Pluripotent stem cell, neurocyte, and application of the same

Abstract

To provide a neurocyte in which intracellular tau can be visualized and quantitatively determined without using an exogenous promoter, and a pluripotent stem cell that can produce the neurocyte, a screening method of a substance using the pluripotent stem cell or neurocyte, a substance screened by the method, and a kit including Targeting vector and gRNA.SOLUTION: A pluripotent stem cell has a DNA encoding a reporter molecule which is introduced adjacent to an endogenous tau gene such that tau protein is expressed as fusion protein with a reporter molecule.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a pluripotent stem cell modified to express tau protein as a fusion protein with a reporter molecule.The present invention further relates to a nerve cell differentiated from the pluripotent stem cell.The present invention further relates to a method for screening a substance using the pluripotent stem cell or nerve cell, and a substance screened by the method.The present invention further relates to a kit including a targeting vector and gRNA. [Background technology]

[0002] Since the onset mechanisms of neurodegenerative diseases such as Alzheimer's disease are diverse, research and development of therapeutic drugs based on various mechanisms is expected. Tau is thought to be a major factor involved in the onset of neurodegenerative diseases, and increases in the brains of patients with neurodegenerative diseases. It has also been reported that there is a correlation between the amount of tau accumulation and cognitive decline, and tau is expected to be a therapeutic target for neurodegenerative diseases. However, it is still unclear how tau accumulation is caused, how to control tau accumulation to lead to treatment, and what is happening downstream of tau accumulation and how it should be controlled. Therefore, it was hoped to establish human nerve cells that can visualize and quantify the increase and decrease of tau and localization changes in cells as a research tool for drug discovery targeting tau.

[0003] There are reports on a cell evaluation system that uses a fusion gene of tau fluorescent protein to visualize and quantify intracellular tau. For example, Non-Patent Document 1 describes a method of externally introducing an RFP-Tau gene into non-neuronal cells (HEK293T) that do not express tau, artificially expressing RFP-Tau by controlling an exogenous promoter, and quantifying the colocalization of tau and microtubules by RFP fluorescence, and a method of quantifying RFP-Tau protein by Western blotting. In Non-Patent Document 1, in addition to the cells being non-neuronal cells, the expression is artificially expressed by an exogenous promoter, and the expression in neurons dependent on the promoter of the tau gene itself, or the expression and distribution of tau in neurons is not measured. Non-Patent Document 2 describes the introduction of mutant Tau-GFP into mice, promoting expression by an exogenous promoter, and visualizing the localization and expression amount of tau in the mouse brain by GFP fluorescence. Non-Patent Document 3 also describes the forced expression of tau by an exogenous promoter.

[0004] Non-Patent Document 4 describes the generation of nerve cells from human iPS cells by expressing Ngn2 (Tet-on). In Non-Patent Document 4, expressed tau is quantified by fluorescent staining.

[0005] Patent Document 1 describes a system for evaluating the presence or absence of splicing at a specific site of a specific gene in a cell line by the expression of GFP. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Human Molecular Genetics, 2015, Vol. 24, No. 14 3971-3981 [Non-Patent Document 2] J Neurosci. 2017 Nov 22; 37(47): 11485-11494 [Non-Patent Document 3] Neuron. 2007 Feb 1;53(3):337-51 [Non-Patent Document 4] Stem Cell Reports. 2017 Oct 10; 9(4): 1221-1233 [Patent documents]

[0007] [Patent Document 1] International Publication No. WO2008 / 102903 Summary of the Invention [Problem to be solved by the invention]

[0008] Tau expressed using an exogenous promoter as described in Non-Patent Documents 1 to 3 may have different intracellular distribution and function from that in the human body. In addition, since the structure of tau protein and the isoforms expressed are different between mice and humans, the binding and release patterns of tau in and out of nerve cells may be different. Furthermore, it has been reported that human nerve cells are more vulnerable to neurotoxic substances than mouse nerve cells in Alzheimer's disease model mice, and that tau pathology is strongly expressed, so that the response of nerve cells via tau may differ depending on the species. Therefore, it was expected to establish cells that can visualize tau expressed under the control of endogenous tau expression in human nerve cells and enable simple evaluation of the amount and localization of tau expression. In addition, in Non-Patent Document 4, fluorescent staining is used, so it is difficult to control the variation in the staining operation (such as cell peeling), and it is highly likely that not all tau molecular species can be visualized due to the specificity of the antibody. In addition, the quantitative accuracy depends on the properties of the antibody.

[0009] The present invention aims to provide a neuron capable of visualizing and quantifying intracellular tau without using an exogenous promoter, and a pluripotent stem cell capable of producing the neuron. The present invention also aims to provide a method for screening a substance using the pluripotent stem cell or neuron, and a substance screened by the method. The present invention also aims to provide a kit including a targeting vector and gRNA. [Means for solving the problem]

[0010] As a result of intensive research by the present inventors to solve the above problems, first, a DNA encoding a reporter molecule was introduced adjacent to an endogenous tau gene to produce a pluripotent stem cell capable of expressing tau protein as a fusion protein with the reporter molecule. The present inventor then differentiated the above pluripotent stem cell into a neuron, thereby succeeding in producing a neuron capable of visualizing and analyzing intracellular tau. The present invention was completed based on the above findings.

[0011] That is, according to the present invention, the following inventions are provided. <1> A pluripotent stem cell having DNA encoding a reporter molecule introduced adjacent to the endogenous tau gene such that the tau protein is expressed as a fusion protein with the reporter molecule. <2> The pluripotent stem cells are human pluripotent stem cells; <1> A pluripotent stem cell according to claim 1. <3> The pluripotent stem cells are induced pluripotent stem cells; <1> or <2> A pluripotent stem cell according to claim 1. <4> The reporter molecule is a fluorescent protein; <1> from <3> 10. The pluripotent stem cell according to any one of the above items. <5> DNA encoding a reporter molecule is located upstream of the endogenous tau gene. <1> from <4> 10. The pluripotent stem cell according to any one of the above items. <6> <1> from <5> A neural cell differentiated from the pluripotent stem cell according to any one of the above items. <7> A fusion protein of a tau protein and a reporter molecule is expressed. <6> A neuron according to claim 1. <8> A neuronal cell having DNA encoding a reporter molecule introduced adjacent to the endogenous tau gene such that the tau protein is expressed as a fusion protein with the reporter molecule. <9> The cell line is a neuronal cell line or a primary neuronal cell line. <8> A neuron according to claim 1. <10> The reporter molecule is a fluorescent protein; <8> or <9> A neuron according to claim 1. <11> DNA encoding a reporter molecule is located upstream of the endogenous tau gene. <8> from <10> A nerve cell according to any one of the above. <12> <1> from <5> The pluripotent stem cell according to any one of the above or <6> from <11> 2. A method for screening a substance, which uses the nerve cell according to any one of the above items 1 to 11. <13> The increase or decrease in the expression level of tau or the distribution of tau in cells is evaluated based on the expression of a reporter molecule. <12> The method according to <14> The increase or decrease in the expression level of tau is evaluated based on the expression intensity of the reporter molecule. <12> or <13> The method according to <15> <12> from <14> A substance screened by any one of the methods described above. <16> A kit that includes a targeting vector containing DNA encoding homology arms upstream and downstream of the tau gene insertion site and a reporter molecule, and gRNA that determines the cleavage site of the tau gene. <17> a homology arm upstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO: 1, and a homology arm downstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO: 2, or a homology arm upstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO: 3, and a homology arm downstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO: 4. <16> The kit according to claim 1, <18> The gRNA targets a sequence having 90% or more identity to the sequence set forth in SEQ ID NO: 5 or 6. <17> The kit according to claim 1, Effect of the Invention

[0012] The pluripotent stem cells and neural cells of the present invention make it possible to evaluate the expression level and distribution of endogenous tau in cells. The pluripotent stem cells and neural cells of the present invention do not require the introduction of an exogenous tau gene, and the expression of endogenous tau can be evaluated without the use of an exogenous promoter. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 shows TagGFP2 fusion to the N-terminus of the MAPT gene by CRISPR-Cas9. [Diagram 2] FIG. 2 shows TagGFP2 fusion to the C-terminus of the MAPT gene by CRISPR-Cas9. [Diagram 3] FIG. 3 shows the map of the CSIV-miR9 / 9*-124-mRFP1-TRE-EF-BsdT vector. [Figure 4] FIG. 4 shows a schematic diagram of the vectors used for neuronal induction. [Diagram 5] FIG. 5 shows TagGFP2-Tau fluorescence in iPS cell-derived neurons. [Figure 6] FIG. 6 shows the results of fluorescent Tau quantification and bright field neurite length analysis. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The present invention will be described in detail below. In this specification, "NP_", "NM_", and "NG_" and the numbers following them respectively represent the ID of the amino acid sequence (NP_~), the nucleotide sequence of the transcript (NM_~), and the genomic DNA sequence (NG_~) registered as reference sequences in the NCBI (National Center for Biotechnology Information) database.

[0015] <Pluripotent stem cells> The pluripotent stem cells of the present invention have DNA encoding a reporter molecule introduced adjacent to the endogenous tau gene such that tau protein is expressed as a fusion protein with the reporter molecule.

[0016] "Pluripotent stem cells" refer to cells that have both the ability to differentiate into all cells that make up a living body (pluripotency) and the ability to produce daughter cells with the same differentiation ability through cell division (self-renewal ability). Pluripotency can be evaluated by transplanting the cells to be evaluated into nude mice and testing for the presence or absence of teratoma formation containing cells from each of the three germ layers (ectoderm, mesoderm, and endoderm).

[0017] Examples of pluripotent stem cells include embryonic stem cells (ES cells), embryonic germ cells (EG cells), induced pluripotent stem cells (iPS cells), etc., but are not limited thereto as long as the cells have both pluripotency and self-replication ability. Preferably, ES cells or iPS cells are used. More preferably, iPS cells are used. The pluripotent stem cells are preferably mammalian cells (e.g., primates such as humans and chimpanzees, and rodents such as mice and rats). The pluripotent stem cells are particularly preferably human pluripotent stem cells. In the most preferred embodiment of the present invention, human iPS cells are used as the pluripotent stem cells.

[0018] ES cells can be established, for example, by culturing early pre-implantation embryos, inner cell masses constituting the above-mentioned early embryos, single blastomeres, etc. (Manipulating the Mouse Embryo A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1994); Thomson, JA et al., Science, 282, 1145-1147 (1998)). As the early embryo, an early embryo produced by nuclear transfer of the nucleus of a somatic cell may be used (Wilmut et al. (Nature, 385, 810 (1997)), Cibelli et al. (Science, 280, 1256 (1998)), Akira Iritani et al. (Protein Nucleic Acid Enzymes, 44, 892 (1999)), Baguisi et al. (Nature Biotechnology, 17, 456 (1999)), Wakayama et al. (Nature, 394, 369 (1998); Nature Genetics, 22, 127 (1999); Proc. Natl. Acad. Sci. USA, 96, 14984 (1999)), Rideout III et al. (Nature Genetics, 24, 109 (2000), Tachibana et al. (Human Embryonic Stem Cells Derived by Somatic Cell Nuclear Transfer, Cell (2013) in press). Parthenogenetic embryos may be used as the initial locus (Kim et al. (Science, 315, 482-486 (2007)), Nakajima et al. (Stem Cells, 25, 983-985 (2007)), Kim et al. (Cell Stem Cell, 1, 346-352 (2007)), Revazova et al. (Cloning Stem Cells, 9, 432-449 (2007)), Revazova et al. (Cloning Stem Cells, 10, 11-24 (2008)).In addition to the above-mentioned papers, for the production of ES cells, references include Strelchenko N., et al. Reprod Biomed Online. 9: 623-629, 2004; Klimanskaya I., et al. Nature 444: 481-485, 2006; Chung Y., et al. Cell Stem Cell 2: 113-117, 2008; Zhang X., et al. Stem Cells 24: 2669-2676, 2006; Wassarman, PM et al. Methods in Enzymology, Vol. 365, 2003, etc. It should be noted that fused ES cells obtained by cell fusion between ES cells and somatic cells are also included in the embryonic stem cells used in the method of the present invention.

[0019] Some ES cells are available from collections or commercially available, for example, human ES cells are available from the Institute for Frontier Medical Sciences, Kyoto University (e.g., KhES-1, KhES-2, and KhES-3), WiCell Research Institute, ESI BIO, etc.

[0020] EG cells can be established by culturing primordial germ cells in the presence of LIF (leukemia inhibitory factor), bFGF (basic fibroblast growth factor), and SCF (stem cell factor), for example (Matsui et al., Cell, 70, 841-847 (1992); Shamblott et al., Proc. Natl. Acad. Sci. USA, 95 (23), 13726-13731 (1998); Turnpenny et al., Stem Cells, 21 (5), 598-609, (2003)).

[0021] "Induced pluripotent stem cells (iPS cells)" are cells that have pluripotency (multi-differentiation ability) and proliferation ability, and are produced by reprogramming somatic cells by introducing reprogramming factors. Induced pluripotent stem cells exhibit properties similar to ES cells. The somatic cells used to produce iPS cells are not particularly limited, and may be differentiated somatic cells or undifferentiated stem cells. The origin of the somatic cells is also not particularly limited, but preferably somatic cells of mammals (e.g., primates such as humans and chimpanzees, and rodents such as mice and rats), and more preferably somatic cells of humans, are used. iPS cells can be produced by various methods reported so far. It is also naturally expected that iPS cell production methods developed in the future will be applied.

[0022] The most basic method for generating iPS cells is to introduce the four transcription factors Oct3 / 4, Sox2, Klf4, and c-Myc into cells using a virus (Takahashi K, Yamanaka S: Cell 126 (4), 663-676, 2006; Takahashi, K, et al: Cell 131(5), 861-72, 2007). There is a report on the establishment of human iPS cells by introducing the four factors Oct4, Sox2, Lin28, and Nonog (Yu J, et al: Science 318(5858), 1917-1920, 2007). It has also been reported that iPS cells can be established by introducing three factors other than c-Myc (Nakagawa M, et al: Nat. Biotechnol. 26(1), 101-106, 2008), two factors Oct3 / 4 and Klf4 (Kim JB, et al: Nature 454(7204), 646-650, 2008), or only Oct3 / 4 (Kim JB, et al: Cell 136(3), 411-419, 2009). In addition, a method of introducing a protein, which is the product of gene expression, into cells has also been reported (Zhou H, Wu S, Joo JY, et al: Cell Stem Cell 4, 381-384, 2009; Kim D, Kim CH, Moon JI, et al: Cell Stem Cell 4, 472-476, 2009). On the other hand, it has been reported that the use of histone methyltransferase G9a inhibitor BIX-01294, histone deacetylase inhibitor valproic acid (VPA) or BayK8644, etc., can improve the production efficiency and reduce the amount of factors introduced (Huangfu D, et al: Nat. Biotechnol. 26(7), 795-797, 2008; Huangfu D, et al: Nat. Biotechnol. 26(11), 1269-1275, 2008; Silva J, et al: PLoS. Biol. 6(10), e253, 2008).Methods for gene transfer have also been investigated, and in addition to retroviruses, lentiviruses (Yu J, et al: Science 318(5858), 1917-1920, 2007), adenoviruses (Stadtfeld M, et al: Science 322(5903), 945-949, 2008), plasmids (Okita K, et al: Science322(5903), 949-953, 2008), transposon vectors (Woltjen K, Michael IP,Mohseni P, et al: Nature458,766-770, 2009;Kaji K,Norrby K, Pac a A,et al:Nature458,771-775, 2009;Yusa K, Rad R,Takeda J, et al:Nat Methods 6, 363-369, 2009) or episomal vectors (Yu J, Hu K, Smuga-Otto K, Tian S, et al: Science 324, 797-801, 2009) have been developed for gene transfer.

[0023] Cells that have been transformed into iPS cells, i.e., reprogrammed, can be selected using the expression of pluripotent stem cell markers (undifferentiated markers) such as Fbxo15, Nanog, Oct / 4, Fgf-4, Esg-1, and Cript as indicators. The selected cells are collected as iPS cells.

[0024] iPS cells can also be obtained from, for example, FUJIFILM Cellular Dynamics, Inc., Kyoto University, or the RIKEN BioResource Center.

[0025] The pluripotent stem cells of the present invention can be produced by introducing DNA encoding a reporter molecule adjacent to the endogenous tau gene into the above-mentioned pluripotent stem cells. By introducing DNA encoding a reporter molecule adjacent to the endogenous tau gene, the pluripotent stem cells of the present invention can express tau protein as a fusion protein with the reporter molecule.

[0026] The endogenous tau gene may be either a wild-type tau gene or a mutant tau gene, but is preferably a wild-type tau gene.

[0027] Tau (also known as microtubule-associated protein tau, MAPT) is a protein encoded by the MAPT gene (Official full name: microtubule-associated protein tau, Official symbol; MAPT, NG_007398.1) located on chromosome 17 (17q21.1) in humans, and six isoforms generated by alternative splicing have been identified.

[0028] Each isoform differs in the number of characteristic 29 amino acid sequences (N) on the N-terminus (0-2 repeats) and the number of repeats (R) involved in microtubule binding on the C-terminus (3 or 4 repeats). Depending on the number of these sequences, they are classified as 0N3R type (352 amino acids, NP_058525.1, NM_016841.4), 1N3R type (381 amino acids, NP_001190180.1, NM_001203251.1), 2N3R type (410 amino acids, NP_001190181.1, NM_001203251.1), and 3N3R type (420 amino acids, NP_001190181.1, NM_001203251.1). They are classified into types 0N4R (383 amino acids, NP_058518.1, NM_016834.4), 0N4R (412 amino acids, NP_001116539.1, NM_001123067.3), and 2N4R (441 amino acids, NP_005901.2, NM_005910.5) (in parentheses, the number of amino acid residues of each human isoform, the ID of the standard amino acid sequence, and the ID of the standard nucleotide sequence of the transcript are shown as examples).

[0029] The tau gene in the present invention may be a tau gene of a mammal other than a human (e.g., a rodent such as a mouse or a rat, or a primate such as a marmoset). There are six types of tau protein isoforms that may be generated by alternative splicing in the brain of a living mammal, namely, the 0N3R type, 1N3R type, 2N3R type, 0N4R type, 1N4R type, and 2N4R type. Only 3R tau is expressed in the human fetal brain, but all six types are expressed in the adult human brain, and in normal individuals, the expression ratio of 4R (4-repeat tau) to 3R (3-repeat tau) (= 4-repeat tau / 3-repeat tau) is similar. In mice, only 3R tau is expressed until neonatal age, but after weaning, only 4R tau is expressed. In rats and marmosets, only 3R tau is expressed in the brain until neonatal age, but after weaning, only 4R tau is expressed. In the present invention, unless otherwise specified, tau may be either 3-repeat tau or 4-repeat tau.

[0030] The endogenous tau gene may be a mutant tau gene. Examples of the mutant tau gene include a mutant tau gene identified from a family with FTDP-17. Mutations include (i) a mutation that changes the amino acid sequence of tau protein, and (ii) a mutation that increases or decreases the expression ratio of 4-repeat tau / 3-repeat tau.

[0031] The above type (i) mutation is usually expressed as an amino acid mutation occurring in the tau protein based on the amino acid sequence of the longest isoform, 2N4R type (441 amino acids, NP_005901.2, NM_005910.5. For example, the description "P301S" means a genetic mutation that produces a tau protein in which the proline residue (P) at position 301 in the amino acid sequence of NP_005910.5 is replaced with a serine residue (S), and "K280Δ" means a genetic mutation that produces a tau protein in which the lysine residue at position 280 in the above sequence is deleted. The term "tau gene" refers to a tau gene having a mutation in exon 9-13 (i.e., encoding a mutant tau protein). Since the mutation sites of type (i) identified in FTDP-17 families are concentrated in exons 9-13, the tau gene may have a mutation in exon 9-13. Examples of the mutation include one or more mutations selected from A152T, K257T, I260V, G272V, N297K, K280Δ, L284L, N296N, P301L, P301S, S305N, S305S, V337M, E342V, G389R, and R406W.

[0032] As the above type (ii) mutation, many mutations in intron 10 have been identified in FTDP-17 families, and the mutant tau gene may be one of these. An example of the base sequence of intron 10 of a wild-type tau gene is the base sequence consisting of bases 120983-124833 of NG_007398.1. Among these, a tau gene having one or more mutations in the stem loop formed during splicing and its vicinity, i.e., in the 1st to 20th nucleotides of intron 10, is preferred, and an example of such a tau gene is a MAPT gene in which the 3rd, 11th, 12th, 13th, 14th, 16th, or 19th base is substituted.

[0033] The nerve cell of the present invention may be a nerve cell induced to differentiate from a pluripotent stem cell having a mutant tau gene. Examples of the pluripotent stem cell having a mutant tau gene include pluripotent stem cells produced from somatic cells of an animal that endogenously carries the mutant tau gene.

[0034] Examples of reporter molecules include proteins that can be detected by visualization, such as enzymes that catalyze luminescence, such as luciferase, color-developing proteins, luminescent proteins, or fluorescent proteins. As reporter molecules, detection systems based on intragenic complementation, such as BiFC (bimolecular fluorescence complementation) and NanoLuc (registered trademark) (chemiluminescence), may be used. In BiFC, a fluorescent protein is split into two and fused to two proteins to be analyzed, respectively. When the two fusion proteins come close to each other in a cell, the three-dimensional structure of the fluorescent protein is reconstructed and fluorescence is generated. In NanoLuc (registered trademark) two-molecule technology (NanoBiT: NanoLuc (registered trademark) Binary Technology), subunits of Large BiT (LgBiT; 18 kDa) and Small BiT (SmBiT; 11 amino acid peptide) are expressed as fusions with target proteins, and when protein-protein interaction occurs, the complementation of the subunits is promoted and bright light is generated as a luminescent enzyme. As reporter molecules, fluorescent proteins are preferable. The type of fluorescent protein is not particularly limited, and any fluorescent protein can be used. Specific examples of fluorescent proteins include the following. BFP stands for blue fluorescent protein, CFP for cyan fluorescent protein, GFP for green fluorescent protein, YFP for yellow fluorescent protein, and RFP for red fluorescent protein.

[0035] [Table 1]

[0036] As a method for introducing DNA encoding a reporter molecule adjacent to an endogenous tau gene, genome editing techniques such as ZFN (zinc finger nuclease), TALEN, or CRISPR / Cas9 can be used, but preferably CRISPR / Cas9 can be used. CRISPR-Cas9 is a technology that induces double-strand breaks in a specific DNA strand having a base sequence complementary to the gRNA by introducing a guide RNA (gRNA) that recognizes a target site on the genome and the nuclease Cas9 into a cell. The gRNA is preferably a single guide RNA (sgRNA). In order to access the endogenous tau gene in the nucleus that is the target of genome editing, Cas9 and sgRNA need to be introduced into the nucleus of the cell. A plasmid vector or a virus vector can be used as a vector for introduction. Cas9 and sgRNA can be introduced into a cell by electroporation or lipofection.

[0037] The DNA encoding the reporter molecule may be located upstream of the endogenous tau gene or downstream of the endogenous tau gene, but is preferably located upstream of the endogenous tau gene. That is, the reporter molecule may be fused to the N-terminus of the tau protein or to the C-terminus of the tau protein, but is preferably fused to the N-terminus of the tau protein. When the reporter molecule is fused to the N-terminus of the tau protein, the expression of tau and the reporter molecule is enhanced, making it easier to detect tau by fluorescence observation or the like. The DNA encoding the reporter molecule and the endogenous tau gene may or may not have a linker as long as they are linked and expressed as one protein. If they are too far apart, there is a possibility that they will separate midway, so the linker is preferably 100 bases or less, more preferably 70 bases or less, and most preferably 3 bases or less. The amino acids after the linker is translated are preferably 50 amino acids or less, more preferably 30 amino acids or less, and most preferably 1 amino acid or less.

[0038] The targeting vector must have homology with the upstream and downstream tau gene sequences from the vicinity of the cleavage site of the tau gene (N-terminus or C-terminus) determined by the gRNA sequence. The upstream homology sequence is called the left homology arm, and the downstream homology sequence is called the right homology arm. The left homology arm and the right homology arm are about 1600 bp in total. Preferably, each is about 800 bp. The homology arm does not need to be exactly the same as the tau gene sequence, and it is preferable to insert a silent mutation in the gRNA recognition sequence. The targeting vector has DNA encoding a reporter molecule to be inserted into the tau gene inside the left homology arm and the right homology arm. Preferably, in addition to the DNA encoding the reporter molecule, it has DNA encoding a drug resistance gene or a fluorescent protein. More preferably, the drug resistance gene or the gene encoding a fluorescent protein is arranged in a form having PiggyBac sequences at both ends. The drug resistance gene is a Puromycin resistance gene, a G418 resistance gene, a Hygromycin resistance gene, a BlasticidinS resistance gene, or the like. A hygromycin resistance gene is preferable. Fluorescent proteins include those listed in Table 1, and an mRFP resistance gene is preferable. In addition, the targeting vector preferably has a gancyclovir susceptibility gene.

[0039] The gRNA is a sequence that sets the cleavage site of the tau gene, and contains a target sequence that recognizes the N-terminal or C-terminal sequence of the tau gene. The target sequence is preferably set at about 20 bases downstream of the PAM sequence (NGG). The gRNA is preferably an sgRNA.

[0040] According to the present invention, there is provided a kit comprising a targeting vector containing DNA encoding homology arms upstream and downstream of the tau gene insertion site and a reporter molecule, and a gRNA that determines the cleavage site of the tau gene. In one example, the homology arm upstream of the tau gene insertion site has a sequence that is 90% or more (preferably 95% or more, more preferably 97% or more) identical to the sequence set forth in SEQ ID NO: 1, and the homology arm downstream of the tau gene insertion site has a sequence that is 90% or more (preferably 95% or more, more preferably 97% or more) identical to the sequence set forth in SEQ ID NO: 2. In another example, the homology arm upstream of the tau gene insertion site has a sequence that is 90% or more (preferably 95% or more, more preferably 97% or more) identical to the sequence set forth in SEQ ID NO: 3, and the homology arm downstream of the tau gene insertion site has a sequence that is 90% or more (preferably 95% or more, more preferably 97% or more) identical to the sequence set forth in SEQ ID NO: 4. Preferably, the gRNA targets a sequence having an identity of 90% or more (preferably 95% or more, more preferably 97% or more) to the sequence set forth in SEQ ID NO: 5 or 6.

[0041] Pluripotent stem cells into which DNA encoding a reporter molecule has been introduced can be cultured using a medium suitable for culturing pluripotent stem cells. When iPS cells are used as pluripotent stem cells, for example, StemFit (registered trademark) AK02N (Ajinomoto), mTeSR (registered trademark) 1 (Stemcell Technologies), StemFlex (registered trademark), etc. can be used. The culture may be performed on a plate (for example, a 6-well plate, etc.) or in a flask, but is preferably performed on a plate. The culture period is not particularly limited, and can be, for example, cultured for 1 to 10 days. Preferably, it is 5 to 8 days.

[0042] The cells proliferated by the above-mentioned culture are harvested, and the sequence adjacent to the tau gene carried by the cells is confirmed by DNA sequencing, thereby confirming that the DNA encoding the reporter molecule has been introduced.

[0043] <Nerve cells> The present invention relates to nerve cells differentiated from the above-mentioned pluripotent stem cells of the present invention. The neuronal cells of the present invention are cells having DNA encoding a reporter molecule introduced adjacent to an endogenous tau gene so that the tau protein is expressed as a fusion protein with the reporter molecule. The neuronal cells of the present invention may be either an established neuronal cell line or a primary neuronal cell. The neuronal cells of the present invention can express a fusion protein of a tau protein and a reporter molecule. Specific examples and preferred forms of the reporter molecule are as described above in this specification. In the neuronal cells of the present invention, intracellular tau can be visualized or quantified using the expression of the reporter molecule as an indicator.

[0044] Methods for inducing differentiation of pluripotent stem cells into neurons include, but are not limited to, a method in which neural stem cells are produced from pluripotent stem cells using treatment with a low molecular weight compound, etc., and then the differentiation is induced into neurons, and a method in which the differentiation is directly induced into neurons by gene expression, etc. Methods for inducing differentiation of pluripotent stem cells into neural cells include, for example, (1) A method in which embryoid bodies (cell masses containing neural progenitor cells) are formed and differentiated in a serum-free medium (SFEB method: Watanabe K., et al., Nat.Neurosci., 8:288-296, 2005; SFEBq method: Wataya T., et al., Proc. Natl. Acad. Sci. USA., 105:11796-11801, 2008); (2) A method of culturing and differentiating on stromal cells (SDIA method: Kawasaki H., et al, Neuron, 28:31-40, 2000); (3) Differentiation by culturing on drug-containing Matrigel (Chambers SM, et al, Nat. Biotechnol., 27:275-280, 2009); (4) A method of differentiation by culturing in a medium containing a low molecular weight compound as an alternative to cytokines (U.S. Patent No. 5,843,780); (5) A method of differentiating pluripotent stem cells by introducing and expressing neural induction factors (such as neurogenin2 (Ngn2)) (WO2014 / 148646; and Zhang Y., et al, Neuron, 78:785-98, 2013); (6) A method of inducing differentiation by introducing and expressing miR-9 / 9*-124 into pluripotent stem cells; and combinations of these methods.

[0045] Among the above, (5) the method of introducing and expressing neurogenin2 into pluripotent stem cells is preferred because it allows for the production of mature nerve cells in a short period of time and with high efficiency. Furthermore, (6) the method of introducing and expressing miR-9 / 9*-124 into pluripotent stem cells to cause differentiation is also preferred. A preferred method for inducing differentiation of pluripotent stem cells into nerve cells is a method of directly inducing nerve cells by expressing Ngn2 alone or Ngn2 and miR-9 / 9*-124. Most preferred is a method of inducing nerve cells by expressing Ngn2 alone or Ngn2+miR-9 / 9*-124 using the TET-on promoter.

[0046] Neurogenin2 protein is a transcription factor known to promote differentiation into nerve cells during development, and its amino acid sequence is exemplified by NP_076924 in humans and NP_033848 in mice. Neurogenin2 gene (official full name: neurogenin2, official symbol: NEUROG2, also called Ngn2 gene) is DNA encoding Neurogenin2 protein, and examples thereof include DNA having the nucleotide sequence of NM_009718 (mouse) or NM_024019 (human) registered as a standard sequence, or a transcript variant thereof. In addition, it may be DNA having a degree of complementarity that allows hybridization under stringent conditions to nucleic acids having the above-mentioned standard sequence and the sequence of a transcript variant.

[0047] Stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe is bound. For example, washing conditions after hybridization can usually be about "1xSSC (Saline Sodium Citrate Buffer), 0.1% SDS, 37°C". It is preferable that the complementary strand maintains a hybridized state with the target positive strand even when washed under such conditions. As more stringent hybridization conditions, washing conditions of about "0.5xSSC, 0.1% SDS, 42°C" can be mentioned, and even more stringent conditions can be mentioned such that the positive strand and complementary strand maintain a hybridized state even when washed under washing conditions of about "0.1xSSC, 0.1% SDS, 65°C". Specifically, examples of such complementary strands include a strand consisting of a base sequence that is completely complementary to the base sequence of the target positive strand, and a strand consisting of a base sequence that has an identity of at least 90%, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more with the above strand.

[0048] Expression of Neurogenin 2 in pluripotent stem cells can be carried out by introducing a nucleic acid (DNA or RNA) encoding Neurogenin 2 or Neurogenin 2 (protein) into the pluripotent stem cells. Expression of miR-9 / 9*-124 in pluripotent stem cells can be carried out by introducing a nucleic acid (DNA or RNA) encoding miR-9 / 9*-124 into the pluripotent stem cells.

[0049] In the present invention, when a nucleic acid encoding Neurogenin2 and a nucleic acid encoding miR-9 / 9*-124 are introduced into a cell, for example, vectors such as viruses, plasmids, and artificial chromosomes can be introduced into pluripotent stem cells using techniques such as lipofection, liposomes, and microinjection. Examples of viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, and Sendai viral vectors. Examples of artificial chromosome vectors include human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), and bacterial artificial chromosomes (BAC, PAC). Mammalian plasmids can be used as plasmids. The vector may contain a control sequence (promoter, enhancer, ribosome binding sequence, terminator, polyadenylation site, etc.) for expressing the Neurogenin2 protein or miR-9 / 9*-124, and may further contain, as necessary, a drug resistance gene (e.g., kanamycin resistance gene, ampicillin resistance gene, puromycin resistance gene, etc.), a selection marker sequence such as a thymidine kinase gene or a diphtheria toxin gene, a reporter gene sequence such as β-glucuronidase (GUS) or FLAG, etc. In particular, it is preferable that a nucleotide sequence encoding the amino acid sequence of a protein is functionally linked to an inducible promoter sequence so that the expression of the Neurogenin2 protein or miR-9 / 9*-124 can be rapidly induced at a desired time.

[0050] Examples of inducible promoters include drug-responsive promoters, and a preferred example thereof is a tetracycline-responsive promoter (CMV minimal promoter having a tetracycline-responsive sequence (TRE) with seven consecutive tetO sequences). For example, the Tet-On / Off Advanced expression induction system is exemplified, but since it is desirable to express the corresponding gene in the presence of tetracycline, the Tet-On system is preferred. That is, it is a system that simultaneously expresses reverse tetR (rtetR) and a fusion protein (rtTA) with VP16AD. The Tet-On system can be obtained from Clontech and used. In addition, cumate-responsive promoters (Q-mate system, Krackeler Scientific, National Research Council (NRC), etc.), estrogen-responsive promoters (WO2006 / 129735, and GenoStat inducible expression system, Upstate cell signaling solutions), RSL1-responsive promoters (RheoSwitch mammalian inducible expression system, New England Biolabs), etc. can also be preferably used. Among these, tetracycline-responsive promoters and cumate-responsive promoters are particularly preferred because of their high specificity to expression inducers and low toxicity, and tetracycline-responsive promoters are the most preferred.

[0051] When a cumate-responsive promoter is used, it is preferable that it also has a pattern for expressing the CymR repressor in pluripotent stem cells. In addition, the control sequence and regulators of the above promoter (rtTA and / or CymR repressor, etc.) may be supplied by a vector into which the neurogenin2 gene or miR-9 / 9*-124 has been introduced.

[0052] When a tetracycline-responsive promoter is used, the expression of Neurogenin2 or miR-9 / 9*-124 can be maintained by culturing the desired cells in a medium containing tetracycline or its derivative doxycycline (hereinafter abbreviated as DOX) for a desired period of time. When a cumate-responsive promoter is used, the expression of Neurogenin2 or miR-9 / 9*-124 can be maintained by continuing to culture the desired cells in a medium containing cumate for a desired period of time.

[0053] When a drug-responsive promoter is used, the expression of Neurogenin2 or miR-9 / 9*-124 can also be stopped by removing the corresponding drug from the medium (for example, by replacing the medium with one that does not contain the drug).

[0054] In the present invention, when a nucleic acid encoding Neurogenin2 or miR-9 / 9*-124 is introduced in the form of RNA, it may be introduced into pluripotent stem cells by techniques such as electroporation, lipofection, microinjection, etc. To maintain the expression of Neurogenin2 or miR-9 / 9*-124 in the cells, the introduction may be carried out multiple times, for example, two, three, four, or five times.

[0055] In the present invention, when Neurogenin2 is introduced in the form of a protein, it may be introduced into pluripotent stem cells by techniques such as lipofection, fusion with a cell membrane-permeable peptide (e.g., HIV-derived TAT and polyarginine), microinjection, etc. To maintain the expression of Neurogenin2 in the cells, it may be introduced multiple times, for example, two, three, four, or five times.

[0056] In the present invention, there is no particular upper limit to the period during which Neurogenin2 or miR-9 / 9*-124 is expressed in pluripotent stem cells for the induction of neural cells, but in the case of human pluripotent stem cells, the period is at least 2 days, preferably at least 3 days, and more preferably at least 4 days.

[0057] After induction of expression in the method of differentiation by introducing and expressing Neurogenin2 or miR-9 / 9*-124, it is preferable to culture the pluripotent stem cells in a medium suitable for inducing differentiation into neural cells (called neural differentiation medium). As such a medium, a basal medium alone or a basal medium supplemented with a neurotrophic factor can be used. The neurotrophic factor in the present invention is a ligand of a membrane receptor that plays an important role in the survival and functional maintenance of nerve cells, and examples thereof include nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3), neurotrophin 4 / 5 (NT-4 / 5), neurotrophin 6 (NT-6), basic FGF, acidic FGF, FGF-5, epidermal growth factor (EGF), hepatocyte growth factor (HGF), insulin, insulin-like growth factor 1 (IGF1), insulin-like growth factor 2 (IGF 2), Glia cell line-derived neurotrophic factor (GDNF), transforming growth factor-b2, transforming growth factor-b3, interleukin 6 (IL-6), ciliary neurotrophic factor (CNTF), and LIF. Among these, preferred neurotrophic factors are GDNF, BDNF, and / or NT-3.

[0058] Examples of basal media include Glasgow's Minimal Essential Medium (GMEM) medium, IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Ham's F12 (F12) medium, Dulbecco's Modified Eagle Medium:Nutrient Mixture F-12 (DMEM / F-12) medium, RPMI 1640 medium, Fischer's medium, Neurobasal Medium medium (Lifetechnologies), and mixed media thereof.

[0059] The basal medium may contain serum or may be serum-free. If necessary, the medium may contain one or more serum substitutes, such as Knockout Serum Replacement (KSR) (a serum substitute for FBS during ES cell culture), N2 supplement (Thermo Fisher Scientific), B27 supplement (Thermo Fisher Scientific), B27 Plus supplement (Thermo Fisher Scientific), Culture One supplement (Thermo Fisher Scientific), albumin, transferrin, apotransferrin, fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, and may also contain one or more substances, such as lipids, amino acids, L-glutamine, Glutamax (Thermo Fisher Scientific), non-essential amino acids, vitamins, growth factors, small molecules, antibiotics, antioxidants, pyruvic acid, buffers, inorganic salts, selenate, progesterone, and putrescine.

[0060] In the present invention, it is particularly preferable to use a medium for neural differentiation in which Neurobasal plus Medium is supplemented with B27 Plus supplement, Culture One supplement, Glutamax, dbcAMP, L-ascorbic acid, Y27632, and DAPT (N-[N-(3,5-Difluorophenacetyl-L-alanyl)]-(S)-phenylglycine t-butyl ester).

[0061] The culture temperature when inducing differentiation of neural cells is not particularly limited, but is about 30 to 40°C, preferably about 37°C, and culture is performed in an atmosphere of CO2-containing air, with the CO2 concentration preferably being about 2 to 5%.

[0062] In the present invention, a neuron is preferably a cell that expresses at least one of the neuron-specific marker genes, which are composed of β-III tubulin, NeuN, N-CAM (neural cell adhesion molecule), and MAP2 (microtubule-associated protein 2), and has β-III tubulin-positive processes (hereinafter referred to as neurites).

[0063] In the present invention, more preferred nerve cells are morphologically mature nerve cells, and even more preferred are glutamatergic nerve cells. Here, the morphologically mature nerve cells are nerve cells in which the cell body is thickened and the neurites are sufficiently extended (as a guide, the neurite length is extended to about 5 times or more the diameter of the cell body).

[0064] <Screening method> The present invention relates to a method for screening a substance, using the above-mentioned pluripotent stem cells or neural cells of the present invention, and further relates to a substance screened by the above-mentioned screening method.

[0065] The nerve cells of the present invention can be used for screening drug candidate substances for central nervous system diseases and for analyzing pathological mechanisms. In the present invention, the increase or decrease in the expression level of tau or the intracellular distribution of tau can be evaluated based on the expression of a reporter molecule. Preferably, the increase or decrease in the expression level of tau can be evaluated based on the expression intensity of the reporter molecule. When a fluorescent protein is used as the reporter molecule, the expression of tau fused to the fluorescent protein allows the increase or decrease in the expression level of tau or the intracellular distribution of tau to be evaluated based on the expression of fluorescence, so that screening of substances such as drugs can be easily performed.

[0066] The expression of the reporter molecule can be monitored in real time while the nerve cells of the present invention are alive. Examples of equipment that can be used for monitoring include a fluorescent microscope, a confocal microscope, and a CCD (Charge Coupled Device) camera. In addition, when real-time monitoring is not required, the nerve cells can be fixed with formalin or the like and then observed. Furthermore, after fixation, it is also possible to stain the cells with an antibody against tau or fluorescent protein, but since the detachment of cells and the variation in staining due to fixation and staining procedures may affect the quantitative results, analysis without staining is preferable.

[0067] In the present invention, for example, (1) contacting the neuronal cell of the present invention with a test substance; (2) measuring the amount of tau expression in the nerve cells; and (3) selecting the test substance as a preventive or therapeutic drug for tauopathy when the tau expression level measured in step (2) in the case where the test substance is contacted in step (1) is lower than the tau expression level measured in the case where the test substance is not contacted in step (1); The present invention provides a method for screening for a prophylactic or therapeutic agent for tauopathy, comprising: In step (1), the level of tau expression being lower than the level observed when the test substance is not contacted is not particularly limited as long as it is low, but if the level of tau expression when the test substance is not contacted is taken as 100%, a test substance is selected that has the effect of reducing the level of tau expression upon contact with the test substance to preferably 80% or less, more preferably 50% or less.

[0068] The screening method of the present invention is useful for screening compounds or lead compounds that can be preventive or therapeutic agents for tauopathy. Tauopathies include Alzheimer's disease (AD), frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal dementia (FTD), Pick's disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic grain dementia, neurofibrillary tangle dementia, and diffuse neurofibrillary tangle disease with calcification (DNTC).

[0069] Examples of test substances include proteins, peptides, antibodies, non-peptide compounds, synthetic compounds, synthetic low molecular weight compounds, natural compounds, cell extracts, plant extracts, animal tissue extracts, plasma, extracts derived from marine organisms, cell culture supernatants, and microbial fermentation products.

[0070] Test substances can also be obtained using any of the many approaches in combinatorial library methods known in the art, including (1) biological library methods, (2) synthetic library methods using deconvolution, (3) one-bead one-compound library methods, and (4) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection are limited to peptide libraries, while other approaches can be applied to small molecule compound libraries of peptides, non-peptide oligomers, or compounds (Lam (1997) Anticancer Drug Des. 12: 145-67). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909-13; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422-6; Zuckermann et al. (1994) J. Med. Chem. 37:2678-85; Cho et al. (1993) Science 261:1303-5; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; Gallop et al. al. (1994) J.Med.Chem.37:1233-51).Compound libraries can be produced in solution (see Houghten (1992) Bio / Techniques 13:412-21) or on beads (Lam (1991) Nature 354:82-4), chips (Fodor (1993) Nature 364:555-6), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. Nos. 5,571,698, 5,403,484, and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89:1865-9) or phages (Scott and Smith (1990) Science 249:386-90; Devlin (1990) Science 249:404-6; Cwirla et al. (1999) Science 249:404-6; Cwirla et al. (1999) Science 249:404-6; Cwirla et al. (1999) Science 249:404-6). al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-82; Felici (1991) J. Mol. Biol. 222:301-10; U.S. Patent Application Publication No. 2002 / 0103360).

[0071] In the present invention, contacting the test substance with the nerve cells may be performed by adding the test substance to the culture solution of the nerve cells. The contact time is not particularly limited as long as the change in indicators such as fluorescence can be confirmed, and may be, for example, 1 day or more, 2 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, or 7 days or more. The concentration of the test substance to be added can be appropriately adjusted depending on the type of compound (solubility, toxicity, etc.).

[0072] The culture medium for neurons used when contacting the test substance with the neurons is not particularly limited as long as it is a medium capable of culturing neurons, and examples thereof include the above-mentioned neuronal differentiation medium.

[0073] The culture temperature when contacting the test substance with the nerve cells is not particularly limited, but is about 30 to 40°C, preferably about 37°C, and culture is performed in an atmosphere of CO2-containing air, with the CO2 concentration preferably being about 2 to 5%.

[0074] The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples. EXAMPLES

[0075] (1) Creation of iPS cells carrying the TagGFP2-Tau gene by gene editing Genetic editing of the tau gene was performed on human iPS cells 201B7 line (obtained from iPS Academia Japan) derived from healthy subjects. Human iPS cells were seeded on a 6-well plate coated with iMatrix (Nippi) and cultured feeder-free using StemFit (registered trademark) AK02N (Ajinomoto). Cultured human iPS cells were detached with TrypLE select (Thermo Fisher Scientific) and cell pellets were obtained by centrifugation. The cell pellets were mixed with Neon buffer R (containing sgRNA, Cas9 protein, and targeting vector) and then introduced by electroporation using Neon (Thermo Fisher Scientific). The targeting vector was created by inserting the homology arms (LHA, RHA) with the tau gene, the fluorescent protein gene sequence to be inserted (TagGFP2), and the gene region (EF1-RFP-T2A-Hyg) used for strain selection flanked by PiggyBac sequences (5'ITR and 3'ITR) into the HR710PA-1 vector (purchased from System Bioscience) (Figures 1 and 2). The base sequences of the homology arms (LHA, RHA) with the tau gene are shown below. The sequence of the sgRNA (Thermo Fisher Scientific) that recognizes the genomic sequence to be cleaved is also shown below.

[0076] Left homology arm (for inserting TagGFP2 into the N-terminus) TTTTGCTGCCAGTTGACATCTGATTGAACCATCTCTTCACTTCTCCGTGCCTCACTTTCCTTACCAGACAGGCTCTGCTGATGCTGTCCCTCTCCTGTTCAGTCGTGCCCTCACCGTTAAAGAGAAAGAGCAAACTGCTGGGCAGCAGCATTGATTTTTTTAATGAAGTGGAAAGAGAGCTGGGAATAACAAGTCGGGCCCACCTCACCTGCCTCACCTGGTGGGTTTATTTGTTTTGTTTTTTTTTTTTTGTTTTGAGACAGAGTTTCACCCTGTCACCCAGGCTGGAGTGCAGTGGTGTAATCTCAGCTCACTGCAACCTCCACCTGCCAGGTTCAATTGATTCTCCTGCCTCAGCCTCCCCAGTAGCTGGGATTACAGGCACCTGCCACATGCCTGGCTAATTATTGTATTTTTAGTAGAGATGGGGTTTTACCATGTTGGCCAGGCTGGTCTCGATCCCCTGACCTCAGGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGAGATCACAGGCGTGAGCCACCATGCCTGGCCGTCACCTGGTGGTGTTGAATATGAACTGCTGCGGTGTTGGTAAATTAAGCAAGCAGATAGATGTAAATAACGCTTGGGCAGGAATATGGAGCACGGGATGAGGATGGGCGGCCAACTGTTAGAGAGGGTAGCAGGGAGGCTGAGATCTGCCTGCCATGAACTGGGAGGAGAGGCTCCTCTCTCTCTTCACCCCCACTCTGCCCCCCAACACTCCTCAGAACTTATCCTCTCCTCTTCTTTCCCCAGGTGAACTTTGAACCAGG(SEQ ID NO: 1)

[0077] Right homology arm (for TagGFP2 insertion at the N-terminus) ATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCTGGGACGTACGGGTTGGGGGACAGGAAAGATCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGGTTAGTGGACAGCCATGCACAGCAGGCCCAGATCACTGCAAGCCAAGGGGTGGCGGGAACAGTTTGCATCCAGAATTGCAAAGAAATTTTAAATACATTATTGTCTTAGACTGTCAGTAAAGTAAAGCCTCATTAATTTGAGTGGGCCAAGATAACTCAAGCAGTGAGATAATGGCCAGACACGGTGGCTCACGCCTGTAATCCCAGCACTTTGGAAGGCCCAGGCAGGAGGATCCCTTGAGGCCAGGAATTTGAGACCGGCCTGGGCAACATAGCAAGACCCCGTCTCTAAAATAATTTAAAAATTAGCCAGGTGTTGTGGTGCATGTCTATAGTCCTAGCTACTCAGGATGCTGAGGCAGAAGGATCACTTGAGCCCAGGAGTTCAAGGTTGCAGTAAGCTGTGATTATAAAACTGCACTCCAGCCTGAGCAACAGAGCAAGACCCTGTCAAAAAAAAAAGAAAAGAAAAAAGAAAGAAAGAAATTTACCTTGAGTTACCCACATGAGTGAATGTAGGGACAGAGATTTTAGGGCCTTAACAATCTCTCAAATACAGGGTACTTTTTGAGGCATTAGCCACACCTGTTAGCTTATAAATCAGTGGTATTGATTAGCATGTAAAATATGTGACTTTAAACATTGCTTTTTATCTCTTACTTAGATC(SEQ ID NO: 2)

[0078] Left homology arm (for TagGFP2 insertion at the C-terminus) ATACTAAGCAGCCTGTGTATCTATACACTCACACGTGTTTGTTTATGTGTGGAATATCTCTGGAGGGTACACAAGAAACTTAAAATGATCACTGTCTCTGGGGAGGGTACCTGGGTGCCTGGGAGGCAGGTCAGGGAAGGAGTGGGCACAGGTATTACCAATTGGAAGACAATAAAAACAACAGCTCCTGGCCAGGCGCAGTGGCTCACGCCTGTAATGGCAGCACTCTGAGAGGCTGAGGCGGGCAGATTGCTTGCGTCCAGGAGTTCAAGACCAGCCTGGGCAACATAGCAAAACCCCGTTTCTATTAAAAATACAAAAAATTAGCCAGGTGTGGTGGCATGCACCTGTAATCCCAGCTACTCGGGAGGCTGAGGTGGGAGAATCACCTGAGCCTGGGAGGTCAAGGCTGCAGTGAGGTGAGATTGTGCCACCGCACTCTAGCCTGGGCGATAGAGCAAGACCCTGTCTCAAAAACAAACAAAAAACAGTCCCTGGCACTCTGGGCCAGGCCTGGCAGGGCAGTTGGCAGGGCTGGTCTTTCTCTGGCACTTCATCTCACCCTCCCTCCCTTCCTCTTCTTGCAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCTAGCTGACGAGGTGTCTGCCTCCCTGGCCAAGCAGGGTTTG(SEQ ID NO: 3)

[0079] Right homology arm (for TagGFP2 insertion at the C-terminus) TCAGGCCCCTGGGGCGGTCAATAATTGTGGAGAGGAGAGAATGAGAGAGTGTGGAAAAAAAAAGAATAATGACCCGGCCCCCGCCCTCTGCCCCCAGCTGCTCCTCGCAGTTCGGTTAATTGGTTAATCACTTAACCTGCTTTTGTCACTCGGCTTTGGCTCGGGACTTCAAAATCAGTGATGGGAGTAAGAGCAAATTTCATCTTTCCAAATTGATGGGTGGGCTAGTAATAAAATATTTAAAAAAAAACATTCAAAAACATGGCCACATCCAACATTTCCTCAGGCAATTCCTTTTGATTCTTTTTTCTTCCCCCTCCATGTAGAAGAGGGAGAAGGAGAGGCTCTGAAAGCTGCTTCTGGGGGATTTCAAGGGACTGGGGGTGCCAACCACCTCTGGCCCTGTTGTGGGGGTGTCACAGAGGCAGTGGCAGCAACAAAGGATTTGAAACTTGGTGTGTTCGTGGAGCCACAGGCAGACGATGTCAACCTTGTGTGAGTGTGACGGGGGTTGGGGTGGGGCGGGAGGCCACGGGGGAGGCCGAGGCAGGGGCTGGGCAGAGGGGAGAGGAAGCACAAGAAGTGGGAGTGGGAGAGGAAGCCACGTGCTGGAGAGTAGACATCCCCCTCCTTGCCGCTGGGAGAGCCAAGGCCTATGCCACCTGCAGCGTCTGAGCGGCCGCCTGTCCTTGGTGGCCGGGGGTGGGGGCCTGCTGTGGGTCAGTGTGCCACCCTCTGCAGGGCAGCCTGTGGGAGAAGGGACAGCGGGTAAAAAGAGAAGGCAAGCTGGCAGGAGGGTG (SEQ ID NO: 4)

[0080] N-TagGFP2 Tau sgRNA: AGGTGAACTTTGAACCAGGA (SEQ ID NO: 5)

[0081] C-TagGFP2 Tau sgRNA: ACAATTATTGACCGCCCCAG (SEQ ID NO: 6)

[0082] After electroporation, StemFit (registered trademark) was added and centrifuged. The cell pellet was suspended in StemFit (registered trademark) (containing 10 μmol / L Y27632) and cultured in an iMatrix-coated 6-well plate. On the third day of culture, the medium was replaced with StemFit (registered trademark) supplemented with 100 μg / mL Hygromycin, and on the fifth day of culture, the medium was replaced with StemFit (registered trademark) supplemented with 2.5 μg / mL Gancyclovir (Fujifilm Wako Pure Chemical Industries, Ltd.). The grown colonies were picked under a microscope to obtain single-cell-derived clones, and the sequence of the tau gene possessed by the cells was confirmed by DNA sequencing to confirm that the target sequence had been inserted. Furthermore, in order to remove the drug resistance gene sequence, an Excision only Piggybac vector (purchased from System Bioscience) was introduced by lipofection using GeneJuice (Novagen) and cultured using StemFit (registered trademark). The colonies were picked under a microscope to obtain single-cell-derived clones. The sequence of the tau gene in the cells was then confirmed by DNA sequencing to confirm that the target sequence had been inserted, and iPS cell clones carrying the TagGFP2-Tau gene were selected.

[0083] (1) Preparation of lentivirus Lentivirus was produced according to the method of non-patent literature (Mitsuru Ishikawa, et al., Cells 2020, 9, 532;). Briefly, lentivirus was produced by transfecting HEK293T cells with three types of plasmids, namely, packaging construct (pCAG-HIVgp), VSV-G and Rev expression construct (pCMV-VSV-G-RSV-Rev), and self-inactivating (SIN) lentivirus vector construct (CSIV-miR9 / 9*-124-mRFP1-TRE-EF-BsdT), using polyethyleneimine (Polysciences). Furthermore, the culture supernatant was concentrated by ultracentrifugation to concentrate the lentivirus. After concentration, the titer was measured using lenti-Gostix PLUS (Takara Bio) and used in the experiment. CSIV-miR9 / 9*-124-mRFP1-TRE-EF-BsdT (Figure 3).

[0084] (2) Introduction of TET-on inducible Ngn2 and miR-9 / 9*-124 vectors into iPS cells According to the method of non-patent literature (Mitsuru Ishikawa, et al., Cells 2020, 9, 532;), a transposase vector (pCMV-HyPBase-PGK-Puro), a rtTA vector (PB-CAGrtTA3G-IH), and a Neurogenin2 (Ngn2) vector (PB-TET-PH-lox66FRT-NEUROG2) as shown in FIG. 4 were prepared. These vectors were introduced into iPS cells cultured with StemFit (registered trademark) by lipofection using GeneJuice (Novagen), and further, a lentivirus (CSIV-miR9 / 9*-124-mRFP1-TRE-EF-BsdT) containing the miR-9 / 9*-124 gene was introduced into the iPS cells. Then, an iPS cell line into which the vector was stably introduced was obtained by drug selection using Puromycin, Hygromycin, and Blasticidin S.

[0085] (3) Confirmation of TagGFP2-Tau fluorescence in iPS cell-derived neurons iPS cells prepared in (2) were detached using TrypLE select and seeded on 96-well or 384-well plates coated with Poly-D-lysine (PDL) and iMatrix. They were cultured in neural induction medium containing doxycycline (DOX) (Neurobasal plus medium (Thermo Fisher Scientific) supplemented with 2% B27 Plus supplement (Thermo Fisher Scientific), 1% Culture One supplement (Thermo Fisher Scientific), 200 μmol / L bcAMP, 200 μmol / L L-ascorbic acid, 10 μmol / L Y27632, 10 μmol / L DAPT (N-[N-(3,5-Difluorophenacetyl-L-alanyl)]-(S)-phenylglycine t-butyl ester), and 4 μg / ml Dox) to induce differentiation into neural cells. From the sixth day after the start of differentiation induction, the medium was replaced with neural maintenance medium (Neurobasal plus medium supplemented with 2% B27 Plus supplement, 1% Culture One supplement, 200 μmol / L dbcAMP, 200 μmol / L L-ascorbic acid, and 10 ng / mL BDNF (Brain-derived neurotrophic factor)), and the cells were cultured for 19 days and then observed under a fluorescent microscope. Unedited iPS cell-derived neurons were observed as a negative control. The results are shown in Figure 5. As shown in Figure 5, fluorescence was observed in both N-terminal (TagGFP2-Tau) and C-terminal (Tau-TagGFP2) neurons. The fluorescence was stronger in N-terminal (TagGFP2-Tau) neurons than in C-terminal (Tau-TagGFP2) neurons.

[0086] (4) Fluorescent Tau quantification and bright field neurite length analysis Neuronal cells on day 5 of neural induction were detached using TrypLE Select. 1×10 4 The cells were seeded at 1000 cells / well. The cells were cultured in neuronal reseeding medium (Neurobasal plus: DMEM / F12 HAM = 1:1 medium supplemented with 2% B27 Plus supplement, 1% Culture One supplement, 200 μmol / L dbcAMP, 200 μmol / L L-ascorbic acid, and 2 μg / ml Dox). The cells were also treated with 1-2 μmol / L Tau Accell siRNA (Dharmacon, #D-001910-03) and cultured for about 2 weeks. Fluorescence imaging (Excitation 485 nm / Emission 535 nm) and bright field imaging of TagGFP2-Tau were performed on live cells using an In Cell Analyzer 6000 (GE Healthcare). Tau expression in neurons was quantified by using the fluorescence intensity in the neurites or the positive neurite length as an index of tau expression. We also quantified neuronal toxicity by measuring neurite length using bright-field imaging. The results are shown in Figure 6. As shown in Figure 6, the TagGFP2 fluorescence intensity and TagGFP2-positive neurite length were decreased, which confirmed that the amount of tau in neurons was decreased. Furthermore, we also confirmed that the phase contrast neurite length did not change significantly after Tau siRNA treatment.

Claims

1. A pluripotent stem cell having DNA encoding a reporter molecule introduced adjacent to an endogenous tau gene such that the tau protein is expressed as a fusion protein with the reporter molecule.

2. The pluripotent stem cell of claim 1 , wherein the pluripotent stem cell is a human pluripotent stem cell.

3. The pluripotent stem cell according to claim 1 or 2, wherein the pluripotent stem cell is an induced pluripotent stem cell.

4. The pluripotent stem cell according to any one of claims 1 to 3, wherein the reporter molecule is a fluorescent protein.

5. The pluripotent stem cell according to any one of claims 1 to 4, wherein DNA encoding a reporter molecule is located upstream of an endogenous tau gene.

6. A neural cell differentiated from the pluripotent stem cell according to any one of claims 1 to 5.

7. The neuronal cell according to claim 6 , in which a fusion protein of tau protein and a reporter molecule is expressed.

8. A neuronal cell having DNA encoding a reporter molecule introduced adjacent to the endogenous tau gene such that the tau protein is expressed as a fusion protein with the reporter molecule.

9. The neuronal cell according to claim 8 , which is an established neuronal cell or a primary neuronal cell.

10. The neuronal cell of claim 8 or 9, wherein the reporter molecule is a fluorescent protein.

11. The neuronal cell according to any one of claims 8 to 10, wherein DNA encoding a reporter molecule is located upstream of an endogenous tau gene.

12. A method for screening a substance, comprising using the pluripotent stem cell according to any one of claims 1 to 5 or the neural cell according to any one of claims 6 to 11.

13. The method according to claim 12, wherein the increase or decrease in the expression level of tau or the intracellular distribution of tau is evaluated based on the expression of a reporter molecule.

14. The method according to claim 12 or 13, wherein an increase or decrease in the expression level of tau is evaluated based on the expression intensity of a reporter molecule.

15. A substance screened by the method according to any one of claims 12 to 14.

16. A kit comprising a targeting vector containing DNA encoding homology arms upstream and downstream of the tau gene insertion site and a reporter molecule, and a gRNA that determines the cleavage site of the tau gene.

17. The kit according to claim 16, wherein the homology arm upstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO:1 and the homology arm downstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO:2, or the homology arm upstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO:3 and the homology arm downstream of the tau gene insertion site has a sequence having 90% or more identity with the sequence set forth in SEQ ID NO:

4.

18. The kit described in <17>, wherein the gRNA has a target sequence having 90% or more identity to the sequence described in SEQ ID NO: 5 or 6.

Images