a template for repair of the double-strand break. Information in the donor molecule that differs from the genomic sequence at or near the double-strand break site can be stably integrated into the genomic DNA of the cell.

[0037] As used herein, the term "homologous" refers to a sequence of nucleic acid or amino acid that has similarity to a second sequence of nucleic acid or amino acid. In some embodiments, homologous sequences may have at least 80% sequence identity (e.g., 81%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) with each other.

[0038] A "target site" or "target sequence" defines a portion of a nucleic acid to which a rare-cutting endonuclease or a CRISPR-associated transposase binds when sufficient conditions for binding exist.

[0039] As used herein, the term "transgene" refers to a sequence of nucleic acid that can be transferred into an organism or cell. A transgene can include a gene or nucleic acid sequence that is not normally present in the target organism or cell. Additionally, a transgene can include a copy of a gene or nucleic acid sequence that is normally present in the target organism or cell. A transgene can be an exogenous DNA sequence that is introduced into the cytoplasm or nucleus of a target cell. In one embodiment, the transgenes described herein include a partial coding sequence, which encodes a portion of a protein produced by a gene in a host cell.

[0040] As used herein, the term "pathogenic" refers to anything that can cause disease. Pathogenic mutations can refer to modifications in genes that cause disease. Pathogenic genes refer to genes that contain modifications that cause disease. For example, the pathogenic ATXN2 gene in patients with spinocerebellar ataxia 2 refers to the ATXN2 gene with expanded CAG trinucleotide repeats, and the expanded CAG trinucleotide repeats cause disease.

[0041] The term "tail-to-tail" as used herein refers to the orientation of two units in opposite and reverse directions. The two units can be two sequences on a single nucleic acid molecule, with the 3' ends of each sequence being placed adjacent to each other. For example, a first nucleic acid having the elements [splice acceptor 1]-[partial coding sequence 1]-[terminator 1] and a second nucleic acid having the elements [splice acceptor 2]-[partial coding sequence 2]-[terminator 2] from 5' to 3' can be placed in tail-to-tail orientation, resulting in [splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC] (RC refers to reverse complement).

[0042] The term "head-to-head" as used herein refers to the orientation of two units in opposite and reverse directions. The two units can be two sequences on a single nucleic acid molecule, with the 5' ends of each sequence being arranged adjacent to each other. For example, from 5' to 3' direction, a first nucleic acid having an element: [promoter1]-[partial coding sequence1]-[splice donor1] and a second nucleic acid having an element: [promoter2]-[partial coding sequence2]-[splice donor2] can be arranged in a head-to-head orientation, resulting in [splice donor1RC]-[partial coding sequence1RC]-[promoter1RC][promoter2]-[partial coding sequence2]-[splice donor2] (RC refers to reverse complement).

[0043] As used herein, the term "integrating" refers to the process of adding DNA to a target region of DNA. As described herein, integration can be facilitated by several different means, including non-homologous end joining, homologous recombination, or targeted transposition. As an example, integration of a user-provided DNA molecule into a target gene can be facilitated by non-homologous end joining, where a targeted double-stranded break is made within the target gene and the user-provided DNA molecule is administered. The user-provided DNA molecule can include exposed DNA ends to facilitate capture during repair of the target gene by non-homologous end joining. The exposed ends can be present on the DNA molecule at the time of administration (i.e., upon administration of a linear DNA molecule) or can be created upon administration into a cell (i.e., a rare-cutting endonuclease cuts the user-provided DNA molecule in the cell to expose the ends). Additionally, the user-provided DNA molecule can be carried by a viral vector, including an adeno-associated viral vector. In another example, integration occurs via homologous recombination, where the user-provided DNA can carry left and right homologous arms. In another example, integration occurs via transposition, where the user-provided DNA carries the left and right ends of a transposon.

[0044] The term "intron-exon junction" refers to a specific position within a gene. This specific position is between the last nucleotide of the intron and the first nucleotide of the following exon. When integrating a transgene as described herein, the transgene can be integrated within an "intron-exon junction". If the transgene contains a cargo, the cargo is integrated immediately after the last nucleotide of the intron. In some cases, integration of a transgene within an intron-exon junction can result in the removal of a sequence within the exon (e.g., integration via HR and replacement of the sequence within the exon with the cargo within the transgene).

[0045] The term "exon-intron junction" refers to a specific position within a gene. This specific position is between the last nucleotide of an exon and the first nucleotide of the following intron. When integrating a transgene as described herein, the transgene may be integrated within an "exon-intron junction". If the transgene contains a cargo, the cargo is integrated immediately before the first nucleotide of the intron. In some cases, integration of a transgene within an exon-intron junction may result in the removal of a sequence within the exon (e.g., integration via HR and replacement of the sequence within the exon with the cargo within the transgene).

[0046] The term "partial coding sequence" as used herein refers to a sequence of nucleic acid that codes for a partial protein. A partial coding sequence can code for a protein that contains one or less amino acids compared to a wild-type or functional protein. A partial coding sequence can code for a partial protein that has homology to a wild-type or functional protein. When referring to a "partial coding sequence" that is operably linked to a promoter, the term "partial coding sequence" refers to a sequence of nucleotides that code for the N-terminus of a protein of interest. For example, a partial coding sequence of an ATXN2 gene that contains 25 exons can include nucleotides that code for a peptide produced by exons 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, or 1-24. When referring to a "partial coding sequence" operably linked to a terminator, the term "partial coding sequence" refers to a sequence of nucleotides that encodes the C-terminus of a protein of interest. For example, a partial coding sequence of the ATXN2 gene can include nucleotides encoding a peptide produced by exons 2-25, 3-25, 4-25, 5-25, 6-25, 7-25, 8-25, 9-25, 10-25, 11-25, 12-25, 13-25, 14-25, 15-25, 16-25, 17-25, 18-25, 19-25, 20-25, 21-25, 22-25, 23-25, 24-25, or 25.

[0047] The term "silencing-resistant coding sequence" or "silencing-resistant partial coding sequence" refers to a nucleic acid sequence, which when RNA is produced using said sequence as a template, cannot be silenced by the corresponding RNAi molecule or is unlikely to be silenced.This may be due to mutation in the RNAi target site or the absence of the site.

[0048] The methods and compositions described herein can use transgenes with cargo sequences. The term "cargo" can refer to elements such as the complete or partial coding sequence of a gene, a partial sequence of a gene that carries single-nucleotide polymorphisms compared to the WT or modified target, a splice acceptor, a splice donor, a promoter, a terminator, a transcriptional regulatory element, an RNAi cassette, a purification tag (e.g., glutathione-S-transferase, poly(His), maltose-binding protein, Strep tag, Myc tag, AviTag, HA tag, or chitin-binding protein), or a reporter gene (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin). As defined herein, "cargo" can refer to a sequence within a transgene that is integrated into a target site. For example, "cargo" can refer to a sequence on a transgene between two homologous arms, between two rare-cutting endonuclease target sites, or between the left and right transposon ends.

[0049] The term "homology sequence" refers to a sequence of a nucleic acid that contains homology to a second nucleic acid. A homology sequence may be present on a donor molecule, for example, as an "arm of homology" or a "homology arm". A homology arm may be a sequence of a nucleic acid within a donor molecule that promotes homologous recombination with a second nucleic acid. In one embodiment, a homology sequence or a homology arm has homology with an endogenous gene. As defined herein, a homology arm may also be referred to as an "arm". In a donor molecule with two homology arms, the homology arms may be referred to as "arm 1" and "arm 2". In one aspect, a cargo sequence may flank the first and second homology arms.

[0050] The term "bidirectional terminator" refers to a terminator that can terminate the transcription of RNA polymerase in either sense or antisense direction. In contrast to two unidirectional terminators in tail-to-tail orientation, bidirectional terminators can contain non-chimeric sequences of DNA. Examples of bidirectional terminators include ARO4, TRP1, TRP4, ADH1, CYC1, GAL1, GAL7, and GAL10 terminators.

[0051] The term "bidirectional promoter" refers to a promoter that can initiate transcription of RNA polymerase in either sense or antisense direction. In contrast to two unidirectional promoters in head-to-head orientation, bidirectional promoters can contain non-chimeric sequences of DNA. Examples of bidirectional promoters include those described in Trinklein et al., Genome Res. 14:62-66, 2004 (the entire disclosure of which is incorporated herein by reference, except for any definitions, disclaimers, disclaimers, and contradictions).

[0052] The 5' or 3' end of a nucleic acid molecule refers to the directionality and chemical orientation of the nucleic acid. As defined herein, the "5' end of a gene" may include an exon with a start codon, but does not include an exon with a stop codon. As defined herein, the "3' end of a gene" may include an exon with a stop codon, but does not include an exon with a start codon.

[0053] The term "RNAi" refers to RNA interference, a process of using RNA molecules to inhibit or reduce gene expression or translation. RNAi can be induced using small interfering RNA (siRNA) or small hairpin RNA (shRNA).

[0054] The term "ATXN2" gene refers to a gene encoding the enzyme ataxin-2. A representative sequence of the ATXN2 gene can be found in the NCBI reference sequence: NG_011572.3 and corresponding SEQ ID NO: 56. The boundaries of the exons and introns can be defined in the sequence provided in SEQ ID NO: 56. Specifically, exon 1 comprises the sequence 282-532. exon 2 comprises the sequence 43397-43433. exon 3 comprises the sequence 45099-45158. exon 4 comprises the sequence 46339-46410. exon 5 comprises the sequence 46886-47036. exon 6 comprises the sequence 74000-74124. exon 7 comprises the sequence 78343-78434. exon 8 comprises the sequence 79240-79437. Exon 9 contains the sequence from 80889 to 81067. Exon 10 contains the sequence from 82953 to 83162. Exon 11 contains the sequence from 85777 to 85959. Exon 12 contains the sequence from 88734 to 88931. Exon 13 contains the sequence from 89318 to 89425. Exon 14 contains the sequence from 89697 to 89767. Exon 15 contains the sequence from 110536 to 110840. Exon 16 contains the sequence from 112492 to 112555. Exon 17 contains the sequence from 113451 to 113603. Exon 18 contains the sequence from 113985 to 114051. Exon 19 contains the sequence from 128574 to 128758. Exon 20 contains the sequence from 129076 to 129208. Exon 21 contains the sequence from 134601 to 134654. Exon 22 contains the sequence from 141957 to 142102. Exon 23 contains the sequence from 143060 to 143287. Exon 24 contains the sequence from 145471 to 145639. Exon 25 contains the sequence from 146476 to 146504. Intron 1 contains the sequence from 533 to 43396. Intron 2 contains the sequence from 43434 to 45098. Intron 3 contains the sequence from 45159 to 46338. Intron 4 contains the sequence from 46411 to 46885. Intron 5 contains the sequence from 47037 to 73999. Intron 6 contains the sequence from 74125 to 78342. Intron 7 contains the sequence from 78435 to 79239.Intron 8 contains the sequence from 79438 to 80888. Intron 9 contains the sequence from 81068 to 82952. Intron 10 contains the sequence from 83163 to 85776. Intron 11 contains the sequence from 85960 to 88733. Intron 12 contains the sequence from 88932 to 89317. Intron 13 contains the sequence from 89426 to 89696. Intron 14 contains the sequence from 89768 to 110535. Intron 15 contains the sequence from 110841 to 112491. Intron 16 contains the sequence from 112556 to 113450. Intron 17 contains the sequence from 113604 to 113984. Intron 18 contains the sequence from 114052 to 128573. Intron 19 contains the sequence from 128759 to 129075. Intron 20 contains the sequence from 129209 to 134600. Intron 21 contains the sequence from 134655 to 141956. Intron 22 contains the sequence from 142103 to 143059. Intron 23 contains the sequence from 143288 to 145470. Intron 24 contains the sequence from 145640 to 146475. Examples of pathogenic mutations in ATXN2 include a CAG trinucleotide expansion (32 or more CAG repeats) in exon 1. Examples of non-pathogenic mutations include ClinVar accession numbers VCV000522367, VCV000522368, VCV000522369, VCV000522370, VCV000128509, VCV000128508, VCV000128507, VCV000218618.

[0055] The term "SNCA" gene refers to a gene encoding the protein synuclein alpha. A representative sequence of the SNCA gene can be found in NCBI Reference Sequence: NG_011851.1 and corresponding SEQ ID NO: 55. The boundaries of the exons and introns can be defined in the sequence provided in SEQ ID NO: 55. Specifically, exon 1 includes the sequence from 1 to 200. exon 2 includes the sequence from 1470 to 1615. exon 3 includes the sequence from 8978 to 9019. exon 4 includes the sequence from 14774 to 14916. exon 5 includes the sequence from 107885 to 107968. exon 6 includes the sequence from 110502 to 113063. intron 1 includes the sequence from 201 to 1469. intron 2 includes the sequence from 1616 to 8977. Intron 3 contains the sequence from 9020 to 14773. Intron 4 contains the sequence from 14917 to 107884. Intron 5 contains the sequence from 107969 to 110501. The start codon is present in intron 2. Examples of pathogenic mutations in SNCA include duplications or triplications of the gene, A53T, G51D, E46K, and A30P. Examples of non-pathogenic mutations include ClinVar accession numbers VCV000350063, VCV000350064, VCV000350086, and VCV000350093.

[0056] As defined herein, SOD1 gene refers to a gene that produces the enzyme superoxide dismutase. A representative sequence of the SOD1 gene can be found in NCBI Reference Sequence: NG_008689.1 and corresponding SEQ ID NO: 57. The boundaries of the exons and introns can be defined in the sequence provided in SEQ ID NO: 57. Specifically, exon 1 includes the sequence 5001-5220. exon 2 includes the sequence 9169-9265. exon 3 includes the sequence 11828-11897. exon 4 includes the sequence 12637-12754. exon 5 includes the sequence 13850-14310. intron 1 includes the sequence 5221-9168. intron 2 includes the sequence 9170-11827. intron 3 includes the sequence 11898-12636. Intron 4 includes sequences from 12755 to 12849. The methods described herein provide a transgene for integration into the SOD1 gene. The transgene may include a promoter, a partial SOD1 coding sequence, and a splice donor, and the integration site may be within introns 1, 2, 3, or 4 of the endogenous SOD1 gene. Additionally, the transgene may include an RNAi cassette targeting the endogenous SOD1 transcript, a promoter, a partial SOD1 coding sequence (resistant to silencing by the RNAi cassette), and a splice donor. The transgene may be integrated into introns 1, 2, 3, or 4 of the endogenous SOD1 gene. Additionally, the transgene may include a splice acceptor, a partial SOD1 coding sequence (resistant to silencing by the RNAi cassette), a terminator, and an RNAi cassette targeting the endogenous SOD1 transcript. The transgene can be integrated into intron 1, 2, 3, or 4 of endogenous SOD1 gene. Examples of pathogenic mutations in SOD1 include A5V, C7F, G13R, G17S, E22K, G38R, L39V, G42S, F46C, H47R, G73S, H81R, L85V, G86R, G94R, E101G, I105F, and L107V. Examples of non-pathogenic mutations include ClinVar accession numbers VCV000440292, VCV000256202, VCV000586633, and VCV000395173.

[0057] As defined herein, the RHO gene refers to a gene that produces the protein rhodopsin. A representative sequence of the RHO gene can be found in the NCBI reference sequence: NC_000003.12 and corresponding SEQ ID NO: 58. The boundaries of the exons and introns can be defined by the sequence shown in SEQ ID NO: 58. Specifically, exon 1 includes the sequence from 1 to 456. exon 2 includes the sequence from 2238 to 2406. exon 3 includes the sequence from 3613 to 3778. exon 4 includes the sequence from 3895 to 4134. exon 5 includes the sequence from 4970 to 6706. intron 1 includes the sequence from 457 to 2237. intron 2 includes the sequence from 2407 to 3612. intron 3 includes the sequence from 3779 to 3894. intron 4 includes the sequence from 4135 to 4969. The method described herein provides a transgene for integration into the RHO gene. The transgene can include a promoter, a partial RHO coding sequence, and a splice donor, and the integration site can be within intron 1, 2, 3, or 4 of the endogenous RHO gene. In addition, the transgene can include an RNAi cassette that targets the endogenous RHO transcript, a promoter, a partial RHO coding sequence (resistant to silencing by the RNAi cassette), and a splice donor. The transgene can be integrated into intron 1, 2, 3, or 4 of the endogenous RHO gene. The transgene can also include a splice acceptor, a partial RHO coding sequence (resistant to silencing by the RNAi cassette), a terminator, and an RNAi cassette that targets the endogenous RHO transcript. The transgene can be integrated into intron 1, 2, 3, or 4 of the endogenous RHO gene.Examples of pathogenic variants in RHO include those listed under ClinVar accession numbers VCV000013039, VCV000013031, VCV000013017, VCV000013042, VCV000013018, VCV000625297, VCV000013055, VCV000013013, VCV000013019, VCV000013047, VCV000013016, VCV000013020, VCV000013021, and VCV000013022. 045, VCV000013054, VCV000625301, VCV000013038, VCV000013022, VCV000013035, VCV000013048, VCV000373094, VCV000013 028, VCV000279882, VCV000013024, VCV000013046, VCV000029875, VCV000013049, VCV000417867, VCV000013050, VCV000143 080, VCV000625303, VCV000013025, VCV000196282, VCV000013033, VCV000590911, VCV000143081, VCV000013023, VCV000013 026, VCV000013043, VCV000013027, VCV000013051, VCV000013034, VCV000013036, VCV000636084, VCV000013030, VCV000523 376, VCV000013044, VCV000013029, VCV000419250, VCV000013056, VCV000013052, VCV000013015, VCV000013053, VCV000013032, VCV000013014, VCV000605502, VCV000605497, VCV000442401, VCV000442400, VCV000154258, and VCV000145614.Examples of non-pathogenic mutations include ClinVar accession numbers VCV000343272, VCV000256383, VCV000281512, VCV000256384, VCV000256382, VCV000343286, VCV000343290, VCV000343302, VCV000343303, VCV000343306, and VCV000606153.

[0058] As defined herein, the C9orf72 gene refers to a gene that produces proteins in various tissues and is associated with amyotrophic lateral sclerosis. A representative sequence of the C9orf72 gene can be found in NCBI Reference Sequence: NG_031977.1 and corresponding SEQ ID NO: 59. The boundaries of the exons and introns can be defined by the sequence shown in SEQ ID NO: 59. Specifically, exon 1 includes the sequence from 1 to 158; exon 2 includes the sequence from 6703 to 7190; exon 3 includes the sequence from 8277 to 8336; exon 4 includes the sequence from 11391 to 11486; exon 5 includes the sequence from 12218 to 12282; exon 6 includes the sequence from 13568 to 13640; and exon 7 includes the sequence from 15260 to 15376. Exon 8 contains the sequence from 17071 to 17306. Exon 9 contains the sequence from 23160 to 23217. Exon 10 contains the sequence from 25201 to 25310. Exon 11 contains the sequence from 25445 to 27321. Intron 1 contains the sequence from 159 to 6702. Intron 2 contains the sequence from 7191 to 8276. Intron 3 contains the sequence from 8337 to 11390. Intron 4 contains the sequence from 11487 to 12217. Intron 5 contains the sequence from 12283 to 13567. Intron 6 contains the sequence from 13641 to 15259. Intron 7 contains the sequence from 15377 to 17070. Intron 8 contains the sequence from 17307 to 23159. Intron 9 includes the sequence from 23218 to 25200. Intron 10 includes the sequence from 25311 to 25444. The methods described herein provide a transgene for integration into the C9orf72 gene. The transgene can include a promoter, a partial C9orf72 coding sequence, and a splice donor, and the integration site can be within introns 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the endogenous C9orf72 gene. Additionally, the transgene can include an RNAi cassette targeting the endogenous C9orf72 transcript, a promoter, a partial C9orf72 coding sequence (resistant to silencing by the RNAi cassette), and a splice donor.The transgene can be integrated into intron 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of endogenous C9orf72 gene. The transgene can also include a splice acceptor, a partial C9orf72 coding sequence (resistant to silencing by RNAi cassette), a terminator, and an RNAi cassette that targets endogenous C9orf72 transcript. The transgene can be integrated into intron 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of endogenous C9orf72 gene. Examples of pathogenic mutations in C9orf72 include duplication, triplication or quadruple of C9orf72 gene, or expansion of GGGGCC repeat. Examples of non-pathogenic mutations include ClinVar accession numbers VCV000366486, VCV000366521, VCV000366524, VCV000183033, and VCV000611705.

[0059] As defined herein, the CHRNA1 gene refers to the gene that produces the protein nicotinic cholinergic receptor α1 subunit. A representative sequence of the CHRNA1 gene can be found in NCBI Reference Sequence: NG_008172.1. As defined herein, the CHRND gene refers to the gene that produces the protein nicotinic cholinergic receptor δ subunit. A representative sequence of the CHRND gene can be found in NCBI Reference Sequence: NG_008028.1. As defined herein, the CHRNE gene refers to the gene that produces the protein nicotinic cholinergic receptor ε subunit. A representative sequence of the CHRNE gene can be found in NCBI Reference Sequence: NG_008029.2. As defined herein, the CHRNB1 gene refers to the gene that produces the protein nicotinic cholinergic receptor β1 subunit. A representative sequence of the CHRNB1 gene can be found in NCBI Reference Sequence: NG_008026.1. As defined herein, the PRPS1 gene refers to the gene that produces the protein phosphoribosyl pyrophosphate synthase 1. A representative sequence of the PRPS1 gene can be found in NCBI Reference Sequence: NG_008407.1. As defined herein, the LRRK2 gene refers to the gene that produces the protein leucine-rich repeat kinase 2. A representative sequence of the LRRK2 gene can be found in NCBI Reference Sequence: NG_011709.1. As defined herein, the STIM1 gene refers to the gene that produces protein stromal interaction molecule 1. A representative sequence of the STIM1 gene can be found in NCBI Reference Sequence: NG_016277.1. As defined herein, the FGFR3 gene refers to the gene that produces the protein fibroblast growth factor receptor 3. A representative sequence of the FGFR3 gene can be found in NCBI Reference Sequence: NG_012632.1. As defined herein, MECP2 gene refers to the gene that produces the protein methylated CpG-binding protein 2. A representative sequence of the MECP2 gene can be found in NCBI reference sequence: NG_007107.2. As defined herein, ATXN1 gene refers to the gene that produces the protein ataxin 1.A representative sequence of the ATXN1 gene can be found in NCBI Reference Sequence: NG_011571.1. As defined herein, the ATXN3 gene refers to the gene that produces the protein ataxin 3. A representative sequence of the ATXN3 gene can be found in NCBI Reference Sequence: NG_008198.2. As defined herein, the CACNA1A gene refers to the gene that produces the protein voltage-gated calcium channel subunit alpha 1A. A representative sequence of the CACNA1A gene can be found in NCBI Reference Sequence: NG_011569.1. As defined herein, the ATXN7 gene refers to the gene that produces the protein ataxin 7. A representative sequence of the ATXN7 gene can be found in NCBI Reference Sequence: NG_008227.1. As defined herein, the TBP gene refers to the gene that produces the protein TATA box-binding protein. A representative sequence of the TBP gene can be found in NCBI Reference Sequence: NG_008165.1. As defined herein, the HTT gene refers to the gene that produces the protein huntingtin. A representative sequence of the HTT gene can be found in NCBI Reference Sequence: NG_009378.1. As defined herein, the AR gene refers to the gene that produces the protein androgen receptor. A representative sequence of the AR gene can be found in NCBI Reference Sequence: NG_009014.2. As defined herein, the FXN gene refers to the gene that produces the protein frataxin. A representative sequence of the FXN gene can be found in NCBI Reference Sequence: NG_008845.2. As defined herein, the DMPK gene refers to the gene that produces the protein DM1 protein kinase. A representative sequence of the DMPK gene can be found in NCBI Reference Sequence: NG_009784.1. As defined herein, PABPN1 gene refers to the gene that produces the protein poly(A)-binding nuclear protein 1. A representative sequence of the PABPN1 gene can be found in NCBI reference sequence: NG_008239.1. As defined herein, ATXN8 gene refers to the gene that produces the protein ataxin 8.A representative sequence for the ATXN8 gene can be found at genomic coordinates (GRCh38):13:54,700,000-72,800,000.

[0060] The term "silencing-resistant partial coding sequence" as described herein refers to a partial coding sequence that has mutations compared with the homologous sequence from corresponding endogenous gene, and the mutations are designed to prevent or reduce the silencing by the corresponding RNAi cassette.The mutations can be insertions, substitutions, or deletions of nucleotides in the DNA sequence that codes for the target RNA sequence.The mutations can be sufficient to prevent or reduce the hybridization of short RNA molecules to the RNA transcript.

[0061] As defined herein, when referring to a silencing-resistant partial coding sequence, "lack of the sequence" refers to the deletion of one or more nucleotides in the corresponding RNAi target site. For example, when RNAi targets the transcript produced by the sequence GGTATCAAGACTACGAAC (within an exon of an endogenous gene), this sequence may also be present in the partial coding sequence of the transgene described herein. To prevent silencing of the modified gene, the RNAi target sequence in the partial coding sequence in the transgene can be modified. Specifically, the site can be mutated by insertion, substitution or deletion of nucleotides in the site. When the mutation is a deletion, one or more of the nucleotides can be deleted. When a nucleotide is deleted, the deletion is preferably designed to be an in-frame deletion that does not eliminate protein function.

[0062] As defined herein, "administration" can refer to the delivery, provision, or introduction of an exogenous molecule into a cell. When a transgene or rare-cutting endonuclease is administered to a cell, the transgene or rare-cutting endonuclease is delivered, provided, or introduced into the cell. The rare-cutting endonuclease can be administered as a purified protein, a nucleic acid, or a mixture of purified protein and nucleic acid. The nucleic acid (i.e., RNA or DNA) can code for the rare-cutting endonuclease, or a portion of the rare-cutting endonuclease (e.g., gRNA). Administration can be achieved through methods such as lipid-mediated delivery, electroporation, direct injection, cell fusion, particle injection, calcium phosphate co-precipitation, DEAE-dextran mediated delivery, viral vector mediated delivery, or any means suitable for delivering purified protein or nucleic acid, or a mixture of purified protein and nucleic acid, to a cell.

[0063] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows: First, the nucleic acid or amino acid sequence is compared to the sequence indicated by a particular sequence identification number using the BLAST2 sequence (Bl2seq) program from the standalone version of BLASTZ, including BLASTN version 2.0.14 and BLASTP version 2.0.14. This standalone version of BLASTZ is available online at fr.com / blast or ncbi.nlm.nih.gov. Instructions on how to use the Bl2seq program can be found in the readme file that accompanies BLASTZ. Bl2seq uses either the BLASTN or BLASTP algorithm to perform a comparison between two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt), -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt), -p is set to blastn, -o is set to any desired file name (e.g., C:\output.txt), -q is set to -1, -r is set to 2, and all other options are left at their default settings. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt -p blastn -oc:\output.txt -q -1 -r 2. To compare two amino acid sequences, the Bl2seq options are set as follows: -i is set to the file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt), -j is set to the file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt), -p is set to blastp, -o is set to any desired file name (e.g., C:\output.txt), and all other options are left at their default settings. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt -p blastp -oc:\output.txt. If the two compared sequences share homology, then the specified output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the specified output file will not present aligned sequences.

[0064] Once aligned, the number of matches is determined by counting the number of positions where the same nucleotide or amino acid residue is present in both sequences. The percent sequence identity is determined by dividing the number of matches by either the length of the sequence shown in the identified sequence or the length of the link (e.g., 100 consecutive nucleotides or amino acid residues from the sequence shown in the identified sequence), and then multiplying the resulting value by 100. The percent sequence identity value is rounded to the nearest tenth.

[0065] Bidirectional gene repair system having promoter(s) In one embodiment, this document features a method for modifying the 5' end of a transgene and an endogenous gene. The transgene can include a first and a second promoter, the first promoter being operably linked to a first partial coding sequence, and the second promoter being operably linked to a second partial coding sequence. The first and second partial coding sequences can be operably linked to a first and a second splice donor sequence, respectively (Figure 1). The first promoter, the first partial coding sequence, and the first splice donor can be arranged in a head-to-head orientation with the second promoter, the second partial coding sequence, and the second splice donor. The transgene can be integrated into the endogenous gene within an intron or at an exon-intron junction. In some embodiments, the transgene can be integrated into the endogenous gene using a rare-cutting endonuclease or a transposon. In one embodiment, the transgenes, including the first and second promoters, the first and second partial coding sequences, and the first and second splice donors, can be flanked by additional sequences, such as viral inverted terminal repeats (e.g., adeno-associated virus inverted repeats). These transgenes can be integrated into endogenous genes via targeted double-strand breaks using rare-cutting endonucleases.

[0066] In another embodiment, the transgenes, including the first and second promoters, the first and second partial coding sequences, and the first and second splice donors, can be flanked by first and second rare-cutting endonuclease target sites. These transgenes can be integrated into endogenous genes via targeted double-stranded breaks using one or more rare-cutting endonucleases, which cut sequences in the endogenous gene and cut adjacent target sites in the transgene.

[0067] In another embodiment, the transgenes, including the first and second promoters, the first and second partial coding sequences, and the first and second splice donors, can be flanked by the first and second homology arms. These transgenes can be integrated into the endogenous gene via targeted double-strand breaks using one or more rare-cutting endonucleases, which cleave the endogenous gene.

[0068] In another embodiment, the transgenes, including the first and second promoters, the first and second partial coding sequences, and the first and second splice donors, can be flanked by the first and second homologous arms and the first and second rare-cutting endonuclease target sites. These transgenes can be integrated into endogenous genes via targeted double-stranded breaks using one or more rare-cutting endonucleases, which cut sequences in the endogenous gene and cut adjacent target sites in the transgene. The first and second target sites in the vector can be flanked by the first and second homologous arms. Alternatively, the first target site or the second target site, or the booth of the first and second target sites, can be within the homologous arms.

[0069] In another embodiment, the transgene comprises the first and second promoters, the first and second partial coding sequences, and the first and second splice donors can be flanked by the left and right transposon ends.These transgenes can be integrated into endogenous genes through transposition using transposase.As described herein, the transposase can be a CRISPR-associated transposase.

[0070] In some embodiments, the first and second promoters can be replaced with bidirectional promoters. In other embodiments, the transgene can further comprise a first and a second terminator arranged in a tail-to-tail orientation between the first and second promoters (FIG. 1). Alternatively, the first and the second terminators can be replaced with bidirectional terminators.

[0071] In one embodiment, this document features a method for modifying the 5' end of an endogenous gene, the endogenous gene having at least one intron between two coding exons. The intron can be any intron that is removed from a precursor messenger RNA by normal messenger RNA processing mechanisms. The intron can be from 20 bp to over 500 kb and includes elements including splice donor sites, branch sequences, and acceptor sites. The transgenes disclosed herein for modification of the 5' end of an endogenous gene can include multiple functional elements, including target sites for rare-cutting endonucleases, homology arms, splice acceptor sequences, coding sequences, promoters, and transcription terminators, (Figure 1).

[0072] In an embodiment, the location for transgene integration may be an intron or an intron-exon junction. When targeting an intron, the partial coding sequence may include a sequence that codes for a peptide produced by an exon preceding the intron in an endogenous gene. For example, when a transgene is designed to integrate into intron 2 of an endogenous gene having 12 exons, the partial coding sequence may code for a peptide produced by exons 1 and 2 of the endogenous gene. When targeting an exon-intron junction, the transgene may be integrated into the exon-intron junction so that the intron sequence is preserved. In one embodiment, after integration, the intron sequence is preserved and the upstream exon sequence is preserved (i.e., a nucleotide from the transgene is added between the last nucleotide in the exon and the first nucleotide in the intron). Alternatively, in one embodiment, after integration, the intron sequence is preserved, but one or more nucleotides of the exon sequence are removed.

[0073] In one embodiment, the transgene comprises two target sites of a rare-cutting endonuclease. The target sites can be of suitable sequence and length for cleavage by a rare-cutting endonuclease. The target sites can be suitable for cleavage by a CRISPR system, a TAL effector nuclease, a zinc finger nuclease or a meganuclease, or a combination of a CRISPR system, a TALE nuclease, a zinc finger nuclease or a meganuclease, or any other rare-cutting endonuclease. The target sites can be positioned such that cleavage by a rare-cutting endonuclease results in the release of the transgene from the vector. The vector can comprise a viral vector (e.g., an adeno-associated vector) or a non-viral vector (e.g., a plasmid, a minicircle vector). When the transgene comprises two target sites, the target sites can be the same sequence (i.e., targeted by the same rare-cutting endonuclease), or they can be different sequences (i.e., targeted by two or more different rare-cutting endonucleases).

[0074] In some embodiments, the transgene provided herein may be integrated by a transposase. The transposase may include a CRISPR transposase (Strecker et al., Science 10.1126 / science.aax9181, 2019; Klompe et al., Nature, 10.1038 / s41586-019-1323-z, 2019). The transposase may be used in combination with a transgene that includes a first and a second splice acceptor sequence, a first and a second coding sequence, a bidirectional terminator, or a first and a second terminator (FIG. 1), and the left and right ends of the transposon. The CRISPR transposase may include TypeV-U5, C2C5 CRISPR protein, Cas12k, along with proteins tnsB, tnsC, and tniQ. In some embodiments, Cas12k can be from Scytonema hofmanni (SEQ ID NO: 30) or Anabaena cylindrica (SEQ ID NO: 31). In one embodiment, the transgene described herein, including the left end (SEQ ID NO: 32) and the right end (SEQ ID NO: 33) of the transposon, can be delivered to a cell along with ShCas12k, tnsB, tnsC, TniQ, and gRNA (SEQ ID NO: 44). Alternatively, the CRISPR transposase can include Cas6 protein along with helper proteins including Cas7, Cas8, and TniQ. In one embodiment, the transgene described herein, including the left end (SEQ ID NO: 41) and right end (SEQ ID NO: 43) of the transposon, can be delivered to eukaryotic cells together with Cas6 (SEQ ID NO: 37), Cas7 (SEQ ID NO: 36), Cas8 (SEQ ID NO: 35), TniQ (SEQ ID NO: 34), TnsA (SEQ ID NO: 38), TnsB (SEQ ID NO: 39), TnsC (SEQ ID NO: 40), and gRNA (SEQ ID NO: 42). The protein can be administered directly to the cell as a purified protein or can be encoded by RNA or DNA. If encoded by RNA or DNA, the sequence can be codon-optimized for expression in eukaryotic cells. The gRNA (SEQ ID NO: 42) can be placed downstream of an RNA polIII promoter and terminated with a poly(T) terminator.

[0075] In one embodiment, the transgene comprises a first and a second target site, and a first and a second homologous arm. The first and the second homologous arms can comprise a sequence homologous to a genomic sequence at or near the desired integration site. The homologous arms can be of a suitable length for participating in homologous recombination with a sequence at or near the desired integration site. The length of each homologous arm can be 50nt to 10,000nt (e.g., 50nt, 100nt, 200nt, 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1,000nt, 2,000nt, 3,000nt, 4,000nt, 5,000nt, 6,000nt, 7,000nt, 8,000nt, 9,000nt, 10,000nt). In one embodiment, the homology arm can contain a functional element that includes a target site for a rare-cutting endonuclease. In one embodiment, the first homology arm (e.g., the left homology arm) can contain a sequence homologous to the targeted exon or intron, and the second homology arm can contain a sequence homologous to a genomic sequence downstream of the first homology arm. The first homology arm must not have a splice acceptor function relative to the transcription direction from the promoter on the transgene. To determine whether a sequence contains a splice acceptor function, several steps can be performed, including in silico analysis and experimental testing. To determine whether there is a possibility of a splice acceptor function, the sequence desired for the second homology arm can be searched for consensus branch sequences (e.g., YTRAC) and splice acceptor sites (e.g., Y-rich NCAGG). If a branch or splice acceptor sequence is present, a single nucleotide polymorphism can be introduced to disrupt the function, or a different but adjacent sequence can be selected that does not contain such a sequence. To experimentally determine whether a first homologous arm has splice acceptor function, a synthetic construct can be constructed that contains the first homologous arm within an intron in a reporter gene. The construct can then be administered to an appropriate cell type and monitored for splicing function by assessing reporter gene activity.

[0076] In one embodiment, the transgene comprises two splice donor sequences, referred to herein as the first and second splice donor sequences. The first and second splice donor sequences are located in the transgene in opposite orientations (i.e., head-to-head orientation) and adjacent internal sequences (i.e., partial coding sequence and promoter). When the transgene is integrated into the intron in forward or reverse orientation, the splice donor sequence promotes the initiation of splicing of the intron in the corresponding pre-mRNA. The first and second splice donor sequences can be the same sequence or different sequences. One or both splice donor sequences can be the splice donor sequence of the intron into which the transgene is integrated. One or both splice donor sequences can be synthetic splice donor sequences or splice donor sequences from introns from different genes.

[0077] In one embodiment, the transgene comprises a first and a second coding sequence operably linked to a first and a second splice donor sequence. The first and the second coding sequence are positioned in the transgene in opposite directions (i.e., head-to-head orientation). When the transgene is integrated into the endogenous gene in the forward or reverse orientation, the first and the second coding sequence are transcribed into mRNA by the promoter located in the transgene. The coding sequence can be designed to correct a defective coding sequence, introduce a mutation, or introduce a novel peptide sequence. The first and the second coding sequence can be the same nucleic acid sequence and code for the same protein. Alternatively, the first and the second coding sequence can be different nucleic acid sequences and code for the same protein (i.e., using codon degeneracy). The coding sequence can encode a purification tag (e.g., glutathione-S-transferase, poly(His), maltose binding protein, Strep tag, Myc tag, AviTag, HA tag, or chitin binding protein) or a reporter protein (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin).

[0078] In one embodiment, the methods and compositions described herein can be used to modify the 5' end of an endogenous gene, resulting in modification of the N-terminus of a protein encoded by the endogenous gene. The modification of the 5' end of the coding sequence of the endogenous gene can include replacement of the first coding exon to an exon between the first and last exon. For example, if the gene contains 12 exons, the modification can include replacement of exons 1, or 1-2, or 1-3, or 1-4, or 1-5, or 1-6, or 1-7, or 1-8, or 1-9, or 1-10, or 1-11. In one embodiment, the endogenous exon being replaced can be replaced with a similar sequence. For example, the first or second coding sequence of the transgene can include exons 1, or 1-2, or 1-3, or 1-4, or 1-5, or 1-6, or 1-7, or 1-8, or 1-9, or 1-10, or 1-11. The transgene may be integrated into the endogenous gene within an intron downstream of the exon that is the last exon in the coding sequence of the transgene (Figure 3). Alternatively, the transgene may be integrated into an exon that corresponds to the last exon in the coding sequence of the transgene (Figure 8). The transgene may be designed to be 4.7 kb or less and integrated into AAV vectors and particles to be delivered to target cells in vivo.

[0079] In one embodiment, the transgene can include a bidirectional promoter, or a first and a second promoter, operably linked to a first and a second coding sequence. The bidirectional promoter, or the first and the second promoter, are positioned in the transgene in opposite directions (i.e., head-to-head orientation). When the transgene is integrated into the endogenous gene in the forward or reverse direction, the bidirectional promoter, or the first and the second promoter, initiates the transcription of the first and the second coding sequence. The first and the second promoters can be the same promoter or different promoters.

[0080] In one embodiment, the transgene can include a bidirectional promoter, or a first and a second promoter, operably linked to a first and a second coding sequence. The bidirectional promoter, or the first and the second promoter, are positioned in the transgene in opposite directions (i.e., head-to-head orientation). When the transgene is integrated into the endogenous gene in the forward or reverse direction, the bidirectional promoter, or the first and the second promoter, initiates the transcription of the first and the second coding sequence. The first and the second promoter can be the same promoter or different promoters. The promoter can be selected from, for example, CMV, EF1α, SV40, PGK1, Ubc, human β-actin, CAG, or any promoter that has sufficient activity to initiate the transcription of the partial coding sequence. Without being bound by theory, the promoter in the reverse direction can cause the generation of double-stranded RNA, thereby resulting in the silencing of gene expression upstream of the integration site. Additionally, the promoter in the forward direction may not be subject to the same silencing (e.g., due to codon degeneracy of the coding sequence) and may initiate the transcription of RNA. Also described herein is a method for reducing potential RNAi from RNA produced in the reverse orientation by a promoter (Figure 5).

[0081] In one embodiment, the transgene can include a bidirectional terminator, or a first and a second terminator, between the first and second promoters (Figure 1). The bidirectional terminator, or the first and the second terminator, are positioned in the transgene in opposite directions (i.e., tail-to-tail orientation). When the transgene is integrated into the endogenous gene in the forward or reverse direction, the bidirectional terminator, or the first and the second terminator, terminates transcription from the promoter of the endogenous gene. The first and the second terminators can be the same terminator or different terminators.

[0082] In one embodiment, this document provides a transgene comprising a first and a second rare-cutting endonuclease target site, a first and a second splice donor sequence, a first and a second coding sequence, and a bidirectional promoter, or a first and a second promoter. The transgene can be integrated into the endogenous gene via non-homology-dependent methods, including non-homologous end joining and alternative non-homologous end joining, or by microhomology-mediated end joining. In one aspect, the transgene is integrated into an intron within the endogenous gene (Figure 2).

[0083] In another embodiment, this document provides a transgene comprising a first and a second homology arm, a first and a second rare-cutting endonuclease target site, a first and a second splice donor sequence, a first and a second coding sequence, and a bidirectional promoter, or a first and a second promoter. The transgene can be integrated into an endogenous gene through both homology-dependent methods (e.g., synthesis-dependent strand annealing and microhomology-mediated end joining) and homology-independent methods (e.g., non-homologous end joining and alternative non-homologous end joining). In one aspect, the transgene is integrated into an intron in the endogenous gene (Figure 3). In another aspect, the transgene is integrated into an exon of the endogenous gene (Figure 8).

[0084] In another embodiment, this document provides a transgene comprising a first and second homology arm, a first and second splice donor sequence, a first and second coding sequence, and a bidirectional promoter, or a first and second promoter (Figure 1). In another embodiment, this document provides a transgene comprising a first and second coding sequence, a first and second splice donor sequence, and a bidirectional promoter, or a first and second promoter.

[0085] In another embodiment, this document provides a transgene comprising a first and second homologous arm, a first and second coding sequence, a first and second splice donor sequence, one bidirectional terminator, or a first and second terminator, and a first and second additional sequence (Figure 1). The additional sequence can be any additional sequence present on the transgene at the 5' and 3' ends, but the additional sequence should not include any element that functions as a splice acceptor or splice donor. The additional sequence can be, for example, an inverted terminal repeat of the adeno-associated virus genome, or a left and right transposon end.

[0086] In another embodiment, this document provides a transgene in a viral vector, including adeno-associated virus and adenovirus, the transgene comprises a first and a second splice donor sequence, a first and a second coding sequence, and a bidirectional terminator, or a first and a second terminator. Due to the inverted terminal repeats of the viral vector, the transgene also comprises a first and a second additional sequence.

[0087] In another embodiment, this document provides a transgene in a viral vector, including adeno-associated virus and adenovirus, the transgene comprises a first and a second homology arm, a first and a second splice donor sequence, a first and a second coding sequence, and a bidirectional promoter or a first and a second promoter. Due to the inverted terminal repeats of the viral vector, the transgene also comprises a first and a second additional sequence.

[0088] In another embodiment, the transgene for integration can be designed to integrate through multiple repair pathways, with each outcome producing the desired effect. For example, the transgene can include a first and a second arm homology arm, a first and a second rare-cutting endonuclease target site, a first and a second coding sequence, a first and a second promoter, and can be carried within the AAV genome (i.e., adjacent to a 145 nucleotide inverted terminal repeat). After expression by the rare-cutting endonuclease, the following outcomes can occur: 1) forward or reverse integration of the entire AAV genome at the target site by NHEJ, 2) forward or reverse integration of the sequence between the first and the second rare-cutting endonuclease target site at the target site by NHEJ, 3) integration by HR using the first and the second homology arm, or 4) any combination of the above outcomes. After integration with any of the above outcomes, the transgene described herein can correct or modify the protein sequence produced by the endogenous gene.

[0089] In some embodiments, the transgenes described herein may have a combination of elements including a splice donor, partial coding sequence, promoter, homology arms, left and right transposase ends, and a cleavage site for a rare-cutting endonuclease. In one embodiment, the combination may be 5' to 3'.

[0090] In some embodiments, the transgenes described herein may have a combination of elements including a splice acceptor, a partial coding sequence, a terminator, homology arms, left and right transposase ends, and a cleavage site for a rare-cutting endonuclease.

[0091] In one embodiment, the combination can be, from 5' to 3', [splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2] (RC stands for reverse complement). This combination can be carried on a linear DNA molecule or an AAV molecule and can be integrated by NHEJ via targeted cleavage of the target gene.

[0092] In another embodiment, the combination can be, from 5' to 3', [rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease cleavage site 2].

[0093] In another embodiment, the combination can be, from 5' to 3', [rare-cutting endonuclease cleavage site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2]. In this combination, one or more rare-cutting endonucleases can be used to promote HR and NHEJ. For example, a single rare-cutting nuclease can cut the target gene (i.e., the desired intron), and the cleavage sites adjacent to the homology arms can be designed to be the same target sequence within the intron.

[0094] In another embodiment, the combination can be from 5' to 3': [homology arm 1 + rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2]. In this combination, one or more rare-cutting endonucleases can promote HR and NHEJ. For example, a single rare-cutting nuclease can cleave within homology arm 1, downstream of homology arm 2, and at the genomic target site (i.e., the site that has homology to the sequence of homology arm 1).

[0095] In another embodiment, the combination can be from 5' to 3', [left end of transposase]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[right end of transposase]. In all embodiments, splice donor 1 and splice donor 2 can be the same or different sequences, partial coding sequence 1 and partial coding sequence 2 can be the same or different sequences, and promoter 1 and promoter 2 can be the same or different sequences.

[0096] In an embodiment, a transgene comprising the structure [rare-cutting endonuclease cleavage site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 2] can be integrated into DNA through delivery of one or more rare-cutting endonucleases. When one rare-cutting endonuclease is delivered, the rare-cutting endonuclease can release the transgene by cleavage at rare-cutting endonuclease cleavage sites 1 and 2. Furthermore, the same rare-cutting endonuclease can generate a cleavage in the target gene that simulates insertion via HR or NHEJ.

[0097] In other embodiments, a transgene comprising the structure [homology arm 1 + rare-cutting endonuclease cleavage site 1]-[splice donor 1 RC]-[partial coding sequence 1]-[promoter 1 RC]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[homology arm 2]-[rare-cutting endonuclease cleavage site 1] can be integrated into DNA by delivery of one or more rare-cutting endonucleases. When one rare-cutting endonuclease is delivered, the rare-cutting endonuclease can release the transgene by cleavage at rare-cutting endonuclease cleavage sites 1 and 2. Furthermore, the same rare-cutting endonuclease can generate a cleavage in the target gene that simulates insertion via HR or NHEJ. Integration by HR can occur when the cleavage is upstream (i.e., within the homology arm) of the integration site.

[0098] In an embodiment, the partial coding sequence may be codon adjusted. The codon adjustment may be aimed at 1) reducing double-stranded RNA pairing (FIG. 5), and 2) optimizing protein expression. A transgene comprising a first and second partial coding sequence operably linked to a first and second promoter is integrated into an endogenous gene, and when the first and second partial coding sequences are homologous to each other and are endogenous genes, double-stranded RNA may be produced (FIG. 5). The partial coding sequence may be codon adjusted to minimize RNA pairing. In an embodiment, the codon optimization may be complete and different with respect to the first and second partial coding sequences. For example, partial coding sequence 1 may have a different nucleotide sequence from partial coding sequence 2, and both partial coding sequences 1 and 2 may have different sequences from the corresponding sequences in the endogenous gene of interest.

[0099] In another embodiment, the codon optimization can be split between a first and a second partial coding sequence. For example, the first partial coding sequence can have a mixture of codon-unaligned sequences (i.e., homologous to corresponding sequences in the endogenous gene of interest) and codon-aligned sequences. In this example, the second partial coding sequence can have the opposite alignment. For example, within the 200 nucleotide partial coding sequences 1 and 2, nucleotides 1-100 of partial coding sequence 1 can be homologous to sequences in the endogenous gene of interest, and nucleotides 101-200 can be codon-aligned to have minimal sequence similarity to the endogenous gene of interest, and nucleotides 1-100 of partial coding sequence 2 can be codon-aligned to have minimal sequence similarity to the endogenous gene of interest, and nucleotides 101-200 can be homologous to sequences in the endogenous gene of interest.

[0100] In one embodiment, the genome modification is the insertion of a transgene in endogenous ATXN2 genome sequence. The transgene can include a partial coding sequence of ATXN2 protein. The partial coding sequence can be homologous to the coding sequence in wild-type ATXN2 gene, or a functional variant of wild-type ATXN2 gene, a codon-adjusted version of ATXN2 gene, or a mutant ATXN2 gene. In one embodiment, the transgene that codes for a partial ATXN2 protein is inserted into intron 1 of endogenous ATXN2 gene (Figures 3 and 4).

[0101] In one embodiment, the transgene provided herein comprises a first and second partial coding sequence encoding a peptide produced by exon 1 of the ATXN2 gene (FIG. 7). The transgene can be integrated into the endogenous ATXN2 gene within intron 1 or at the exon 1-intron 1 junction. This embodiment is particularly useful in cells that contain an expanded trinucleotide repeat in exon 1 of ATXN2.

[0102] The methods and compositions provided herein can be used to modify genes encoding proteins within cells, including endogenous proteins such as fibrinogen, prothrombin, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor XI, factor XII (Hageman factor), factor XIII (fibrin stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, and plasminogen. , α2-antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase (IDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, propionyl CoA carboxylase (PCC) (PCCA , and / or PCCB subunits), glucose-6-phosphate transporter (G6PT) protein or glucose-6-phosphatase (G6Pase), LDL receptor (LDLR), ApoB, LDLRAP-1, PCSK9, mitochondrial proteins (such as NAGS (N-acetylglutamate synthase), CPS1 (carbamoyl phosphate synthase I), and OTC (ornithine transcarbamylase)), ASS (argininosuccinate synthase), ASL (argininosuccinyl acid lyase), and β-glucose-6-phosphate transporter (G6PT) protein or glucose-6-phosphatase (G6Pase). ) and / or ARG1 (arginase), and / or solute carrier family 25 (SLC25A13, aspartate / glutamate carrier) protein, UGT1A1 or UDP glucuronyltransferase polypeptide A1, fumarylacetoacetate hydrolyase (FAH), alanine glyoxylate aminotransferase (AGXT) protein, glyoxylate reductase / hydroxypyruvate reductase (GRHPR) protein, transthyretin gene (TTR) protein,These include ATP7B protein, phenylalanine hydroxylase (PAH) protein, USH2A protein, ATXN protein, and lipoprotein lyase (LPL) protein.

[0103] The transgene may comprise sequences for modifying endogenous genes carrying loss-of-function or gain-of-function mutations. Mutations may include those resulting in the following genetic disorders: achondroplasia, color blindness, acid maltase deficiency, adenosine deaminase deficiency, adrenoleukodystrophy, Aicardi syndrome, alpha 1 antitrypsin deficiency, alpha thalassemia, androgen insensitivity syndrome, pert syndrome, arrhythmogenic right ventricular dysplasia, ataxia telangiectasia, Barth syndrome, beta thalassemia, blue rubber nipple syndrome, Canavan disease, chronic granulomatous disease (CGD), cri-a-cat syndrome, cystic fibrosis, Dercum's disease, ectodermal dysplasia, Fanconi anemia, fibrodysplasia ossificans progressiva, fragile X syndrome, galactosemia, systemic gangliosidosis (e.g., GM1), hemochromatosis, beta-globin (HbC) number 6 Hemoglobin C mutations in the eye codon, hemophilia, Huntington's disease, hypophosphatasia, Klinefelter syndrome, Krabbe disease, Langer-Gideon syndrome, leukocyte adhesion deficiency, leukodystrophies, long QT syndrome, Marfan syndrome, Moebius syndrome, mucopolysaccharidoses (MPS), nail-patella syndrome, nephrogenic diabetes insipidus, neurofibromatosis, Niemann-Pick disease, osteogenesis imperfecta, porphyria, Prader-Willi syndrome, progeria, progeria Roteus syndrome, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Shwachman syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, thrombocytopenic-radial deficiency (TAR) syndrome, Treacher Collins syndrome, trisomy, tuberous sclerosis, Turner syndrome, urea cycle disorders, von Hippel-Lindau disease, Waardenburg syndrome, Williams syndrome, Wilson disease, Wiskott-Aldrich syndrome, X-linked lymphoproliferative syndrome, lysosomal storage disorders (e.g., Gaucher disease, GM1, Fabry disease, and Tay-Sachs disease), von Willebrand disease, Usher syndrome, polycystic kidney disease, spinocerebellar ataxia type 2, spinal-bulbar muscular atrophy, Friedreich's ataxia, and myotonic dystrophy type 2.

[0104] As described herein, the transgene may be carried within a viral or non-viral vector. The vector may be in the form of circular or linear, double-stranded or single-stranded DNA. The donor molecule may be conjugated or associated with a reagent that promotes stability or cellular update. The reagent may be a lipid, calcium phosphate, cationic polymer, DEAE-dextran, dendrimer, polyethylene glycol (PEG), cell membrane-permeable peptide, gas-filled microbubbles, or magnetic beads. The donor molecule may be incorporated into a viral particle. The virus may be a retrovirus, adenovirus, adeno-associated vector (AAV), herpes simplex, poxvirus, hybrid adenoviral vector, Epstein-Barr virus, lentivirus, or herpes simplex virus.

[0105] Gene repair system using RNAi cassette In another embodiment, the method described herein can be used to silence an endogenous gene while simultaneously replacing the RNA / protein lost due to silencing. In one embodiment, the method can include administering a transgene to a cell, the transgene containing two functional elements: 1) a silencing sequence, and 2) a complete coding sequence encoding a protein that is homologous to the silenced protein but resistant to silencing (Figure 9). The two functional elements can be on separate transgenes or on the same transgene. In another embodiment, the method can include administering a transgene to a cell, the transgene incorporating into an endogenous gene of interest and containing 1) a silencing sequence, and 2) a partial or complete coding sequence for repair of the mutated gene that is resistant to silencing (Figures 12-17).

[0106] Silencing sequence can include a promoter, a nucleic acid sequence that functions to silence target nucleic acid, and a terminator.Nucleic acid sequence can be in a form that can induce gene silencing in target nucleic acid (e.g., microRNA, hairpin RNA, antisense RNA).Nucleic acid sequence can target different regions of the mRNA of target gene, including 5'UTR, coding sequence, or 3'UTR.

[0107] In one embodiment, this document describes a method to silence and replace the production of a protein of interest by administering a transgene as described in FIG. 13 to a cell and integrating the transgene into an endogenous gene of interest. In one embodiment, the transgene can include a splice acceptor, a partial coding sequence (resistant to silencing), a terminator, and an RNAi cassette designed to silence the endogenous gene of interest. The splice acceptor can be operably linked to the partial coding sequence, which can be operably linked to the terminator. The splice acceptor, the partial coding sequence, the terminator, and the RNAi cassette can flank the first and second homologous arms, or the left and right transposon ends. The transgene can be integrated into an intron in the endogenous gene of interest or into an intron-exon junction in the endogenous gene of interest. The partial coding sequence can code for the remaining peptide sequence compared to the position where the transgene is integrated. For example, if a transgene is integrated into intron 3 of a gene containing five exons (Figure 13), the partial coding sequence can code for a peptide produced by exon 4 and exon 5 of the endogenous gene. The RNAi cassettes in these transgenes can target sequences in exons 4 or 5 or the 3'UTR. Thus, the corresponding target sites in the partial coding sequences in the transgene can be modified to prevent silencing of the modified endogenous allele. In other embodiments, the transgene can include a first and a second splice acceptor, a first and a second partial coding sequence (both resistant to silencing), a first and a second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and a second rare-cutting endonuclease target site, left and right transposon ends, or both a first and a second homologous arm and a first and a second rare-cutting endonuclease target site.In one embodiment, the structure of the transgene can be, from 5' to 3', [homology arm 1]-[splice acceptor]-[partial coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[splice acceptor]-[partial coding sequence]-[terminator]-[RNAi cassette]-[right end of transposase]. In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[additional sequence 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[splice acceptor 1]-[partial coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[partial coding sequence 2 RC]-[splice acceptor 2 RC]-[right end of transposase].

[0108] In one embodiment, this document describes a method to silence and replace the production of a protein of interest by administering a transgene as described in FIG. 14 to a cell and integrating the transgene into an endogenous gene of interest. In one embodiment, the transgene can include a splice acceptor, a 2A sequence, a complete coding sequence (resistant to silencing), a terminator, and an RNAi cassette designed to silence the endogenous gene of interest. The splice acceptor can be operably linked to the 2A sequence, and can be operably linked to the complete coding sequence, which can be operably linked to the terminator. The splice acceptor, the 2A sequence, the complete coding sequence, the terminator, and the RNAi cassette can flank the first and second homologous arms, or the left and right transposon ends. The transgene can be integrated into an intron in the endogenous gene of interest or into an intron-exon junction in the endogenous gene of interest (FIG. 14). RNAi can be designed to silence the expression of an endogenous gene of interest, and the complete coding sequence in the transgene can be designed to be resistant to silencing. Thus, the corresponding target site in the complete coding sequence in the transgene can be modified to prevent silencing. In other embodiments, the transgene can include a first and a second splice acceptor, a first and a second 2A sequence, a first and a second coding sequence (both resistant to silencing), a first and a second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and a second rare-cutting endonuclease target site, left and right transposon ends, or both a first and a second homologous arm and a first and a second rare-cutting endonuclease target site. In one embodiment, the structure of the transgene can be, from 5' to 3', [homology arm 1]-[splice acceptor]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2].In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[splice acceptor]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[right end of transposase]. In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[splice acceptor 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[splice acceptor 2 RC]-[additional sequence 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[splice acceptor 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[splice acceptor 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice acceptor 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[splice acceptor 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[splice acceptor 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[splice acceptor 2 RC]-[right end of transposase].

[0109] In one embodiment, this document describes a method to silence and replace the production of a protein of interest by administering a transgene as described in FIG. 15 to a cell and integrating the transgene into an endogenous gene of interest. In one embodiment, the transgene can include a 2A sequence, a complete coding sequence (resistant to silencing), a terminator, and an RNAi cassette designed to silence the endogenous gene of interest. The 2A sequence can be operably linked to the complete coding sequence, which can be operably linked to a terminator. The 2A sequence, the complete coding sequence, the terminator, and the RNAi cassette can be adjacent to the first and second homologous arms, or the left and right transposon ends. The transgene can be integrated into an exon in the endogenous gene of interest (FIG. 15). The RNAi can be designed to silence the expression of the endogenous gene of interest, and the complete coding sequence in the transgene can be designed to be resistant to silencing. Thus, the corresponding target site in the complete coding sequence in the transgene can be modified to prevent silencing. In other embodiments, the transgene can include a first and a second 2A sequence, a first and a second coding sequence (both resistant to silencing), a first and a second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and a second rare-cutting endonuclease target site, left and right transposon ends, or both a first and a second homologous arm and a first and a second rare-cutting endonuclease target site. In one embodiment, the structure of the transgene can be, from 5' to 3', [homologous arm 1]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[homologous arm 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[2A]-[coding sequence]-[terminator]-[RNAi cassette]-[right end of transposase].In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[additional sequence 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[homologous arm 1]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[homologous arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[2A1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[2A2 RC]-[right end of transposase].

[0110] In one embodiment, this document describes a method to silence and replace the production of a protein of interest by administering a transgene described in FIG. 16 to a cell and integrating the transgene into the endogenous gene of interest. In one embodiment, the transgene can include a complete coding sequence (resistant to silencing and including a start codon), a terminator, and an RNAi cassette designed to silence the endogenous gene of interest. The complete coding sequence can be operably linked to the terminator. The complete coding sequence, terminator, and RNAi cassette can be adjacent to the first and second homology arms, or the left and right transposon ends. The integration site can be within the 5'UTR or before the start codon (FIG. 16). Additional integration sites, if present, can be within an intron within the 5'UTR, but the transgene described within this embodiment must then include a splice acceptor sequence operably linked to the complete coding sequence(s). RNAi can be designed to silence the expression of an endogenous gene of interest, and the complete coding sequence in the transgene can be designed to be resistant to silencing. Thus, the corresponding target site in the complete coding sequence in the transgene can be modified to prevent silencing. In other embodiments, the transgene can include a first and a second coding sequence (both resistant to silencing), a first and a second terminator, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and a second rare-cutting endonuclease target site, left and right transposon ends, or both a first and a second homologous arm and a first and a second rare-cutting endonuclease target site. In one embodiment, the structure of the transgene can be, from 5' to 3', [homology arm 1]-[coding sequence]-[terminator]-[RNAi cassette]-[homology arm 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[coding sequence]-[terminator]-[RNAi cassette]-[right end of transposase].In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[coding sequence 1]-[terminator 1]-[RNAi cassette]-[terminator 2 RC]-[coding sequence 2 RC]-[additional sequence 2]. In other embodiments, the transgene can be designed to replace protein production and not silence the endogenous gene. In one embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, 5' to 3', [rare-cutting endonuclease target site 1]-[homology arm 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, 5' to 3', [left end of transposase]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[right end of transposase]. In another embodiment, the structure of the transgene can be, 5' to 3', [homology arm 1]-[coding sequence]-[terminator]-[homology arm 2]. In another embodiment, the structure of the transgene can be, 5' to 3', [left end of transposase]-[coding sequence]-[terminator]-[right end of transposase]. In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[additional sequence 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[rare-cutting endonuclease target site 2].In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[homology arm 1]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[homology arm 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[coding sequence 1]-[terminator 1]-[terminator 2 RC]-[coding sequence 2 RC]-[right end of transposase].

[0111] In one embodiment, this document describes a method to silence and replace the production of a protein of interest by administering a transgene as described in FIG. 17 to a cell and integrating the transgene into an endogenous gene of interest. In one embodiment, the transgene can include an RNAi cassette designed to silence the endogenous gene, a promoter, a partial coding sequence (resistant to silencing), and a splice donor sequence. The promoter can be operably linked to the partial coding sequence, which can be operably linked to a splice donor. The RNAi cassette, promoter, partial coding sequence, and splice donor can flank the first and second homologous arms, or the left and right transposon ends. The transgene can be integrated into an exon or intron within the endogenous gene of interest (FIG. 17), but cannot be integrated into a site that disrupts the endogenous splice acceptor required for the production of the full-length protein. The RNAi can be designed to silence the expression of the endogenous gene of interest, and the partial coding sequence within the transgene can be designed to be resistant to silencing. Thus, the corresponding target site in the complete coding sequence in the transgene can be modified to prevent silencing. In other embodiments, the transgene can include a first and a second splice donor sequence, a first and a second partial coding sequence (both resistant to silencing), a first and a second promoter, and an RNAi cassette. These transgenes can be flanked by additional sequences (e.g., viral ITRs), a first and a second rare-cutting endonuclease target site, left and right transposon ends, or both a first and a second homologous arm and a first and a second rare-cutting endonuclease target site. In one embodiment, the structure of the transgene can be, from 5' to 3', [homologous arm 1]-[RNAi cassette]-[promoter]-[partial coding sequence]-[splice donor]-[homologous arm 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposon]-[RNAi cassette]-[promoter]-[partial coding sequence]-[splice donor]-[right end of transposon].In another embodiment, the structure of the transgene can be, from 5' to 3', [additional sequence 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[additional sequence 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [rare-cutting endonuclease target site 1]-[homology arm 1]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[rare-cutting endonuclease target site 2]. In another embodiment, the structure of the transgene can be, from 5' to 3', [left end of transposase]-[splice donor 1 RC]-[partial coding sequence 1 RC]-[promoter 1 RC]-[RNAi cassette]-[promoter 2]-[partial coding sequence 2]-[splice donor 2]-[right end of transposase]. The transgene can be used to modify the SNCA gene. Mutations in SNCA have been found to cause Parkinson's disease. The transgenes described herein can be used to correct gene expression of SNCA. In some cases, SNCA is duplicated or tripled, leading to excessive production of the alpha-synuclein protein, while in other cases, mutations such as Ala30Pro cause the protein to misfold.The transgenes described herein provide a method to reduce endogenous SNCA expression (from gene duplication and intragenic mutations) while replacing expression of SNCA with some or all of the SNCA isoforms (there are at least six transcripts of SNCA, including the full-length 140aa protein, 126aa protein, 112aa protein, 98aa protein, 67aa protein, and 115aa protein). The SNCA gene contains six exons, with a start codon in exon 2. This document provides transgenes for integration into the SNCA gene. The transgene can include an RNAi cassette targeting exon 1 or exon 2 of SNCA, a promoter, a partial coding sequence encoding a peptide produced by exon 2 of SNCA (wherein the partial coding sequence is resistant to silencing by the RNAi cassette), and a splice donor.

[0112] In one embodiment, the methods provided herein describe the delivery of a transgene with a fully functional silencing-resistant coding sequence and an RNAi silencing sequence (FIG. 9). The functional coding sequence may include a promoter, a nucleic acid sequence that functions to produce an RNA or protein product, and a terminator. The nucleic acid sequence may be customized to avoid silencing by the silencing sequence (FIG. 9). In one embodiment, the transgene may include a silencing sequence that targets the 5'UTR of the transcript. The functional coding sequence in the transgene may include a coding sequence of the silenced gene (either WT or codon-regulated) with an alternative 5'UTR that is not derived from the target gene, or without a 5'UTR. In another embodiment, the transgene may include a silencing sequence that targets the 3'UTR of the transcript. The functional coding sequence in the transgene may include a coding sequence of the silenced gene (either WT or codon-regulated) with an alternative 3'UTR that is not derived from the target gene, or without a 3'UTR. In yet another embodiment, the transgene may include a silencing sequence that targets the coding sequence of the gene. The functional coding sequence may comprise the coding sequence of the silenced gene, and the entire coding sequence or a portion of the coding sequence is modified to avoid silencing by the silencing sequence. Modification may be achieved by methods such as codon optimization / codon tuning, or by deleting the target region. In one embodiment, the transgene described herein, which comprises the silencing sequence and the functional coding sequence, may be transiently delivered to the cell (e.g., by a viral vector or plasmid DNA) or may be integrated into the genome of the cell. In some embodiments, the transgene may be delivered to the cell and comprises one or more genes with gain-of-function mutations (Figure 7).Examples of diseases with gain-of-function mutations include HD (Huntington's disease), SBMA (Spinobulbar muscular atrophy), SCA1 (Spinocerebellar ataxia type 1), SCA2 (Spinocerebellar ataxia type 2), SCA3 (Spinocerebellar ataxia type 3 or Machado-Joseph disease), SCA6 (Spinocerebellar ataxia type 6), SCA7 (Spinocerebellar ataxia type 7), Fragile X syndrome, Fragile XE mental retardation, Friedreich's ataxia, and myotonic dystrophy type 1. , myotonic dystrophy type 2, spinocerebellar ataxia type 8, spinocerebellar ataxia type 12, spinal-bulbar muscular atrophy, JPH3, amyotrophic lateral sclerosis (ALS), hereditary motor and sensory neuropathy type IIC, postsynaptic slow channel congenital myasthenic syndrome, PRPS1 overactivity, Parkinson's disease, tubule aggregate myopathy, achondroplasia, Rubus X-linked mental retardation syndrome, and autosomal dominant retinitis pigmentosa.

[0113] In certain embodiments, the transgene described herein, which comprises a silencing sequence and a functional coding sequence, can be used to silence a specific gene and replace the expression of the gene to correct a gain-of-function disorder.The gene can include SOD1, TRPV4, CHRNA1, CHRND, CHRNE, CHRNB1, PRPS1, LRRK2, STIM1, FGFR3, MECP2, SNCA, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, AR, FXN, DMPK, PABPN1, ATXN8, RHO, and C9orf72.

[0114] The transgenes described herein, including silencing sequences and functional coding sequences, can be delivered to cells using viral (e.g., AAV vectors) or non-viral methods. In certain embodiments, the AAV vectors described herein can be derived from any AAV. In certain embodiments, the AAV vectors are derived from defective and non-pathogenic Parvoviridae adeno-associated type 2 viruses. All such vectors are derived from plasmids that only carry the 145bp inverted terminal repeats of AAV adjacent to the expression cassette of the transgene. Efficient gene transport and stable transgene delivery by integration into the genome of transduced cells are key features of this vector system. (Wagner et al., Lancet 351:9117 1702-3, 1998; Kearns et al., Gene Ther. 9:748-55, 1996). Other AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh.10, as well as any new AAV serotypes, can also be used according to the present invention.In some embodiments, chimeric AAVs are used, and the viral origin of the long terminal repeat (LTR) sequence of viral nucleic acid is heterologous to the viral origin of the capsid sequence.Non-limiting examples include chimeric viruses that have LTR from AAV2 and capsid from AAV5, AAV6, AAV8, or AAV9 (i.e., AAV2 / 5, AAV2 / 6, AAV2 / 8, and AAV2 / 9, respectively).

[0115] The constructs described herein can also be incorporated into adenovirus vector systems. Adenovirus-based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. Such vectors can provide high titers and high levels of expression.

[0116] The methods and compositions described herein are applicable to any eukaryotic organism that is desired to modify through genome modification.Eukaryotic organisms include plants, algae, animals, fungi, and protists.Eukaryotic organisms can also include plant cells, algae cells, animal cells, fungal cells, and protist cells.

[0117] Exemplary mammalian cells include oocytes, K562 cells, CHO (Chinese hamster ovary) cells, HEP-G2 cells, BaF-3 cells, Schneider cells, COS cells (monkey kidney cells expressing the SV40 T-antigen), CV-1 cells, HuTu80 cells, NTERA2 cells, NB4 cells, HL-60 cells, and HeLa cells, 293 cells (see, e.g., Graham et al. (1977) J. Gen. Virol. 36:59), and myeloma cells such as SP2 or NS0 (see, e.g., Galfre et al. (1989) J. Gen. Virol. 36:59). and Milstein (1981) Meth.Enzymol.73(B):3 46) can also be used. Also peripheral blood mononuclear cells (PBMC) or T cells can be used, as well as embryonic stem cells and adult stem cells. For example, stem cells that can be used include embryonic stem cells (ES), induced pluripotent stem cells (iPSC), mesenchymal stem cells, hematopoietic stem cells, liver stem cells, skin stem cells, and neural stem cells.

[0118] The methods and compositions of the present invention can be used to produce modified organisms. The recombinant organisms can be small mammals, companion animals, livestock, and primates. Non-limiting examples of rodents can include mice, rats, hamsters, gerbils, and guinea pigs. Non-limiting examples of companion animals can include cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock can include horses, goats, sheep, pigs, llamas, alpacas, and cows. Non-limiting examples of primates can include capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. The methods and compositions of the present invention can be used in humans.

[0119] Exemplary plants and plant cells that can be modified using the methods described herein include, but are not limited to, monocotyledonous plants (e.g., wheat, corn, rice, foxtail millet, barley, sugarcane), dicotyledonous plants (e.g., soybean, potato, tomato, alfalfa), fruit crops (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot, potato, sugar beet, yam), leafy vegetable crops (e.g., lettuce, spinach). , plant crops for consumption (e.g., soybeans and other legumes, pumpkin, peppers, eggplant, celery, etc.), flowering plants (e.g., petunias, roses, chrysanthemums), conifers and pines (e.g., pine, fir, spruce), poplar trees (e.g., P. tremula x P. alba), fiber crops (cotton, jute, flax, bamboo), plants used for phytoremediation (e.g., heavy metal accumulating plants), oil crops (e.g., sunflower, rapeseed), and plants used for experimental purposes (e.g., Arabidopsis thaliana). The methods disclosed herein can be used in Asparagus, Avena, Brassica, Citrus, Melon, Capsicum, Cucumber, Carrot, Artemisia, Soybean, Cotton, Barley, Lactuca, Solanum, Tomato, Apple, Cassava, Tobacco, Porcine, Rice, Alligator Pear, Phaseolus, Pea, Pear, Cherry, Radish, Rye, Solanum, Sorghum, Wheat, Vitis, Vitis, and Maize. The term plant cell includes isolated plant cells, as well as whole plants or parts of whole plants, such as seeds, calluses, leaves, and roots. The present disclosure also encompasses the seeds of the plants described above, which are modified using the compositions and / or methods described herein. The present disclosure further encompasses progeny, clones, cell lines or cells of the transgenic plants described above, which progeny, clones, cell lines or cells carry the transgene or gene construct.Exemplary algae species include microalgae, diatoms, Botryococcus braunii, Chlorella, Dunaliella tertiolecta, Gracileria, Pleurochrysis carterae, Sorghum, and Ulva.

[0120] The methods described herein can include the use of rare-cutting endonucleases to stimulate homologous recombination or non-homologous integration of transgene molecules into endogenous genes. Rare-cutting endonucleases can include CRISPR, TALEN, or zinc finger nucleases (ZFNs). CRISPR systems can include CRISPR / Cas9 or CRISPR / Cas12a (Cpf1). CRISPR systems can include variants that exhibit broad PAM capabilities (Hu et al., Nature 556, 57-63, 2018; Nishimasu et al., Science DOI: 10.1126, 2018), or variants that exhibit higher on-target binding or cleavage activity (Kleinstiver et al., Nature 529: 490-495, 2016). Gene editing reagents include nucleases (Mali et al., Science 339:823-826, 2013; Christian et al., Genetics 186:757-761, 2010), nickases (Cong et al., Science 339:819-823, 2013; Wu et al., Biochemical and Biophysical Research 186:757-761, 2010), and cyclases (Cong et al., Science 339:819-823, 2013). Communications 1:261-266, 2014), CRISPR-FokI dimers (Tsai et al., Nature Biotechnology 32:569-576, 2014), or CRISPR·nickase pairs (Ran et al. al., Cell 154:1380-1389, 2013).

[0121] The methods and compositions described herein can be used in situations where it is desired to modify the 5' end of the coding sequence of an endogenous gene.For example, patients with SCA2 have an expanded CAG repeat in exon 1. Patients with SCA2 can benefit from replacing exon 1.In another example, patients with genetic disorders caused by loss-of-function mutations in the 5' end of an endogenous gene can benefit from replacing the first exon of the gene.

[0122] Furthermore, the methods and compositions described in this document can be used in situations where it is desirable to treat a gain-of-function genetic disorder while ensuring that wild-type protein is still produced. For example, patients with retinitis pigmentosa who have a gain-of-function mutation in the RHO gene can benefit from a therapy that includes a transgene that can silence the endogenous RHO gene and simultaneously produce wild-type RHO protein. Additional advantages of this approach include the ability to select target sites for silencing that are not centered around the gain-of-function mutation site. This advantage allows for the design of effective silencing constructs (e.g., low off-targeting and highly effective on-targeting), allowing for the design of monotherapy for patients with gain-of-function mutations in different regions of the RHO gene. Furthermore, the method may be particularly useful in Parkinson's disease and gain-of-function disorders due to genes that produce multiple isoforms, including SNCA. Cells with a gain-of-function mutation at the 5' end of the SNCA gene can benefit from the integration of an RNAi cassette targeting exon 2 with a transgene that includes a promoter and a partial coding sequence that is resistant to RNAi silencing.

[0123] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES

[0124] Example 1: Targeted integration of DNA in the ATXN2 gene Three plasmids were constructed with transgenes designed to integrate into the ATXN2 gene in human cells. All transgenes were designed to integrate within intron 2 of the ATXN2 gene, and all transgenes were designed to insert bidirectional partial coding sequences with their respective promoters. The partial coding sequences encode peptides produced by exon 1 of the ATXN2 gene. The first plasmid (designated pBA1141) contained left and right homology arms with sequences homologous to the beginning of intron 1 (i.e., successful gene targeting results in the insertion of the cargo of pBA1141 into intron 1). Included between the homologous arms, from 5' to 3', was a splice donor in reverse complementary orientation, partial coding sequence 1 with codon adjustments in reverse complementary orientation (encoding a peptide produced by exon 1 of the ATXN2 gene), an EF1α promoter in reverse complementary orientation, a CMV promoter, partial coding sequence 2 with codon adjustments (encoding a peptide produced by exon 1 of the ATXN2 gene), and a splice donor. The sequence of the pBA1141 transgene is shown in SEQ ID NO: 15 (FIG. 6). Two nucleases were designed to facilitate integration of pBA1141 into the genome: Cas9, with target site (TGTGCAGGAGGGCCTGTTGGGGG, SEQ ID NO: 16), and Cas12a, with target site (TTTCCCTTGTGCCTCAAGTCCATCCGT, SEQ ID NO: 17). Target sites were also included in pBA1141 to facilitate release of the donor molecule from the plasmid. The individual components within pBA1141 are shown in SEQ ID NOs: 18-24. SEQ ID NO: 18 is a sequence that contains both Cas9 and Cas12a target sites. SEQ ID NO: 19 contains the sequence of the left homologous arm. SEQ ID NO: 20 contains the reverse complement of the codon-regulated portion of the non-pathogenic ATXN2 gene (exon 1). SEQ ID NO: 21 contains the reverse complement of the EF1α promoter. SEQ ID NO: 22 contains the reverse complement of the CMV promoter. SEQ ID NO: 23 contains the codon-regulated portion of the non-pathogenic ATXN2 gene (exon 1). SEQ ID NO: 24 contains the sequence of the right homologous arm. A second plasmid (designated pBA1142) contains the same cargo as pBA1135, but with the homologous arm removed.The nuclease target site was retained to facilitate the release of the transgene from the plasmid. Successful cleavage of the plasmid was expected to release the transgene, thereby allowing the sequence to be used for integration into the ATXN2 gene by NHEJ. The sequence of pBA1141 is shown in SEQ ID NO: 25. A third plasmid (designated pBA1143) contained the same sequence as pBA1141, except that the sequence carrying the nuclease target site (upstream of the left homology arm) was removed and the right homology arm was shortened to 600 bp.

[0125] Transfections were performed using HEK293T cells. HEK293T cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. HEK293T cells were transfected with 2ug of donor, 2ug of guide RNA (RNA format), and 2ug of Cas9 (RNA format) or 2ug of Cas12a plasmid (DNA format). Transfections were performed using electroporation. 72 hours after transfection, genomic DNA was isolated and evaluated for integration events. A list of primers used to detect integration or genomic DNA is shown in Table 1. [Table 1-1] [Table 1-2]

[0126] PCR was performed on genomic DNA to detect integration of pBA1141, pBA1142 and pBA1143. For pBA1143, the transgene was designed to be precisely integrated by HR. Thus, bands were detected in the PCR of the 3' junction for both Cas9 and Cas12a transfected samples, indicating precise insertion into intron 1 (Figure 17 lanes 7-10). The expected band sizes were 1,225 bp (lanes 7 and 9), and 1,407 bp (lanes 8 and 10). Primers oNJB201+oNJB190, and oNJB202+oNJB191 were used for PCR of the 3' junction. For pBA1142, since no homologous arms were present, the transgene was predicted to be inserted via NHEJ insertion. Integration by NHEJ in the Cas9 transfected sample can be seen in lane 6 of Figure 17. The expected band size was 813 bp. Primers oNJB202+oNJB211 were used for PCR of the NHEJ insertion 3' junction. For pBA1141, both the homology arms and the nuclease cleavage site were present on the transgene (Figure 7). Integration by HR was observed in lanes 2-4 of Figure 17, and integration by NHEJ was observed in lane 5 of Figure 17. The expected sizes for PCR detection of insertion by HR were 1594bp (lane 2, primers oNJB201+oNJB190), 1775bp (lane 3, primers oNJB202+oNJB191), and 1775bp (lane 4, primers oNJB202+oNJB191). The expected sizes for PCR detection of insertion by NHEJ were 2067bp (lane 5, primers oNJB202+oNJB211).

[0127] The results show that the described transgenes, which contain bidirectional partial coding sequences with promoters, can be integrated into genomic DNA via multiple different repair pathways.

[0128] HEK293T cells are used for transfection. HEK293T cells are maintained in DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. HEK293T cells were transfected with 2ug of donor, 2ug of guide RNA (RNA format), and 2ug of Cas9 (RNA format) or 2ug of Cas12a plasmid (DNA format). Electroporation is used for transfection. Single cell clones containing integrations are isolated and RNA is extracted. RNA sequencing can be used to detect new transcripts.

[0129] Example 2: Silencing of endogenous SOD1 gene expression and expression of replacement SOD1 protein This document describes methods for using RNAi, RNAi-resistant coding sequences, and gene editing to silence and replace expression of endogenous genes. These methods are particularly useful for gain-of-function disorders, including amyotrophic lateral sclerosis, which have mutations in the SOD1 gene.

[0130] To verify gene silencing and replacement, a transgene was designed with an RNAi (shRNA) cassette target sequence within exon 2 of SOD1. The shRNA contained the sequence GGCCTGCATGGATTCCATGTTCAAGAGACATGGAATCCATGCAGGCC (SEQ ID NO: 49) and was placed downstream of the U6 promoter. The transgene also contained the SOD1 coding sequence downstream of the CMV promoter. A sequence within the coding sequence was modified to avoid shRNA silencing. The sequence of the transgene (designated pBA1148) is shown in SEQ ID NO: 10. A control vector was generated that contained a scrambled shRNA (designated pBA1147, SEQ ID NO: 53) and the coding sequence of WT SOD1 (designated pBA1149, SEQ ID NO: 54).

[0131] Transfection was performed using HEK293T cells. HEK293T cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. HEK293T cells were transfected with 2ug of plasmid. Transfection was performed using electroporation. 48 hours after transfection, RNA was isolated and SOD1 mRNA levels were evaluated.

[0132] To silence expression of the SOD1 gene using gene editing and produce a replacement SOD1 protein, two vectors are designed to be integrated into intron 1. The first vector contains, from 5' to 3', a left homology arm, a splice acceptor, a partial coding sequence of SOD1 encoding the peptide produced by exons 2-5 (and also including mutations to avoid silencing by the RNAi cassette), a terminator, an RNAi cassette with the shRNA sequence shown in SEQ ID NO:49, and a right homology arm. The second vector comprises, from 5' to 3', a nuclease target site, a splice acceptor, a partial coding sequence of SOD1 encoding a peptide produced by exons 2 to 5 (and also including mutations to avoid silencing by the RNAi cassette), a terminator, an RNAi cassette having an shRNA sequence shown in SEQ ID NO: 49, a second terminator in a reverse complementary orientation, a second partial coding sequence of SOD1 in a reverse complementary orientation encoding a peptide produced by exons 2 to 5 (and also including mutations to avoid silencing by the RNAi cassette), a second splice acceptor in a reverse complementary orientation, and a second nuclease target site (Figure 12).

[0133] Two additional vectors are designed to integrate into intron 3 of the SOD1 gene. The first vector contains, from 5' to 3', a left homology arm, an RNAi cassette with the shRNA sequence shown in SEQ ID NO: 49, a promoter, a partial coding sequence of SOD1 encoding the peptide produced by exons 1 and 2 (and also containing mutations to avoid silencing by the RNAi cassette), a splice donor, and a right homology arm. The second vector contains, from 5' to 3', a nuclease target site, a splice donor in a reverse complementary orientation, a partial coding sequence of SOD1 in a reverse complementary orientation that encodes a peptide produced by exons 1 and 2 (and also includes mutations to avoid silencing by the RNAi cassette), a promoter in a reverse complementary orientation, an RNAi cassette having an shRNA sequence shown in SEQ ID NO: 49, a second promoter, a second partial coding sequence of SOD1 that encodes a peptide produced by exons 1 and 2 (and also includes mutations to avoid silencing by the RNAi cassette), a splice donor, and a second nuclease target site (Figure 16).

[0134] HEK293T cells are used for transfection. HEK293T cells are maintained in DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. HEK293T cells are transfected with 2ug of plasmid, 2ug of guide RNA (RNA format), and 2ug of Cas9 (RNA format). Transfection is performed using electroporation. 72 hours after transfection, DNA is isolated and evaluated for transgene integration. Clones containing integration events are isolated and evaluated for SOD1 mRNA levels (both from the endogenous gene and from the modified gene).

[0135] Example 3: Silencing of endogenous SNCA gene expression and expression of two SNCA protein isoforms Mutations in SNCA have been found to cause Parkinson's disease. The methods described herein can be used to correct gene expression of SNCA. In some cases, SNCA is duplicated or tripled, resulting in excessive production of alpha-synuclein protein. In other cases, mutations such as Ala30Pro cause protein misfolding. Described herein are methods to reduce expression of endogenous SNCA (from gene duplication and intragenic mutations) while replacing some or all of SNCA and SNCA isoforms (at least six existing SNCA transcripts, including full-length 140aa protein, 126aa protein, 112aa protein, 98aa protein, 67aa protein, and 115aa protein).

[0136] The transgene was designed to carry an shRNA to silence the expression of the endogenous SNCA gene. The transgene was also designed to replace two SNCA protein isoforms by encoding two open reading frames, one for each isoform. The shRNA contains a 19 nt hairpin sequence that targets the 3' end of the coding sequence of SNCA (GGTATCAAGACTACGAAC, SEQ ID NO: 11). The two SNCA open reading frames in the transgene were designed to carry mutations at the shRNA target sites. SEQ ID NO: 12 shows the nucleic acid sequence of the transgene cloned into an expression plasmid (designated pBA1153). Two other transgenes were constructed: the first one with the shRNA and two wild-type SNCA isoforms (without mutations that prevent shRNA silencing), and the second one with the scrambled shRNA and the SNCA isoforms with two mutations.

[0137] The transgene is transfected into HEK293 cells. The HEK293 cells are maintained in DMEM high glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution (×100), without L-glutamine and sodium pyruvate, at 37° C. and 5% CO2. The HEK293 cells are transfected with each of the plasmid constructs and their combinations using Lipofectamine3000. 48 hours after transfection, RNA is extracted and the transcription level of SNCA is evaluated. Reduction of the expression of endogenous SNCA RNA and expression of RNA from the codon-regulated SNCA sequence indicates the functionality of the transgene.

[0138] To silence expression of the SNCA gene using gene editing to produce a replacement SNCA protein while maintaining isoform production, two vectors are designed to be integrated into the exon 2-intron 2 junction. The first vector contains, from 5' to 3', a left homology arm, an RNAi cassette with an shRNA sequence targeting the exon 2 transcription sequence, a promoter (including 1,000 bp of the endogenous SNCA promoter), a start codon and a partial coding sequence encoding the peptide produced by exon 2 of the endogenous SNCA gene (and also includes mutations to avoid silencing by the RNAi cassette), a splice donor, and a right homology arm. The splice donor and right homology arm are sequences derived from the 5' end of the endogenous intron 2. The second vector contains, from 5' to 3', a nuclease target site, a splice donor in a reverse complementary orientation, a partial coding sequence of SNCA in a reverse complementary orientation that encodes a peptide produced by exon 2 (and also includes a mutation to avoid silencing by the RNAi cassette), a promoter in a reverse complementary orientation, an RNAi cassette with an shRNA targeting exon 2, a second promoter, a second partial coding sequence of SNCA that encodes a peptide produced by exon 2 (and also includes a mutation to avoid silencing by the RNAi cassette), a splice donor, and a second nuclease target site (Figure 16). The splice donor sequence is a splice donor sequence from intron 2 of the SNCA gene. The nuclease is designed to promote integration of the transgene into the exon 2-intron 2 junction.

[0139] The transgene and nuclease are transfected into HEK293 cells. The HEK293 cells are maintained in DMEM high glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution (×100), without L-glutamine and sodium pyruvate, at 37° C. and 5% CO2. The HEK293 cells are transfected with each of the plasmid constructs and their combinations using Lipofectamine3000. Clones containing integration events are isolated and RNA is extracted. Reduction of expression of endogenous SNCA RNA and expression of RNA from the modified SNCA gene indicate functionality of the transgene.

[0140] Example 4: Silencing expression of endogenous RHO genes and expression of replacement RHO proteins The transgene is designed to carry the shRNA that silences the expression of endogenous RHO gene and the open reading frame that codes for wild-type RHO protein.The sequence of RHO protein is shown in SEQ ID NO: 13.The silencing sequence carries a hairpin sequence that targets endogenous RHO transcript.The RHO open reading frame in the transgene is codon-adjusted to contain minimal sequence homology at the shRNA target site.

[0141] The transgene is transfected into HEK293 cells. The HEK293 cells are maintained in DMEM high glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution (×100), without L-glutamine and sodium pyruvate, at 37° C. and 5% CO2. The HEK293 cells are transfected with each of the plasmid constructs and their combinations using Lipofectamine3000. Three days after transfection, RNA is extracted from the cells and transcript levels are evaluated. Reduction in the expression of endogenous RHO RNA and expression of RNA from codon-regulated RHO sequences indicate the functionality of the transgene.

[0142] Example 5: Silencing of endogenous C9orf72 gene expression and expression of replacement C9orf72 protein The transgene is designed to carry shRNA that silences the expression of endogenous C9orf72 gene and an open reading frame that codes for wild-type C9orf72 protein.The sequence of C9orf72 protein is shown in SEQ ID NO: 14.The silencing sequence carries a hairpin sequence that targets endogenous C9orf72 transcript.The open reading frame of C9orf72 in the transgene is codon-adjusted to contain minimal sequence homology at the target site of shRNA.

[0143] The transgene is transfected into HEK293 cells. The HEK293 cells are maintained in DMEM high glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution (×100), without L-glutamine and sodium pyruvate, at 37° C. and 5% CO2. The HEK293 cells are transfected with each of the plasmid constructs and their combinations using Lipofectamine3000. Three days after transfection, RNA is extracted from the cells and transcript levels are evaluated. Reduction in the expression of endogenous C9orf72 RNA and expression of the codon-regulated C9orf72 sequence indicate the functionality of the transgene.

[0144] Example 6: Targeted integration of DNA in the ATXN2 gene A transgene targeting ATXN2 is designed to replace the 5' end of the ATXN2 coding sequence. A plasmid designated pBA1012-D1 is constructed with a transgene designed to integrate the WT coding sequence into intron 1 of the ATXN2 gene (Figure 4). The transgene contains a splice donor site in intron 1 (SEQ ID NO:2) followed by a first homologous arm homologous to the sequence. Adjacent to the first homologous arm is a target site for the Cas9 nuclease. The first homologous arm is followed by the reverse complement splice donor sequence and exon 1 of the ATXN2 gene (non-expanded CAG repeat sequence, SEQ ID NO:3). Following the first coding sequence is the EF1α promoter (SEQ ID NO:4). In a head-to-head orientation, there is a second set of functional elements. The start of the second set of elements contains a CMV promoter (SEQ ID NO:5) that drives expression of the coding sequence of the codon-regulated exon 1 of the ATXN2 gene (SEQ ID NO:6). The coding sequence is followed by a splice donor site and a second homologous arm. The second homologous arm contains a rare-cutting endonuclease target site (SEQ ID NO:8). The sequence of the transgene is shown in SEQ ID NO:1.

[0145] The corresponding Cas9 nuclease is designed to generate three double-stranded breaks: 1) within intron 1 of the endogenous ATXN2 gene, 2) adjacent to the first homologous arm within the pBA1012-D1 transgene, and 3) within the second homologous arm within the pBA1012-D1 transgene. The target sequence for the Cas9 nuclease is shown in SEQ ID NO:8.

[0146] Verification of the functionality of the transgene and CRISPR vector is achieved by transfection of HEK293 cells. HEK293 cells are maintained at 37°C and 5% CO2 in DMEM high glucose medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution (x100), without L-glutamine and sodium pyruvate. HEK293 cells are transfected with each of the plasmid constructs and their combinations using Lipofectamine3000. Two days after transfection, DNA is extracted and evaluated for mutations and targeted insertions within the ATXN2 gene. Nuclease activity is analyzed using the Cel-I assay or by deep sequencing of amplicons containing the CRISPR / Cas9 target sequence. Successful integration of the transgene is analyzed using PCR.

[0147] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the above description is intended to be illustrative, and not limiting, of the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

[Claim 1] The invention described in the specification.

Images