Natural killer cell receptor 2B4 compositions and methods for immunotherapy

Abstract

Compositions and methods are provided for editing, e.g., modifying DNA sequences, within the 2B4 gene.Compositions and methods are provided for immunotherapy.

Description

[Technical field]

[0001] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 147,226, filed February 8, 2021, the contents of which are incorporated herein by reference in their entirety.

[0002] This application is filed with a Sequence Listing in electronic format. The Sequence Listing is provided in a file entitled "01155-0042-00PCT_Seq_List_ST25.txt", created on January 31, 2022, and is 133,099 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0003] Introduction and Overview T cell exhaustion is a broad term that has been used to describe the response of T cells to chronic antigen stimulation. It was first observed in the setting of chronic viral infection, but has also been studied in immune responses to tumors. The properties and characteristics of T cell exhaustion mechanisms may have critical implications for the success of checkpoint blockade and adoptive T cell transfer therapy.

[0004] T cell exhaustion is the progressive loss of effector function due to prolonged antigen stimulation, a hallmark of chronic infections and cancer. In addition to continuous antigen stimulation, antigen-presenting cells and cytokines present in the microenvironment may also contribute to this exhausted phenotype. Thus, T cell exhaustion is a state of T cell dysfunction in which T cell effector function is reduced and expression of inhibitory receptors persists. This prevents optimal control of infections or tumors. Moreover, exhausted T cells have a transcriptional state that differs from that of functional effector or memory T cells. Therapeutic treatments have the potential to rescue exhausted T cells (Goldberg, MV & Drake, CG, 2011, Wherry, EJ & Kurachi M., 2015).

[0005] Exhausted T cells typically express co-inhibitory receptors such as programmed cell death 1 (PDCD1 or PD-1). The gene products act as components of the immune checkpoint system. T cell exhaustion can be reversed by blocking these receptors.

[0006] Natural killer cell receptor 2B4 (also known as CD244) is an immunoregulatory transmembrane receptor in the signaling lymphocyte activation molecule (SLAM) family. 2B4 expression has been shown in a variety of cells, including, for example, natural killer cells, T cells, dendritic cells, basophils, monocytes, and myeloid-derived suppressor cells. Previous studies have demonstrated that 2B4 expression on certain immune cells is altered under certain pathological conditions. Subsequently, 2B4 inhibition has been associated with the maintenance of an exhausted phenotype in T cells, for example, in chronic infections and cancer. Agresta et al., Front. Immunol. 9:2809, 2018.

[0007] Provided herein are compounds and compositions for use in methods of preparing cells with genetic modifications (e.g., insertions, deletions, substitutions) in 2B4 sequences, e.g., genomic loci, e.g., generated using CRISPR / Cas systems, as well as cells with genetic modifications in 2B4 sequences and their use in various methods, e.g., to promote immune responses, e.g., in immuno-oncology and infectious diseases. Cells with 2B4 genetic modifications that can reduce 2B4 expression can include genetic modifications in additional genomic sequences, including T cell receptor (TCR) loci that reduce TCR expression, e.g., TRAC or TRBC loci; genomic loci that reduce expression of MHC class I molecules, e.g., B2M and HLA-A loci; genomic loci that reduce expression of MHC class II molecules, e.g., CIITA locus; and checkpoint inhibitor loci, e.g., LAG3 locus, TIM3 locus, and PD-1 locus. The present disclosure relates to cell populations that include cells with genetic modifications in 2B4 sequences, and optionally other genomic loci provided herein. The cells may be used in adoptive T cell transfer therapy.The present disclosure relates to compositions and uses of cells with genetic modification of 2B4 sequences for use in therapy, such as cancer therapy and immunotherapy.The present disclosure relates to gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of cells.

[0008] Provided herein is an engineered cell comprising a genetic modification in the human 2B4 sequence within the genomic coordinates of chr1:160830160-160862887. Further embodiments are provided and described throughout the claims and drawings.

[0009] Also disclosed is the use of the composition or formulation described in any of the above embodiments for preparing a medicament for treating a subject.The subject may be a human or an animal (e.g., a human or a non-human animal, e.g., a cynomolgus monkey).Preferably, the subject is a human.

[0010] Any of the above compositions or formulations are also disclosed for use in making genetic modifications (e.g., insertions, substitutions, or deletions) in the 2B4 gene sequence. In certain embodiments, the genetic modifications in the sequence cause changes in the nucleic acid sequence that prevent the translation of full-length proteins, for example, by forming frameshift or nonsense mutations, prior to the genetic modification of the genomic locus, resulting in premature termination of translation. The genetic modifications can include insertions, substitutions, or deletions at splice sites, i.e., splice acceptor sites or splice donor sites, resulting in abnormal splicing resulting in frameshift mutations, nonsense mutations, or truncated mRNA, resulting in premature termination of translation. The genetic modifications can also disrupt the translation or folding of the encoded protein, resulting in premature termination of translation.

[0011] The compositions provided herein for use in generating genetic modifications in a sequence preferably result in reduced expression of a protein from the sequence, e.g., reduced cell surface expression of a protein.

[0012] In another aspect, the invention provides a method of providing immunotherapy to a subject, comprising administering to the subject an effective amount of a cell as described herein, e.g., a cell of any of the foregoing cell aspects and embodiments.

[0013] In method embodiments, the method includes lymphodepletion prior to administering a cell or cell population described herein. In method embodiments, the method includes administering a lymphodepleting agent or an immunosuppressant prior to administering an effective amount of a cell described herein, such as any of the cell aspects and embodiments described above, to a subject. In another aspect, the invention provides a method of preparing a cell (e.g., a cell population).

[0014] Immunotherapy is the treatment of disease by activating or suppressing the immune system. Immunotherapies designed to induce or amplify an immune response are classified as activated immunotherapies. Cell-based immunotherapy has proven effective in the treatment of several cancers. Immune effector cells, such as lymphocytes, macrophages, dendritic cells, natural killer cells (NK cells), and cytotoxic T lymphocytes (CTLs), can be programmed to act in response to abnormal antigens expressed on the surface of tumor cells. Cancer immunotherapy thus enables components of the immune system to destroy tumors or other cancer cells.

[0015] Immunotherapy may also be useful in treating chronic infections, such as Hepatitis B and C virus infections, human immunodeficiency virus (HIV) infections, tuberculosis infections, and malaria infections. Immune effector cells containing targeted receptors, such as transgenic TCRs or CARs, are useful in immunotherapy, such as those described herein.

[0016] In another aspect, the present invention provides a method of preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) modifying the cells by reducing or eliminating expression of one or more or all components of the T cell receptor (TCR), e.g., by introducing a gRNA molecule (described herein) disclosed herein, or two or more gRNA molecules, into the cells; and (b) expanding the cells. The cells of the present invention are suitable for further engineering, e.g., by introduction of a heterologous sequence encoding a targeted receptor, e.g., a polypeptide that mediates TCR / CD3 zeta chain signaling. In some embodiments, the polypeptide is a targeted receptor selected from a non-endogenous TCR or CAR sequence. In some embodiments, the polypeptide is a wild-type or variant TCR. The cells of the present invention may also be suitable for further engineering, e.g., by introduction of a heterologous sequence encoding an alternative antigen-binding portion, e.g., an alternative (non-endogenous) T cell receptor, e.g., a chimeric antigen receptor (CAR) engineered to target a specific protein. CARs are also known as chimeric immune receptors, chimeric T cell receptors, or artificial T cell receptors.

[0017] In another aspect, the invention provides a method of treating a subject comprising administering a cell (e.g., a cell population) prepared by the method of preparing a cell described herein, e.g., any of the foregoing aspects and embodiments of the method of preparing a cell. [Brief description of the drawings]

[0018] [Figure 1A] Stem cell memory T cells (Tscm) are shown as a fraction of CD8+WT1 TCR-expressing engineered cells. [Figure 1B] Central memory T cells (Tcm) are shown as a fraction of CD8+WT1 TCR-expressing engineered cells. [Figure 1C] Effector memory T cells (Tem) are shown as a fraction of CD8+WT1 TCR-expressing engineered cells. [Figure 2A]13 shows the indel frequency determined with the first primer set via NGS for the third sequential edit in engineered T cells. [Figure 2B] Shown is the indel frequency determined with a second distinct primer set via NGS for the third sequential edit in engineered T cells. [Figure 3A] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 5:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3B] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 5:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3C] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 5:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3D] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3E] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3F] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:1 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3G]Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:5 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3H] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:5 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. [Figure 3I] Shown are the average image areas fluorescing in both red and green after exposure of WT1-expressing AML cells to engineered T cells, assayed using 1:5 E:T with AML cell lines pAML1, pAML2, or pAML3, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the present teachings will be described in conjunction with various embodiments, it is not intended that the present teachings be limited to those embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0020] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as such may vary. As used herein and in the appended claims, it should be noted that the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, a reference to "a cell" includes a plurality of cells (e.g., a population of cells), and so forth.

[0021] Numerical ranges include the numbers defining the range. Measurements and measurable values ​​are understood to be approximate, taking into account significant orders of magnitude and error associated with the measurements. In some embodiments, the cell population is at least 10 3 , 10 4 , 10 5 , or 10 6 cells, preferably 10 7 , 2×10 7 , 5×10 7 , or 10 8 It refers to a population of individual cells.

[0022] The use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that both the general description above and the detailed description below are exemplary and are merely illustrative and not limiting of the teachings. Unless otherwise stated herein, embodiments herein that recite various components as "comprising" are also assumed to "consist" of or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist" of or "consist essentially of" the recited components (this interchangeability does not apply to the use of these terms in the claims).

[0023] The term "or" is used in the specification in its inclusive sense, ie, equivalent to "and / or," unless the context clearly indicates otherwise.

[0024] The term "about" when used before a list modifies each member of the list. The term "about" is understood to include the acceptable variation or error within the art, such as 2 standard deviations from the mean, or the sensitivity of the method used to make the measurement. When "about" is present before the first value of a series, it can be understood to modify each value of the series.

[0025] Ranges are understood to include the end values ​​of the range and all logical values ​​therebetween, for example, 5-10 nucleotides is understood to mean 5, 6, 7, 8, 9, or 10 nucleotides, and 5-10% is understood to include all possible values ​​from 5% to 10%.

[0026] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the provided sequence, and is therefore clearly understood to provide an upper limit even if one is not specifically provided. Similarly, up to 3 nucleotides is understood to encompass 0, 1, 2, or 3 nucleotides, and provides a lower limit even if one is not specifically provided. When "at least," "up to," or other similar language modifies a number, it can be understood to modify each number in the sequence.

[0027] As used herein, "less than" or "less than" is understood as the logically lower value or integer up to zero, as is logical from the value adjacent to the phrase and the context. For example, a duplex region of "2 or less nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "less than" or "less than" is present before a series of numbers or ranges, it is understood that each number in the series or range is modified.

[0028] As used herein, ranges include both upper and lower limits.

[0029] In the event of a discrepancy between a sequence in this application and an indicated accession number or position in an accession number, the sequence in this application will control.

[0030] In the event of a discrepancy between a chemical name and a structure, the structure shall control.

[0031] As used herein, "detecting an analyte" and the like is understood as performing an assay that can detect the analyte, if present, where the analyte is present in an amount above the detection level of the assay.

[0032] As used herein, when the maximum amount of a value is expressed as 100% (e.g., 100% inhibition or 100% encapsulation), it is understood that the value is limited by the detection method.For example, 100% inhibition is understood as inhibition to a level below the detection level of the assay, and 100% encapsulation is understood as the material intended for encapsulation cannot be detected outside the vesicle.

[0033] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other express content of the present specification, the present specification shall control.

[0034] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings.

[0035] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds that contain nucleosides or nucleoside analogs (including traditional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof) with nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT No. 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2' methoxy or 2' halide substitutions. RNA can contain, for example, one or more deoxyribose nucleotides as a modification, and similarly, DNA can contain one or more ribonucleotides. Nitrogenous bases include the conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine); inosine; derivatives of purines or pyrimidines (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4-alkyl-pyrimidines; U.S. Patent No. 5,378,825 and PCT WO93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., eds., 11th ed., 1992). Nucleic acids may contain one or more "abasic" residues in which the backbone does not contain a nitrogenous base at a position(s) of the polymer (U.S. Patent No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases and linkages, or can contain both conventional building blocks and substitutions (e.g., conventional nucleosides with 2' methoxy substituents, or polymers containing both conventional nucleosides and one or more nucleoside analogs). Nucleic acids include "locked nucleic acids" (LNAs), which are analogs containing one or more LNA nucleotide monomers that have bicyclic furanose units locked to an RNA-mimetic sugar structure, enhancing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and can differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0036] "Guide RNA", "gRNA", and simply "guide" are used interchangeably herein to refer, for example, to either a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or, for example, in two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refer to each type. The trRNA may be a naturally occurring sequence or a trRNA sequence with modifications or alterations.

[0037] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be, for example, 20 base pairs in length, for Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologues. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as a guide. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-86. In some embodiments, the target sequence is, for example, within a gene or on a chromosome, and is, for example, complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence is at least 75%, 80%, 85%, 90%, or 95%, or 100%. For example, in some embodiments, the guide sequence comprises a sequence having at least 75%, 80%, 85%, 90%, or 95%, or 100% identity to at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1-86. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides.In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches, and the guide sequence comprises 20 nucleotides. That is, the guide sequence and the target region may form a duplex region with 17, 18, 19, 20, or more base pairs. In certain embodiments, the duplex region may contain 1, 2, 3, or 4 mismatches, such that the guide strand and the target sequence are not completely complementary. For example, the guide strand and the target sequence may be complementary over a region of more than 20 nucleotides, including 2 mismatches, such that the guide sequence and the target sequence are 90% complementary, providing a duplex region of 18 out of 20 base pairs.

[0038] Since the nucleic acid substrate of the RNA-guided DNA binder is a double-stranded nucleic acid, the target sequence of the RNA-guided DNA binder includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that the guide RNA can be directed to bind to the sense or antisense strand of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., the target sequence without PAM), except for the substitution of U to T in the guide sequence.

[0039] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases and their inactivated forms (dCas DNA binding agents). As used herein, "Cas nuclease" encompasses Cas cleavase, Cas nickase, and dCas DNA binding agents. dCas DNA binding agents can be inactive nucleases that contain a non-functional nuclease domain (RuvC or HNH domain). In some embodiments, Cas cleavase or Cas nickase encompasses dCas DNA binding agents that have been modified to enable DNA cleavage, for example, via fusion with a FokI domain. Cas cleavage / nickases and dCas DNA binders include the Csm or Cmr complex of type III CRISPR system, its Cas10, Csm1, or Cmr2 subunit, the Cascade complex of type I CRISPR system, its Cas3 subunit, and class 2 Cas nucleases. As used herein, "class 2 Cas nucleases" are single-chain polypeptides with RNA-guided DNA binding activity. Class 2 Cas nucleases include class 2 Cas cleavage / nickases (e.g., H840A, D10A, or N863A variants) that further have RNA-guided DNA cleavage or nickase activity, and class 2 dCas DNA binders in which cleavage / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof.The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains a RuvC-like nuclease domain. Zetsche's Cpf1 sequences are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0040] Exemplary nucleotide and polypeptide sequences of Cas9 molecules are provided below. Methods for identifying alternative nucleotide sequences encoding Cas9 polypeptide sequences, including alternative naturally occurring variants, are known in the art. Sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 nucleic acid sequences, amino acid sequences, or nucleic acid sequences encoding the amino acid sequences provided herein are also contemplated.

[0041] Exemplary open reading frame for Cas9 (SEQ ID NO:120)

[0042] Exemplary amino acid sequence of Cas9 (SEQ ID NO:121)

[0043] Exemplary open reading frame for Cas9 (SEQ ID NO:122)

[0044] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA comprising an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas cleavase, a Cas nickase, or a dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA guides an RNA-guided DNA binding agent, such as Cas9, to a target sequence, the guide RNA hybridizes to the target sequence, and the agent binds to the target sequence, where the agent is a cleavase or nickase and can perform cleavage or nicking after binding.

[0045] As used herein, "target sequence" refers to a nucleic acid sequence in a target gene that has complementarity to the guide sequence of a gRNA, i.e., is sufficiently complementary to allow specific binding of the guide sequence to the guide sequence. The interaction of the target sequence with the guide sequence directs the RNA-guided DNA binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0046] As used herein, a first sequence is considered to be "identical" or to have "100% identity" with a second sequence if alignment of the first sequence with the second sequence shows that all positions of the second sequence are matched by the first sequence. For example, sequence AAGA has 100% identity with sequence AAG, because alignment gives 100% identity in that there is a match without gaps at all three positions of the first sequence. Identities less than 100% can be calculated using conventional methods. For example, ACG will have 67% identity with AAGA (2 / 3=67%), because two of the three positions of the first sequence are matched with the second sequence. The differences between RNA and DNA (generally the replacement of thymidine with uridine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to the difference in identity or complementarity between polynucleotides, so long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complements). Thus, for example, the sequence 5'-AXG, where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, is considered to be 100% identical to AUG, in that both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. One of skill in the art will understand what algorithms and parameter settings are appropriate to choose for a given pair of sequences to be aligned.Generally, for sequences of similar length and predicted identity greater than 50% for amino acids or 75% for nucleotides, the Needleman-Wunsch algorithm, using default settings in the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server, is generally appropriate.

[0047] Similarly, as used herein, a first sequence is considered to be "fully complementary" or 100% complementary" to a second sequence when all of the nucleotides of the first sequence are complementary to the second sequence without gaps. For example, the sequence UCU would be considered to be fully complementary to the sequence AAGA, since each of the nucleobases from the first sequence is base-paired with the nucleotides of the second sequence, without gaps. The sequence UGU would be considered to be 67% complementary to the sequence AAGA, since two of the three nucleobases of the first sequence are base-paired with the nucleobases of the second sequence. Those skilled in the art will understand that algorithms are available with various parameter settings to determine the percent complementarity for any pair of sequences, for example, using the NCBI BLAST interface (blast.ncbi.nlm.nih.gov / Blast.cgi) or the Needleman-Wunsch algorithm.

[0048] "mRNA" is used herein to refer to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). An mRNA can include a phosphate sugar backbone that includes ribose residues or analogs thereof (e.g., 2'-methoxyribose residues). In some embodiments, the sugars of the mRNA phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof.

[0049] Exemplary guide sequences useful in the guide RNA compositions and methods described herein are shown in Table 1 and throughout the application. For example, where Table 1 shows a guide sequence, this guide sequence can be used in a guide RNA to direct an RNA-guided DNA binding agent, such as a nuclease, such as a Cas nuclease, such as Cas9, to a target sequence. The target sequence is provided in Table 1 as a genomic coordinate, and includes both the plus and minus strands of genomic DNA (i.e., the sequence given and the reverse complement of the sequence). In some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., the target sequence without the PAM), except for the substitution of U for T in the guide sequence.

[0050] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted at the site of a double-stranded break (DSB) in a target nucleic acid.

[0051] As used herein, "inhibit expression" refers to a decrease in the expression of a particular gene product (e.g., protein, mRNA, or both). Protein (i.e., gene product) expression can be measured by detecting the total cellular amount of protein from a tissue or cell population of interest, the expression of the protein as individual members of the cell population, e.g., by cell sorting to define the percentage of cells expressing the protein, or the expression of the protein in cells in the population, e.g., by ELISA or Western blot. Inhibition of expression can result from genetic modification of a gene sequence, e.g., a genomic sequence, such that the full-length gene product or any gene product is no longer expressed, e.g., knockdown of a gene. Certain genetic modifications can result in the introduction of frameshift or nonsense mutations that prevent translation of the full-length gene product. Genetic modifications close enough to a splice site, e.g., a splice acceptor site or a splice donor site, can prevent translation of the full-length protein to disrupt splicing. Inhibition of expression can be due to genetic modifications in regulatory sequences in genomic sequences required for expression of a gene product, e.g., promoter sequences, 3'UTR sequences, e.g., capping sequences, 5'UTR sequences, e.g., polyA sequences. Inhibition of expression can also be due to the expression or activity of regulatory factors required for translation of the gene product, e.g., preventing the production of the gene product. For example, genetic modifications of transcription factor sequences that inhibit the expression of a full-length transcription factor can have downstream effects and inhibit the expression of one or more gene products controlled by the transcription factor. Inhibition of expression can therefore be predicted by changes in the genome or mRNA sequence. Thus, mutations expected to result in inhibition of expression can be detected by known methods, including sequencing of mRNA isolated from a tissue or cell population of interest. Inhibition of expression can be determined as a given expression level of the protein, i.e., the percentage of cells in the population that express the protein of interest at at least a particular level, or the percentage of cells in the population that have a reduced number.Inhibition of expression can also be assessed, for example, by determining a reduction in overall protein levels in a cell or tissue sample, such as a biopsy sample. In certain embodiments, inhibition of expression of a secreted protein can be assessed in a fluid sample, such as cell culture medium or a bodily fluid. The protein can be present in a bodily fluid, such as blood or urine, to allow for analysis of protein levels. In certain embodiments, protein levels can be determined by the level of protein activity or metabolites, such as the level of protein activity or metabolites in urine or blood. In some embodiments, "inhibition of expression" can refer to some loss of expression of a particular gene product, such as a reduction in the amount of mRNA transcribed, or a reduction in the amount of protein expressed by a cell population. In some embodiments, "inhibition" can refer to some loss of expression of a particular gene product, such as the 2B4 gene product at the cell surface. It is understood that the level of knockdown is relative to the starting level in the same type of subject sample. For example, routine monitoring of protein levels is more easily performed in a fluid sample from a subject (e.g., blood or urine) than in a tissue sample (e.g., biopsy sample). It is understood that the level of knockdown is for the sample being assayed. Similarly, in animal studies where serial tissue samples, such as liver tissue, may be obtained, the knockdown target may be expressed in other tissues, and thus the level of knockdown is not necessarily the level of systemic knockdown, but rather the level of knockdown within the tissue, cell type, or fluid sampled.

[0052] As used herein, a "genetic modification" is a change at the DNA level, for example, induced by the CRISPR / Cas9 gRNA and Cas9 system. A genetic modification can include an insertion, deletion, or substitution (i.e., base sequence substitution, i.e., mutation) typically within a defined sequence or genomic locus. A genetic modification changes the nucleic acid sequence of DNA. A genetic modification can be at a single nucleotide position. A genetic modification can be multiple nucleotides, e.g., 2, 3, 4, 5 or more nucleotides, typically close to each other, e.g., contiguous nucleotides. A genetic modification can be within a coding sequence, e.g., an exon sequence. A genetic modification can be located close enough to a splice site, i.e., a splice acceptor site or a splice donor site, to disrupt splicing. A genetic modification can include the insertion of a nucleotide sequence that is not endogenous to the genomic locus, for example, the insertion of a heterologous open reading frame or coding sequence of a gene. As used herein, preferably, genetic modification prevents the translation of a full-length protein having the amino acid sequence of the full-length protein before the genetic modification of the genomic locus.Prevention of the translation of a full-length protein or gene product includes prevention of the translation of any length of protein or gene product.For example, the translation of a full-length protein can be prevented by a frameshift mutation that results in the generation of a premature stop codon, or by the generation of a nonsense mutation.The translation of a full-length protein can be prevented by disrupting splicing.

[0053] As used herein, a "heterologous coding sequence" refers to a coding sequence that has been introduced as an exogenous source into a cell (e.g., inserted into a genomic locus, such as a safe harbor locus, including a TCR locus). That is, the introduced coding sequence is heterologous at least with respect to its insertion site. A polypeptide expressed from such a heterologous coding sequence gene is referred to as a "heterologous polypeptide." A heterologous coding sequence can be naturally occurring or engineered, and can be wild-type or variant. A heterologous coding sequence can include nucleotide sequences other than the sequence encoding the heterologous polypeptide (e.g., an internal ribosome entry site). A heterologous coding sequence can be a coding sequence that is naturally occurring in a genome, either as a wild-type or variant (e.g., mutant). For example, a cell contains a coding sequence of interest (as a wild-type or variant), but the same coding sequence or a variant thereof can be introduced as an exogenous source for expression, for example, at a locus of high expression. A heterologous coding sequence can also be a coding sequence that is not naturally occurring in a genome or that expresses a heterologous polypeptide that is not naturally occurring in a genome. "Heterologous coding sequence," "exogenous coding sequence," and "transgene" are used interchangeably. In some embodiments, a heterologous coding sequence or transgene comprises an exogenous nucleic acid sequence, e.g., a nucleic acid sequence that is not endogenous to a recipient cell. In some embodiments, a heterologous coding sequence or transgene comprises an exogenous nucleic acid sequence, e.g., a nucleic acid sequence that does not naturally occur in a recipient cell. For example, a heterologous coding sequence can be heterologous with respect to its insertion site and with respect to its recipient cell.

[0054] A "safe harbor" locus is a locus in a genome where a gene can be inserted without significant harmful effects on cells.Non-limiting examples of safe harbor loci targeted by nuclease(s) for use herein include AAVS1 (PPP1 R12C), TCR, B2M.In some embodiments, insertion at a locus or loci targeted to knockdown, such as TRC gene, for example, TRAC gene, is advantageous to cells.Other suitable safe harbor loci are known in the art.

[0055] As used herein, a "targeting receptor" refers to a receptor present on the surface of a cell, e.g., a T cell, that allows the cell to bind to a target site, e.g., a specific cell or tissue within an organism. Targeting receptors include, but are not limited to, chimeric antigen receptors (CARs), T cell receptors (TCRs), and receptors of cell surface molecules operably linked through at least a transmembrane domain within an internal signaling domain that can activate a T cell upon binding of the extracellular receptor portion of the protein.

[0056] As used herein, a chimeric antigen receptor refers to an scFv, VHH, nanobody that is operably linked to an extracellular antigen recognition domain, e.g., an intracellular signaling domain that activates T cells when an antigen is bound. A CAR is composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T cell signaling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, WO2018208837, the contents of which are each incorporated herein by reference in their entirety). Reverse universal CARs that facilitate immune cell binding to target cells via adaptor molecules (see, e.g., WO2019238722, the contents of which are incorporated herein in their entirety) are also contemplated. CARs can target any antigen for which an antibody can be developed, and are typically directed to molecules displayed on the surface of the targeted cell or tissue.

[0057] As used herein, "treatment" refers to any application of administration or therapy for a disease or disorder in a subject, including inhibiting the disease, arresting its progression, alleviating one or more symptoms of the disease, curing the disease, preventing one or more symptoms of the disease, or preventing the recurrence of one or more symptoms of the disease. Treating an autoimmune or inflammatory response or disorder may include alleviating inflammation associated with a particular disorder, resulting in the alleviation of disease-specific symptoms. Treatment with the engineered T cells described herein may be used before, after, or in combination with additional therapeutic agents, such as standard care for the indication being treated.

[0058] The human wild-type 2B4 sequence is available at NCBI Gene ID: 51744 (www.www.ncbi.nlm.nih.gov / gene / 51744, version available on the filing date of this application). Ensembl: ENSG00000122223, chr1:160830160-160862887. The 2B4 gene contains nine exons. CD244, NAIL, NKR2B4, Nmrk, SLAMF4 are gene synonyms of 2B4. The 2B4 gene corresponds to the protein UniProtKB identifier Q9BZW8. The 2B4 gene encodes a cell surface receptor expressed on natural killer (NK) cells and T cells that mediate non-major histocompatibility complex (MHC) restricted killing.

[0059] As used herein, "T cell receptor" or "TCR" refers to a receptor in T cells. Generally, TCR is a heterodimeric receptor molecule containing two TCR polypeptide chains, α and β. The α and β chain TCR polypeptides can complex with various CD3 molecules and induce immune response(s), including inflammation and autoimmunity, after antigen binding. As used herein, knockdown of TCR refers to partial or total knockdown of any TCR gene, for example, deletion of a part of the TRBC1 gene, alone or in combination with partial or total knockdown of other TCR gene(s).

[0060] "TRAC" is used to refer to the T cell receptor alpha chain. Human wild type TRAC sequence is available at NCBI Gene ID: 28755; Ensembl: ENSG00000277734. T cell receptor alpha constant, TCRA, IMD7, TRCA and TRA are gene synonyms of TRAC.

[0061] "TRBC" is used to refer to the T cell receptor β chain, e.g., TRBC1 and TRBC2. "TRBC1" and "TRBC2" refer to two homologous genes that encode the T cell receptor β chain, which are the gene products of the TRBC1 or TRBC2 genes.

[0062] The human wild type TRBC1 sequence is available at NCBI Gene ID: 28639; Ensembl: ENSG00000211751. T cell receptor beta constant, V_segment translation product, BV05S1J2.2, TCRBC1, and TCRB are gene synonyms of TRBC1.

[0063] The human wild type TRBC2 sequence is available at NCBI Gene ID: 28638; Ensembl: ENSG00000211772. T cell receptor beta constant, V_segment translation product, and TCRBC2 are gene synonyms of TRBC2.

[0064] "T cells" play a central role in immune responses following exposure to antigens. For example, T cells can be naturally occurring or non-naturally occurring, for example, when they are formed by engineering, e.g., from stem cells, or by transdifferentiation, e.g., by reprogramming somatic cells. T cells can be distinguished from other lymphocytes by the presence of a T cell receptor on the cell surface. This definition includes conventional adaptive T cells, including helper CD4+ T cells, cytotoxic CD8+ T cells, memory T cells, and regulatory CD4+ T cells, as well as innate-like T cells, including natural killer T cells, mucosal-associated invariant T cells, and gamma delta T cells. In some embodiments, T cells are CD4+. In some embodiments, T cells are CD3+ / CD4+.

[0065] As used herein, "MHC" or "MHC protein" refers to a major histocompatibility complex molecule(s), including, for example, MHC class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) and MHC class II molecules (e.g., HLA-DP, HLA-DQ, and HLA-DR in humans).

[0066] "CIITA" or "CIITA" or "C2TA" as used herein refers to the nucleic acid or protein sequence of the "class II major histocompatibility complex transactivator", the human gene having the accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The CIITA protein in the nucleus acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.

[0067] "β2M" or "B2M" as used herein refers to the nucleic acid or protein sequence of "β-2 microglobulin", the human gene having accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein associates with MHC class I molecules as a heterodimer on the surface of nucleated cells and is required for MHC class I protein expression.

[0068] The term "HLA-A" as used herein in the context of an HLA-A protein refers to an MHC class I protein molecule that is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term "HLA-A" or "HLA-A gene" as used herein in the context of a nucleic acid refers to the gene that encodes the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain" and the human gene has the accession number NC_000006.12 (29942532..29945870). The HLA-A gene is known to have thousands of different versions (also called "alleles") throughout the population (and an individual can receive two different alleles of the HLA-A gene). A public database of HLA-A alleles, including sequence information, can be accessed at IPD-IMGT / HLA: www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms "HLA-A" and "HLA-A gene."

[0069] As used herein, the term "within genomic coordinates" includes the boundaries of a given genomic coordinate range. For example, given chr6:29942854-chr6:29942913, coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, genomic coordinates referenced are based on the genome annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to the corresponding coordinates of another assembly of the human genome, including conversion to a previous assembly produced by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion of an assembly produced by a different institution or algorithm (e.g., from GRCh38 to NCBI33, produced by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, the NCBI Genome Remapping Service available at the National Center for Biotechnology Information website, UCSC LiftOver available at the UCSC Genome Brower website, and Assembly Converter available at the Ensembl.org website.

[0070] As used herein, "splice site" refers to the three nucleotides that make up an acceptor splice site or a donor splice site (defined below), or any other nucleotide known in the art that is part of a splice site. See, e.g., Burset et al., Nucleic Acids Research 28(21):4364-4375(2000) (describing canonical and non-canonical splice sites in the mammalian genome). The three nucleotides that make up the "acceptor splice site" are the two conserved residues 3' of the intron (e.g., AG in humans) and the boundary nucleotide (i.e., the first nucleotide of the exon 3' of AG). The "splice site boundary nucleotide" of the acceptor splice site is designated as "Y" in the diagram below, and may also be referred to herein as the "acceptor splice site boundary nucleotide" or the "splice acceptor site boundary nucleotide." The terms "acceptor splice site," "splice acceptor site," "acceptor splice sequence," or "splice acceptor sequence" may be used interchangeably herein.

[0071] The three nucleotides that make up the "donor splice site" are two conserved residues at the 5' end of the intron and the boundary nucleotide (i.e., the first nucleotide of the exon 5' to GT) (e.g., GT (gene) in humans or GU (in RNA such as pre-mRNA). The "splice site boundary nucleotide" of the donor splice site is designated as "X" in the diagram below and may also be referred to herein as the "donor splice site boundary nucleotide" or "splice donor site boundary nucleotide." The terms "donor splice site," "splice donor site," "donor splice sequence," or "splice donor sequence" may be used interchangeably herein. [ka]

[0072] II. Composition A. Compositions Comprising Guide RNA (gRNA) Provided herein are compositions useful for modifying DNA sequences, e.g., using guide RNAs in conjunction with RNA-guided DNA binding agents (e.g., CRISPR / Cas systems) to induce single-strand breaks (SSBs) or double-strand breaks (DSBs) in the 2B4 gene. Guide sequences that target the 2B4 gene are shown in Table 1 as SEQ ID NOs: 1-86, as are the genomic coordinates to which such guide RNAs are targeted.

[0073] Each guide sequence shown in Table 1 as SEQ ID NOs: 1-86 may further comprise additional nucleotides to form a crRNA, for example, having at its 3' end the following exemplary nucleotide sequence following the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 200), in the 5' to 3' orientation.

[0074] In the case of sgRNA, the guide sequence described above may further include additional nucleotides to form the sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 201) in the 5' to 3' orientation.

[0075] In the case of sgRNAs, the guide sequences described above may further include additional nucleotides to form the sgRNA, such as the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 202) in the 5' to 3' orientation.

[0076] In the case of sgRNAs, the guide sequence may incorporate the following modified motif mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*Mu (SEQ ID NO: 300), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide, the sugar portion of the nucleotide can be ribose, deoxyribose, or similar compounds having substitutions, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between the nucleotide residues, and N is collectively the nucleotide sequence of the guide sequence.

[0077] In the case of sgRNA, the guide sequence may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in the table below (SEQ ID NO: 201 (GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-"exemplary SpyCas9 sgRNA-1") included at the 3' end of the guide sequence and comprises domains as shown in the table below. LS is the lower stem. B is the bulge. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 are collectively referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.

[0078] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can serve as a template sequence for specific chemical modifications, sequence replacements, and cleavage.

[0079] In certain embodiments, the gRNA is, for example, an sgRNA or a dgRNA, and optionally includes a chemical modification. In some embodiments, the modified sgRNA includes a guide sequence and a SpyCas9 sgRNA sequence, for example, the exemplary SpyCas9 sg-RNA-1. The gRNA, such as the sgRNA, may include a modification at one or more of the terminal nucleotides, for example, one, two, three, or four of the nucleotides at the 3' end or 5' end, at the 5' end of the guide sequence or the 3' end of the guide sequence, for example, the exemplary SpyCas9 sgRNA-1. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, and inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides include 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotide comprises a PS linkage.In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide and a PS linkage.

[0080] In certain embodiments, using SEQ ID NO: 201 "Exemplary SpyCas9 sgRNA-1" as an example, the exemplary SpyCas9 sgRNA-1 further comprises one or more of the following:

[0081] A. A shortened or substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 are substituted with Watson-Crick paired nucleotides in Hairpin 1, and the Hairpin 1 region optionally comprises: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or C. lacking 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened hairpin 1 region is missing 4 to 8 nucleotides, preferably 4 to 6 nucleotides; a. one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to an exemplary SpyCas9 sgRNA-1; or b. one or more of positions H1-6 through H1-10 are substituted relative to an exemplary SpyCas9 sgRNA-1; or 3. A shortened hairpin 1 region, in which the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9 sgRNA-1; or

[0082] B. A shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides, and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region contain no more than 4 substitutions relative to the exemplary SpyCas9 sgRNA-1; or

[0083] C. A substitution compared to an exemplary SpyCas9 sgRNA-1 in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substitutent nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine; or

[0084] D. An exemplary SpyCas9 sgRNA-1 having an upper stem region, wherein the upper stem modification comprises any one or more modifications of US1-US12 in the upper stem region; 1. The modified nucleotides are optionally selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof; or 2. An exemplary SpyCas9 sgRNA-1, wherein the modified nucleotides optionally include 2'-OMe modified nucleotides.

[0085] In certain embodiments, the sgRNA, such as the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 201), or an sgRNA comprising the exemplary SpyCas9 sgRNA-1, further comprises a 3' tail, e.g., a 3' tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides. In certain embodiments, the modified nucleotides comprise PS linkages between nucleotides. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides and PS linkages between nucleotides.

[0086] In certain embodiments, the hairpin region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.

[0087] In certain embodiments, the upper stem region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.

[0088] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a modified nucleotide. In certain embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide.

[0089] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a replacement nucleotide, i.e., a sequence replacement nucleotide, where the pyrimidine is replaced with a purine. In certain embodiments, when a pyrimidine forms a Watson-Crick base pair within a single guide, the Watson-Crick based nucleotide of the replaced pyrimidine nucleotide is replaced to maintain the Watson-Crick base pair. [Table 1] [Table 2-1] [Table 2-2] [Table 2-3]

[0090] For each crRNA, the 20 nt guide sequence shown is contained within the N20GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 203) nucleic acid sequence, where "N20" represents the guide sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

[0091] In some embodiments, the invention provides compositions comprising one or more guide RNAs (gRNAs) comprising a guide sequence that directs an RNA-guided DNA binding agent, which may be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in 2B4. In some embodiments comprising a gRNA, the gRNA may comprise a guide sequence as shown in Table 1, e.g., as an sgRNA. In some embodiments, the gRNA may comprise a guide sequence selected from SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17. The gRNA may comprise a guide sequence comprising 17, 18, 19, or 20 contiguous nucleotides of a guide sequence as shown in Table 1. In some embodiments, the gRNA comprises a guide sequence comprising a sequence having at least 75%, 80%, 85%, 90%, or 95%, or 100% identity to at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence as set forth in Table 1, optionally SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17. In some embodiments, the gRNA comprises a guide sequence comprising a sequence having at least 75%, 80%, 85%, 90%, or 95%, or 100% identity to a guide sequence as set forth in Table 1, optionally SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17. The gRNA may further comprise a trRNA. In each embodiment described herein, the gRNA may comprise a crRNA and a trRNA associated as a single RNA (sgRNA) or on separate RNAs (dgRNA). In the context of an sgRNA, the crRNA and trRNA components can be covalently linked, for example, via a phosphodiester bond or other covalent bond.

[0092] In each of the embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, which comprises a guide sequence, for example, as shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex by base pairing between portions of the crRNA and the trRNA.

[0093] In each of the embodiments described herein, the guide RNA may comprise a single RNA molecule as a "single guide RNA" or "sgRNA." The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1, or a guide sequence selected from SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17, covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1, or a guide sequence selected from SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17. In some embodiments, the crRNA and the trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between portions of the crRNA and the trRNA. In some embodiments, the crRNA and the trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

[0094] In some embodiments, the trRNA may comprise all or part of the trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.

[0095] In some embodiments, the present invention provides compositions comprising one or more guide RNAs comprising any one of the guide sequences of SEQ ID NOs: 1-86, preferably SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17.

[0096] In some embodiments, the present invention provides compositions comprising one or more sgRNAs comprising any one of SEQ ID NOs: 87-119.

[0097] In one aspect, the invention provides a composition comprising a gRNA comprising a guide sequence that is 100%, or at least 95% or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-86, preferably SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17.

[0098] In other embodiments, the composition comprises at least one, e.g., at least two, gRNAs comprising a guide sequence selected from any two or more of the guide sequences of SEQ ID NOs: 1-86, preferably SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence that is 100%, or at least 95% or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-86, preferably SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17.

[0099] The guide RNA composition of the present invention is designed to recognize (e.g., hybridize to) a target sequence in the 2B4 gene. For example, the 2B4 target sequence can be recognized and cleaved by the provided Cas cleavage containing guide RNA. In some embodiments, the RNA guided DNA binding agent, e.g., Cas cleavage agent, can direct the guide RNA to the target sequence of the 2B4 gene, the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA guided DNA binding agent, e.g., Cas cleavage agent, cleaves the target sequence.

[0100] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the 2B4 gene.

[0101] Without being bound to any particular theory, mutations in certain regions of a gene (e.g., indels resulting from nuclease-mediated DSBs, i.e., frameshift mutations resulting from insertions or deletions) may be less tolerated than mutations in other regions of a gene, and thus the location of the DSB is an important factor in the amount or type of protein knockdown that can be effected. In some embodiments, a gRNA that is complementary or has complementarity to a target sequence in 2B4 is used to direct an RNA-guided DNA-binding agent to a specific location in the 2B4 gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary or has complementarity to a target sequence in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8 of 2B4.

[0102] In some embodiments, the guide sequence is 100%, or at least 95% or 90% identical to the target sequence or the reverse complement of the target sequence present in the human 2B4 gene. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, or 95%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is about 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, where the guide sequence is 20 nucleotides.

[0103] In some embodiments, the compositions or formulations disclosed herein comprise an RNA-guided DNA binding agent, such as an mRNA comprising an open reading frame (ORF) encoding a Cas nuclease as described herein. In some embodiments, an RNA-guided DNA binding agent, such as an mRNA comprising an ORF encoding a Cas nuclease, is provided, used, or administered.

[0104] B. Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to describe the presence of one or more non-natural or naturally occurring components or structures that are used in place of, or in addition to, the standard A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with non-standard nucleosides or nucleotides and is referred to herein as "modified." Modified nucleosides or nucleotides can include one or more of: (i) an alteration in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens or one or more of the bridging phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., replacement, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar (exemplary sugar modifications); (iii) wholesale replacement of a phosphate moiety with a "dephosphorylated" linker (exemplary backbone modifications); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); (v) replacement or modification of the ribose phosphate backbone (exemplary backbone modifications); (vi) a modification of the 3' or 5' end of the oligonucleotide, e.g., removal, modification or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3' or 5' cap modifications can include sugar and / or backbone modifications); and (vii) a modification or replacement of the sugar (exemplary sugar modifications).

[0105] Chemical modifications such as those listed above can be combined to provide modified gRNAs or mRNAs that include nucleosides and nucleotides (collectively "residues") that may have two, three, four, or more modifications. For example, modified residues may have modified sugars and modified nucleobases. In some embodiments, each base of the gRNA is modified, e.g., all bases have modified phosphate groups, such as phosphorothioates. In certain embodiments, all, or substantially all, of the phosphate groups of the gRNA molecule are replaced by phosphorothioate groups. In some embodiments, the modified gRNA includes at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA includes at least one modified residue at or near the 3' end of the RNA.

[0106] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in the modified gRNA are modified nucleosides or nucleotides.

[0107] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or those found in serum. For example, nucleases may hydrolyze phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein may include one or more modified nucleosides or nucleotides, for example, to introduce stability against intracellular or serum-derived nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit reduced innate immune responses when introduced into cell populations both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, including induction of cytokine (particularly interferon) expression and release and cell death.

[0108] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygens with different substituents.Moreover, modified residues, such as modified residues present in modified nucleic acids, can include large-scale replacement of unmodified phosphate moieties with modified phosphate groups as described herein.In some embodiments, backbone modification of phosphate backbone can include modifications that result in either uncharged linkers or charged linkers with asymmetric charge distribution.

[0109] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. The phosphate atom in an unmodified phosphate group is achiral. However, the replacement of one of the non-bridging oxygens with one of the atoms or groups of atoms mentioned above can make the phosphorus atom chiral. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). The backbone can also be modified by the replacement of the bridging oxygen (i.e., the oxygen that connects the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). The replacement can occur at either or both bridging oxygens.

[0110] The phosphate group can be replaced by a non-phosphorus-containing linking group in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group can include, but are not limited to, for example, methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, methyleneoxymethylimino.

[0111] Scaffolds can also be constructed that can mimic nucleic acids, in which the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by backbone surrogates. Examples can include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0112] Modified nucleosides and modified nucleotides may include one or more modifications to the sugar group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) may be modified, e.g., replaced by a number of different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2' hydroxyl group may enhance the stability of the nucleic acid, since the hydroxyl can no longer be deprotonated to form a 2'-alkoxide ion.

[0113] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) n In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be 2'-fluoro modification, where the 2'-hydroxyl group is replaced with fluorine. In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me, where the 2' ... 1-6They may also include "locked" nucleic acids (LNAs) that may be linked to the 4' carbon of the same ribose sugar via a heteroalkylene bridge, exemplary bridges being methylene, propylene, ether, or amino bridges, O-amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH). n -amino (wherein amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include an "unlocked" nucleic acid (UNA) in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0114] A "deoxy" 2' modification can be any of the following: hydrogen (i.e., a deoxyribose sugar, e.g., a partial dsRNA overhang); halo (e.g., bromo, chloro, fluoro, or iodo); amino (where amino can be, e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CHCHNH) n and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein; -NHC(O)R, where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar; cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein.

[0115] Sugar modifications can include sugar groups that contain one or more carbons and have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides that contain, for example, arabinose as sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that are L-form, for example, L-nucleosides.

[0116] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can include modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of bases.

[0117] In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may include modifications. Such modifications may be present at one or both ends of the crRNA or tracrRNA. In embodiments including sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleosides may be modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. Certain embodiments include 5'-end modifications and 3'-end modifications.

[0118] In some embodiments, the guide RNA disclosed herein comprises one of the modification patterns disclosed in WO2018 / 107028(A1), entitled "Chemically Modified Guide RNAs", filed December 8, 2017, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in US20170114334, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in WO2017 / 136794, the contents of which are incorporated herein by reference in their entirety.

[0119] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, where N is any natural or non-natural nucleotide and the entirety of N comprises a 2B4 guide sequence as described herein, for example, in Table 1. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU (SEQ ID NO: 300), where "N" can be any natural or non-natural nucleotide and the entirety of N comprises a 2B4 guide sequence as described in Table 1. For example, where N is replaced with any of the guide sequences disclosed herein in Table 1, and optionally, N is replaced with SEQ ID NOs: 1-86, or preferably, SEQ ID NOs: 1-28, SEQ ID NOs: 1-5, SEQ ID NOs: 1 and 2, or SEQ ID NOs: 3, 4, 10, and 17.

[0120] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.

[0121] The terms "mA," "mC," "mU," or "mG" may be used to refer to 2'-O-Me modified nucleotides.

[0122] The 2'-O-methyl modification can be depicted as follows: [ka]

[0123] Another chemical modification that has been shown to affect the nucleotide sugar ring is halogen substitution. For example, 2'-fluoro (2'-F) substitutions on the nucleotide sugar ring can increase oligonucleotide binding affinity and nuclease stability.

[0124] In this application, the terms "fA," "fC," "fU," or "fG" may be used to refer to 2'-F substituted nucleotides.

[0125] The 2'-F substitution can be depicted as follows: [ka]

[0126] Phosphorothioate (PS) linkage or bond refers to a phosphodiester linkage, e.g., a bond in which a sulfur replaces one non-bridging phosphate oxygen in the bond between nucleotide bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0127] "*" may be used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the adjacent (e.g., 3') nucleotide by a PS bond.

[0128] In this application, the terms "mA*," "mC*," "mU*," or "mG*" may be used to refer to a nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide with a PS bond.

[0129] The diagram below shows the substitution of S- for the non-bridging phosphate oxygens resulting in a PS bond instead of a phosphodiester bond. [ka]

[0130] An abasic nucleotide is one that lacks a nitrogenous base. The diagram below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base. [ka]

[0131] An inverted base refers to one that has a linkage that is inverted from the normal 5' to 3' linkage (i.e., either a 5' to 5' linkage or a 3' to 3' linkage). For example, [ka]

[0132] The abasic nucleotide can be linked with an inverted linkage. For example, the abasic nucleotide can be linked to the terminal 5' nucleotide via a 5' to 5' linkage, or the abasic nucleotide can be linked to the terminal 3' nucleotide via a 3' to 3' linkage. An inverted abasic nucleotide at either the terminal 5' or 3' nucleotide can also be referred to as an inverted abasic end cap.

[0133] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified, in some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications known in the art to increase stability or performance.

[0134] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked using phosphorothioate (PS) bonds.

[0135] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abasic nucleotides. In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern set forth in mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), where N is any natural or non-natural nucleotide, and the entirety of N comprises a guide sequence that directs a nuclease to a target sequence within 2B4 (e.g., the genomic coordinates set forth in Table 1).

[0136] In some embodiments, the guide RNA comprises a sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-86 and a conserved portion of the sgRNA, such as the conserved portion of the sgRNA shown as exemplary SpyCas9 sgRNA-1, or the conserved portion of the gRNA shown in Table 2 and throughout the specification. In some embodiments, the guide RNA comprises a guide sequence of SEQ ID NOs: 1-86 and an sgRNA comprising any one of the nucleotides of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 202), where the nucleotide is at the 3' end of the guide sequence, and the sgRNA can be modified as described herein or in the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300). In some embodiments, the sgRNA includes the exemplary SpyCas9 sgRNA-1 provided herein and modified versions thereof, or the versions provided in Table 3 below, in which the entire N comprises a guide sequence that directs a nuclease to a target sequence. Each N is independently modified or unmodified. In certain embodiments, in the absence of an indication of modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. [Table 4]

[0137] As mentioned above, in some embodiments, the compositions or formulations disclosed herein comprise an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas9 nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas9 nuclease, is provided, used, or administered. In some embodiments, the ORF encoding the RNA-guided DNA nuclease is a "modified RNA-guided DNA binding agent ORF" or simply a "modified ORF", which is used as an abbreviation to indicate that the ORF is modified.

[0138] In some embodiments, the mRNA or modified ORF may include modified uridines at at least one, multiple, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5 position, e.g., with a halogen, methyl, or ethyl. In some embodiments, the modified uridine is a pseudouridine modified at the 1 position, e.g., with a halogen, methyl, or ethyl. The modified uridine may be, e.g., pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0139] In some embodiments, the mRNA disclosed herein comprises a 5' cap, e.g., Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., for ARCA, as discussed below) linked via a 5'-triphosphate to the 5' position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5'-3' strand of the mRNA. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA both comprise a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 can be immunogenic in mammals, such as humans, because they are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, and can cause increased levels of cytokines, including type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, can also compete with eIF4E for binding to mRNAs with caps other than Cap1 or Cap2, potentially inhibiting translation of the mRNA.

[0140] Caps can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of guanine ribonucleotides and can be incorporated into transcripts in vitro at initiation. ARCA results in a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is a hydroxyl. See, for example, Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. [ka]

[0141] CleanCap™ AG (m7G(5')ppp(5')(2'OmeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OmeG)pG, TriLink Biotechnologies catalog number N-7133) can be used to provide the Cap1 structure co-transcriptionally. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. [ka]

[0142] Alternatively, a cap can be added to RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S) and has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit, and guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.

[0143] In some embodiments, the mRNA further comprises a polyadenylation (poly-A) tail. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In some embodiments, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides.

[0144] C. Ribonucleoprotein complex In some embodiments, the composition includes one or more gRNAs comprising one or more guide sequences from Table 1, or one or more sgRNAs from Table 2, and an RNA-guided DNA binding agent, e.g., a nuclease, e.g., a Cas nuclease, e.g., Cas9. In some embodiments, the RNA-guided DNA binding agent has cleavase activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of S. pyogenes, S. aureus, and other prokaryotic type II CRISPR systems (see, e.g., the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., US20160312198, US20160312199. Other examples of Cas nucleases include the Csm or Cmr complexes of type III CRISPR systems, or the Cas10, Csm1, or Cmr2 subunits thereof, and the Cascade complexes of type I CRISPR systems, or the Cas3 subunits thereof. In some embodiments, the Cas nuclease may be from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., NAT.REV.MICROBIOL.9:467-477(2011); Makarova et al., NAT.REV.MICROBIOL,13:722-36(2015); Shmakov et al., MOLECULAR CELL,60:385-397(2015).

[0145] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya asp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae bacterium ND2006、、、Acaryochloris marina is included。.

[0146] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.

[0147] In some embodiments, the gRNA with the RNA-guided DNA-binding agent is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA-binding agent is a Cas nuclease. In some embodiments, the gRNA with the Cas nuclease is referred to as a Cas RNP. In some embodiments, the RNP comprises type I, type II, or type III components. In some embodiments, the Cas nuclease is a Cas9 protein from a type II CRISPR / Cas system. In some embodiments, the gRNA with Cas9 is referred to as a Cas9 RNP.

[0148] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises two or more RuvC domains or two or more HNH domains. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the composition, use and method embodiments, Cas induces a double-stranded break in the target DNA.

[0149] In some embodiments, chimeric Cas nucleases are used, where one domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

[0150] In other embodiments, the Cas nuclease may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0151] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e., it can cleave one DNA strand to generate a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is an aspect of a Cas nuclease (e.g., the Cas nucleases discussed above) in which the endonucleolytic active site has been inactivated, e.g., by one or more modifications (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Pat. No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications. In some embodiments, the Cas nickase, such as the Cas9 nickase, has an inactivated RuvC or HNH domain.

[0152] In some embodiments, the RNA-guided DNA binding agent is modified to contain only one functional nuclease domain. For example, the drug protein may be modified to have one of the nuclease domains mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase with a RuvC domain with reduced activity is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with a HNH domain with reduced activity is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0153] In some embodiments, conserved amino acids in the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may include an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may include an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN)).

[0154] In some embodiments, the mRNA encoding the nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNA directs the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), thereby introducing DSBs. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of DNA, producing a double nick in the target DNA. In some embodiments, the nickase is used with two separate guide RNAs that are selected to be in close proximity to each other, producing a double nick in the target DNA.

[0155] In some embodiments, the RNA-guided DNA binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA binding agent comprises a dCas DNA binding polypeptide. The dCas polypeptide has DNA binding activity while essentially lacking catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA binding agent lacking cleavase and nickase activity or the dCas DNA binding polypeptide is an embodiment of a Cas nuclease (e.g., the Cas nuclease described above) whose endonucleolytic active site has been inactivated, for example, by one or more modifications (e.g., point mutations) in its catalytic domain. See, for example, US20140186958, US20150166980.

[0156] In some embodiments, the RNA-guided DNA binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

[0157] In some embodiments, the heterologous functional domain may facilitate the transport of the RNA-guided DNA binding agent to the cell nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent may be fused with 1-10 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused with 1-5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused with one NLS. When one NLS is used, the NLS may be linked at the N-terminal or C-terminal end of the sequence of the RNA-guided DNA binding agent. It may also be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs. In certain situations, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to a sequence of two SV40 NLSs linked to the carboxy-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused to two NLSs, one linked to the N-terminal end and one linked to the C-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused to three NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused without an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 123) or PKKKRRV (SEQ ID NO: 124). In some embodiments, the NLS may be a bikaryotic sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 125). In certain embodiments, a single PKKKRKV (SEQ ID NO: 123) NLS may be linked at the C-terminal end of the RNA-guided DNA binding agent. One or more linkers are optionally included in the fusion site.

[0158] In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder may be increased. In some embodiments, the half-life of the RNA-guided DNA binder may be decreased. In some embodiments, the heterologous functional domain may increase the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may decrease the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may function as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may include a PEST sequence. In some embodiments, the RNA-guided DNA binder may be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neural progenitor expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0159] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, Ypet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato, or any other suitable fluorescent protein. In other embodiments, the marker domain may be a purification tag or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent proteins.

[0160] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to mitochondria.

[0161] In further embodiments, the heterologous functional domain may be an effector domain. When the RNA-guided DNA binding agent is directed to its target sequence, for example, when a Cas nuclease is directed to the target sequence by gRNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repression domain. In some embodiments, the heterologous functional domain is a nuclease, for example, a FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression", Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors", Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering", Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes", Cell 154:442-51 (2013). Thus, RNA-guided DNA-binding agents essentially become transcription factors that can be directed to bind to desired target sequences using guide RNAs.In some embodiments, the heterologous functional domain is a deaminase, such as a cytidine deaminase or an adenine deaminase. In certain embodiments, the heterologous functional domain is a CT base converter (cytidine deaminase), such as an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.

[0162] D. Determining gRNA Efficacy In some embodiments, the efficacy of gRNA is determined when it is delivered or expressed together with other components that form RNP. In some embodiments, gRNA is expressed together with RNA-guided DNA binding agent, such as Cas protein, such as Cas9. In some embodiments, gRNA is delivered to or expressed in a cell line that already stably expresses RNA-guided DNA nuclease, such as Cas nuclease or nickase, such as Cas9 nuclease or nickase. In some embodiments, gRNA is delivered to cell as part of RNP. In some embodiments, gRNA is delivered to cell together with mRNA that codes RNA-guided DNA nuclease, such as Cas nuclease or nickase, such as Cas9 nuclease or nickase.

[0163] As described herein, the use of the RNA-guided DNA nucleases and guide RNAs disclosed herein may generate double-strand breaks in DNA, which upon repair by the cellular machinery may result in errors in the form of insertion / deletion (indel) mutations. Many mutations resulting from indels alter the reading frame or introduce premature stop codons, thus producing non-functional proteins. In some embodiments, the efficacy of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is peripheral blood mononuclear cells ("PBMCs"). In some embodiments, the in vitro model is T cells, such as primary human T cells. With respect to using primary cells, commercially available primary human hepatocytes can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model (e.g., in T cells) is determined, for example, by analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. Exemplary procedures for such determination include analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. + A working example using T cells is provided.

[0164] In some embodiments, the efficacy of a particular gRNA is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparison of data with selected gRNAs is performed. In some embodiments, cross-screening is performed across multiple cell models.

[0165] In some embodiments, the efficacy of the guide RNA is measured by the percent indels or percent gene modifications of 2B4. In some embodiments, the efficacy of the guide RNA is measured by the percent indels or percent gene modifications at the 2B4 locus. In some embodiments, the efficacy of the guide RNA is measured by the percent indels or percent gene modifications of 2B4 at the genomic coordinates of Table 1 or Table 2. In some embodiments, the percent editing of 2B4 is compared to the percent of indels or gene modifications required to achieve knockdown of the 2B4 protein product. In some embodiments, the efficacy of the guide RNA is measured by reducing or eliminating the expression of the 2B4 protein. In embodiments, the reduction or elimination of the expression of the 2B4 protein is as measured, for example, by flow cytometry as described herein.

[0166] In some embodiments, 2B4 protein expression is reduced or eliminated in a cell population using the methods and compositions disclosed herein, in some embodiments, the cell population is at least 55%, 60%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% 2B4 negative as measured by flow cytometry relative to an unmodified cell population.

[0167] An "unmodified cell" (or "unmodified cells") refers to a control cell (or cells) of the same type of cell in an experiment or test, where the "unmodified" control cell has not been contacted with a 2B4 guide. Thus, an unmodified cell (or cells) can be a cell that has not been contacted with a guide RNA or a cell that has been contacted with a guide RNA that does not target 2B4.

[0168] In some embodiments, the efficacy of a guide RNA is measured by the number or frequency of indels or genetic modifications at off-target sequences in the genome of a target cell type. In some embodiments, an effective guide RNA is provided that generates indels at off-target sites at a very low frequency (e.g., less than 5%) relative to the frequency of indel generation in a cell population or at a target site. Thus, the present disclosure provides guide RNAs that do not exhibit off-target indel formation in a target cell type (e.g., T cells) or that have a frequency of off-target indel formation less than 5% relative to the frequency of indel generation in a cell population or at a target site. In some embodiments, the present disclosure provides guide RNAs that do not exhibit any off-target indel formation in a target cell type (e.g., T cells). In some embodiments, a guide RNA is provided that generates indels at less than 5 off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, a guide RNA is provided that generates indels at less than 4, 3, 2, or 1 or less off-target site(s), e.g., as assessed by one or more methods described herein. In some embodiments, the off-target site does not occur within a protein-coding region in the target cell (e.g., hepatocyte) genome.

[0169] In some embodiments, detecting gene editing events, such as the formation of insertion / deletion ("indel") mutations, and insertion or homology-directed repair (HDR) events in target DNA utilizes linear amplification with tagged primers and isolation of tagged amplification products (hereinafter referred to as "LAM-PCR" or "linear amplification (LA)" method). In some embodiments, the efficacy of the guide RNA is measured by the level of a functional protein complex that comprises the expressed protein product of the gene. In some embodiments, the efficacy of the guide RNA is measured by flow cytometric analysis of TCR expression, where a biological population of edited cells is analyzed for loss of TCR.

[0170] ET cell receptor (TCR) In some embodiments, for example, an engineered cell or cell population comprising a genetic modification of an endogenous nucleic acid sequence encoding 2B4 further comprises a modification, e.g., knockdown, of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC).

[0171] In some embodiments, an engineered cell or cell population comprising a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding 2B4, and the insertion into the cell of a heterologous sequence(s) encoding a targeted receptor, further comprises a modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC).

[0172] Generally, TCRs are heterodimeric receptor molecules that contain two TCR polypeptide chains, α and β. Suitable α and β genomic sequences or loci for targeting knockdown are known in the art. In some embodiments, the engineered T cells comprise a modification, e.g., knockdown, of a TCR α chain gene sequence, e.g., TRAC. See, e.g., NCBI Gene ID: 28755; Ensembl: ENSG00000277734 (T cell receptor alpha constants), US2018 / 0362975, and WO2020081613.

[0173] In some embodiments, the engineered cell or cell population comprises a genetic modification of an endogenous nucleic acid sequence encoding 2B4, a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC), and a modification (e.g., knockdown) of an MHC class I gene (e.g., B2M or HLA-A). In some embodiments, the MHC class I gene is an HLA-B gene or an HLA-C gene.

[0174] In some embodiments, the engineered cell or cell population comprises a genetic modification of an endogenous nucleic acid sequence encoding 2B4, and a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC), and a genetic modification (e.g., knockdown) of an MHC class II gene (e.g., CIITA).

[0175] In some embodiments, the engineered cell or cell population comprises a modification of an endogenous nucleic acid sequence encoding 2B4, a genetic modification (e.g., knockdown) of an endogenous nucleic acid sequence encoding a TCR gene sequence(s) (e.g., TRAC or TRBC), and a genetic modification (e.g., knockdown) of a checkpoint inhibitor gene (e.g., TIM3, LAG3, or PD-1).

[0176] In some embodiments, the engineered cell or cell population comprises a genetic modification of the 2B4 gene as assessed by sequencing, e.g., NGS, where at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cells comprise an insertion, deletion, or substitution in the endogenous 2B4 sequence. In some embodiments, at least 50% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 55% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 60% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 65% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 70% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 75% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 85% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 70% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 90% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, at least 95% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous 2B4 sequence. In some embodiments, 2B4 is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or below the detection limit of the assay, e.g., compared to a suitable control in which the 2B4 gene is not modified.In some embodiments, the expression of 2B4 is reduced by at least 50% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, the expression of 2B4 is reduced by at least 55% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, the expression of 2B4 is reduced by at least 60% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, the expression of 2B4 is reduced by at least 65% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, the expression of 2B4 is reduced by at least 70% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, the expression of 2B4 is reduced by at least 80% or below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified. In some embodiments, expression of 2B4 is reduced by at least 90%, for example, as compared to a suitable control in which the 2B4 gene is not modified, or to below the detection limit of the assay. In some embodiments, expression of 2B4 is reduced by at least 95%, for example, as compared to a suitable control in which the 2B4 gene is not modified, or to below the detection limit of the assay. Assays for 2B4 protein and mRNA expression are known in the art.

[0177] In some embodiments, the engineered cells or cell populations include modification (e.g., knockdown) of the TCR gene sequence by gene editing, e.g., assessed by sequencing, e.g., NGS, and at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cells include an insertion, deletion, or substitution in the endogenous TCR gene sequence. In some embodiments, the TCR is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or below the detection limit of the assay, e.g., compared to a suitable control in which the TCR gene is not modified. In certain embodiments, the TCR is TRAC or TRBC. Assays for TCR protein and mRNA expression are known in the art.

[0178] In some embodiments, the engineered cell or cell population includes, by gene editing, the insertion of a sequence(s) encoding a targeted receptor, e.g., as assessed by sequencing (e.g., NGS).

[0179] In some embodiments, a guide RNA that specifically targets a site within the TCR gene, e.g., the TRAC gene, is used to provide modification (e.g., knockdown) of the TCR gene.

[0180] In some embodiments, the TCR gene is modified (e.g., knocked down) in T cells using guide RNA with an RNA-guided DNA binding agent. In some embodiments, disclosed herein are engineered T cells by inducing a break (e.g., a double-strand break (DSB) or a single-strand break (nick)) in the TCR gene of a T cell, for example, using guide RNA with an RNA-guided DNA binding agent (e.g., CRISPR / Cas system). The method can be used in vitro or ex vivo, for example, in the manufacture of cell products for suppressing immune responses.

[0181] In some embodiments, the guide RNA mediates target-specific cleavage by an RNA-guided DNA-binding agent (e.g., a Cas nuclease) at a site described herein within the TCR gene. It will be appreciated that in some embodiments, the guide RNA comprises a guide sequence that binds or is capable of binding to the region of interest.

[0182] III. Methods and Uses, Including Therapeutic Methods and Methods for Preparing Engineered Cells or Immunotherapeutic Reagents The gRNAs and related methods and compositions disclosed herein are useful for generating immunotherapy reagents, such as engineered cells.

[0183] In some embodiments, gRNAs comprising guide sequences from Table 1 together with an RNA-guided DNA nuclease, e.g., a Cas nuclease, induce a DSB and non-homologous end joining (NHEJ) during repair results in a modification in the B24 gene. In some embodiments, NHEJ causes a deletion or insertion of a nucleotide(s) to induce a frameshift or nonsense mutation in the B24 gene. In certain embodiments, gRNAs comprising guide sequences targeting TCR sequences, e.g., TRAC and TRBC, are also delivered to cells together with or separately from an RNA-guided DNA nuclease, e.g., a Cas nuclease, to effect genetic modification in the TCR sequence and inhibit expression of the full-length TCR sequence. In certain embodiments, the gRNA is an sgRNA.

[0184] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate.

[0185] In some embodiments, the guide RNA, compositions, and formulations are used to produce cells, e.g., immune cells, e.g., T cells, with genetic modifications in the B24 gene, ex vivo. The modified T cells may be natural killer (NK) T cells. The modified T cells may express a T cell receptor, such as a universal TCR or a modified TCR. The T cells may express a CAR or CAR construct with a zeta chain signaling motif.

[0186] Delivery of gRNA compositions Lipid nanoparticles (LNPs) are well-known vehicles for the delivery of nucleotide and protein cargoes and may be used to deliver the guide RNAs and compositions disclosed herein ex vivo and in vitro. In some embodiments, the LNPs deliver nucleic acids, proteins, or nucleic acids together with proteins.

[0187] In some embodiments, the invention includes a method for delivering any one of the cells or cell populations disclosed herein to a subject, wherein the gRNA is delivered via a LNP. In some embodiments, the gRNA / LNP is also associated with Cas9 or an mRNA encoding Cas9.

[0188] In some embodiments, the invention includes a composition comprising any one of the disclosed gRNAs and LNPs, in some embodiments, the composition further comprises Cas9 or an mRNA encoding Cas9.

[0189] In some embodiments, the LNPs associated with the gRNAs disclosed herein are for use in preparing a cell as a medicament for treating a disease or disorder.

[0190] Electroporation is a well-known means for delivery of cargo, and any electroporation methodology can be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation can be used to deliver any one of the gRNAs and Cas9 or mRNA encoding Cas9 disclosed herein.

[0191] In some embodiments, the invention includes a method of delivering any one of the gRNAs disclosed herein to a cell ex vivo, where the gRNA is associated with a LNP or is not associated with a LNP. In some embodiments, the gRNA / LNP or gRNA is also associated with Cas9 or an mRNA encoding Cas9.

[0192] In some embodiments, the guide RNA compositions described herein, alone or encoded in one or more vectors, are formulated in or administered via lipid nanoparticles, see, e.g., WO2017 / 173054 and WO2021 / 222287, the contents of each of which are incorporated herein by reference in their entirety.

[0193] In certain embodiments, the invention includes DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode a guide RNA. The nucleic acid that does not encode a guide RNA includes, but is not limited to, a promoter, an enhancer, a control sequence, and a nucleic acid that encodes an RNA-guided DNA nuclease (which may be a nuclease such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding a sgRNA and an mRNA encoding an RNA-guided DNA nuclease, which may be a Cas nuclease, e.g., Cas9 or Cpf1. In some embodiments, the vector comprises one or more nucleotide sequences encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which may be a Cas protein, e.g., Cas9. In one embodiment, the Cas9 is from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or the crRNA and trRNA (which may be an sgRNA) comprises or consists of a guide sequence flanked by all or part of repeat sequences from a naturally occurring CRISPR / Cas system. The nucleic acid comprising or consisting of the crRNA, trRNA, or the crRNA and trRNA may further comprise a vector sequence, where the vector sequence comprises or consists of a nucleic acid sequence not found in nature with the crRNA, trRNA, or the crRNA and trRNA.

[0194] In some embodiments, the components can be introduced as naked nucleic acids, as nucleic acids complexed with agents such as liposomes or poloxamers, or they can be delivered by viral vectors (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus). Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biologics, virosomes, liposomes, immunoliposomes, LNP, polycation or lipid:nucleic acid conjugates, naked nucleic acids (e.g., naked DNA / RNA), artificial virions, and drug-enhanced uptake of DNA. Sonoporation, for example using the Sonitron 2000 system (Rich-Mar), can also be used for delivery of nucleic acids.

[0195] This description and exemplary embodiments should not be construed as limiting. In this specification and the appended claims, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values ​​used in the specification and the appended claims should be understood to be modified in each case by the term "about" to the extent that they are not yet modified in any significant way. Thus, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending on the desired properties to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed by taking into account the number of reported significant digits and applying ordinary rounding techniques. EXAMPLES

[0196] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of the disclosure in any way.

[0197] Example 1 - Materials and Methods Next-generation sequencing ("NGS") and analysis of on-target cleavage efficiency Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, Cat. No. QE09050) according to the manufacturer's protocol.

[0198] To quantitatively determine the editing efficiency at the target position in the genome, deep sequencing was used to identify the presence of insertions and deletions ("indels") introduced by gene editing. PCR primers were designed around the target site in the gene of interest (e.g., 2B4) to amplify the genomic region of interest. Primer sequence design was performed as standard in the field.

[0199] An additional PCR was performed according to the manufacturer's protocol (Illumina) to add the necessary chemistry for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. After removing reads with low quality scores, the reads were aligned to the human reference genome (e.g., hg38). The resulting file containing the reads was mapped against the reference genome (BAM file), reads that overlapped with the target sequence of interest were selected, and the number of wild-type reads and reads containing insertions or deletions ("indels") were calculated.

[0200] The editing percentage (e.g., "editing efficiency" or "percent indels") used in the examples is defined as the total number of sequence reads that contain an insertion or deletion ("indel") relative to the total number of sequence reads that contain the wild type.

[0201] Preparation of lipid nanoparticles Unless otherwise specified, lipid components were dissolved in 100% ethanol at various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0 to obtain an RNA cargo concentration of approximately 0.45 mg / mL.

[0202] Unless otherwise specified, the lipid nucleic acid assembly contained the ionizable lipid A ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38:9:3, respectively, unless otherwise specified. The lipid nucleic acid assembly was formulated at a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6, and a gRNA to mRNA weight ratio of 1:1, unless otherwise specified.

[0203] Lipid nanoparticles (LNPs) were prepared by impinging jet mixing of lipids in ethanol with two volumes of RNA solution and one volume of water using a cross-flow technique. Lipids in ethanol are mixed with two volumes of RNA solution by cross mixing. A fourth water stream was mixed with the cross outlet stream through a tee in series (see Figure 2 in WO2016010840). The LNPs were kept at room temperature (RT) for 1 hour and further diluted with water (approximately 1:1 v / v). The LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100 kD MWCO) and buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). Alternatively, the LNPs were optionally concentrated using a 100 kDa Amicon spin filter and buffer exchanged into TSS using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were stored at 4° C. or -80° C. until further use.

[0204] In vitro transcription of mRNA ("IVT") Capped polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter, sequence for transcription, and polyadenylation sequence was linearized by incubation with XbaI for 2 hours at 37°C under the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and 1x reaction buffer. XbaI was inactivated by heating the reaction at 65°C for 20 minutes. Linearized plasmid was purified from enzymes and buffer salts. IVT reactions to generate modified mRNA were performed by incubation at 37°C for 1.5 to 4 hours under the following conditions: The reaction mixture contained 50 ng / μL linearized plasmid, 2–5 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink), 10–25 mM ARCA (Trilink), 5 U / μL T7 RNA polymerase (NEB), 1 U / μL mouse Rnase inhibitor (NEB), 0.004 U / μL inorganic E. coli pyrophosphatase (NEB), and 1× reaction buffer. TURBO Dnase (ThermoFisher) was added to a final concentration of 0.01 U / μL and the reaction was incubated for an additional 30 min to remove the DNA template. The mRNA was purified using the MegaClear transcription cleanup kit (ThermoFisher) or the Rneasy Maxi kit (Qiagen) according to the manufacturer's protocol. Alternatively, the mRNA was purified by a precipitation protocol, which in some cases was followed by HPLC-based purification. Briefly, after Dnase digestion, LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation are used to purify mRNA. For HPLC-purified mRNA, after LiCl precipitation and reconstitution, mRNA was purified by RP-IP HPLC (see, for example, Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142).The fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above. In a further alternative method, mRNA was purified by LiCl precipitation followed by further purification by tangential flow filtration. RNA concentration was determined by measuring the light absorbance at 260 nm (Nanodrop) and transcripts were analyzed by capillary electrophoresis with a Bioanlayzer (Agilent).

[0205] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID NOs:801-803 (see sequences in Table 9). It is understood that where SEQ ID NOs:801-803 are referred to below with respect to the RNA, T should be replaced with U (which was N1-methylpseudouridine as above). The messenger RNA used in the examples includes a 5' cap and a 3' polyA tail, e.g., up to 100 nt, and is identified by SEQ ID NOs:801-803 in Table 9.

[0206] Example 2 - 2B4 guide screening in HEK293 cells Guides were designed and tested for editing efficacy at the 2B4 locus in HEK293 cells. Initial guide selection was performed in silico using a human reference genome (e.g., hg38) and a user-defined genomic region of interest (e.g., 2B4) to identify PAMs in the region of interest. For each identified PAM, analysis was performed and statistics were reported. Guide RNA molecules were further selected and ranked based on several criteria known in the art (e.g., GC content, predicted on-target activity, and potential off-target activity).

[0207] A total of 86 guide RNAs targeting the protein exon coding region of 2B4 (ENSG00000122223) were tested. The guide sequences and corresponding genomic coordinates are provided above (Table 1).

[0208] Guides were first screened for editing efficiency in HEK293_Cas9 cells. Human embryonic kidney adenocarcinoma cell line HEK293 ("HEK293_Cas9"), which constitutively expresses Spy Cas9, was cultured in DMEM medium supplemented with 10% fetal bovine serum. Approximately 24 hours before transfection, cells were plated at a density of 10,000 cells / well in 96-well plates (approximately 70% confluent at the time of transfection). Cells were transfected with Lipofectamine RNAiMAX (ThermoFisher, Catalog 13778150) according to the manufacturer's protocol. Cells were transfected with lipoplexes containing individual guides (25 nM), trRNA (25 nM), Lipofectamine RNAiMAX (0.3 μL / well), and OptiMem. DNA isolation and NGS analysis were performed as described in Example 1. Table 4 shows the % indels at the 2B4 locus with these guides in HEK293_Cas9 cells using the two primer sets. "No data" indicates that the primer set failed to produce the calculated editing percentage. [Table 5-1] [Table 5-2] [Table 5-3]

[0209] Example 3 - Human CD3 + 2B4-guided screening in T cells 28 guides, CD3 +We screened for editing efficiency in T cells. Pan CD3+ T cells (StemCell) from two healthy donors were thawed and activated by the addition of a 1:100 dilution of T Cell TransAct human reagent (Miltenyi) in T cell medium (RPMI 1640, 10% fetal bovine serum, L-glutamine, 100 uM non-essential amino acids, 1 mM sodium pyruvate, 10 mM HEPES buffer, 22 uM 2-mercaptoethanol, and 100 U / ml human recombinant interleukin-2 (Peprotech, catalog 200-02)). Ribonucleoproteins (RNPs) were formed by incubating a solution containing 20 uM sgRNA and 10 uM recombinant Cas9 protein for 10 min. After 72 h of activation, T cells were harvested, centrifuged, and resuspended in P3 electroporation buffer (Lonza) at a concentration of 5 x 10e6 T cells / ml. CD3 + T cells were transfected with RNP using a P3 Primary Cell 96-well Nucleofector™ kit (Lonza, catalog V4SP-3960) and an Amaxa™ 96-well Shuttle™ with manufacturer's pulse code. T cell medium was added to the cells immediately after nucleofection and cultured for 4 days. Genomic DNA was collected and prepared for NGS as described in Example 1. Table 5 shows the editing percentage at the 2B4 locus in T cells. [Table 6]

[0210] Example 4 - Engineered T cells with inhibitor gene knockout T cells were engineered with a series of gene disruptions and insertions. Healthy donor cells were treated sequentially with three LNPs, each co-formulated with mRNA encoding Cas9 and sgRNA targeting. First, cells were edited to knock out TRBC. A transgenic T cell receptor (SEQ ID NO: 1001) targeting Wilms tumor antigen (WT1 TCR) was incorporated into the TRAC cut site by using AAV to deliver a homology-directed repair template. Finally, T cells were edited to knock out 2B4.

[0211] 4.1.T cell preparation Healthy human donor apheresis was commercially obtained (HemaCare), washed, and resuspended in CliniMACS PBS / EDTA buffer (Miltenyi catalog 130-070-525). T cells from three donors were isolated by positive selection using CD4 and CD8 magnetic beads (Miltenyi BioTec, catalog 130-030-401, 130-030-801) and CliniMACS Plus and CliniMACS LS disposable kits. T cells were aliquoted into vials and cryopreserved for future use in a 1:1 formulation of Cryostor CS10 (StemCell Technologies catalog 07930) and Plasmalyte A (Baxter catalog 2B2522X). The day before starting T cell editing, cells were thawed and incubated at a concentration of 5ug / mL in T cell activation medium (TCAM): CTS OpTmizer (Thermofisher, catalog A3705001) (TCAM containing 2.5% human AB serum (Gemini, catalog 100-512), 1X GlutaMAX (Thermofisher, catalog 35050061), 10mM HEPES (Thermofisher, catalog 15630080), 200U / mL of IL-2 (Peprotech, catalog 200-02), IL-7 (Peprotech, catalog 200-07), IL-15 (Peprotech, catalog 200-15).

[0212] 4.2. LNP Treatment and T Cell Expansion On day 1, LNPs (G016239) containing Cas9 mRNA and sgRNA targeting TRBCs were incubated at a concentration of 5ug / mL in TCAM containing 1ug / mL rhApoE3 (Peprotech, Catalog 350-02). Meanwhile, T cells were harvested, washed, and incubated at 2x10 in TCAM with human reagent T cell TransAct (Miltenyi, Catalog 130-111-160) at a dilution of 1:50. 6 The T cells were resuspended at a density of 10000000 cells / mL. The T cells and LNP-ApoE medium were mixed in a 1:1 ratio and the T cells were plated overnight in a culture flask.

[0213] On day 3, T cells were harvested, washed, and plated at 1 × 10 6 The T cells were resuspended at a density of 3×10 cells / mL. LNPs (G013006) containing Cas9 mRNA and sgRNA targeting TRAC were incubated at a concentration of 5ug / mL in TCAM containing 5ug / mL rhApoE3 (Peprotech, Catalog 350-02). T cells and LNP-ApoE medium were mixed in a 1:1 ratio, and T cells were plated in a culture flask. AAV containing WT1 TCR was then added at a concentration of 3×10 5 The edited cells were added to each group at an MOI of 100 genome copies / cell. Cells carrying these edits are referred to as "WT1 T cells" in the tables and figures.

[0214] On day 4, T cells were harvested, washed, and plated at 1 × 10 6 The LNPs were resuspended at a density of 10000 cells / mL. The LNPs contained Cas9 mRNA and one of the gRNAs listed in Table 7. The LNPs were incubated at a concentration of 5ug / mL in TCAM containing 5ug / mL rhApoE3 (Peprotech, Catalog 350-02). The LNP-ApoE solution was then added to the appropriate cultures at a 1:1 ratio.

[0215] On days 5-11, T cells were transferred to 24-well GREX plates (Wilson Wolf, catalog 80192) in T cell expansion medium (TCEM): CTS OpTmizer (Thermofisher, catalog A3705001) (5% CTS immune cell serum replacement (Thermofisher, catalog A2596101), 1X GlutaMAX (Thermofisher, catalog 35050061), 10 mM HEPES (Thermofisher, catalog 15630080), 200 U / mL IL-2 (Peprotech, catalog 200-02), IL-7 (Peprotech, catalog 200-07), and IL-15 (Peprotech, catalog 200-15)). Cells were expanded according to the manufacturer's protocol. T cells were expanded for 6 days and medium was changed every other day. Cells were counted using a Vi-CELL cell counter (Beckman Coulter) and all samples showed similar fold expansion.

[0216] 4.3. Quantification of T cell editing by flow cytometry and NGS After expansion, edited T cells were assayed by flow cytometry to determine TCR insertion and memory cell phenotype. T cells were incubated with an antibody cocktail targeting the following molecules: CD4 (Biolegend, Catalog 300524), CD8 (Biolegend, Catalog 301045), Vb8 (Biolegend, Catalog 348106), CD3 (Biolegend, Catalog 300327), CD62L (Biolegend, Catalog 304844), CD45RO (Biolegend, Catalog 304230), CCR7 (Biolegend, Catalog 353214), and CD45RA (Biolegend, Catalog 304106). Cells were then processed on a Cytoflex LX instrument (Beckman Coulter) and data were analyzed using the FlowJo software package. The percentage of cells expressing the relevant cell surface proteins after successive T cell engineering is shown in Tables 6A-6C and Figures 1A-1C. Table 6A shows the total percentage of CD8+ cells after T cell engineering, and the proportion of CD8+ or CD4+ cells expressing the engineered TCR as detected with the Vb8 antibody. Table 6B and Figure 1A show the percentage of CD8+Vb8+ cells with stem cell memory phenotype (Tscm; CD45RA+CD62L+). Table 6C and Figure 1B show the percentage of CD8+Vb8+ cells with central memory cell phenotype (Tcm; CD45RO+CD62L+). Table 6C and Figure 1C show the percentage of total cells with effector memory phenotype (Tem; CD45RO+CD62L-CCR7-). In addition to flow cytometry analysis, genomic DNA was prepared as described in Example 1 and NGS analysis was performed to determine the editing rate at each target site. Table 7 and Figures 2A-2B show the results of indel frequency at loci engineered in the third serial edit. [Table 7] [Table 8] [Table 9] [Table 10]

[0217] Example 5 - Target cell killing by engineered T cells The T cells engineered in Example 4 were evaluated for their ability to kill primary leukemia blasts using the Incucyte Live Imaging system. Briefly, T cells were engineered to insert WT1 TCR into the TRAC locus and knock out the TRBC locus in two T cell donor samples (WT1 T cells). In a third engineering step, some WT1 T cells were treated to knock out 2B4 using G021215 or G021216. Primary leukemia blasts expressing WT1 from three HLA-A*02:01 patients were labeled with NucLight Rapid Red reagent for live cell nucleus labeling (Essen Bioscences) and co-cultured with engineered lymphocytes at different effector-to-target (E:T) ratios (5:1, 1:1, and 1:5) in the presence of caspase 3 / 7 green reagent. Twenty thousand blasts were used for the 5:1 E:T ratio and 75,000 blasts for the 1:1 and 1:5 E:T ratios. Co-cultures were seeded in flat-bottom 96-well plates in X-VIVO supplemented with 5% FBS, 1% penicillin-streptomycin (BioWhittaker / Lonza), 2 mM glutamine (BioWhittaker / Lonza), 1 μg / mL CD28 monoclonal antibody (BD Biosciences), G-CSF and IL-3 (20 ng / mL, Bio-techne). Images were taken every 60 min and green fluorescent caspase 3 / 7 signal in red target cells was quantified using Incucyte Live-Cell Imaging and Analysis software (Essen Biosciences). In this assay, live AML cells fluoresce only red, whereas dead AML cells fluoresce both red and green.

[0218] Table 8 and Figures 3A-I show the mean ± SEM of the average area of ​​each image (um2 / image) that fluoresces in both green and red. For each effector population, engineered cells from two different T cell donors were used, as described above. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4] [Table 11-5] [Table 11-6] [Table 11-7] [Table 11-8] [Table 11-9] [Table 11-10]

[0219] Example 6 - Inhibition of AML cell proliferation using engineered T cells Checkpoint inhibitors are associated with immune exhaustion that may occur in proliferation disorders such as cancer.WT1-related proliferation disorders include many hematological malignancies, including acute myeloid leukemia (AML) and chronic myeloid leukemia (CML).The cells prepared by the method of Example 7 are used to test the expression of checkpoint inhibitors and induce the expression of WT1 TCR using known AML models in vitro and in vivo (see, for example, Zhou et al., Blood (2009) 114: 3793-3802).

[0220] In vitro cell killing assay can be used to detect the activity of T cells against cells with abnormal proliferation.The ability of the T cells prepared by the method of Example 7 to eliminate target cells is evaluated by co-culturing the engineered T cells with the primary leukemia blasts (CD33+ cells) from acute myeloid leukemia (AML) with high expression of WT1 antigen.The leukemia blasts can be, for example, the same as in Example 5.

[0221] Human WT1-expressing AML cell line is injected into mice via intravenous route at a lethal dose on day 0. Cells prepared by the method of Example 7 are administered intravenously on day 14. Survival of mice is monitored. Mice treated with T cells engineered to express WT1 TCR survive longer than mice treated with T cells that do not express WT1 TCR. Mice treated with T cells engineered to inhibit the expression of checkpoint inhibitors in addition to the expression of WT1 TCR survive longer than mice treated with T cells that express WT1 TCR and all endogenous checkpoint inhibitors.

[0222] Example 7. Additional embodiments Embodiment 1 An engineered cell comprising a genetic modification in the human 2B4 sequence within the genomic coordinates of chr1:160830160-160862887.

[0223] Embodiment 2. The engineered cell of embodiment 1, wherein the genetic modification is selected from an insertion, a deletion, and a substitution.

[0224]

[0023] Embodiment 3. The engineered cell of claim 1 or 2, wherein the genetic modification inhibits expression of the 2B4 gene.

[0225]

[0023] Embodiment 4: The genetic modification is located at a genomic coordinate selected from the following: [Table 12] Optionally, the engineered cell of any one of embodiments 1 to 3 comprises at least one nucleotide modification within a genomic coordinate selected from those targeted by 2B4-1 to 2B4-5, 2B4-1 and 2B4-2, or 2B4-3, 2B4-4, 2B4-10, and 2B4-17.

[0226] Embodiment 5. The engineered cell of any one of embodiments 1-4, wherein the engineered cell comprises a genetic modification within the genomic coordinates of an endogenous T cell receptor (TCR) sequence, wherein the genetic modification inhibits expression of the TCR gene.

[0227]

[0023] Embodiment 6. The engineered cell of embodiment 5, wherein the TCR gene is TRAC or TRBC.

[0228] Embodiment 7. The engineered cell of embodiment 6, comprising a genetic modification of a TRBC within a genomic coordinate selected from the following: [Table 13-1] [Table 13-2] [Table 13-3]

[0229]

[0023] Embodiment 8 comprises a genetic modification of TRAC within a genomic coordinate selected from the following: [Table 14-1] [Table 14-2] [Table 14-3] 8. The engineered cell of any one of embodiments 5-7, wherein optionally, the genetic modification is within a genomic coordinate selected from chr14:22547524-22547544, chr14:22547529-22547549, chr14:22547525-22547545, chr14:22547536-22547556, chr14:22547501-22547521, chr14:22547556-22547576, and chr14:22547502-22547522.

[0230]

[0023] Embodiment 9. The engineered cell of any one of embodiments 1-8, wherein the cell comprises a genetic modification, wherein the genetic modification inhibits expression of one or more MHC class I proteins.

[0231]

[0023] Embodiment 10. The engineered cell of embodiment 9, wherein the genetic modification that inhibits expression of one or more MHC class I proteins is a genetic modification in a B2M sequence, and the genetic modification is within a genomic coordinate selected from the following: [Table 15-1] [Table 15-2] [Table 15-3]

[0232]

[0023] Embodiment 11. The genetic modification that inhibits expression of one or more MHC class I proteins is a genetic modification in an HLA-A sequence, and optionally the genetic modification is at a genomic coordinate selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619, optionally at chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr 10. The engineered cell of embodiment 9, wherein the genomic coordinates are selected from the group consisting of chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0233]

[0023] Embodiment 12. The engineered cell of any one of the above embodiments, wherein the cell comprises a genetic modification, wherein the genetic modification inhibits expression of one or more MHC class II proteins.

[0234]

[0023] Embodiment 13. The genetic modification that inhibits expression of one or more MHC class II proteins is a genetic modification in a CIITA sequence, and the genetic modification is selected from the group consisting of chr:16:10902171-10923242, optionally chr16:10902662-10923285, chr16:10906542-10923285, or chr16:10906542-10908121, optionally chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916 476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:109 18512-10918532, chr16:10918511-10918531, chr16:10895742-1089576 2, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909 172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747-10895767, chr16:10916348-10916368, chr16:10910186-10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430, and chr16:10908130-10908150; optionally, chr16:10918504-10918524, chr16:10923218-10923 238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:109 06486-10906506, chr16:10906485-10906505, chr16:10903873-1090389 3, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916 362-10916382, chr16:10916450-10916470, chr16:10922153-10922173,chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742-10895762, chr16:10916449-10916469, chr16:10923214-10923234, chr16:10906492-10906512, and chr16:10906487-1090650; or optionally, chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-1090794 4, chr16:10906985-10907005, chr16:10908073-10908093, chr16:109074 33-10907453, chr16:10907979-10907999, chr16:10907139-10907159, ch r16:10922435-10922455, chr16:10907384-10907404, chr16:10907434-1 0907454, chr16:10907119-10907139, chr16:10907539-10907559, chr16:1 0907810-10907830, chr16:10907315-10907335, chr16:10916426-109164 46, chr16:10909138-10909158, chr16:10908101-10908121, chr16:10907 790-10907810, chr16:10907787-10907807, chr16:10907454-10907474, c hr16:10895702-10895722, chr16:10902729-10902749, chr16:10918492- 10918512, chr16:10907932-10907952, chr16:10907623-10907643, chr16 :10907461-10907481, chr16:10902723-10902743, chr16:10907622-1090 7642, chr16:10922441-10922461, chr16:10902662-10902682, chr16:109 15626-10915646, chr16:10915592-10915612, chr16:10907385-10907405,13. The engineered cell of embodiment 12, wherein the genomic coordinates are selected from chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322.

[0235] Embodiment 14. The method of claim 1, wherein the genetic modification that inhibits expression of one or more MHC class II proteins comprises modification of at least one nucleotide of the CIITA splice site, optionally a) modification of at least one nucleotide of the CIITA splice donor site, and / or b) The engineered cell of embodiment 12 or 13, comprising a modification of the CIITA splice site boundary nucleotide.

[0236] Embodiment 15. The engineered cell of any one of embodiments 1 to 14, wherein said cell has reduced cell surface expression of 2B4 protein.

[0237] Embodiment 16. The engineered cell of any one of embodiments 1 to 15, wherein said cell has reduced cell surface expression of 2B4 protein and reduced cell surface expression of TRAC protein.

[0238] Embodiment 17. The engineered cell of embodiment 15 or 16, further comprising reduced cell surface expression of TRBC protein.

[0239] Embodiment 18. The engineered cell of any one of embodiments 16 or 17, wherein cell surface expression of 2B4 is below detectable levels.

[0240] Embodiment 19. The engineered cell of any one of embodiments 16 to 18, wherein cell surface expression of at least one of TRAC and TRBC is below detection levels.

[0241] Embodiment 20. The engineered cell of embodiment 19, wherein cell surface expression of each of 2B4, TRAC, and TRBC is below detection levels.

[0242] Embodiment 21 The engineered cell of any one of the above embodiments, comprising a genetic modification in the human LAG3 sequence within the genomic coordinates of chr12:6772483-6778455.

[0243]

[0023] Embodiment 22: The genetic modification in LAG3 is located at a genomic coordinate selected from the following: [Table 16] Optionally, the engineered cell of embodiment 21 is within genomic coordinates selected from those targeted by LAG3-1 to LAG3-15, LAG3-1 to LAG3-11, LAG3-1 to LAG3-4, or LAG3-1, LAG3-4, LAG3-5, and LAG3-9.

[0244] Embodiment 23. The engineered cell of any one of the preceding embodiments, comprising a genetic modification in a human TIM3 sequence within the genomic coordinates of chr5:157085832-157109044.

[0245]

[0023] Embodiment 24: The genetic modification in TIM3 is located at a genomic coordinate selected from the following: [Table 17] Optionally, TIM3-1 to TIM3-4, TIM3-6 to TIM3-15, TIM3-18, TIM3-19, TIM3-22, TIM3-29, TIM3-42, TIM3-44, TIM3-58, TIM3-62, TIM3-69, TIM3-82, TIM3-86, and TIM3-88; TIM3-1 to TIM3-5, TIM3-7, TIM3-8, TIM3-12 to TIM3-15, TIM3-23, TIM3-26, TIM3-32, TIM3-56, TIM3-59, TIM3-63, TIM3-66, TIM3-75, and TIM3-88. 24. The engineered cell of embodiment 23, wherein the engineered cell is within genomic coordinates selected from those targeted by TIM3-87; TIM3-2, TIM3-4, TIM3-15, TIM3-23, TIM3-56, TIM3-59, TIM3-63, TIM3-75, and TIM3-87; TIM3-1 through TIM3-4; TIM3-2, TIM-4, and TIM3-15; TIM3-2, TIM-4, TIM3-15, TIM3-63, and TIM3-87; TIM3-2 and TIM3-15; TIM3-63 and TIM3-87; or TIM3-15.

[0246]

[0041] Embodiment 25. The engineered cell of any one of the preceding embodiments, comprising a genetic modification in a human PD-1 sequence within the genomic coordinates of chr2:241849881-241858908.

[0247] Embodiment 26. The engineered cell of any one of embodiments 21 to 25, wherein the genetic modification at the indicated genomic coordinates is selected from an insertion, a deletion, and a substitution.

[0248]

[0041] Embodiment 27. The engineered cell of any one of embodiments 21-26, wherein the genetic modification inhibits expression of the gene in which the genetic modification is present.

[0249]

[0041] Embodiment 28. The engineered cell of any one of the above embodiments, wherein the genetic modification comprises an indel.

[0250]

[0041] Embodiment 29. The engineered cell of any one of the above embodiments, wherein the genetic modification comprises the insertion of a heterologous coding sequence.

[0251]

[0036] Embodiment 30. The engineered cell of any one of the above embodiments, wherein the genetic modification comprises a substitution.

[0252]

[0036] Embodiment 31. The engineered cell of embodiment 30, wherein the substitution comprises a C to T substitution or an A to G substitution.

[0253]

[0036] Embodiment 32. The engineered cell of any one of the preceding embodiments, wherein the genetic modification results in an alteration in the nucleic acid sequence that prevents translation of the full-length protein having the amino acid sequence of the full-length protein prior to genetic modification.

[0254]

[0036] Embodiment 33. The engineered cell of embodiment 32, wherein said genetic modification results in an alteration in said nucleic acid sequence that results in a premature stop codon in the coding sequence of said full-length protein.

[0255]

[0036] Embodiment 34. The engineered cell of embodiment 32, wherein said genetic modification results in an alteration in a nucleic acid sequence that results in an alteration in the splicing of a pre-mRNA from said genomic locus.

[0256] Embodiment 35. The engineered cell of any one of the above embodiments, wherein said inhibition results in reduced cell surface expression of a protein from a gene that comprises a genetic modification.

[0257]

[0023] Embodiment 36. The engineered cell of any one of the preceding embodiments, wherein said inhibition results in reduced cell surface expression of a protein that is regulated by the gene comprising the genetic modification.

[0258] Embodiment 37. The engineered cell of any one of the above embodiments, wherein the cell comprises an exogenous nucleic acid encoding a targeting receptor expressed on the surface of the engineered cell.

[0259]

[0046] Embodiment 38. The engineered cell of embodiment 37, wherein the targeting receptor is a CAR.

[0260]

[0041] Embodiment 39. The engineered cell of embodiment 37, wherein the targeting receptor is a TCR.

[0261]

[0039] Embodiment 40. The engineered cell of embodiment 39, wherein the targeted receptor is WT1 TCR.

[0262] Embodiment 41 The engineered cell of any one of the above embodiments, wherein the engineered cell is an immune cell.

[0263] Embodiment 42. The engineered cell of embodiment 41, wherein the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte.

[0264]

[0081] Embodiment 43. The engineered cell of embodiment 41, wherein the engineered cell is a lymphocyte.

[0265]

[0081] Embodiment 44. The engineered cell of embodiment 43, wherein the engineered cell is a T cell.

[0266] Embodiment 45. A pharmaceutical composition comprising an engineered cell according to any one of embodiments 1 to 44.

[0267] Embodiment 46. A cell population comprising the engineered cells of any one of embodiments 1 to 44.

[0268] Embodiment 47. A pharmaceutical composition comprising the cell population, wherein the cell population comprises an engineered cell according to any one of embodiments 1 to 44.

[0269] Embodiment 48. A method of administering the engineered cell, cell population, pharmaceutical composition of any one of the preceding embodiments to a subject in need thereof.

[0270] Embodiment 49. A method of administering the engineered cell, cell population, or pharmaceutical composition of any one of the preceding embodiments to a subject as adoptive cell transfer (ACT) therapy.

[0271] Embodiment 50. The engineered cell, cell population, or pharmaceutical composition of any one of the preceding embodiments for use as an ACT therapy.

[0272] Embodiment 51 A 2B4 guide RNA that specifically hybridizes to a 2B4 sequence comprising a nucleotide sequence selected from the following: a. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 1-28; b. a guide sequence comprising a nucleotide sequence of at least 17, 18, 19, or 20 consecutive nucleotides of a nucleotide sequence selected from the sequences of SEQ ID NOs: 1-28; c. a guide sequence comprising a nucleotide sequence at least 95% identical or at least 90% identical to a nucleotide sequence selected from SEQ ID NOs: 1-28; d. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 1-5; e. a guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 1 and 2, and f. A guide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 3, 4, 10, and 17.

[0273] Embodiment 52 A 2B4 guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to a chromosomal location within a genomic coordinate selected from those targeted by SEQ ID NOs: 1-28, optionally selected from those targeted by SEQ ID NOs: 1-5, optionally selected from those targeted by SEQ ID NOs: 1 and 2, or optionally selected from those targeted by SEQ ID NOs: 3, 4, 10, and 17.

[0274] Embodiment 53. The guide RNA of embodiment 51 or 52, wherein the guide RNA is a dual guide RNA (dgRNA).

[0275]

[0046] Embodiment 54. The guide RNA of embodiment 51 or 52, wherein the guide RNA is a single guide RNA (sgRNA).

[0276] Embodiment 55. The guide RNA of embodiment 54, further comprising a nucleotide sequence of SEQ ID NO: 400 3' to said guide sequence, wherein said guide RNA comprises a 5' end modification or a 3' end modification.

[0277]

[0046] Embodiment 56 further comprises a 5'-end modification or a 3'-end modification and a conserved portion of the gRNA, wherein the conserved portion comprises A. A shortened or substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, is replaced with Watson-Crick paired nucleotides in a substituted and optionally shortened Hairpin 1, said Hairpin 1 region optionally comprising: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or C. lacking 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened hairpin 1 region lacks 4 to 8 nucleotides, preferably 4 to 6 nucleotides; a. one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to SEQ ID NO: 400, or b. one or more of positions H1-6 to H1-10 are substituted relative to SEQ ID NO: 400; or 3. The hairpin 1 region, wherein the shortened hairpin 1 region is missing 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to SEQ ID NO: 400; or B. A truncated upper stem region, wherein the truncated upper stem region lacks 1-6 nucleotides, and wherein 6, 7, 8, 9, 10, or 11 nucleotides of the truncated upper stem region contain no more than 4 substitutions relative to SEQ ID NO: 400; or C. A substitution relative to SEQ ID NO:400 in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substitution nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine; or D. The guide RNA of embodiment 54, comprising one or more of the upper stem modifications, including one or more modifications of US1 to US12 in the upper stem region.

[0278]

[0046] Embodiment 57. The guide RNA of embodiment 54, further comprising the nucleotide sequence of SEQ ID NO: 200 (GUUUUAGAGCUAUGCUGUUUUG) 3' to the guide sequence.

[0279]

[0046] Embodiment 58. The guide RNA of embodiment 54, further comprising the nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 201) 3' to the guide sequence, optionally GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 202) 3' to the guide sequence.

[0280]

[0046] Embodiment 59. The guide RNA of embodiment 57 or 58, wherein the guide RNA is modified according to the pattern mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), wherein "N" can be any natural or non-natural nucleotide, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage between nucleotide residues, and said N's are collectively the nucleotide sequence of the guide sequence of any preceding embodiment.

[0281]

[0046] Embodiment 60. The guide RNA of embodiment 59, wherein each N is independently any natural or non-natural nucleotide, and wherein said guide sequence targets Cas9 to the 2B4 gene.

[0282] Embodiment 61. The guide RNA of any one of embodiments 53 to 60, wherein the guide RNA comprises a modification.

[0283] Embodiment 62. The guide RNA of embodiment 61, wherein said modification comprises 2'-O-methyl (2'-O-Me) modified nucleotides or 2'-F modified nucleotides.

[0284]

[0081] Embodiment 63. A guide RNA according to embodiment 61 or 62, wherein said modification comprises a phosphorothioate (PS) bond between nucleotides.

[0285] Embodiment 64. The guide RNA of any one of embodiments 61 to 63, wherein the guide RNA is an sgRNA and the modification comprises a modification in one or more of the five nucleotides at the 5' end of the guide RNA.

[0286] Embodiment 65. The guide RNA of any one of embodiments 61 to 64, wherein the guide RNA is an sgRNA and the modification comprises a modification in one or more of the five nucleotides at the 3' end of the guide RNA.

[0287] Embodiment 66. The guide RNA of any one of embodiments 61 to 65, wherein the guide RNA is an sgRNA and the modification comprises a PS bond between each of the four nucleotides at the 5' end of the guide RNA.

[0288] Embodiment 67. The guide RNA of any one of embodiments 61 to 66, wherein the guide RNA is an sgRNA and the modification comprises a PS bond between each of the four nucleotides at the 3' end of the guide RNA.

[0289] Embodiment 68. The guide RNA of any one of embodiments 61 to 67, wherein the guide RNA is an sgRNA and the modifications comprise 2'-O-Me modified nucleotides in each of the first three nucleotides at the 5' end of the guide RNA.

[0290] Embodiment 69. The guide RNA of any one of embodiments 61 to 68, wherein the guide RNA is an sgRNA and the modifications comprise 2'-O-Me modified nucleotides in each of the last three nucleotides at the 3' end of the guide RNA.

[0291] Embodiment 70. A composition comprising a guide RNA and an RNA-guided DNA binding agent according to any one of embodiments 53 to 69, wherein the RNA-guided DNA binding agent is a polypeptide RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent polypeptide, and optionally, the RNA-guided DNA binding agent is a Cas9 nuclease.

[0292]

[0081] Embodiment 71. The composition of embodiment 70, wherein the RNA-guided DNA binding agent is a polypeptide capable of effecting modifications in a DNA sequence.

[0293]

[0081] Embodiment 72. The composition of embodiment 71, wherein the RNA-guided DNA binding agent is S. pyogenes Cas9 nuclease.

[0294] Embodiment 73. The composition of any one of embodiments 70 to 72, wherein the nuclease is selected from the group of cleavage, nickase, and inactive nuclease.

[0295]

[0036] Embodiment 74: The nucleic acid encoding the RNA-guided DNA binding agent comprises: A DNA coding sequence, b. an mRNA having an open reading frame (ORF); c. a coding sequence in an expression vector; d. The composition of embodiment 70, wherein the composition is selected from a coding sequence in a viral vector.

[0296]

[0023] Embodiment 75 The method further comprises a guide RNA that specifically hybridizes to a genomic coordinate selected from the following: [Table 18-1] [Table 18-2] [Table 18-3] Optionally, the genetic modification is within a genomic coordinate selected from chr14:22547524-22547544, chr14:22547529-22547549, chr14:22547525-22547545, chr14:22547536-22547556, chr14:22547501-22547521, chr14:22547556-22547576, and chr14:22547502-22547522.

[0297] Embodiment 76. The composition of any one of embodiments 70 to 75, further comprising a guide RNA that specifically hybridizes to a genomic coordinate selected from the following: [Table 19-1] [Table 19-2] [Table 19-3]

[0298] 77th embodiment chr:16:10902171-10923242, optionally chr16:10902662-chr16:10923285, chr16:10906542-10923285, or chr16:10906542-10908121, optionally chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:109 18512-10918532, chr16:10918511-10918531, chr16:10895742-10895762 , chr16:10916362-10916382, chr16:10916455-10916475, chr16:1090917 2-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr 16:10922478-10922498, chr16:10895747-10895767, chr16:10916348-10 916368, chr16:10910186-10910206, chr16:10906481-10906501, chr16:10909007-10909027, chr16:10895410-10895430, and chr16:10908130-10908150, optionally, chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-1 0906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16: 10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916 382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:1092 3222-10923242, chr16:10910176-10910196, chr16:10895742-10895762,chr16:10916449-10916469, chr16:10923214-10923234, chr16:10906492-10906512, and chr16:10906487-1090650, or optionally chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-1090745 3, chr16:10907979-10907999, chr16:10907139-10907159, chr16:109224 35-10922455, chr16:10907384-10907404, chr16:10907434-10907454, ch r16:10907119-10907139, chr16:10907539-10907559, chr16:10907810-1 0907830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:1 0909138-10909158, chr16:10908101-10908121, chr16:10907790-109078 10, chr16:10907787-10907807, chr16:10907454-10907474, chr16:10895 702-10895722, chr16:10902729-10902749, chr16:10918492-10918512, c hr16:10907932-10907952, chr16:10907623-10907643, chr16:10907461- 10907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16 :10922441-10922461, chr16:10902662-10902682, chr16:10915626-1091 5646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:109 07030-10907050, chr16:10907935-10907955, chr16:10906853-10906873,The composition of any one of embodiments 70 to 76, further comprising a guide RNA that specifically hybridizes to a genomic coordinate selected from chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322.

[0299] Embodiment 78. Genomic coordinates selected from chr6:29942854-29942913 and chr6:29943518-29943619, optionally chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:299435 78. The composition of any one of embodiments 70-77, further comprising a guide RNA that specifically hybridizes to a genomic coordinate selected from among chr6:29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.

[0300] Embodiment 79. The guide RNA of any one of embodiments 51-69 or the composition of any one of embodiments 70-78, wherein the composition further comprises a pharma- ceutically acceptable excipient.

[0301] Embodiment 80. The guide or composition of embodiment 79, wherein the composition is non-pyrogenic.

[0302] Embodiment 81. The guide RNA of any one of embodiments 51 to 69 or the composition of any one of embodiments 70 to 80, wherein the guide RNA is associated with a lipid nanoparticle (LNP).

[0303] Embodiment 82. A method for genetically modifying a 2B4 sequence in a cell, comprising contacting said cell with a guide RNA or a composition according to any one of embodiments 51 to 81.

[0304]

[0082] Embodiment 83. The method of embodiment 82, further comprising making a genetic modification in the TCR sequence to inhibit expression of the TCR gene.

[0305] Embodiment 84 A method for preparing a cell population for immunotherapy, comprising: a. performing a genetic modification in a 2B4 sequence in cells in a population having a 2B4 guide RNA or a composition according to any one of embodiments 51 to 81; b. performing a genetic modification in a TCR sequence in the cells of the population to reduce expression of the TCR protein on the surface of the cells in the population; c. expanding said cell population in culture.

[0306]

[0082] Embodiment 85. The method of embodiment 84, wherein expression of the TCR protein on the surface of the cells is reduced below the level of detection in at least 70% of the cells in the population.

[0307]

[0082] Embodiment 86. The method of embodiment 84 or 85, wherein said genetic modification of TCR sequences in said cells of said population comprises modification of two or more TCR sequences.

[0308]

[0082] Embodiment 87. The method of embodiment 86, wherein the two or more TCR sequences comprise TRAC and TRBC.

[0309]

[0082] Embodiment 88. The method of any of embodiments 84 to 87, optionally comprising the insertion of an exogenous nucleic acid at the TRAC locus encoding a targeting receptor to be expressed on the surface of the engineered cell, e.g., a TCR or CAR.

[0310]

[0082] Embodiment 89. The method of any one of embodiments 84-88, further comprising contacting the cell with a LNP composition comprising the 2B4 guide RNA.

[0311]

[0081] Embodiment 90. The method of embodiment 89, comprising contacting the cell with a second LNP composition comprising a guide RNA.

[0312] Embodiment 91. A cell population produced by the method according to any one of embodiments 82 to 90.

[0313]

[0081] Embodiment 92. The cell population of embodiment 91, wherein the cell population is modified ex vivo.

[0314] Embodiment 93. A pharmaceutical composition comprising the cell population of embodiment 91 or 92.

[0315] Embodiment 94. A method of administering the cell population of embodiment 91 or 92, or the pharmaceutical composition of embodiment 93, to a subject in need thereof.

[0316] Embodiment 95. A method of administering the cell population of embodiment 91 or 92, or the pharmaceutical composition of embodiment 93, to a subject as adoptive cell transfer (ACT) therapy.

[0317] Embodiment 96. The cell population of embodiment 91 or 92, or the pharmaceutical composition of embodiment 93, for use as an ACT therapy.

[0318] Embodiment 97. A cell population comprising a genetic modification of the 2B4 gene, wherein at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous 2B4 sequence.

[0319] Embodiment 98. The cell population of embodiment 97, wherein the genetic modification is as defined in any of embodiments 1 to 4.

[0320] Embodiment 99. The cell population of embodiment 97 or 98, wherein expression of 2B4 is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, or 95%, or below the detection limit of the assay, e.g., compared to a suitable control in which the 2B4 gene is not modified.

[0321] Embodiment 100. The cell population of any one of embodiments 97-99, wherein at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the cells comprise a genetic modification of a TCR gene comprising a modification selected from an insertion, a deletion, and a substitution in the endogenous TCR gene sequence.

[0322] Embodiment 101. The cell population of embodiment 100, wherein the genetic modification is as defined in any of embodiments 5 to 8.

[0323] Embodiment 102. The cell population of embodiment 100 or 101, wherein expression of the TCR is reduced by at least 50%, 55%, 60%, 65%, preferably at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or below the detection limit of the assay, e.g., compared to a suitable control in which the TCR gene is not modified.

[0324]

[0022] Embodiment 103: The population comprises at least 10 3 , 10 4 , 10 5 or 10 6 cells, preferably 10 7 , 2×10 7 , 5×10 7 , or 10 8 103. The cell population of any of embodiments 97-102, comprising cells.

[0325] Embodiment 104. The cell population of any one of embodiments 97-103, wherein at least 70% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous 2B4 sequence.

[0326] Embodiment 105. The cell population of any one of embodiments 97-104, wherein at least 80% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous 2B4 sequence.

[0327] Embodiment 106. The cell population of any one of embodiments 97-105, wherein at least 90% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous 2B4 sequence.

[0328] Embodiment 107. The cell population of any one of embodiments 97-106, wherein at least 95% of the cells in the population comprise a modification selected from an insertion, a deletion, and a substitution in the endogenous 2B4 sequence.

[0329] Embodiment 108. The cell population of any one of embodiments 97 to 107, wherein expression of 2B4 is reduced by at least 70%, or to below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified.

[0330] Embodiment 109. The cell population of any one of embodiments 97 to 108, wherein expression of 2B4 is reduced by at least 80%, or to below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified.

[0331] Embodiment 110. The cell population of any one of embodiments 97 to 109, wherein expression of 2B4 is reduced by at least 90%, or to below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified.

[0332] Embodiment 111. A cell population described in any one of embodiments 97 to 110, wherein expression of 2B4 is reduced by at least 95%, or to below the detection limit of the assay, for example, compared to a suitable control in which the 2B4 gene is not modified.

[0333] Embodiment 112. A pharmaceutical composition comprising the cell population described in any one of embodiments 97 to 111.

[0334] Embodiment 113. The cell population according to any of embodiments 97 to 111 or the pharmaceutical composition according to embodiment 112 for use as an ACT therapy.

[0335]

[0046] Embodiment 114. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841611-160841631.

[0336]

[0046] Embodiment 115. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841865-160841885.

[0337]

[0046] Embodiment 116. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160862624-160862644.

[0338]

[0046] Embodiment 117. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160862671-160862691.

[0339]

[0046] Embodiment 118. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841622-160841642.

[0340]

[0046] Embodiment 119. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841819-160841839.

[0341]

[0046] Embodiment 120. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841823-160841843.

[0342]

[0071] Embodiment 121. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841717-160841737.

[0343]

[0071] Embodiment 122. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841859-160841879.

[0344]

[0071] Embodiment 123. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841806-160841826.

[0345]

[0071] Embodiment 124. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841834-160841854.

[0346]

[0082] Embodiment 125. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841780-160841800.

[0347]

[0082] Embodiment 126. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841713-160841733.

[0348]

[0082] Embodiment 127. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841631-160841651.

[0349]

[0071] Embodiment 128. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841704-160841724.

[0350]

[0071] Embodiment 129. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841584-160841604.

[0351]

[0082] Embodiment 130. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841679-160841699.

[0352]

[0071] Embodiment 131. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841874-160841894.

[0353]

[0082] Embodiment 132. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841750-160841770.

[0354]

[0082] Embodiment 133. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841577-160841597.

[0355]

[0082] Embodiment 134. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841459-160841479.

[0356]

[0082] Embodiment 135. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841466-160841486.

[0357]

[0082] Embodiment 136. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841461-160841481.

[0358]

[0082] Embodiment 137. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841460-160841480.

[0359]

[0082] Embodiment 138. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841360-160841380.

[0360]

[0071] Embodiment 139. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841304-160841324.

[0361]

[0082] Embodiment 140. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841195-160841215.

[0362]

[0081] Embodiment 141. The engineered cell, guide RNA, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification is within the genomic coordinates of chr1:160841305-160841325.

[0363]

[0071] Embodiment 142. The genetic modification is located at a genomic coordinate selected from the following: [Table 20] or Respectively, chr2:241852919-241852939, chr2:241852915-241852935, chr2:241852750-241852770, chr2:241852264-241852284, chr2:241852265-241852285, chr2:241858807-241858827, chr2:241852201-241 genomic coordinates selected from: 852221, chr2:241858789-241858809, chr2:241858788-241858808, chr2:241858755-241858775, chr2:241852755-241852775, chr2:241852751-241852771, and chr2:241852703-241852723, or genomic coordinates selected from chr2:241858788-241858808, chr2:241858755-241858775, chr2:241852919-241852939, chr2:241852915-241852935, chr2:241852751-241852771, chr2:241858807-241858827, and chr2:241852703-241852723, respectively; or genomic coordinates selected from chr2:241858789-241858809, chr2:241852919-241852939, chr2:241852915-241852935, chr2:241852755-241852775, chr2:241852751-241852771, and chr2:241858807-241858827, respectively; or genomic coordinates selected from chr2:241858788-241858808, chr2:241858755-241858775, chr2:241852751-241852771, and chr2:241852703-241852723, respectively; or Genomic coordinates selected from chr2:241858788-241858808 and chr2:241852703-241852723, respectively; or genomic coordinates selected from chr2:241858788-241858808, chr2:241852751-241852771, chr2:241852703-241852723, chr2:241852188-241852208, and chr2:241852201-241852221, respectively; or genomic coordinates selected from chr2:241858788-241858808, chr2:241852703-241852723, and chr2:241852201-241852221, respectively; or 26. The engineered cell of embodiment 25, comprising at least one nucleotide modification within the genomic coordinates of chr2:241858807-241858827. [Table 21-1] [Table 21-2] [Table 21-3] [Table 21-4]

Table 21-5

Table 21-6

Table 21-7

Table 21-8

Table 21-9

Table 21-10

Table 21-11

Table 21-12

Table 21-13

Table 21-14

[0364]

Table 21-15

Claims

[Claim 1] The invention described in the specification.

Images