Compositions and methods for enhancing gene silencing activity of oligonucleotide compounds
Patent Information
- Application Number
- JP2024520007
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-05
- Filing Date
- 2022-10-04
- Publication Date
- 2025-10-10
AI Technical Summary
There is a need to improve the intracellular delivery of therapeutic oligonucleotides, such as siRNA molecules, to enhance their efficacy by overcoming the inefficiencies in escaping endosomes and accessing the cytosol, where they can effectively inhibit protein expression.
Identifying and inhibiting the expression or activity of suppressor proteins, such as RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, or VPS37A, using inhibitors or genetic modification agents, and delivering oligonucleotide compounds conjugated with ligands like GalNAc to target liver cells, thereby enhancing gene silencing activity.
The method significantly increases the gene silencing activity of oligonucleotide compounds, allowing them to effectively suppress target gene expression and enhance therapeutic utility by improving intracellular delivery and escape from endosomes.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 252,596, filed October 5, 2021, which is incorporated by reference in its entirety.
[0002] Description of electronically submitted text files This application has been submitted electronically in XML format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. A copy of the Sequence Listing in computer readable format, created on October 3, 2022, is titled A-2846-WO01-SEC_ST26.xml and is 81.2 kilobytes in size.
[0003] The present invention relates to the identification of proteins that act to suppress gene silencing activity of oligonucleotide compounds in cells.More specifically, the present invention relates to compositions and methods for enhancing the efficacy of ligand-conjugated oligonucleotide compounds that reduce the expression of target genes in cells by inhibiting the expression or activity of such suppressor proteins, such as RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B or VPS37A.The described methods are particularly useful for enhancing the efficacy of ligand-conjugated oligonucleotide compounds that are administered for therapeutic purposes. [Background technology]
[0004] Nucleic acid-based therapeutics, such as small interfering RNA (siRNA) molecules and antisense oligonucleotides, have developed rapidly in recent years, despite the challenges associated with delivering large, highly charged nucleic acids. Compared to traditional drug molecules, siRNA molecules and antisense oligonucleotides are highly potent and can act on targets that were previously "non-druggable" (Juliano, Nucleic Acids Res, Vol. 44; 6518-6548, 2016; Dowdy, Nat Biotechnol, Vol. 35; 222-229, 2017; and Khvorova and Watts, Nat Biotechnol, Vol. 35; 238-248, 2017). Even more surprisingly, the duration of siRNA-mediated gene silencing in particular has been shown to last for several months (Nair et al., Nucleic Acids Res, Vol. 45; 10969-10977, 2017; Juliano, 2016; Dowdy, 2017; and Khvorova and Watts, 2017, supra).
[0005] Delivery of oligonucleotide therapeutic molecules to the liver has been established by conjugation of the oligonucleotide to a ligand consisting of N-acetylgalactosamine (GalNAc), which binds to the asialoglycoprotein receptor (ASGPR), which is highly expressed on the surface of liver cells (see, for example, Nair et al., J Am Chem Soc, Vol. 136; 16958-16961, 2014). The siRNA molecule is then delivered to endosomes by a receptor-mediated endocytosis mechanism, passing through the plasma membrane (see, for example, Baenziger and Fiete, Cell, Vol. 22; 611-620, 1980; Prakash et al., Nucleic Acids Res, Vol. 42; 8796-8807, 2014). As endosomes mature, the internal pH drops, resulting in the release of GalNAc-conjugated oligonucleotides from the ASGPR, which then rapidly recycles back to the cell surface, while the GalNAc-conjugated oligonucleotides remain inside the endosome (Prakash et al., 2014, supra). To gain access to target mRNA and effectively inhibit protein expression, oligonucleotides must escape from endosomes into the cytosol and associate with the RNA-induced silencing complex (RISC) in the case of siRNA molecules, or with RNase H in the case of antisense oligonucleotides. Less than 1% of oligonucleotide molecules in endosomes are able to escape into the cytosol (Gilleron et al., Nat Biotechnol, Vol. 31; 638-646, 2013). The intracellular transport and egress steps of therapeutic oligonucleotide molecules are highly inefficient and the underlying mechanisms are not fully understood (Springer and Dowdy, Nucleic Acid Ther, Vol. 28; 109-118, 2018; Prakash et al., 2014, supra).
[0006] Thus, there remains a need in the art to improve the intracellular delivery of therapeutic oligonucleotides to their site of action within the cytosol, which could result in improved efficacy of these molecules. [Prior art documents] [Non-patent literature]
[0007] [Non-Patent Document 1] Juliano,Nucleic Acids Res,Vol.44;6518-6548,2016 [Non-Patent Document 2] Dowdy,Nat Biotechnol,Vol.35;222-229,2017 [Non-Patent Document 3] Khvorova and Watts,Nat Biotechnol,Vol.35;238-248,2017 [Non-Patent Document 4] Nair et al.,Nucleic Acids Res,Vol.45;10969-10977,2017 [Non-Patent Document 5] Nair et al.,J Am Chem Soc,Vol.136;16958-16961,2014 [Non-Patent Document 6] Baenziger and Fiete,Cell,Vol.22;611-620,1980 [Non-Patent Document 7] Prakash et al.,Nucleic Acids Res,Vol.42;8796-8807,2014 [Non-Patent Document 8] Gilleron et al.,Nat Biotechnol,Vol.31;638-646,2013 [Non-Patent Document 9] Springer and Dowdy,Nucleic Acid Ther,Vol.28;109-118,2018 Summary of the Invention [Means for solving the problem]
[0008] The present invention is based in part on the identification of cellular proteins that act to inhibit or suppress the gene silencing activity of oligonucleotide compounds, particularly ligand-conjugated oligonucleotide compounds.Accordingly, the method of the present invention described herein provides a means for enhancing the gene silencing activity of ligand-conjugated oligonucleotide compounds, particularly therapeutic oligonucleotide compounds, by inhibiting the expression or activity of such suppressor proteins in target cells or subjects.
[0009] In some embodiments, the method includes inhibiting expression or activity of a suppressor protein in a cell, for example by contacting the cell with an inhibitor of the suppressor protein, and contacting the cell with an oligonucleotide compound (e.g., a target gene-directed oligonucleotide compound) that includes a sequence substantially or completely complementary to the target gene sequence, where the oligonucleotide compound is covalently linked to a ligand of a receptor expressed on the surface of the cell. The cell may be in vitro or in vivo. In some embodiments, the cell is present in a subject in need of reducing expression of the target gene. Thus, in certain embodiments, the invention also includes a method for reducing expression of a target gene in a subject, comprising administering to the subject an inhibitor of the suppressor protein and an oligonucleotide compound (e.g., a target gene-directed oligonucleotide compound) that includes a sequence substantially or completely complementary to the target gene sequence, where the oligonucleotide compound is covalently linked to a ligand. In some embodiments, the target gene may be a human gene and a gene expressed in liver cells or tissues. In these and other embodiments, expression of the target gene is associated with a disease or disorder in the subject, and thus the oligonucleotide compound may be therapeutic.
[0010] The target gene-directed oligonucleotide compounds used in the methods of the present invention may be single-stranded or double-stranded. For example, in some embodiments, the oligonucleotide compounds are single-stranded antisense oligonucleotides that contain a sequence that is substantially or completely complementary to the target gene sequence. In such embodiments, the antisense oligonucleotides may be about 15 to about 30 nucleotides in length. In other embodiments, the oligonucleotide compounds are siRNA molecules that contain a sense strand and an antisense strand, and the antisense strand contains a sequence that is substantially or completely complementary to the sequence of the target gene. In some embodiments, the sense strand may contain a sequence that is sufficiently complementary to the sequence of the antisense strand to form a duplex region that is about 15 to about 30 base pairs in length. In these and other embodiments, the sense strand and the antisense strand are each independently about 19 to about 30 nucleotides in length.
[0011] The target gene-directed oligonucleotide compounds used in the methods of the present invention may contain one or more modified nucleotides, including nucleotides with modifications in the ribose ring, nucleobase, or phosphodiester backbone. In some embodiments, the oligonucleotide compounds contain one or more 2'-modified nucleotides. Such 2'-modified nucleotides may include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), deoxyribonucleotides, or combinations thereof. In some embodiments, all of the nucleotides in the oligonucleotide compounds are modified nucleotides. In certain embodiments, the target gene-directed oligonucleotide compounds used in the methods of the present invention contain at least one backbone modification, such as modified internucleotide or internucleoside linkages. For example, in some embodiments, the oligonucleotide compounds contain one or more phosphorothioate internucleotide linkages.
[0012] In certain embodiments of the method of the present invention, the target gene-directed oligonucleotide compound is covalently linked to a ligand of a receptor expressed in a cell or tissue to which the oligonucleotide compound is intended to be delivered. In some embodiments, the ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folate moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or an antigen-binding fragment thereof. In certain embodiments, the ligand targets the delivery of the oligonucleotide compound to a liver cell (e.g., a hepatocyte). In these and other embodiments, the ligand may be a ligand of an asialoglycoprotein receptor and may comprise galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand comprises a multivalent galactose or multivalent GalNAc moiety, e.g., a trivalent or tetravalent galactose or GalNAc moiety. The ligand may be covalently linked to the 5'-end or 3'-end of the oligonucleotide of the oligonucleotide compound, optionally via a linker.
[0013] The inhibitor of suppressor protein can be any kind of molecule or drug that reduces the expression or activity of suppressor protein in the cell where the target gene-directed oligonucleotide compound is delivered. In some embodiments of the method of the present invention, the suppressor protein is RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, VPS37A, YAP1, CCNE1, SLC30A9, TEDC1, HIF1AN, or TRAF2. In certain embodiments of the method of the present invention, the suppressor protein is RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, or VPS37A. In certain other embodiments of the method of the present invention, the suppressor protein is RAB18, ZW10, or STX18. In one particular embodiment, the suppressor protein is RAB18.
[0014] In some embodiments of the methods of the present invention, the inhibitor of a suppressor protein, e.g., any of the suppressor proteins described herein, may be an oligonucleotide-based inhibitor that reduces the expression of a nucleic acid (e.g., mRNA) encoding the suppressor protein. For example, in some embodiments, the inhibitor of a suppressor protein is an oligonucleotide compound as described herein, the oligonucleotide compound is a compound that comprises a sequence substantially or completely complementary to an mRNA sequence encoding the suppressor protein (e.g., a suppressor protein-directed oligonucleotide compound). Such a suppressor protein-directed oligonucleotide compound may be single-stranded, e.g., a single-stranded antisense oligonucleotide that comprises a sequence substantially or completely complementary to an mRNA sequence encoding the suppressor protein. In alternative embodiments, the suppressor protein-directed oligonucleotide compound may be double-stranded, e.g., comprise an siRNA or shRNA. In some embodiments of the methods of the present invention, the suppressor protein-directed oligonucleotide compound is an siRNA molecule that comprises a sense strand and an antisense strand, the antisense strand comprising a sequence substantially or completely complementary to an mRNA sequence encoding the suppressor protein. The suppressor protein-directed oligonucleotide compound may contain one or more modified nucleotides (e.g., 2'-modified nucleotides) or modified internucleotide or internucleoside linkages (e.g., phosphorothioate internucleotide linkages) as described herein. In some embodiments, the suppressor protein-directed oligonucleotide compound may be covalently linked to any of the ligands described herein. In one such embodiment, the ligand covalently linked to the suppressor protein-directed oligonucleotide compound may be the same as the ligand covalently linked to the target gene-directed oligonucleotide compound.In another embodiment, the ligand covalently attached to the suppressor protein-directed oligonucleotide compound may be different from the ligand covalently attached to the target gene-directed oligonucleotide compound, but both ligands are ligands for receptors expressed in the same cell type or tissue.
[0015] In other embodiments of the method of the present invention, the inhibitor of the suppressor protein, e.g., any of the suppressor proteins described herein, is a genetic modification agent that modifies the gene encoding the suppressor protein to encode a variant of the suppressor protein with reduced activity or function, or to completely eliminate the expression of the gene (i.e., knock out the gene). In certain embodiments, the genetic modification agent comprises a transcription activator-like effector nuclease (TALEN) or a zinc finger nuclease (ZFN), or a vector / polynucleotide encoding a nuclease. In certain other embodiments, the genetic modification agent comprises (i) a Cas nuclease or a vector / polynucleotide encoding a nuclease, and (ii) a vector / polynucleotide comprising a guide RNA or a guide RNA expression cassette, wherein the guide RNA comprises a sequence complementary to a portion of the gene sequence encoding the suppressor protein. The vector encoding the nuclease and / or the guide RNA expression cassette can be a viral vector, such as a lentiviral vector. [Brief description of the drawings]
[0016] [Figure 1A] 1 shows a bar graph of SLC3A2 expression in the Hep3B parental cell line or one of three different stable Hep3BCas9 cell lines after transduction with one of two gRNA lentiviral vectors, SLC3A2-83 or SLC3A2-84. [Figure 1B] A bar graph of ASGR1 expression in the Hep3B parental cell line or one of three different stable Hep3BCas9 cell lines after transduction with one of two gRNA lentiviral vectors, ASGR1-77 or ASGR1-78. [Figure 2A] Bar graphs of viable cell numbers measured on days 3 (FIG. 2A) and 6 (FIG. 2B) after treatment with 100 μM 6-thioguanine (6TG) in one of four different treatment groups. Hep3BCas9 cells transduced with a gRNA lentiviral library were treated with GalNAc partially conjugated HPRT1 siRNA alone (HPRT1-si), GalNAc partially conjugated HPRT1 siRNA and 6TG (HPRT1-si+6-TG), 6-TG alone (6-TG), or no siRNA or 6TG (negative control). For each treatment group, the number of viable cells measured on the ViCell on days 3 and 6 after 6TG treatment was normalized by the measurement for the negative control group. The normalized viability for each group obtained at both time points is shown as the mean ± standard deviation. [Figure 2B] Bar graphs of viable cell numbers measured on days 3 (FIG. 2A) and 6 (FIG. 2B) after treatment with 100 μM 6-thioguanine (6TG) in one of four different treatment groups. Hep3BCas9 cells transduced with a gRNA lentiviral library were treated with GalNAc partially conjugated HPRT1 siRNA alone (HPRT1-si), GalNAc partially conjugated HPRT1 siRNA and 6TG (HPRT1-si+6-TG), 6-TG alone (6-TG), or no siRNA or 6TG (negative control). For each treatment group, the number of viable cells measured on the ViCell on days 3 and 6 after 6TG treatment was normalized by the measurement for the negative control group. The normalized viability for each group obtained at both time points is shown as the mean ± standard deviation. [Figure 3A] Scatter plot showing genes enriched in both 150 nM siRNA + 6TG treated samples (150si6TGd9) versus no siRNA but 6TG treated samples (nosi6TGd9) and 750 nM siRNA + 6TG treated samples (750si6TGd9) versus no siRNA but 6TG treated samples (nosi6TGd9). A total of 17 genes with a false discovery rate (FDR) < 0.2 were identified (represented by solid black dots). [Figure 3B]Scatter plot showing genes enriched by genes depleted by 6TG alone versus no siRNA and no 6TG samples, and by 750 nM siRNA + 6TG treated samples (750si6TGd9) versus no siRNA but 6TG treated samples (nosi6TGd9). The horizontal axis indicates sensitivity to 6TG. Eight genes with FDR<0.2 that were significantly depleted upon treatment with 6TG are enclosed by dashed boxes. [Figure 4A] 1 is a line graph showing the percentage of RAB18 mRNA level in Hep3B cells treated with one of three different RAB18 targeting siRNA molecules at various concentrations for 24 hours. RNA samples were extracted from Hep3B cells treated with three different siRNA molecules targeting RAB18 gene at various concentrations 24 hours after treatment. Then, cDNA samples synthesized from RNA by reverse transcription were subjected to ddPCR analysis. The ddPCR measurements of RAB18 were normalized to the ddPCR measurements of housekeeping TBP gene to calculate the percentage of RAB18 mRNA level. [Figure 4B] 1 is a bar graph of RAB18 mRNA levels in Hep3B cells transfected with non-targeting control siRNA molecules (siNTC) or RAB18-targeting siRNA molecules (siRAB18) 4 days after treatment with GalNAc-moiety-conjugated HPRT1 siRNA molecules. Hep3B cells were pretreated with siRAB18-3 or siNTC molecules by transfection. After 24 hours, the transfection medium was washed away and the cells were treated with various concentrations of GalNAc-moiety-conjugated HPRT1 siRNA molecules (duplex no. 8172). Four days after treatment with duplex no. 8172, cells were harvested to measure RAB18 mRNA levels by ddPCR. [Figure 4C]Dose-response curves of GalNAc moiety conjugated HPRT1 siRNA molecule (duplex 8172) in Hep3B cells transfected with either a non-targeting control siRNA molecule (siNTC) or a RAB18-targeting siRNA molecule (siRAB18). Four days after treatment with duplex no. 8172, HPRT1 mRNA levels were measured by ddPCR from cells harvested from the experiment described in FIG. 4B. HPRT1 mRNA levels are expressed as a percentage normalized to measurements of the housekeeping TBP gene and to treatment controls without siRNA (PBS only). [Diagram 5] Figure 1 is a graph of the percentage of cell lysis as a function of concentration for the indicated GalNAc moiety-conjugated siRNA molecules. Hep3BCas9 cells and two different RAB18 knockout cell pools (RAB18 KO_1 and RAB18 KO_2) were treated with various concentrations of either GalNAc-HPRT1 siRNA conjugated molecules (HPRT1-si) or GalNAc-PPIB siRNA conjugated molecules (PPIB-si) for 3 days. Cells were then subjected to a live / dead selection screen using 100 μM 6TG. At day 6 after 6TG treatment, viable cells were detected using CellTiter-Glo reagent. [Figure 6A] Dose-response curves of GalNAc moiety conjugated HPRT1 siRNA molecule (duplex number 8172) in Hep3BCas9 cells and two different RAB18 knockout cell pools (RAB18 KO_1 and RAB18 KO_2) are shown. Cells were treated for 4 days with various concentrations of either GalNAc-HPRT1 siRNA conjugated molecule (HPRT1-si) or GalNAc-PPIB siRNA conjugated molecule (PPIB-si) as a control. mRNA levels were measured by ddPCR. HPRT1 mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and to the treatment control group without siRNA (PBS only). [Figure 6B]Dose-response curves of GalNAc moiety conjugated ASGR1 siRNA molecule (duplex number 16084) in Hep3BCas9 cells and two different RAB18 knockout cell pools (RAB18 KO_1 and RAB18 KO_2) are shown. Cells were treated for 4 days with various concentrations of either GalNAc-ASGR1 siRNA conjugated molecule (ASGR1-si) or GalNAc-PPIB siRNA conjugated molecule (PPIB-si) as a control. mRNA levels were measured by ddPCR. ASGR1 mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and to the treatment control group without siRNA (PBS only). [Figure 6C] Dose-response curves of GalNAc-moiety conjugated PPIB siRNA molecule (duplex no. 8714) in Hep3BCas9 cells and two different RAB18 knockout cell pools (RAB18 KO_1 and RAB18 KO_2) are shown. Cells were treated for 4 days with various concentrations of either GalNAc-PPIB siRNA conjugated molecule (PPIB-si) or GalNAc-HPRT1 siRNA conjugated molecule (HPRT1-si) as a control. mRNA levels were measured by ddPCR. PPIB mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and to the treatment control group without siRNA (PBS only). [Figure 7]Dose-response curves of GalNAc moiety conjugated HPRT1 siRNA molecule (duplex no. 8172) in Hep3BCas9 cells and two different RAB18 knockout cell pools (RAB18 KO_1 and RAB18 KO_2) are shown. Cells were pretreated with anti-ASGR1 antibody (7E11), isotype control antibody (isotype), or no antibody for 30 min. GalNAc-HPRT1 siRNA conjugate was then added to the cells at various concentrations. Four days after siRNA treatment, mRNA levels were measured by ddPCR. HPRT1 mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and the no siRNA (PBS only) treatment control group. [Figure 8] Dose-response curves of unconjugated HPRT1 siRNA molecule (duplex no. 17629) with and without Lipofectamine reagent (RNAiMAX) in Hep3BCas9 cells and RAB18 knockout cells (RAB18 KO). Cells were treated with various concentrations of unconjugated HPRT1 siRNA molecule (HPRT1-si 17629) alone or with Lipofectamine RNAiMAX reagent for 4 days. mRNA levels were measured by ddPCR. HPRT1 mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and to the treatment control group without siRNA (PBS only). [Figure 9] Dose-response curves of GalNAc-moiety conjugated HPRT1 single-stranded antisense oligonucleotide (ASO) molecules (compound no. 15469 and 15470) and a control GalNAc-moiety conjugated PNPLA3 ASO molecule (compound no. 15472) in Hep3BCas9 cells and RAB18 knockout cells (RAB18 KO). Cells were treated with various concentrations of different GalNAc-ASO conjugate molecules for 4 days. mRNA levels were measured by ddPCR. HPRT1 mRNA levels are expressed as a percentage normalized to the measurements of the housekeeping TBP gene and to the treatment control without ASO (PBS only). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0017] The present invention is based in part on the identification of intracellular proteins that negatively affect the gene silencing activity of oligonucleotide compounds, such as siRNA molecules. As further described herein, suppressing or inhibiting the expression or activity of such suppressor proteins significantly increases the gene silencing activity of oligonucleotide compounds, thereby potentially expanding the therapeutic utility of oligonucleotide compounds. Some of the identified suppressor proteins, such as RAB18, are believed to play a role in intracellular endosomal trafficking, and therefore the method of the present invention is particularly useful for enhancing or increasing the gene silencing activity of ligand-conjugated oligonucleotide compounds that enter cells via receptor-dependent endocytosis pathways. Thus, in certain embodiments, the present invention provides a method for enhancing the silencing activity of an oligonucleotide compound in a cell, comprising inhibiting the expression or activity of a suppressor protein in the cell and contacting the cell with an oligonucleotide compound, wherein the oligonucleotide compound comprises a sequence that is substantially complementary to the sequence of a target gene.
[0018] As used herein, an "oligonucleotide compound" is a compound that includes at least one oligonucleotide having a nucleotide sequence sufficiently complementary to a target nucleic acid sequence to hybridize with the target nucleic acid and cause gene silencing activity. "Hybridize" or "hybridization" refers to the pairing of complementary polynucleotides, typically via hydrogen bonds (e.g., Watson-Crick hydrogen bonds, Hoogsteen or reversed Hoogsteen hydrogen bonds) between complementary bases in two oligonucleotides. As used herein, a first sequence is "complementary" to a second sequence if the oligonucleotide comprising the first sequence can hybridize to the oligonucleotide comprising the second sequence under a particular condition, such as physiological conditions, to form a double-stranded region. Other such conditions can include moderate or stringent hybridization conditions, which are known to those skilled in the art. A first sequence is considered to be fully complementary (100% complementary) to a second sequence when an oligonucleotide containing the first sequence base pairs with an oligonucleotide containing the second sequence over the entire length of one or both nucleotide sequences without any mismatches. A sequence is "substantially complementary" to a target sequence if the sequence is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to the target sequence. The percentage of complementarity can be calculated by dividing the number of bases in the first sequence that are complementary to the bases at the corresponding positions in the second sequence or the target sequence by the entire length of the first sequence. A sequence can also be said to be substantially complementary to another sequence if there are no more than 5, 4, 3, or 2 mismatches over a 30 base pair double-stranded region when the two sequences hybridize.
[0019] The oligonucleotide compounds used in the methods of the present invention include at least one oligonucleotide having a region with a sequence that is substantially or completely complementary to a target gene sequence. A target gene sequence generally refers to a nucleic acid sequence that includes a partial or complete coding sequence of a polypeptide. A target gene sequence may also include non-coding regions, such as 5' or 3' untranslated regions (UTRs) or promoter regions. In certain embodiments, the target gene sequence is a messenger RNA (mRNA) sequence. An mRNA sequence refers to any messenger RNA sequence that encodes a protein, protein variant, or isoform, including splice variants, from any species (e.g., mouse, rat, non-human primate, human). In one embodiment, the target gene sequence is an mRNA sequence that encodes a human protein. A target gene sequence may also be an RNA sequence other than an mRNA sequence, such as a tRNA sequence, a microRNA sequence, or a viral RNA sequence.
[0020] In certain embodiments of the methods of the present invention, the oligonucleotide compound comprises at least one oligonucleotide having a region that is substantially complementary or completely complementary to at least 10 consecutive nucleotides of a target gene sequence. In some embodiments, the region of the target gene sequence to which the oligonucleotide comprises a region of complementarity can range from about 10 to about 30 consecutive nucleotides, about 15 to about 30 consecutive nucleotides, about 16 to about 28 consecutive nucleotides, about 18 to about 26 consecutive nucleotides, about 17 to about 24 consecutive nucleotides, about 15 to about 20 consecutive nucleotides, about 19 to about 30 consecutive nucleotides, about 19 to about 25 consecutive nucleotides, about 19 to about 23 consecutive nucleotides, or about 19 to about 21 consecutive nucleotides.
[0021] "Gene silencing activity" or "silencing activity" refers to the downregulation or reduction of expression of a target gene at the transcription or translation level. Gene silencing activity includes the reduction of gene expression by RNA interference mechanisms, RNase H-mediated degradation, and steric inhibition. RNA interference is a process in which a nucleic acid molecule induces the cleavage and degradation of a target RNA molecule (e.g., a messenger RNA or mRNA molecule) in a sequence-specific manner, for example, via the RNA-induced silencing complex (RISC) pathway. RNase H-mediated degradation occurs when an oligonucleotide containing a stretch or gap of deoxyribonucleotides hybridizes to a target RNA molecule (e.g., an mRNA molecule), generating a DNA / RNA hybrid that is a substrate for the ribonuclease RNase H, which allows the cleavage of the target RNA molecule by RNase H. Gene silencing activity may also result from steric inhibition, in which an oligonucleotide hybridizes to a target nucleic acid sequence and inhibits transcription by RNA polymerase (e.g., if the target nucleic acid sequence is a promoter region) or inhibits translation by ribosomes if the target nucleic acid sequence is an mRNA molecule.
[0022] In some embodiments of the method of the present invention, the oligonucleotide compound is single-stranded. For example, the oligonucleotide compound comprises or consists of a single oligonucleotide that does not contain any double-stranded or self-complementary regions. In certain embodiments, the oligonucleotide compound is a single-stranded antisense oligonucleotide that comprises a sequence that is substantially complementary or completely complementary to a target gene sequence. The single-stranded antisense oligonucleotide can be about 10 to about 30 nucleotides long, about 15 to about 30 nucleotides long, about 12 to about 28 nucleotides long, about 18 to about 26 nucleotides long, about 20 to about 30 nucleotides long, about 15 to about 20 nucleotides long, about 19 to about 25 nucleotides long, about 19 to about 23 nucleotides long, about 19 to about 21 nucleotides long, about 21 to about 25 nucleotides long, or about 20 to about 23 nucleotides long. In some embodiments, the single-stranded antisense oligonucleotide is about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides long.
[0023] In other embodiments of the method of the present invention, the oligonucleotide compound is double-stranded. In some such embodiments, the oligonucleotide compound comprises or consists of two antiparallel oligonucleotides that are sufficiently complementary to each other to hybridize and form a double-stranded region. An oligonucleotide that comprises a region that has a substantially complementary or completely complementary sequence with a target gene sequence (e.g., a target mRNA) is referred to as an "antisense strand" or "guide strand". A "sense strand" or "passenger strand" refers to an oligonucleotide that comprises a substantially complementary or completely complementary region with a region of the antisense strand. In some embodiments, the sense strand may comprise a region that has a substantially identical sequence to a target gene sequence.
[0024] A double-stranded oligonucleotide compound (e.g., a double-stranded RNA molecule) may contain chemical modifications of ribonucleotides, including modifications of the ribose sugar, base, or backbone components of the ribonucleotide, such as those described herein or known in the art. Any such modifications are encompassed by the term "double-stranded RNA" for purposes of this disclosure as used in double-stranded RNA molecules (e.g., siRNA, shRNA, etc.).
[0025] In embodiments where the oligonucleotide compound is double-stranded, the region of the antisense strand comprises a sequence that is substantially or completely complementary to a region of the target gene sequence (e.g., target mRNA). In such embodiments, the sense strand may comprise a sequence that is completely complementary to the sequence of the antisense strand. In other such embodiments, the sense strand may comprise a sequence that is substantially complementary to the sequence of the antisense strand, for example, a sequence that has 1, 2, 3, 4, or 5 mismatches in the duplex region formed by the sense strand and the antisense strand. In certain embodiments, it is preferred that any mismatches occur within the terminal regions (e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5'-end and / or 3'-end of the strand). In one embodiment, any mismatches in the duplex region formed by the sense strand and the antisense strand occur within 6, 5, 4, 3, or 2 nucleotides of the 5'-end of the antisense strand.
[0026] In certain embodiments of the method of the present invention, the sense strand and antisense strand of oligonucleotide compound can be two separate molecules that hybridize to form a double-stranded region, but are otherwise separate.Such double-stranded RNA molecules formed from two separate strands are called "small interfering RNA" or "short interfering RNA" (siRNA).Thus, in some embodiments, the oligonucleotide compound used in the method of the present invention comprises or consists of siRNA.
[0027] In other embodiments, the sense and antisense strands that hybridize to form the duplex region may be part of a single oligonucleotide, i.e., the sense and antisense strands are part of the self-complementary region of a single oligonucleotide. In such cases, the oligonucleotide compound comprises or consists of a single oligonucleotide that includes a duplex region (also referred to as stem region) and a loop region. The 3' end of the sense strand is linked to the 5' end of the antisense strand by a continuous sequence of unpaired nucleotides, thereby forming a loop region. The loop region is typically long enough to allow the oligonucleotide to refold back on itself so that the antisense strand can base pair with the sense strand to form the duplex or stem region. The loop region may include about 3 to about 25, about 5 to about 15, or about 8 to about 12 unpaired nucleotides. Such oligonucleotides (e.g., RNA molecules) that include at least a partial self-complementary region are referred to as "small hairpin RNAs" (shRNAs). In certain embodiments, the oligonucleotide compounds used in the methods of the invention include or consist of shRNAs. The length of a single, at least partially self-complementary oligonucleotide may be from about 40 nucleotides to about 100 nucleotides, from about 45 nucleotides to about 85 nucleotides, or from about 50 nucleotides to about 60 nucleotides, and may include a duplex region and a loop region, each having a length as recited herein.
[0028] In embodiments where the oligonucleotide compound is double-stranded (e.g., including siRNA), the sense strand typically contains a sequence sufficiently complementary to that of the antisense strand such that the two strands hybridize under physiological conditions to form a duplex region. "Duplex region" refers to the regions within two complementary or substantially complementary oligonucleotides that base pair with each other, either by Watson-Crick base pairing or other hydrogen bonding interactions, to generate a duplex between the two oligonucleotides. The duplex region of an oligonucleotide compound must be of sufficient length to allow the compound to enter the RNA interference pathway, for example, by the participation of the Dicer enzyme and / or the RISC complex. For example, in some embodiments, the duplex region is about 15 to about 30 base pairs in length. Other lengths of the duplex region within this range are also suitable, such as about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 base pairs, or about 19 to about 21 base pairs. In certain embodiments, the duplex region is about 17 to about 24 base pairs in length. In other embodiments, the duplex region is about 19 to about 21 base pairs in length. In one embodiment, the duplex region is about 19 base pairs in length. In another embodiment, the duplex region is about 21 base pairs in length.
[0029] For embodiments in which the sense and antisense strands are two separate oligonucleotides (e.g., the oligonucleotide compound comprises or consists of an siRNA), the sense and antisense strands need not be the same length as the length of the duplex region. For example, one or both strands may be longer than the duplex region and may have one or more unpaired nucleotides or mismatches adjacent to the duplex region. Thus, in some embodiments, an oligonucleotide compound (e.g., an siRNA molecule) comprises at least one nucleotide overhang. As used herein, a "nucleotide overhang" refers to an unpaired nucleotide that extends beyond the duplex region at the end of a strand. A nucleotide overhang is typically generated when the 3' end of one strand extends beyond the 5' end of the other strand, or when the 5' end of one strand extends beyond the 3' end of the other strand. The length of a nucleotide overhang is generally 1-6 nucleotides, 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, 2-6 nucleotides, 2-5 nucleotides, or 2-4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In one particular embodiment, the nucleotide overhang comprises 1-4 nucleotides. In certain other embodiments, the nucleotide overhang comprises 2 nucleotides. In certain other embodiments, the nucleotide overhang comprises a single nucleotide.
[0030] The nucleotides in the overhang can be ribonucleotides or modified nucleotides as described herein. In some embodiments, the nucleotides in the overhang are 2'-modified nucleotides (e.g., 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides), deoxyribonucleotides, abasic nucleotides, inverted nucleotides (e.g., inverted abasic nucleotides, inverted deoxyribonucleotides), or combinations thereof. For example, in one embodiment, the nucleotides in the overhang are deoxyribonucleotides, e.g., deoxythymidine. In another embodiment, the nucleotides in the overhang are 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, or combinations thereof. In other embodiments, the overhang comprises a 5'-uridine-uridine-3' (5'-UU-3') dinucleotide. In such embodiments, the UU dinucleotide can comprise a ribonucleotide or a modified nucleotide, e.g., a 2'-modified nucleotide. In other embodiments, the overhang comprises a 5'-deoxythymidine-deoxythymidine-3' (5'-dTdT-3') dinucleotide. When a nucleotide overhang is present in the antisense strand, the nucleotides in the overhang may be complementary to the target gene sequence, may form a mismatch with the target gene sequence, or may comprise some other sequence (e.g., a polypyrimidine or polypurine sequence, such as UU, TT, AA, GG, etc.).
[0031] The nucleotide overhang may be present at the 5'-end or 3'-end of one or both strands. For example, in one embodiment, the oligonucleotide compound (e.g., siRNA molecule) comprises a nucleotide overhang at the 5'-end and 3'-end of the antisense strand. In another embodiment, the oligonucleotide compound (e.g., siRNA molecule) comprises a nucleotide overhang at the 5'-end and 3'-end of the sense strand. In some embodiments, the oligonucleotide compound (e.g., siRNA molecule) comprises a nucleotide overhang at the 5'-end of the sense strand and the 5'-end of the antisense strand. In other embodiments, the oligonucleotide compound (e.g., siRNA molecule) comprises a nucleotide overhang at the 3'-end of the sense strand and the 3'-end of the antisense strand.
[0032] The oligonucleotide compounds (e.g., siRNA molecules) used in the methods of the present invention may comprise a single nucleotide overhang at one end of the double-stranded molecule and a blunt end at the other end. "Blunt end" means that the sense and antisense strands are perfectly base-paired at the ends of the molecule, with no unpaired nucleotides extending beyond the double-stranded region. In some embodiments, the oligonucleotide compounds (e.g., siRNA molecules) comprise a nucleotide overhang at the 3' end of the sense strand and a blunt end at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the oligonucleotide compounds (e.g., siRNA molecules) comprise a nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand and the 3' end of the sense strand. In certain embodiments, the oligonucleotide compounds (e.g., siRNA molecules) used in the methods of the present invention comprise blunt ends at both ends of the double-stranded molecule. In such embodiments, the sense and antisense strands have the same length, and the double-stranded region is the same length as the sense and antisense strands (i.e., the molecule is double-stranded over its entire length).
[0033] In embodiments in which an oligonucleotide compound comprises a sense strand and an antisense strand (e.g., an oligonucleotide compound comprises or consists of an siRNA molecule), the sense strand and the antisense strand can each independently be about 15 to about 30 nucleotides in length, about 19 to about 30 nucleotides in length, about 18 to about 28 nucleotides in length, about 19 to about 27 nucleotides in length, about 19 to about 25 nucleotides in length, about 19 to about 23 nucleotides in length, about 19 to about 21 nucleotides in length, about 21 to about 25 nucleotides in length, or about 21 to about 23 nucleotides in length. In certain embodiments, the sense strand and the antisense strand are each independently about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides in length. In some embodiments, the sense strand and the antisense strand have the same length but form a duplex region that is shorter than the strands such that the oligonucleotide compound has a two nucleotide overhang. For example, in one embodiment, the oligonucleotide compound comprises (i) a sense strand and an antisense strand each 21 nucleotides long, (ii) a duplex region 19 base pairs long, and (iii) a nucleotide overhang of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In another embodiment, the oligonucleotide compound comprises (i) a sense strand and an antisense strand each 23 nucleotides long, (ii) a duplex region 21 base pairs long, and (iii) a nucleotide overhang of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the sense strand and the antisense strand have the same length and form a duplex region over their entire length such that there is no nucleotide overhang at either end of the double-stranded molecule. In such an embodiment, the oligonucleotide compound is blunt-ended (e.g., has two blunt ends) and comprises (i) a sense strand and an antisense strand each 21 nucleotides long, and (ii) a duplex region 21 base pairs long. In another such embodiment, the oligonucleotide compound is blunt-ended (e.g., has two blunt ends) and comprises (i) sense and antisense strands, each 23 nucleotides in length, and (ii) a duplex region 23 base pairs in length.In yet another such embodiment, the oligonucleotide compound is blunt-ended (e.g., has two blunt ends) and comprises (i) sense and antisense strands, each 19 nucleotides in length, and (ii) a duplex region 19 base pairs in length.
[0034] In another embodiment of the method of the present invention, the sense strand or antisense strand of the oligonucleotide compound is longer than the other strand, and the two strands form a duplex region with a length equal to the length of the shorter strand, so that the oligonucleotide compound (e.g., siRNA molecule) comprises at least one nucleotide overhang.For example, in one embodiment, the oligonucleotide compound comprises (i) a sense strand with a length of 19 nucleotides, (ii) an antisense strand with a length of 21 nucleotides, (iii) a duplex region with a length of 19 base pairs, and (iv) a nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.In another embodiment, the oligonucleotide compound comprises (i) a sense strand with a length of 21 nucleotides, (ii) an antisense strand with a length of 23 nucleotides, (iii) a duplex region with a length of 21 base pairs, and (iv) a nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.
[0035] The oligonucleotide compound used in the method of the present invention may contain one or more modified nucleotides. "Modified nucleotide" refers to a nucleotide that has one or more chemical modifications at the nucleoside, nucleobase, pentose ring, or phosphate group. As used herein, modified nucleotide does not include ribonucleotides that contain adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate. However, the oligonucleotide compound may contain a combination of modified nucleotides and ribonucleotides. The incorporation of modified nucleotides into the oligonucleotide compound can improve the in vivo stability of the oligonucleotide molecule, for example, by reducing the susceptibility of the molecule to nucleases and other degradative processes. The incorporation of modified nucleotides can also enhance the efficacy of the oligonucleotide compound to reduce the expression of a target gene.
[0036] In certain embodiments, modified nucleotides have modifications of the ribose sugar. These sugar modifications can include modifications of the 2' and / or 5' positions of the pentose ring, as well as bicyclic sugar modifications. A 2'-modified nucleotide refers to a nucleotide having a pentose ring with a substituent at the 2' position other than OH. Such 2'-modifications include 2'-H (e.g., deoxyribonucleotides), 2'-O-alkyl (e.g., O-C1-C2-C3-C4-C5-C6-C7-C8-C9-C10-C11-C12-C13-C24-C36-C4-C14-C25-C37-C4-C15-C26-C38-C4-C16-C27-C39-C4-C4-C5-C6-C7-C8-C9-C17-C18-C19-C28-C29-C38-C39-C4-C4-C19-C28-C39-C4-C18-C29-C38-C4-C19-C29-C39-C4-C4-C5-C6-C7-C8-C9-C19-C28-C39-C4-C19-C29-C38-C4-C39-C4-C4-C5-C6-C7-C8-C9-C19-C29-C39-C4 ... 10 or O-C1-C 10 Modifications at the 5' position of the pentose ring include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy.
[0037] "Bicyclic sugar modification" refers to a modification of a pentose ring in which two atoms of the ring are linked by a bridge to form a second ring, resulting in a bicyclic sugar structure. In some embodiments, a bicyclic sugar modification comprises a bridge between the 4' and 2' carbons of the pentose ring. Nucleotides containing a sugar moiety having a bicyclic sugar modification are referred to herein as bicyclic nucleic acids or BNAs. Exemplary bicyclic sugar modifications include α-L-methyleneoxy (4'-CH2-O-2') bicyclic nucleic acids (BNAs); β-D-methyleneoxy (4'-CH2-O-2') BNAs (also referred to as locked nucleic acids or LNAs); ethyleneoxy (4'-(CH2)2-O-2') BNAs; aminooxy (4'-CH2-ON(R)-2') BNAs; oxyamino (4'-CH2-N(R)-O-2') BNAs; methyl(methyleneoxy) (4'-CH(CH3)-O-2' ) BNAs (also referred to as constrained ethyl or cEt); methylene-thio (4'-CH2-S-2') BNAs; methylene-amino (4'-CH2-N(R)-2') BNAs; methyl carbocyclic (4'-CH2-CH(CH3)-2') BNAs; propylene carbocyclic (4'-(CH2)3-2') BNAs; and methoxy(ethyleneoxy) (4'-CH(CH2OMe)-O-2') BNAs (also referred to as constrained MOE or cMOE). These and other sugar-modified nucleotides that can be incorporated into the oligonucleotide compounds used in the methods of the invention are described in U.S. Pat. No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol. 19:937-954, 2012, all of which are incorporated by reference in their entireties.
[0038] In some embodiments, the oligonucleotide compound comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), deoxyribonucleotides, or combinations thereof. In certain embodiments, the oligonucleotide compound comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, or combinations thereof. In one particular embodiment, the oligonucleotide compound comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or combinations thereof. In another particular embodiment, the oligonucleotide compound comprises one or more 2'-O-methoxyethyl modified nucleotides, BNAs, deoxyribonucleotides, or combinations thereof.
[0039] In embodiments where the oligonucleotide compound used in the method of the present invention comprises a sense strand and an antisense strand (e.g., the oligonucleotide compound comprises or consists of an siRNA), both the sense strand and the antisense strand may comprise one or more modified nucleotides. For example, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In certain embodiments, all nucleotides of the sense strand are modified nucleotides. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In other embodiments, all nucleotides of the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides may be 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or combinations thereof.
[0040] In embodiments where the oligonucleotide compound used in the methods of the invention comprises or consists of a single-stranded antisense oligonucleotide, the antisense oligonucleotide may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In some embodiments, all nucleotides of the single-stranded antisense oligonucleotide are modified nucleotides. In such embodiments, the single-stranded antisense oligonucleotide may be a gapmer oligonucleotide. A gapmer oligonucleotide comprises a 5'-end segment and a 3'-end segment, each end segment comprising 2-5 modified nucleotides (e.g., 2'-O-methoxyethyl modified nucleotides or BNAs), and the end segments flank a central "gap" region comprised of 8-10 deoxyribonucleotides. In one embodiment, the gapmer oligonucleotide comprises, in 5' to 3' order, 5 2'-O-methoxyethyl modified nucleotides, 10 deoxyribonucleotides, and 5 2'-O-methoxyethyl modified nucleotides. In another embodiment, the gapmer oligonucleotide comprises, in 5' to 3' order, three BNAs (eg, LNAs), ten deoxyribonucleotides, and three BNAs (eg, LNAs).
[0041] In certain embodiments, modified nucleotides incorporated into oligonucleotide compounds used in the methods of the invention have modifications of the nucleobase (also referred to herein as "base"). "Modified nucleobase" or "modified base" refers to a base other than the naturally occurring purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases may be synthetic or naturally occurring modifications, and include the universal bases 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6-methyladenine, 6-methylguanine, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, 6-amino ... These include, but are not limited to, syl, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine.
[0042] In some embodiments, the modified base is a universal base. "Universal base" refers to a base analogue that indiscriminately base pairs with all natural bases in RNA and DNA without changing the double helix structure of the resulting double-stranded region. Universal bases are known to those skilled in the art and include, but are not limited to, inosine, C-phenyl, C-naphthyl and other aromatic derivatives, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole and 6-nitroindole.
[0043] Other suitable modified bases that can be incorporated into the oligonucleotide compounds used in the method of the present invention include those described in Herdewijn, Antisense Nucleic Acid Drug Dev., Vol.10:297-310,2000, and Peacock et al., J.Org.Chem., Vol.76:7295-7300,2011, both of which are incorporated herein by reference in their entirety.Those skilled in the art are well aware that guanine, cytosine, adenine, thymine and uracil can be replaced by other nucleobases, such as the modified nucleobases described above, without substantially changing the base pairing properties of the oligonucleotides that contain nucleotides with such substituted nucleobases.
[0044] In some embodiments, an oligonucleotide compound may contain one or more abasic nucleotides. An "abasic nucleotide" or "abasic nucleoside" is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the ribose sugar. In certain embodiments, an abasic nucleotide is incorporated at the terminus of one or more oligonucleotides of an oligonucleotide compound. For example, in one embodiment where an oligonucleotide compound comprises or consists of an siRNA, the sense strand contains an abasic nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In another embodiment, the antisense strand contains an abasic nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In such an embodiment where an abasic nucleotide is a terminal nucleotide, the nucleotide may be an inverted nucleotide, i.e., it may be linked to an adjacent nucleotide via a 3'-3' internucleotide bond (if on the 3' end of the strand) or via a 5'-5' internucleotide bond (if on the 5' end of the strand) rather than a natural 3'-5' internucleotide bond. The abasic nucleotide may also include a sugar modification, such as any of the sugar modifications described above. In certain embodiments, the abasic nucleotide includes a 2'-modification, such as a 2'-fluoro, 2'-O-methyl, or 2'-H (deoxy) modification. In one embodiment, the abasic nucleotide includes a 2'-O-methyl modification. In another embodiment, the abasic nucleotide includes a 2'-H modification (i.e., a deoxy abasic nucleotide).
[0045] The oligonucleotide compounds used in the methods of the present invention may also include one or more modified internucleotide linkages. As used herein, the term "modified internucleotide linkage" refers to an internucleotide linkage other than the natural 3'-5' phosphodiester linkage. In some embodiments, the modified internucleotide linkage is a phosphorus-containing internucleotide linkage, such as phosphotriester, aminoalkylphosphotriester, alkylphosphonate (e.g., methylphosphonate, 3'-alkylenephosphonate), phosphinate, phosphoramidate (e.g., 3'-aminophosphoramidate and aminoalkylphosphoramidate), phosphorothioate (P=S), chiral phosphorothioate, phosphorodithioate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, and boranophosphate. In one embodiment, the modified internucleotide linkage is a 2'-5' phosphodiester linkage. In other embodiments, the modified internucleotide linkage is a non-phosphorus-containing internucleotide linkage, and thus may be referred to as a modified internucleoside linkage. Such non-phosphorus-containing linkages include, but are not limited to, morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane linkages (-O-Si(H)2-O-); sulfide, sulfoxide and sulfone linkages; formacetyl and thioformacetyl linkages; alkene-containing backbones; sulfamate backbones; methylenemethylimino (-CH2-N(CH3)-O-CH2-) and methylenehydrazino linkages; sulfonate and sulfonamide linkages; amide linkages; and others having mixed N, O, S and CH2 component moieties. In one embodiment, the modified internucleoside linkage is a peptide-based linkage (e.g., aminoethylglycine) to generate peptide nucleic acids or PNAs as described in U.S. Pat. Nos. 5,539,082, 5,714,331, and 5,719,262.Other suitable modified internucleotide and internucleoside linkages that can be used in oligonucleotide compounds are described in U.S. Pat. No. 6,693,187, U.S. Pat. No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol. 19:937-954, 2012, all of which are incorporated by reference in their entireties.
[0046] In certain embodiments, the oligonucleotide compound used in the method of the present invention comprises one or more phosphorothioate internucleotide linkages. In some embodiments, the oligonucleotide compound comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages. In embodiments where the oligonucleotide compound is double-stranded (e.g., the oligonucleotide compound comprises siRNA), the phosphorothioate internucleotide linkages can be present in the sense strand, the antisense strand, or both strands of the oligonucleotide compound. For example, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In yet other embodiments, both strands comprise 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. The oligonucleotide compound may contain one or more phosphorothioate internucleotide linkages at the 3'-terminus, 5'-terminus, or both the 3'-terminus and 5'-terminus of the sense strand, the antisense strand, or both strands. For example, in certain embodiments, the oligonucleotide compound contains from about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 3'-terminus of the sense strand, the antisense strand, or both strands. In other embodiments, the oligonucleotide compound contains from about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 5'-terminus of the sense strand, the antisense strand, or both strands. In one particular embodiment, the antisense strand contains at least one but not more than 6 phosphorothioate internucleotide linkages and the sense strand contains at least one but not more than 4 phosphorothioate internucleotide linkages. In another specific embodiment, the antisense strand contains at least one but not more than four phosphorothioate internucleotide linkages and the sense strand contains at least one but not more than two phosphorothioate internucleotide linkages.
[0047] In some embodiments, the oligonucleotide compound comprises a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3' end of the sense strand. In other embodiments, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3' end of the sense strand. In one embodiment, the oligonucleotide compound comprises a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3' end of the sense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3' end of the antisense strand. In another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3' end of the antisense strand (i.e., phosphorothioate internucleotide linkages at the first and second internucleotide linkages at the 3' end of the antisense strand). In another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3' end and the 5' end of the antisense strand. In yet another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide linkages at the 5'-end of the sense strand. In yet another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3'-end of the sense strand.In another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end of the sense strand (i.e., phosphorothioate internucleotide linkages at the first and second internucleotide linkages at both the 5'-end and 3'-end of the antisense strand and phosphorothioate internucleotide linkages at the first and second internucleotide linkages at both the 5'-end and 3'-end of the sense strand). In yet another embodiment, the oligonucleotide compound comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotide at the 3'-end of the sense strand. In any of the embodiments in which one or both strands comprise one or more phosphorothioate internucleotide linkages, the remaining internucleotide linkages within the strands may be natural 3'-5' phosphodiester linkages. For example, in some embodiments, each internucleotide bond of sense strand and antisense strand is selected from phosphodiester and phosphorothioate, and at least one internucleotide bond is phosphorothioate.Similarly, in the embodiment where the oligonucleotide compound comprises or consists of a single oligonucleotide (e.g., single-stranded antisense oligonucleotide), each internucleotide bond in the oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleotide bond is phosphorothioate.In other embodiments, all internucleotide bonds in single-stranded oligonucleotide are phosphorothioate internucleotide bonds.
[0048] In embodiments where the oligonucleotide compound comprises a nucleotide overhang, two or more of the unpaired nucleotides of the overhang can be linked by phosphorothioate internucleotide bonds. In certain embodiments, all of the unpaired nucleotides of the nucleotide overhang at the 3' end of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide bonds. In other embodiments, all of the unpaired nucleotides of the nucleotide overhang at the 5' end of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide bonds. In yet other embodiments, all of the unpaired nucleotides of any nucleotide overhang are linked by phosphorothioate internucleotide bonds.
[0049] Modified nucleotides that can be incorporated into oligonucleotide compounds used in the methods of the invention can have two or more chemical modifications described herein. For example, modified nucleotides can have modifications of the nucleobase as well as modifications of the ribose sugar. By way of example, modified nucleotides can include a 2' sugar modification (e.g., 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, or BNA) and can include a modified base (e.g., 5-methylcytosine or pseudouracil). In other embodiments, modified nucleotides can include a sugar modification in combination with a modification of the 5' phosphate to generate a modified internucleotide or internucleoside linkage when incorporated into a polynucleotide. For example, in some embodiments, modified nucleotides can include a sugar modification, such as a 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, or bicyclic sugar modification, and a 5' phosphorothioate group. Thus, in some embodiments, one or both oligonucleotides of the oligonucleotide compounds used in the methods of the invention include a combination of a 2' modified nucleotide or BNA and a phosphorothioate internucleotide linkage. In certain embodiments, both the sense and antisense strands of a double-stranded oligonucleotide compound contain a combination of 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, and phosphorothioate internucleotide linkages.
[0050] The oligonucleotide compounds used in the method of the present invention can be easily prepared using techniques known in the art, for example, using conventional solid-phase nucleic acid synthesis.The oligonucleotides of the oligonucleotide compounds can be assembled using standard nucleotide or nucleoside precursors (e.g., phosphoramidites) in a suitable nucleic acid synthesizer.Automatic nucleic acid synthesizers are commercially available from several vendors, including the DNA / RNA synthesizer from Applied Biosystems (Foster City, CA), the MerMade synthesizer from BioAutomation (Irving, TX), and the OligoPilot synthesizer from GE Healthcare Life Sciences (Pittsburgh, PA).
[0051] To synthesize oligonucleotides by phosphoramidite chemistry, 2' silyl protecting groups can be used at the 5' position of ribonucleosides, along with acid-labile dimethoxytrityl (DMT). Final deprotection conditions are known that do not significantly degrade the RNA product. All syntheses can be performed on large, medium, or small scale by any automated or manual synthesizer. Syntheses can also be performed in multiple well plates, columns, or glass slides.
[0052] The 2'-O-silyl group can be removed by exposure to fluoride ions, which can include any source of fluoride ions, such as salts containing fluoride ions paired with inorganic counterions, such as cesium fluoride and potassium fluoride, or salts containing fluoride ions paired with organic counterions, such as tetraalkylammonium fluoride. The deprotection reaction can utilize crown ether catalysts in combination with inorganic fluorides. The preferred fluoride ion source is tetrabutylammonium fluoride or aminohydrofluoride (e.g., mixing aqueous HF with triethylamine in a dipolar aprotic solvent such as dimethylformamide).
[0053] The choice of protecting groups for use in the phosphite triesters and phosphotriesters can alter the stability of the triester towards fluoride: methyl protection of the phosphotriester or phosphite triester can stabilize the bond towards fluoride ion and improve process yields.
[0054] Because ribonucleosides have a reactive 2' hydroxyl substituent, it may be desirable to protect the reactive 2' position in the RNA with a protecting group that is orthogonal to the 5'-O-dimethoxytrityl protecting group (e.g., a protecting group that is stable to acid treatment). Silyl protecting groups meet this requirement and can be easily removed in a final fluoride deprotection step, thereby minimizing RNA degradation.
[0055] In standard phosphoramidite coupling reactions, tetrazole catalysts can be used. Preferred catalysts include, for example, tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, p-nitrophenyltetrazole.
[0056] As can be understood by those skilled in the art, further methods of synthesizing the oligonucleotide compounds described herein will be apparent to those skilled in the art. In addition, various synthetic steps may be carried out in an alternative order or sequence to obtain desired compounds. Other synthetic chemical transformations, protecting groups (e.g., for hydroxyl, amino, etc. present in bases), and protecting group methodologies (protection and deprotection) useful in synthesizing the oligonucleotide compounds described herein are known in the art, and include, for example, the methods described in R.Larock, Comprehensive Organic Transformations, VCH Publishers (1989); TWGreene and PGMWuts, Protective Groups in Organic Synthesis, 2d.Ed., John Wiley and Sons (1991); L.Fieser and M.Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L.Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and their subsequent editions. Custom synthesis of oligonucleotide compounds is also available from several commercial vendors, including Dharmacon, Inc. (Lafayette, Colo.), AxoLabs GmbH (Kulmbach, Germany), and Ambion, Inc. (Foster City, Calif.).
[0057] In certain embodiments of the method of the present invention, the oligonucleotide compound is covalently linked to a ligand. As used herein, "ligand" refers to any compound or molecule that specifically or reversibly binds to another compound or molecule to form a complex. The interaction of the ligand with another compound or molecule may elicit a biological response (e.g., triggering a signal transduction cascade, inducing receptor-mediated endocytosis) or may simply be a physical association. In some embodiments, the ligand is a ligand for a receptor expressed on the surface of a cell, such as a cell to which the oligonucleotide compound is intended to be specifically delivered. The ligand can modify one or more properties of the oligonucleotide compound to which it is bound, such as the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties of the oligonucleotide compound.
[0058] Ligands include serum proteins (e.g., human serum albumin, low-density lipoproteins, globulins), cholesterol moieties, vitamins (biotin, vitamin E, vitamin B 12), folate moieties, steroids, bile acids (e.g., cholic acid), fatty acids (e.g., palmitic acid, myristic acid), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), glycosides, phospholipids, or antibodies or binding fragments thereof (e.g., antibodies or binding fragments that target an oligonucleotide compound to a specific cell type, such as the liver). Other examples of ligands include dyes, intercalating agents (e.g., acridines), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl groups, hexadecyl Examples of suitable amines include glycerol, borneol, menthol, 1,3-propanediol, heptadecyl groups, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine), peptides (e.g., antennapedia peptide, Tat peptide, RGD peptide), alkylating agents, polymers such as polyethylene glycols (PEG) (e.g., PEG-40K), polyamino acids, and polyamines (e.g., spermine, spermidine).
[0059] In some embodiments, the ligand comprises a lipid or other hydrophobic molecule. In one embodiment, the ligand comprises a cholesterol moiety or other steroid. Cholesterol-conjugated oligonucleotides have been reported to be more active than their non-conjugated counterparts (Manoharan, Antisense Nucleic Acid Drug Development, Vol. 12: 103-228, 2002). Ligands comprising cholesterol moieties and other lipids for conjugation to nucleic acid molecules are also described in U.S. Patent Nos. 7,851,615; 7,745,608; and 7,833,992, all of which are incorporated herein by reference in their entirety. In another embodiment, the ligand comprises a folate moiety. Oligonucleotides conjugated to a folate moiety can be taken up into cells via receptor-mediated endocytosis pathways. Such folate-oligonucleotide conjugates are described in U.S. Patent No. 8,188,247, which is incorporated herein by reference in its entirety.
[0060] In certain embodiments, the ligand specifically binds to a receptor or other protein expressed on the surface of a target cell to which the oligonucleotide compound is intended to be delivered. In some such embodiments, the ligand is an antibody or antigen-binding fragment thereof (e.g., Fab, scFv) that specifically binds to a cell surface receptor, such as the asialoglycoprotein receptor (ASGPR) or low density lipoprotein (LDL) receptor for delivery to the liver, the transferrin receptor for delivery to skeletal muscle, cardiac muscle, and the central nervous system, and the epidermal growth factor receptor for delivery to tumor tissue.
[0061] In some embodiments of the method of the present invention, the oligonucleotide compound is covalently linked to a ligand of a receptor expressed on the surface of liver cells, such as hepatocytes. In one such embodiment, the oligonucleotide compound is covalently linked to a ligand that binds to ASGPR or its components (e.g., ASGR1, ASGR2). In a particular embodiment, the ligand comprises an antibody or binding fragment thereof that specifically binds to ASGR1 and / or ASGR2. In another embodiment, the ligand comprises a Fab fragment of an antibody that specifically binds to ASGR1 and / or ASGR2. A "Fab fragment" is composed of one immunoglobulin light chain (i.e., the light chain variable region (VL) and constant region (CL)) and one immunoglobulin heavy chain CH1 region and variable region (VH). In another embodiment, the ligand comprises a single chain variable antibody fragment (scFv fragment) of an antibody that specifically binds to ASGR1 and / or ASGR2. An "scFv fragment" comprises the VH and VL regions of an antibody, which are present in a single polypeptide chain, and optionally includes a peptide linker between the VH and VL regions, which allows the Fv to form the desired structure for antigen binding. Exemplary antibodies and binding fragments thereof that specifically bind ASGR1 and can be used as ligands for targeting oligonucleotide compounds to the liver are described in WO 2017 / 058944, which is incorporated by reference in its entirety. Other antibodies or binding fragments thereof that specifically bind ASGR1, LDL receptor, or other liver surface expressed proteins suitable for use as ligands that can be covalently attached to oligonucleotide compounds used in the methods of the invention are commercially available.
[0062] In certain embodiments, the ligand comprises a carbohydrate. "Carbohydrate" refers to a compound composed of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched or cyclic) and containing an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Carbohydrates include, but are not limited to, sugars (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. In some embodiments, the carbohydrate incorporated into the ligand is a monosaccharide selected from pentose, hexose, or heptose, as well as disaccharides and trisaccharides containing such monosaccharide units. In other embodiments, the carbohydrate incorporated into the ligand is an amino sugar, such as galactosamine, glucosamine, N-acetylgalactosamine, and N-acetylglucosamine.
[0063] In some embodiments, the ligand comprises a hexose or hexosamine. The hexose may be selected from glucose, galactose, mannose, fucose, or fructose. The hexosamine may be selected from fructosamine, galactosamine, glucosamine, or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine, or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine, or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine. In certain embodiments, the ligand comprises N-acetyl-galactosamine. Ligands comprising glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective in targeting compounds to liver cells, since such ligands bind to ASGPR expressed on the surface of liver cells. See, e.g., D'Souza and Devarajan, J. Control Release, Vol. 203:126-139, 2015. Examples of GalNAc or galactose-containing ligands that can be covalently attached to oligonucleotides of oligonucleotide compounds are described in U.S. Patent Nos. 7,491,805; 8,106,022; and 8,877,917; U.S. Patent Publication No. 20030130186; and WO 2013166155, all of which are incorporated herein by reference in their entireties.
[0064] In certain embodiments, the ligand comprises a multivalent carbohydrate moiety. As used herein, a "multivalent carbohydrate moiety" refers to a moiety that comprises two or more carbohydrate units that can independently bind or interact with other molecules. For example, a multivalent carbohydrate moiety comprises two or more binding domains composed of carbohydrates that can bind to two or more different molecules, or to two or more different sites on the same molecule. The valency of the carbohydrate moiety indicates the number of individual binding domains within the carbohydrate moiety. For example, the terms "monovalent," "bivalent," "trivalent," and "tetravalent" with respect to a carbohydrate moiety refer to a carbohydrate moiety having one, two, three, and four binding domains, respectively. A multivalent carbohydrate moiety can comprise a multivalent lactose moiety, a multivalent galactose moiety, a multivalent glucose moiety, a multivalent N-acetyl-galactosamine moiety, a multivalent N-acetyl-glucosamine moiety, a multivalent mannose moiety, or a multivalent fucose moiety. In some embodiments, the ligand comprises a multivalent galactose moiety. In other embodiments, the ligand comprises a multivalent N-acetyl-galactosamine moiety. In these and other embodiments, the multivalent carbohydrate moiety can be bivalent, trivalent, or tetravalent. In such embodiments, the polyvalent carbohydrate moiety can be biantennary or triantennary. In a particular embodiment, the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent. In another particular embodiment, the polyvalent galactose moiety is trivalent or tetravalent. Exemplary trivalent or tetravalent GalNAc-containing ligands for covalent attachment to oligonucleotide compounds used in the methods of the invention are described in detail below.
[0065] The ligand may be directly or indirectly covalently attached or conjugated to the oligonucleotide compound. For example, in some embodiments where the oligonucleotide compound is double stranded (e.g., the oligonucleotide compound comprises an siRNA), the ligand is directly covalently attached to the sense strand or antisense strand of the oligonucleotide compound. In other embodiments, the ligand is covalently attached to the sense strand or antisense strand of the oligonucleotide compound via a linker. The ligand may be attached to the nucleobase, sugar moiety, or internucleotide bond of the oligonucleotide contained in the oligonucleotide compound used in the method of the present invention. Conjugation or attachment to the purine nucleobase or its derivative may occur at any position, including endocyclic and exocyclic atoms. In certain embodiments, the 2-, 6-, 7-, or 8-position of the purine nucleobase is attached to the ligand. Conjugation or attachment to the pyrimidine nucleobase or its derivative may also occur at any position. In some embodiments, the 2-, 5-, and 6-position of the pyrimidine nucleobase may be attached to the ligand. Conjugation or attachment to the sugar moiety of the nucleotide may occur at any carbon atom. Exemplary carbon atoms of the sugar moiety that may be attached to the ligand include the 2', 3', and 5' carbon atoms. For example, in abasic nucleotides, the 1' position can also be linked to a ligand. The internucleotide bond can also support the binding of a ligand. In the case of phosphorus-containing bonds (e.g., phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, etc.), the ligand can be directly linked to the phosphorus atom or to an O, N, or S atom linked to the phosphorus atom. In the case of amine- or amide-containing internucleoside bonds (e.g., PNA), the ligand can be linked to the nitrogen atom of the amine or amide or to the adjacent carbon atom.
[0066] In some embodiments, the ligand may be attached to the 3'-end or 5'-end of a single-stranded oligonucleotide compound (e.g., a single-stranded antisense oligonucleotide). In embodiments where the oligonucleotide compound is double-stranded (e.g., the oligonucleotide compound comprises an siRNA), the ligand may be attached to the 3'-end or 5'-end of either the sense strand or the antisense strand. In certain embodiments, the ligand is covalently attached to the 5'-end of the sense strand. In such embodiments, the ligand is attached to the 5'-terminal nucleotide of the sense strand. In these and other embodiments, the ligand is attached at the 5'-position of the 5'-terminal nucleotide of the sense strand. In other embodiments, the ligand is covalently attached to the 3'-end of the sense strand. For example, in some embodiments, the ligand is attached to the 3'-terminal nucleotide of the sense strand. In certain such embodiments, the ligand is attached at the 3'-position of the 3'-terminal nucleotide of the sense strand. In alternative embodiments, the ligand is attached near the 3'-end of the sense strand but before one or more terminal nucleotides (i.e., before 1, 2, 3 or 4 terminal nucleotides). In some embodiments, the ligand is attached at the 2' position of the sugar of the 3'-terminal nucleotide of the sense strand, hi other embodiments, the ligand is attached at the 2' position of the sugar of the 5'-terminal nucleotide of the sense strand.
[0067] In certain embodiments, the ligand is attached to the oligonucleotide compound via a linker. A "linker" is an atom or group of atoms that covalently attaches the ligand to the oligonucleotide component of the oligonucleotide compound. The linker can be about 1 to about 30 atoms in length, about 2 to about 28 atoms in length, about 3 to about 26 atoms in length, about 4 to about 24 atoms in length, about 6 to about 20 atoms in length, about 7 to about 20 atoms in length, about 8 to about 20 atoms in length, about 8 to about 18 atoms in length, about 10 to about 18 atoms in length, and about 12 to about 18 atoms in length. In some embodiments, the linker can include a bifunctional linking moiety, which generally includes an alkyl moiety having two functional groups. One of the functional groups is selected to bind to a compound of interest (e.g., an oligonucleotide of an oligonucleotide compound), and the other is selected to substantially bind to any selected group, such as a ligand, as described herein. In certain embodiments, the linker includes a chain structure or oligomer consisting of repeating units, such as ethylene glycol units or amino acid units. Examples of functional groups typically used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturation (e.g., double or triple bonds), and the like.
[0068] Linkers that can be used to attach a ligand to the oligonucleotide of the oligonucleotide compound used in the method of the invention include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 6-aminohexanoic acid, substituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Preferred substituents for such linkers include, but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0069] In certain embodiments, the linker is cleavable. The cleavable linker is sufficiently stable outside the cell, but is cleaved upon entering the target cell, releasing the two moieties that the linker holds together. In some embodiments, the cleavable linker is cleaved at least 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least 100 times faster in the target cell or under a first reference condition (e.g., which can be selected to mimic or correspond to intracellular conditions) than in the subject's blood or under a second reference condition (e.g., which can be selected to mimic or correspond to conditions found in blood or serum).
[0070] Cleavable linkers are sensitive to cleavage agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleavage agents are found to be more prevalent or at higher levels or activity inside cells than in serum or blood. Examples of such degradable agents include redox agents that are selected for a specific substrate or have no substrate specificity, such as oxidases or reductases, or reducing agents such as mercaptans that are present inside cells and can degrade redox cleavable linkers by reduction; esterases; agents that can generate endosomes or acidic environments, such as those that result in a pH of 5 or less; enzymes that can hydrolyze or degrade acid cleavable linkers by acting as general acids, peptidases (which can be substrate specific), and phosphatases.
[0071] The cleavable linker may contain a moiety that is sensitive to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have a cleavable group that is cleaved at a preferred pH, thereby releasing the oligonucleotide compound from the ligand to the interior of the cell or to a desired compartment of the cell.
[0072] The linker may contain a cleavable group that can be cleaved by a specific enzyme. The type of cleavable group incorporated into the linker may depend on the cell to be targeted. For example, a liver targeting ligand may be attached to an oligonucleotide compound via a linker that contains an ester group. Since liver cells are rich in esterases, the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterases. Other types of cells that are rich in esterases include lung, renal cortex and testis cells. When targeting cells that are rich in peptidases, such as liver cells and synovial cells, a linker containing a peptide bond may be used.
[0073] In general, the suitability of a candidate cleavable linker can be evaluated by testing the ability (or conditions) of a degrading agent to cleave the candidate linker. It is also desirable to test the candidate cleavable linker for its ability to resist cleavage when in blood or in contact with other non-target tissues. Thus, the relative susceptibility to cleavage can be determined between a first condition selected to exhibit cleavage in target cells and a second condition selected to exhibit cleavage in other tissues or body fluids, such as blood or serum. Evaluation can be performed in a cell-free system, cells, cell cultures, organs or tissue cultures, or in whole animals. It can be useful to perform an initial evaluation in a cell-free or cultured condition, and then confirm by further evaluation in a whole animal. In some embodiments, a useful candidate linker is cleaved at least 2-fold, 4-fold, 10-fold, 20-fold, 50-fold, 70-fold, or 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0074] In other embodiments, redox cleavable linkers are utilized. Redox cleavable linkers are cleaved when reduced or oxidized. One example of a reductively cleavable group is a disulfide linking group (-SS-). To determine whether a candidate cleavable linker is a suitable "reductively cleavable linker" or suitable for use with, for example, a particular oligonucleotide compound and a particular ligand, one or more methods described herein can be used. For example, a candidate linker can be evaluated by incubating with dithiothreitol (DTT) or other reducing agents known in the art that mimic the cleavage rate that would be observed in cells (e.g., target cells). Candidate linkers can also be evaluated under conditions selected to mimic blood or serum conditions. In certain embodiments, the candidate linker is cleaved at up to 10% in blood.
[0075] In yet other embodiments, a phosphate-based cleavable linker is utilized to covalently attach a ligand to an oligonucleotide of an oligonucleotide compound, which is cleaved by an agent that degrades or hydrolyzes the phosphate group. One example of an agent that hydrolyzes phosphate groups within a cell is an enzyme such as a phosphatase within the cell. Examples of phosphate based cleavable groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, and -OP(S)(Rk)-S-, where Rk can be hydrogen or alkyl. Particular embodiments include -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-. Another particular embodiment is -OP(O)(OH)-O-. These linker candidates can be evaluated using methods similar to those described above.
[0076] In other embodiments, the linker may include an acid-cleavable group, which is a group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable group is cleaved in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less) or by an agent such as an enzyme that can act as a general acid. Within a cell, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for the acid-cleavable group. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups may have the general formula -C=NN-, C(O)O, or -OC(O). A particular embodiment is where the carbon attached to the oxygen (alkoxy group) of the ester is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethyl, pentyl, or t-butyl. These candidates can be evaluated using methods similar to those described above.
[0077] In other embodiments, the linker may include an ester-based cleavable group that is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable groups have the general formula -C(O)O- or -OC(O)-. These linker candidates can be evaluated using methods similar to those described above.
[0078] In further embodiments, the linker may include a peptidic cleavable group that is cleaved by enzymes such as peptidases and proteases in cells. Peptidic cleavable groups are peptide bonds formed between amino acids to give rise to oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptidic cleavable groups include amide groups (-C(O)NH-). Amide groups can be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to give rise to peptides and proteins. Peptidic cleavable groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give rise to peptides and proteins. Peptidic cleavable linking groups have the general formula -NHCHR A C(O)NHCHR B C(O)—, where R A and R B are the side chains of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.
[0079] Other types of linkers suitable for attaching ligands to the oligonucleotides of the oligonucleotide compounds used in the methods of the invention are known in the art and can include those described in U.S. Pat. Nos. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551, all of which are incorporated herein by reference in their entireties.
[0080] In certain embodiments, the ligand covalently attached to the oligonucleotide of the oligonucleotide compound comprises a GalNAc moiety, e.g., a multivalent GalNAc moiety. In some embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 3'-end of the oligonucleotide (e.g., the sense strand of a double-stranded oligonucleotide compound). In other embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 5'-end of the oligonucleotide (e.g., the sense strand of a double-stranded oligonucleotide compound). In still other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 3'-end of the oligonucleotide (e.g., the sense strand of a double-stranded oligonucleotide compound). In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 5'-end of the oligonucleotide (e.g., the sense strand of a double-stranded oligonucleotide compound).
[0081] Exemplary trivalent and tetravalent GalNAc moieties and linkers that can be attached to the oligonucleotides of the oligonucleotide compounds used in the methods of the invention are shown below in structural formulas I-IX, where "Ac" in the formulas listed herein represents an acetyl group.
[0082] In one embodiment, an oligonucleotide compound comprises a ligand and a linker having the structure of Formula I below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and j is 1 or 2, and the ligand is attached to the 3' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line) of the oligonucleotide compound. [ka]
[0083] In another embodiment, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula II below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and j is 1 or 2, and the ligand is attached to the 3' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line) of the oligonucleotide compound. [ka]
[0084] In yet another embodiment, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula III below, where the ligand is attached to the 3' end of the oligonucleotide of the oligonucleotide compound (e.g., the sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line). [ka]
[0085] In yet another embodiment, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula IV below, wherein the ligand is attached to the 3' end of an oligonucleotide of the oligonucleotide compound (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line). [ka]
[0086] In certain embodiments, an oligonucleotide compound comprises a ligand and a linker having the structure of Formula V below, where each n is independently 1 to 3 and k is 1 to 3, and the ligand is attached to the 5' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line) of the oligonucleotide compound. [ka]
[0087] In other embodiments, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula VI below, where each n is independently 1 to 3 and k is 1 to 3, and the ligand is attached to the 5' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line) of the oligonucleotide compound. [ka]
[0088] In one particular embodiment, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula VII below, where X=O or S, and the ligand is attached to the 5' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a wavy line) of the oligonucleotide compound. [ka]
[0089] In some embodiments, the oligonucleotide compound comprises a ligand and a linker having the structure of Formula VIII below, where each n is independently 1 to 3, and the ligand is attached to the 5' end of an oligonucleotide (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line) of the oligonucleotide compound. [ka]
[0090] In certain embodiments, an oligonucleotide compound comprises a ligand and a linker having the structure of Formula IX below, where the ligand is attached to the 5' end of an oligonucleotide of the oligonucleotide compound (e.g., a sense strand of a double-stranded oligonucleotide compound) (represented by a solid wavy line). [ka]
[0091] To covalently attach the ligand and linker to the oligonucleotide, phosphorothioate linkages may be substituted for the phosphodiester linkages shown in any one of Formulas I-IX.
[0092] The method of the present invention comprises inhibiting the expression or activity of suppressor protein in a cell.As used herein, suppressor protein refers to the presence or activity of a protein that reduces or inhibits the gene silencing activity of an oligonucleotide compound.In certain embodiments, suppressor protein reduces or prevents the gene silencing activity of the ligand-conjugated oligonucleotide compound that is internalized by receptor-mediated endocytosis by negatively regulating intracellular vesicular trafficking, particularly endosomal trafficking. In some embodiments of the methods of the invention, the suppressor protein is selected from the group consisting of Ras-associated protein Rab-18 (RAB18), Zw10 kinetochore protein (ZW10), syntaxin 18 (STX18), Sec1 family domain-containing protein 2 (SCFD2), NSF attachment protein gamma (NAPG), sterile alpha motif domain-containing protein 4B (SAMD4B), vacuolar protein sorting-associated protein 37A (VPS37A), yes-associated protein 1 (YAP1), cyclin E1 (CCNE1), solute carrier family 30 member 9 protein (SLC30A9), tubulin epsilon and delta complex protein 1 (TFA1), and / or cyclooxygenase 1 (KAP1). 1) (TEDC1; also known as C14orf80), hypoxia-inducible factor 1-alpha inhibitor protein (HIF1AN), or TNF receptor-associated factor 2 (TRAF2). In certain embodiments, the suppressor protein is RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, or VPS37A. In certain other embodiments, the suppressor protein is RAB18, ZW10, or STX18.In one particular embodiment of the method of the present invention, the suppressor protein is RAB18.
[0093] The expression or activity of the suppressor protein can be inhibited by contacting a cell with an inhibitor of the suppressor protein that reduces the intracellular amount or activity of the suppressor protein by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to the intracellular amount or activity of the suppressor protein in a cell not contacted with the inhibitor. In certain embodiments, an inhibitor of a suppressor protein reduces the intracellular amount or activity of the suppressor protein by about 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% compared to the intracellular amount or activity of the suppressor protein in a cell not contacted with the inhibitor. In one embodiment, the suppressor protein reduces the intracellular amount or activity of the suppressor protein by at least 75% compared to the intracellular amount or activity of the suppressor protein in a cell not contacted with the inhibitor. In another embodiment, the suppressor protein reduces the intracellular amount or activity of the suppressor protein by at least 80% compared to the intracellular amount or activity of the suppressor protein in a cell not contacted with the inhibitor. In another embodiment, the suppressor protein reduces the intracellular amount or activity of the suppressor protein by at least 90% compared to the intracellular amount or activity of the suppressor protein in a cell not contacted with the inhibitor.
[0094] In certain embodiments of the methods of the present invention, the inhibitor of the suppressor protein can be an oligonucleotide-based inhibitor that reduces the expression of a nucleic acid (e.g., mRNA) encoding the suppressor protein. For example, in some embodiments, the inhibitor of the suppressor protein is an oligonucleotide compound as described herein, where the oligonucleotide compound comprises a sequence substantially or completely complementary to the mRNA sequence encoding the suppressor protein. In some such embodiments, the oligonucleotide compound can be a single-stranded antisense oligonucleotide comprising a sequence substantially or completely complementary to the mRNA sequence encoding the suppressor protein. In other embodiments, the inhibitor of the suppressor protein is a double-stranded oligonucleotide compound, such as an siRNA or shRNA as described herein. In one embodiment, the double-stranded oligonucleotide compound is an siRNA molecule comprising a sense strand and an antisense strand, where the antisense strand comprises a sequence substantially or completely complementary to the mRNA sequence encoding the suppressor protein. In another embodiment, the double-stranded oligonucleotide compound is an shRNA molecule comprising a sense strand and an antisense strand bound together by a loop region, where the antisense strand comprises a sequence substantially or completely complementary to the mRNA sequence encoding the suppressor protein.
[0095] The mRNA sequence encoding the suppressor protein can be any messenger RNA sequence, such as allelic variants and splice variants, encoding the suppressor protein, including variants or isoforms of the suppressor protein from any species (e.g., non-human primates, human). The mRNA sequence encoding the suppressor protein also includes the transcript sequence expressed as its complementary DNA (cDNA) sequence. A cDNA sequence refers to the sequence of the mRNA transcript expressed as DNA bases (e.g., guanine, adenine, thymine, and cytosine) rather than RNA bases (e.g., guanine, adenine, uracil, and cytosine). Thus, in some embodiments, the inhibitor of the suppressor protein can be an oligonucleotide compound that includes a region having a sequence substantially or completely complementary to the mRNA sequence or cDNA sequence encoding the suppressor protein. References in the Ensembl Genome database or the National Center for Biotechnology Information (NCBI) database for exemplary mRNA and cDNA sequences of selected suppressor proteins to which oligonucleotide compounds may be substantially or perfectly complementary are listed in Table 1 below.
[0096] [Table 1]
[0097] In some embodiments of the methods of the present invention, the suppressor protein is RAB18, and the inhibitor of RAB18 is a single-stranded antisense oligonucleotide comprising or consisting of a nucleotide sequence selected from SEQ ID NOs: 8-10, 5'-UUUAGCCUUAUUUCCAUCC-3' (SEQ ID NO: 25), 5'-AACGUAUCAUCUGUGAACC-3' (SEQ ID NO: 26), 5'-AUCGACUUCACGAUUUUCC-3' (SEQ ID NO: 27), 5'-CCUCUAUAAUAGCUGGGAGUUA-3' (SEQ ID NO: 28), and 5'-CCCUGUGCACCUCUAUAAUAGC-3' (SEQ ID NO: 29). In certain embodiments, the inhibitor of RAB18 is a single-stranded antisense oligonucleotide comprising or consisting of a nucleotide sequence of any one of SEQ ID NOs: 25-29, in which thymine is replaced by uracil. In other embodiments, the suppressor protein is RAB18 and the inhibitor of RAB18 is an siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises or consists of a nucleotide sequence selected from SEQ ID NOs: 8-10 and 25-29. In such embodiments, the nucleotide sequence of the sense strand is substantially or completely complementary to the sequence of the antisense strand. In certain embodiments, the inhibitor of RAB18 is an siRNA comprising a sense strand and an antisense strand, wherein (i) the sense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 5 and the antisense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 8, (ii) the sense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 6 and the antisense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 9, or (iii) the sense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 7 and the antisense strand comprises or consists of the nucleotide sequence of SEQ ID NO: 10.
[0098] In some embodiments of the methods of the present invention, inhibiting expression or activity of a suppressor protein in a cell may include modifying a gene encoding the suppressor protein using any suitable known genome editing technique, including but not limited to CRISPR-Cas-based methods, transcription activator-like effector nuclease (TALEN)-based methods, and zinc finger nuclease (ZFN)-based methods (see, for example, Porteus, Annual Review of Pharmacology and Toxicology, Vol. 56: 163-190, 2016; Maeder and Gersbach, Mol Ther., Vol. 24; 430-446, 2016). The gene encoding the suppressor protein may be modified such that the gene encodes a variant of the suppressor protein with reduced activity or function, or the gene may be modified to completely eliminate expression of the gene (i.e., to knock out the gene). Thus, in such embodiments, the inhibitor of the suppressor protein may be a gene modifying agent. Depending on the genome editing technology used, the genetic modification agent may include a nuclease (e.g., Cas nuclease, TALEN, or ZFN), or a vector encoding a nuclease and / or a guide RNA. Guide RNA refers to a polynucleotide that includes a sequence that has sufficient complementarity with a target nucleic acid sequence to hybridize to the target sequence and induce sequence-specific binding of Cas nuclease to the target sequence. In the case of TALEN-based or ZFN-based methods, the nuclease is engineered to recognize a portion of a gene sequence that encodes a suppressor protein, such as any of the sequences listed in Table 1. In an embodiment in which the CRISPR-Cas system is used to modify a gene encoding a suppressor protein, the guide RNA includes a sequence that is complementary to a portion of a gene sequence that encodes a suppressor protein, such as any of the sequences listed in Table 1.Methods for designing guide RNAs to modify target gene sequences are known to those skilled in the art, for example, those described in Mohr et al., The FEBS Journal, Vol. 283; 3232-3238, 2016 and Brazelton et al., GM Crops & Food, Vol. 6; 266-276, 2015. In certain embodiments, the inhibitor of the suppressor protein is a genetic modification agent comprising a Cas nuclease or a vector / nucleic acid encoding a Cas nuclease and a guide RNA comprising a sequence complementary to a portion of the gene sequence encoding the suppressor protein. As further described herein, the genetic modification agent can be delivered into the cell using a viral vector encoding both the nuclease or Cas nuclease and the guide RNA when used in the CRISPR-Cas system, as well as by a lipid-based delivery vehicle capable of packaging the nuclease or Cas nuclease-guide RNA complex.
[0099] In some embodiments of the methods of the invention, the suppressor protein is RAB18 and the inhibitor of RAB18 is a genetic modification agent comprising a guide RNA having a sequence complementary to the sequence of SEQ ID NO: 11 or SEQ ID NO: 12. In related embodiments, the inhibitor of RAB18 is a genetic modification agent comprising a guide RNA comprising a sequence selected from SEQ ID NOs: 8-10 and 25-29. In any of the foregoing embodiments, the genetic modification agent may further comprise a Cas nuclease or a vector / nucleic acid encoding a Cas nuclease.
[0100] In certain embodiments, the present invention provides a method for enhancing the silencing activity of an oligonucleotide compound in a cell, comprising contacting the cell with an inhibitor of a suppressor protein, such as any inhibitor described herein or known in the art, and inhibiting the expression or activity of a suppressor protein in the cell by contacting the cell with an oligonucleotide compound.Enhancing the silencing activity of an oligonucleotide compound, such as any of the oligonucleotide compounds described herein, means that the silencing activity is increased in the cell in terms of the level of reduction in gene expression, the duration of reduction, and / or the potency of reduction, compared to the silencing activity of the oligonucleotide compound in a cell in which the expression or activity of the suppressor protein is not inhibited or in a cell that has not been contacted with an inhibitor of the suppressor protein.The silencing activity of the oligonucleotide compound can be enhanced by the method of the present invention by at least 2-fold, at least 4-fold, at least 8-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 30-fold, compared to the silencing activity of the oligonucleotide compound in a cell in which the expression or activity of the suppressor protein is not inhibited or in a cell that has not been contacted with an inhibitor of the suppressor protein. The silencing activity of oligonucleotide compounds can be evaluated by measuring the amount of expression of target gene in the presence of oligonucleotide compounds compared to the amount of expression of target gene in cells in the absence of oligonucleotide compounds.The expression of target gene can be evaluated by measuring the amount or level of target mRNA, target protein, or another biomarker associated with the expression of target gene, as described further below.
[0101] As described in the Examples herein, inhibiting or eliminating expression of a suppressor protein (e.g., RAB18) significantly increases the level of target gene knockdown mediated by ligand-conjugated oligonucleotide compounds, thereby making it possible to reduce the expression of even highly abundant proteins that are not normally able to be silenced using oligonucleotide compounds. Thus, the present invention also includes a method of reducing expression of a target gene in a cell, comprising contacting the cell with an inhibitor of a suppressor protein as described herein and contacting the cell with an oligonucleotide compound, such as an oligonucleotide compound described herein, wherein the oligonucleotide compound comprises a sequence substantially or completely complementary to the sequence of the target gene. The cell can be in vitro or in vivo. In some embodiments, the cell is present in a subject (e.g., a human subject) in need of reducing expression of the target gene. The cell can be a cell that naturally expresses the target gene, or a cell or cell line that has been genetically engineered to express the target gene. In some embodiments, the cell is a mammalian cell or a mammalian cell line. The cell may be any tissue type that expresses the target gene, including, but not limited to, adipocytes, epithelial cells, neurons, glial cells, cardiomyocytes, skeletal muscle cells, pancreatic beta cells, macrophages, B cells, tumor cells, or hepatocytes. In certain embodiments, the cell is a hepatocyte, such as a primary hepatocyte. In other embodiments, the cell is a liver cell line, such as a HepAD38 cell, a HuH-6 cell, a HuH-7 cell, a HuH-5-2 cell, a BNLCL2 cell, a Hep3B cell, or a HepG2 cell. In one embodiment, the cell is a Hep3B cell.
[0102] The reduction of target gene expression in cells or animals contacted with oligonucleotide compounds according to the method of the present invention can be compared with the target gene expression in cells or animals that are not contacted with oligonucleotide compounds or that are contacted with a control oligonucleotide compound.For example, in some embodiments, the reduction of target gene expression is evaluated by (a) measuring the amount or level of target mRNA in cells contacted with oligonucleotide compounds according to the method of the present invention, (b) measuring the amount or level of target mRNA in cells contacted with a control oligonucleotide compound (e.g., an RNA molecule that is not expressed in cells, or an oligonucleotide compound that is derived from an oligonucleotide compound with a nonsense sequence or a scrambled sequence) or in cells that do not contain a compound, and (c) comparing the measured target mRNA level from the cells treated in (a) with the measured target mRNA level from the control cells in (b).Before comparison, the target mRNA level in treated cells and control cells can be normalized to the RNA level of a control gene (e.g., 18S ribosomal RNA or a housekeeping gene). Target mRNA levels can be measured by a variety of methods, including Northern blot analysis, nuclease protection assays, fluorescent in situ hybridization (FISH), reverse transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, droplet digital PCR, and others.
[0103] In another embodiment, the reduction of target gene expression is evaluated by (a) measuring the amount or level of target protein in cells contacted with the oligonucleotide compound according to the method of the present invention, (b) measuring the amount or level of target protein in cells contacted with a control oligonucleotide compound (e.g., an RNA molecule that is not expressed in cells, or an oligonucleotide compound that is derived from an oligonucleotide compound with a nonsense sequence or a scrambled sequence), or in cells that do not contain a compound, and (c) comparing the measured target protein from the cells treated with (a) with the measured target protein level from the control cells of (b).Methods for measuring target protein level are known to those skilled in the art, and include Western blot, immunoassay (e.g., ELISA), and flow cytometry.
[0104] The present invention also provides a method for reducing expression of a target gene in a subject in need thereof, comprising administering to the subject an inhibitor of a suppressor protein as described herein and an oligonucleotide compound, such as an oligonucleotide compound described herein, wherein the oligonucleotide compound comprises a sequence substantially or completely complementary to the sequence of the target gene. In some embodiments of the methods of the present invention, expression of the target gene is associated with a disease or disorder, for example, in which overexpression of the gene product or expression of a protein variant or isoform (e.g., a mutated form of the gene product) contributes to a pathological phenotype. In certain embodiments of the methods of the present invention, the target gene is a human gene. Exemplary target genes include, but are not limited to, LPA, PNPLA3, ASGR1, F7, F12, FXI, APOCIII, APOB, APOL1, TTR, PCSK9, HSD17B13, HPRT1, PPIB, EPAS1, DUX4, DMPK, XDH, SCNN1A, SCAP, KRAS, CD274, PDCD1, C3, C5, CFB, ALAS1, GYS1, HAO1, LDHA, ANGPTL3, SERPINA1, ALDH2, AGT, HAMP, LECT2, EGFR, VEGF, KIF11, AT3, CTNNB1, HMGB1, HIF1A, and STAT3. Target genes can also include viral genes, such as hepatitis B and hepatitis C virus genes, human immunodeficiency virus genes, herpes virus genes, and the like. In some embodiments of the method of the present invention, the target gene is a gene encoding human microRNA (miRNA). In certain embodiments of the methods of the present invention, the target gene is a gene expressed in the liver.
[0105] In some embodiments of the method of the present invention, the expression of the target gene is reduced in the cell or subject by at least 50%. In other embodiments of the method of the present invention, the expression of the target gene is reduced in the cell or subject by at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%. In still other embodiments, the expression of the target gene is reduced in the cell or subject by about 90% or more, for example, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more. The reduction in the expression of the target gene can be measured by any of the methods described herein as well as other methods known in the art.
[0106] In certain embodiments of the method of the present invention, the method comprises contacting a cell with an inhibitor of a suppressor protein and a first oligonucleotide compound comprising a sequence substantially or completely complementary to the sequence of a target gene, the first oligonucleotide compound being covalently linked to a ligand of a receptor expressed on the surface of the cell, and the inhibitor of the suppressor protein being a second oligonucleotide compound comprising a sequence substantially or completely complementary to the mRNA sequence encoding the suppressor protein. In some embodiments, the first oligonucleotide compound is a single-stranded antisense oligonucleotide. In other embodiments, the first oligonucleotide compound is an siRNA. In any of the above embodiments, the second oligonucleotide compound is a single-stranded antisense oligonucleotide or an siRNA.
[0107] In certain other embodiments of the method of the present invention, the method comprises administering to a subject an inhibitor of a suppressor protein and a first oligonucleotide compound comprising a sequence substantially or completely complementary to a sequence of a target gene, the first oligonucleotide compound being covalently linked to a first ligand, and the inhibitor of the suppressor protein being a second oligonucleotide compound comprising a sequence substantially or completely complementary to an mRNA sequence encoding the suppressor protein. In some embodiments, the first oligonucleotide compound is a single-stranded antisense oligonucleotide. In other embodiments, the first oligonucleotide compound is an siRNA. In any of the foregoing embodiments, the second oligonucleotide compound is a single-stranded antisense oligonucleotide or an siRNA. In some embodiments, the second oligonucleotide compound is covalently linked to a second ligand. The first ligand, the second ligand, or both the first and second ligands can be any of the ligands described herein. For example, in some embodiments, the first ligand, the second ligand, or both the first and second ligands comprise a cholesterol moiety, a vitamin, a steroid, a bile acid, a folate moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or an antigen-binding fragment thereof. In other embodiments, the first ligand, the second ligand, or both the first and second ligands comprise galactose, galactosamine, or N-acetyl-galactosamine. In one embodiment, the first ligand, the second ligand, or both the first and second ligands comprise a multivalent galactose moiety or a multivalent N-acetyl-galactosamine moiety. In any of the foregoing embodiments, the first ligand covalently attached to the first oligonucleotide compound is the same as the second ligand covalently attached to the second oligonucleotide compound. In some such embodiments, the first and second ligands are ligands of a receptor expressed on the surface of liver cells, such as ASGPR. In other embodiments of the methods of the present invention, the first ligand is different from the second ligand, but both the first ligand and the second ligand are ligands for a receptor expressed on the same cell type.By way of example, the first ligand may comprise a multivalent N-acetyl-galactosamine moiety that is a ligand for the ASGPR expressed on hepatocytes, and the second ligand may comprise a cholesterol moiety that is a ligand for the LDL receptor also expressed on hepatocytes.
[0108] The oligonucleotide compounds and genetic modifying agents described herein can be delivered into cells by a variety of methods, including transfection, viral transduction, lipid-based particles, and conjugation to ligands as further described herein. In some embodiments, the oligonucleotide compounds and / or genetic modifying agents are expressed from vectors. "Vector" refers to any molecule or entity (e.g., nucleic acid, plasmid, bacteriophage, or virus) used to introduce genetic material into a host cell. Examples of vectors include, but are not limited to, plasmids, viral vectors, non-episomal mammalian vectors, and expression vectors, such as recombinant expression vectors. Suitable viral vectors that are preferred in some embodiments include adenoviral vectors, adeno-associated viral vectors, and retroviral vectors, such as lentiviral vectors. The term "expression vector" or "expression construct" as used herein refers to a recombinant nucleic acid molecule that includes a desired target sequence and the appropriate nucleic acid control sequences required to express the operably linked target sequence in a particular cell. Expression vectors may contain, but are not limited to, sequences that affect or control transcription, translation, and, if introns are present, RNA splicing of the coding region operably linked thereto. Nucleic acid sequences necessary for expression in prokaryotes include promoters, optionally enhancer sequences, and termination and polyadenylation signals.
[0109] In some embodiments where the inhibitor of the suppressor protein is an oligonucleotide compound as described herein, the inhibitor of the suppressor protein is delivered into the cell using a vector (e.g., a viral vector) that includes an oligonucleotide operably linked to a promoter (e.g., an RNA pol III promoter) such that the oligonucleotide compound is expressed in the cell. In such embodiments, the oligonucleotide sequence operably linked to the promoter can be an antisense oligonucleotide or shRNA as described above. As used herein, the term "operably linked" refers to two or more nucleic acid sequences being linked together such that a nucleic acid molecule capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule is generated. For example, a control sequence of a vector "operably linked" to a nucleotide sequence is ligated to the nucleotide sequence such that expression of the nucleotide sequence is achieved under conditions compatible with the transcriptional activity of the control sequence. Numerous promoters recognized by a variety of potential host cells are well known to those of skill in the art. For example, suitable promoters for use with mammalian host cells include those obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as adenovirus type 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retroviruses, hepatitis B virus, and simian virus 40 (SV40). In embodiments where the desired product is an oligonucleotide compound or a guide RNA, the promoter can be an RNA pol III promoter, such as a U6 promoter.
[0110] In other embodiments where the inhibitor of the suppressor protein is a genetic modification agent that includes a nuclease, such as a Cas nuclease, ZFN, or TALEN, the nuclease can be delivered to the cell using a vector (e.g., a viral vector) that includes a nucleotide sequence encoding the nuclease operably linked to a promoter suitable for expression in the cell of interest. In embodiments where the genetic modification agent further includes a guide RNA (e.g., when utilizing a CRISPR-Cas genome editing method), the vector can further include a guide RNA expression cassette that includes a guide RNA sequence operably linked to an RNA pol III promoter, such as a U6 promoter. In alternative embodiments, the cell can be contacted with a second vector that includes a guide RNA expression cassette at the same time as or after contacting with a first vector that encodes a nuclease.
[0111] In other embodiments of the method of the present invention, the oligonucleotide compounds and gene modifying agents described herein can be delivered to cells using lipid-based delivery methods. For example, colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes, can be used as delivery vehicles for oligonucleotide compounds and gene modifying agents. Commercially available lipid emulsions suitable for delivering nucleic acids include Intralipid® (Baxter International Inc.), Liposyn® (Abbott Pharmaceuticals), Liposyn® II (Hospira), Liposyn® III (Hospira), Nutrilipid (B. Braun Medical Inc.), and other similar lipid emulsions. A preferred colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The oligonucleotide compounds and / or gene modifying agents can be encapsulated in liposomes or can be complexed with liposomes, particularly cationic liposomes. Alternatively, the oligonucleotide compound and / or gene modifying agent may be complexed with lipids, particularly cationic lipids. Suitable lipids and liposomes include neutral (e.g., dioleoyl phosphatidylethanolamine (DOPE), dimyristoyl phosphatidylcholine (DMPC), and dipalmitoyl phosphatidylcholine (DPPC), distearoyl phosphatidylcholine), negative (e.g., dimyristoyl phosphatidylglycerol (DMPG)), and cationic (e.g., dioleoyl tetramethylaminopropyl (DOTAP) and dioleoyl phosphatidylethanolamine (DOTMA)). The preparation and use of such colloidal dispersions are well known in the art.Exemplary formulations are also disclosed in U.S. Pat. Nos. 5,981,505, 6,217,900; 6,383,512; 5,783,565; 7,202,227; 6,379,965; 6,127,170; 5,837,533; 6,747,014; and WO 03 / 093449.
[0112] In some embodiments, the oligonucleotide compounds and / or genetic modifying agents are fully encapsulated within the lipid formulation to form, for example, SNALP or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle. SNALPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALPs are extremely useful for systemic administration because they exhibit long circulatory life after intravenous injection and accumulate at distal sites (e.g., sites physically separated from the site of administration). Nucleic acid-lipid particles typically have an average diameter of about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm, and are substantially non-toxic. In addition, nucleic acids, when present in nucleic acid-lipid particles, are resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and their preparation methods are disclosed in, for example, U.S. Patent Nos. 5,976,567, 5,981,501, 6,534,484, 6,586,410, 6,815,432 and WO 96 / 40964.Thus, in some embodiments where the inhibitor of suppressor protein is an oligonucleotide compound as described herein, the oligonucleotide compound can be encapsulated in SNALP or other types of liposomes.Similarly, in some embodiments where the inhibitor of suppressor protein is a genetic modification agent that comprises nuclease (e.g., Cas nuclease, ZFN, or TALEN), the mRNA that codes for the nuclease can be incorporated into SNALP or other liposomes, optionally with guide RNA (e.g., when using CRISPR-Cas system).
[0113] In certain preferred embodiments of the method of the present invention, the oligonucleotide compound that targets the gene of interest is delivered to cells in vitro or in vivo by conjugating to the ligand of the receptor expressed on the surface of the cell, as described in detail above.Therefore, in such embodiments, the oligonucleotide compound can be formulated in a pharmaceutical composition that includes one or more pharma-ceutically acceptable excipients.Such compositions are useful for reducing the expression of the target gene in subjects that require it.When clinical application is contemplated, the pharmaceutical composition is prepared in a form that is suitable for the intended use.In general, this requires preparing a composition that is essentially free of pyrogens as well as other impurities that may be harmful to humans or animals.
[0114] The phrase "pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmacologically acceptable excipients" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, and absorption retardants that are acceptable for use in formulating pharmaceuticals, e.g., pharmaceuticals suitable for human administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except where any conventional media or agent is incompatible with the oligonucleotide compound, its use in the therapeutic composition is contemplated. Supplementary active ingredients can also be incorporated into the composition, provided they do not inactivate the oligonucleotide compound of the composition.
[0115] The compositions and methods for formulating pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the type and extent of the disease or disorder to be treated, or the dose to be administered. In some embodiments, the pharmaceutical composition is formulated based on the intended route of delivery. For example, in certain embodiments, the pharmaceutical composition is formulated for parenteral delivery. Parenteral delivery forms include intravenous, intraarterial, subcutaneous, intrathecal, intraperitoneal, or intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery.
[0116] In some embodiments, the pharmaceutical composition comprises an effective amount of the oligonucleotide compound described herein. An "effective amount" is an amount sufficient to produce a beneficial or desired clinical result. In some embodiments, an effective amount is an amount sufficient to reduce the expression of a target gene in a particular tissue or cell type (e.g., liver or hepatocyte) of a subject.
[0117] The administration of the pharmaceutical composition may be via any common route, so long as the target tissue is available via that route. Such routes include, but are not limited to, parenteral (e.g., subcutaneous, intramuscular, intraperitoneal, or intravenous), oral, nasal, buccal, intradermal, transdermal, and sublingual routes, or direct injection into the target tissue (e.g., liver tissue) or delivery via the hepatic portal vein. In some embodiments, the pharmaceutical composition is administered parenterally. For example, in certain embodiments, the pharmaceutical composition is administered intravenously. In other embodiments, the pharmaceutical composition is administered subcutaneously.
[0118] Pharmaceutical compositions suitable for injection use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that they are easily syringable. Preparations must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Suitable solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0119] Sterile injection solution can be prepared by incorporating active compound in appropriate amount with any other desired components (for example, as listed above) in solvent, followed by sterilization by filtration.Generally, dispersion is prepared by incorporating various sterilized active components into a sterile vehicle containing basic dispersion medium and other desired components, for example, as listed above.For the case of sterile powder for preparing sterile injection solution, the preferred preparation method includes vacuum drying and freeze-drying technology, which obtains powder of active component and any additional desired components from their solution that has been previously sterile filtered.
[0120] The compositions of the present invention can generally be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with free amino groups) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxide) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).
[0121] When administered parenterally in an aqueous solution, for example, the solution is usually suitably buffered and the liquid diluent is first rendered isotonic, for example with sufficient saline or glucose. Such aqueous solutions can be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. It is preferable to use a sterile aqueous medium, as known to those skilled in the art, especially in light of the present disclosure. As an example, a single dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid, or injected at the proposed infusion site (see, for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). When administered to humans, the preparation must meet the standards of sterility, pyrogenicity, general safety and purity required by FDA standards. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and an oligonucleotide compound as described herein. In other embodiments, the pharmaceutical composition of the present invention comprises or consists of a sterile saline solution and an oligonucleotide compound as described herein and sterile water (e.g., water for injection, WFI). In yet other embodiments, a pharmaceutical composition of the invention comprises or consists of an oligonucleotide compound described herein and phosphate buffered saline (PBS).
[0122] The following examples, including the experiments conducted and results achieved, are provided for illustrative purposes only and should not be construed as limiting the scope of the appended claims. EXAMPLES
[0123] Example 1. Identification of proteins that regulate siRNA-mediated gene silencing To identify cellular factors that limit the intracellular delivery of siRNA therapeutic molecules, we performed a pooled genome-wide loss-of-function screen utilizing the delivery of N-acetylgalactosamine (GalNAc)-conjugated siRNA targeting the HPRT1 gene in human hepatocellular carcinoma Hep3B cells. The Hep3B cell line was selected for the screen due to its proliferation potential and high expression level of the asialoglycoprotein receptor (ASGPR). In addition, Hep3B cells were shown to robustly knockdown target genes by silencing induced by GalNAc-conjugated siRNA (data not shown).
[0124] Hep3B cells stably expressing CRISPR-associated protein 9 (Cas9) were generated by transducing cells with TransEDIT CRISPR Cas9 nuclease-expressing lentivirus (pCLIP-Cas9-nuclease-EFS-Blast; TransOMIC technologies, Huntsville, AL, Cat. No. NC0956087) at three different multiplicities of infection (MOI; 0.5, 1, and 2). After transduction, all cells were selected and maintained with 10 μg / mL blasticidin. No toxicity was observed in any of the Cas9 stable expressing Hep3B pools. The editing capacity of Cas9 stable Hep3B cells was evaluated by verifying the efficiency of editing in two target genes, SLC3A2 and ASGR1. Two different guide RNA (gRNA) lentiviral vectors targeting the SLC3A2 gene (SLC3A2-83 and SLC3A2-84) or the ASGR1 gene (ASGR1-77 and ASGR1-78) were individually transduced into both the parental Hep3B cell line and each Cas9-stable Hep3B pool. These gRNA lentiviral vectors are shown in Table 2 below. The expression levels of SLC3A2 and ASGR1 before and after gRNA lentiviral transduction were measured by flow cytometry analysis after antibody staining. Compared with the parental Hep3B cell line, both target genes were successfully knocked out in all Cas9-stable Hep3B pools (Figures 1A and 1B), demonstrating that the Cas9-stable Hep3BCas9 cells were fully functional for editing. Because the editing efficacy was similar in all three Cas9-stable Hep3B pools, we selected the one with the lowest MOI (0.5, designated Hep3BCas9) to minimize potential Cas9 toxicity and performed a clustered regularly interspaced short palindromic repeats (CRISPR) screen to identify potential regulators of silencing induced by GalNAc moiety-conjugated siRNA.
[0125] [Table 2]
[0126] To identify potential regulators of GalNAc moiety-conjugated siRNA efficacy, we used a HPRT1-6TG-based live / dead selection system for CRISPR knockout screening. 6-Thioguanine (6TG) is a purine analogue that is phosphorylated by hypoxanthine phosphoribosyltransferase (HPRT), encoded by the HPRT1 gene in humans, before being incorporated into DNA and RNA, resulting in cell death (Liao et al., Nucleic Acids Res, Vol. 43(20); e134, doi:10.1093 / nar / gkv675, 2015). Knocking down or knocking out the expression of HPRT1 in cells renders them resistant to 6TG, allowing those cells to survive. We designed and validated a GalNAc moiety-conjugated siRNA (duplex no. 8172) targeting human HPRT1 that incorporates 2'-fluoro and 2'-methoxy (OMe) modifications. The sense and antisense sequences of duplex number 8172 are shown in Table 5 below. If GalNAc moiety conjugated HPRT1 siRNA can enter cells and induce HPRT1 gene silencing, these cells can survive in the presence of 6TG. If not, the cells will be killed by 6TG selection. Under CRISPR knockout conditions, if a gene is normally required for siRNA activity, knocking out this gene will reduce or eliminate siRNA function, and 6TG selection will eliminate the cells. Alternatively, if a gene normally functions to inhibit or block siRNA activity, knocking out this gene will improve siRNA potency and allow the cells to survive 6TG selection. Thus, when gRNAs are sequenced in living cells, the enriched gRNAs will reflect genes that can normally inhibit siRNA activity, but gRNAs targeting genes essential for siRNA function will be depleted.However, other gRNAs targeting genes that affect cell viability by mechanisms unrelated to siRNA are also depleted from the live cell population, making it difficult to identify genes essential for siRNA from the depleted gRNA population. Therefore, we focused our analysis of enriched gRNAs from live cells by CRISPR knockout screening so that we could identify genes that inhibit silencing induced by GalNAc moiety-conjugated siRNA.
[0127] First, a baseline 6TG killing curve was established in Hep3BCas9 cells not treated with siRNA. To avoid both insufficient and excessive killing due to 6TG, a small pilot run was performed using 100 μM 6TG (~IC70) and 20 μM 6TG (~IC50). Hep3BCas9 cells were transduced with an 80K genome-wide gRNA lentiviral library (CRISPR KOHGW 80K (Lot No. 17050301), Cellecta, Mountain View, CA) to generate genome-wide knockout pools. First, cells were evenly divided into four groups (0.6E+06 cells / group): 1) siRNA only, 2) siRNA treated with 6TG, 3) 6TG only, and 4) negative control. To obtain sufficient but not excessive siRNA effect, 750 nM (approximate IC60) of GalNAc moiety conjugated HPRT1 siRNA (duplex no. 8172) was added to groups 1 and 2 on day 0 of the experiment. On day 3 of the experiment, tissue culture medium was removed from each group, and then 100 μM 6TG or 20 μM 6TG was added to groups 2 and 3, while non-selective complete growth medium was added to groups 1 and 4. After treatment with 6TG, cells were incubated for 3 days. Cells were then split and 6TG medium was replaced with complete growth medium without 6TG and cultured for another 3 days. Cell number measurements (measured by ViCell) were recorded on day 3 after 6TG treatment and day 6 after 6TG treatment (Figures 2A and 2B). As illustrated in Figure 2A, on day 3 after 6TG treatment, the 6TG only group had 35% viable cells, while the HPRT1-si+6TG group had 52% viable cells. At day 6 after 6TG treatment, only 5% of cells survived in the 6TG-only group, whereas 17% of cells survived in the HPRT1-si+6TG group (Figure 2B). These results indicate that treatment with GalNAc-partially conjugated HPRT1 siRNA provided partial protection, providing a screening phenotype highly suitable for detecting gene knockouts that enhance RNA interference (RNAi) activity.Based on findings from this initial screen, 100 μM 6TG treatment for 6 days was selected as the condition for the large-scale genome-wide knockout screen.
[0128] To test the effect of siRNA dosage, a large-scale screening was performed using two different concentrations of GalNAc-partially conjugated HPRT1 siRNA (duplex no. 8172), 150 nM siRNA conjugate (low dose group) and 750 nM conjugate (high dose group). Hep3BCas9 cells were transduced with a gRNA lentiviral library expressing gRNA under the wild-type U6 promoter and TagRFP and Puro resistance genes under the human ubiquitin C promoter. The library covers approximately 19,000 genes and contains four gRNAs for each gene. The gRNA lentiviral library was transduced into 9.2E+07 Hep3BCas9 cells. The actual library transduction efficiency (61%) reflected by the RFP-positive cell population was confirmed by flow cytometry analysis on the fourth day after transduction. Based on calculations, the MOI of transduction of the actual gRNA lentiviral library was approximately 0.9, and the actual coverage was 1035. The transduced cells were then selected with puromycin and blastidine for 14 days. At day 14 after selection, 87% of the cells were RFP positive by flow cytometry (indicating that 87% of the cells had integrated the gRNA). At day 14 after selection, 1E+08 cells were harvested as a baseline sample and frozen. The remaining cells were evenly divided into three groups (2.4E+08 cells / group): group 1 was treated with 150 nM GalNAc partially conjugated HPRT1 siRNA (duplex no. 8172) as the low dose group, group 2 was treated with 750 nM GalNAc partially conjugated HPRT1 siRNA as the high dose group, and group 3 was set as a control without siRNA. On the third day after siRNA treatment, 2E+08 cells were harvested from each group as samples before 6TG treatment and frozen, and then the remaining cells of each group were further divided into two subgroups: a) a group without 6TG, and b) a group without 6TG. The cell culture medium containing siRNA was removed from each flask, and fresh medium containing 100 μM of 6TG was added to each flask of the 6TG group, and fresh medium without 6TG was added to each flask of the group without 6TG. All cells were incubated for another 3 days, and then all cells were split into fresh medium without 6TG.After a final 3-day incubation, all cells were harvested. Genomic DNA samples were extracted from all harvested samples using the Gentra Puregene Cell kit (QIAGEN INC, Cat. No. 158767) according to the manufacturer's instructions and subjected to next-generation sequencing (NGS) barcode sequencing. NGS sequencing results were analyzed by the OGA algorithm (Meisen et al., Mol Ther Methods Clin Dev, Vol. 17; 601-611, 2020). A false discovery rate (FDR) < 0.2 was used as the cutoff line. All samples maintained good reproducibility of the gRNA library (approximately 77,000 gRNAs are present with an overall similar distribution). In addition, gRNAs targeting HPRT1 were successfully enriched by approximately 2-fold in the 6TG-treated group compared to the group without 6TG (data not shown).
[0129] To identify genes that could improve internalization, transport, or RNAi activity of GalNAc-conjugated siRNA when knocked out, we focused our analysis on gRNAs that were enriched in samples treated with both siRNA and 6TG, but not in the control group treated with 6TG alone. These hits include genes that, when knocked out, could 1) enhance the silencing potency of HPRT1 siRNA, 2) improve sensitivity to 6TG in the absence of siRNA, or 3) enhance cell viability in the presence of 6TG. To identify genes with the strongest potency, we selected gene hits that were significantly (FDR<0.2) enriched in both high-dose (750 nM) and low-dose (150 nM) GalNAc-conjugated HPRT1 siRNA and 6TG-treated groups compared to the 6TG-only treated group (Figure 3A). This analysis identified the following 17 genes: ADK, C14orf80 (also known as TEDC1), CAB39, CCNE1, DENR, FKBP1A, HIF1AN, NAPG, NDUFB11, RAB18, SAMD4B, SCFD2, SLC30A9, SNRNP40, TRAF2, VPS37A, and YAP1 (Figure 3A). To see if any of these 17 genes affect the sensitivity of cells to 6TG treatment in the absence of siRNA treatment, these genes were plotted with genes depleted in the group treated with 6TG alone (no siRNA) versus samples derived from cells not treated with siRNA or 6TG (no siRNA, no 6TG samples) (Figure 3B). In Figure 3B, the horizontal axis indicates sensitivity to 6TG. Genes that have enhanced sensitivity to 6TG when their expression is knocked out and that result in strong cell death when treated with 6TG are enriched and are on the horizontal axis with small FDR. When FDR < 0.2 was set as the cutoff, eight genes were identified as promoting sensitivity to 6TG treatment (Figure 3B). The remaining nine genes did not affect 6TG sensitivity even when knocked out, as indicated by the large FDR on the horizontal axis.The enrichment of these nine genes (RAB18, YAP1, CCNE1, SLC30A9, C14orf80 (also known as TEDC1), HIF1AN, TRAF2, NAPG, and SCFD2) was likely directly implicated in their role in siRNA delivery and activity. Thus, inhibiting the expression of these genes or the activity of the proteins encoded by these genes can enhance the silencing activity of ligand-conjugated oligonucleotide compounds, such as GalNAc moiety-conjugated siRNA molecules.
[0130] Example 2. Validation of protein regulators of siRNA silencing activity Candidates identified using HPRT1-6TG selection method need to be independently verified by different assay systems.To verify the hits identified in genome-wide loss-of-function screening described in Example 1, a secondary screening using multiplexed synthetic gRNA (Synthego Corporation, Redwood City, CA) is used.In this multi-guide method, three gRNAs designed close to each other are delivered together into Cas9+ cells to induce large deletions in target genes and induce more efficient knockout of target genes than single gRNA.
[0131] Multiplexed synthetic gRNAs of 58 selected genes, including genes identified in the initial screen described in Example 1 (RAB18, CCNE1, SLC30A9, NAPG, SCFD2, VPS37A, SAMD4B, and CAB39), along with several control genes (AGO2, ASGR1, and ASGR2), were transfected into Hep3BCas9 stable cells in a 96-well plate format using Lipofectamine CRISPRMAX Cas9 transfection reagent (Invitrogen, Cat. No. CMAX00008). First, 1.5 μL of 0.3 μM multiplexed synthetic gRNA was mixed with 8.5 μL of Opti-MEM medium in each well. Then, 0.2 μL of CRISPRMAX reagent diluted in 5 μL of Opti-MEM medium was added to each well and incubated at room temperature for 5-10 minutes. After incubation, 85 μL of Hep3BCas9 stable cells (15,000 cells per well) were added to each well. The plates were left for 20 minutes before being placed in a 37° C. tissue culture incubator, and approximately 6 hours after transfection, the transfection medium was replaced with EMEM containing 10% FBS and 1% AA (antibiotic-antimycotic solution). On the third day after incubation, the cells were split at a 1:6 ratio. After transfection with CRISPRMAX, the cells were incubated for a total of 6 days to allow for protein knockdown. Six days after transfection, the cells were treated with GalNAc moiety-conjugated HPRT1 siRNA (duplex no. 8172), HPRT1 siRNA conjugated to anti-ASGR1 antibody (duplex no. 6709), or HPRT1 siRNA conjugated to cholesterol (duplex no. 17102). The structures of these HPRT1 siRNA conjugates are shown in Table 5 below. HPRT1 siRNA conjugates were added to each well at the desired concentrations (500 nM, 100 nM and 20 nM) followed by incubation in a 37° C. tissue culture incubator for 4 days.Total RNA of each sample was extracted by using the KingFisher Flex System (Thermo Fisher Scientific) and MagMAX mirVana Total RNA Isolation Kit (Applied Biosystems, Cat. No. A27828) according to the manufacturer's instructions. cDNA was then synthesized from the total RNA samples using the Applied Biosystems High Capacity Reverse Transcription Kit (Cat. No. 4368813), which was used to quantify siRNA activity by ddPCR (droplet digital polymerase chain reaction). The ddPCR reaction was assembled using BioRad ddPCR Supermix for Probes (Cat. No. 1863010) according to the user manual. Droplets were then generated by a QX200 Automated Droplet Generator (BioRad, Cat. No. 1864101). Thermal cycling reactions were then performed in a C1000 Touch Thermal Cycler with a 96-Deep Well Reaction Module (BioRad, Cat. No. 1851197). The reactions were then read on a QX200 Droplet Reader (BioRad, Cat. No. 1864003) and analyzed using BioRad QuantaSoft software package. Pre-designed primers / probes for ddPCR assays with a primer / probe ratio of 3.6:1 were obtained from Integrated DNA Technologies (Coralville, IA). The assay IDs for primers / probes used to quantify HPRT1 and housekeeping TBP (TATA box binding protein) genes were Hs.PT.39a.22214821 and Hs.PT.58.19489510, respectively. For each well, ddPCR copy number measurements (copies / 20 μL) of both the target gene (HPRT1) and the housekeeping TBP gene were recorded.Normalized target gene mRNA levels were calculated by dividing the target gene ddPCR measurements by the TBP ddPCR measurements taken from the same wells. The number of siRNA-treated samples obtained was further divided by the number of non-siRNA-treated samples to obtain a percentage of the target gene mRNA level measurements.
[0132] The HPRT1 siRNA silencing potency (normalized to siRNA-free control) in cells with selected genes knocked out as measured by ddPCR is shown in Table 3 below. As expected, when AGO2 is knocked out with multiplexed synthetic gRNA, all siRNA conjugates tested abolish HPRT1 siRNA silencing activity. Since ASGR1 is a crucial component of ASGPR, ASGR1 CRISPR-KO leads to loss of response to anti-ASGR1 antibody-conjugated HPRT1 siRNA as well as GalNAc moiety-conjugated HPRT1 siRNA. However, knocking out ASGR1 did not affect the function of cholesterol-conjugated HPRT1 siRNA. These results indicate that the multiplexed synthetic gRNA system was functioning as expected. As shown in Table 3, knocking out the CRISPR screening hits RAB18, SCFD2, NAPG, and SAMD4B with multiplexed synthetic gRNA enhanced the potency of siRNA conjugates to different degrees. VPS37A specifically enhanced the potency of cholesterol-conjugated siRNA. Other screening hits, CAB39, CCNE1, and SLC30A9, could not be validated by the multiplexed synthetic gRNA approach. Proteins encoded by ZW10 and STX18 have been shown to interact with RAB18 protein (Xu et al., J Cell Biol, Vol. 217; 975-995, 2018; Li et al., Cell Rep, Vol. 27; 343-358 e345, 2019). Knockout of ZW10 and STX18 by multiplexed synthetic gRNA also enhanced siRNA silencing efficacy (Table 3).The experimental results in this example show that some of the genes identified as potential regulators of siRNA silencing activity, including RAB18, SCFD2, NAPG, VPS37A, and SAMD4B, were validated by a second arrayed CRISPR screening system by using multiplexed synthetic gRNAs.
[0133] [Table 3]
[0134] Example 3. Inhibiting RAB18 expression enhances the silencing effect of multiple siRNA conjugates Since RAB18 was the only RAB family member detected in the loss-of-function screen, and the RAB family is important in regulating intracellular vesicle trafficking, further experiments were performed to understand the mechanism by which RAB18 regulates siRNA activity in Hep3B cells. To study the function of RAB18, three different siRNA molecules (siRAB18-1, siRAB18-2, and siRAB18-3) targeting the human RAB18 gene were obtained from Ambion (Austin, TX; Catalog No. 4390824, siRNA ID Nos. s22703, s22704, and s22705) and were tested for their silencing efficacy of RAB18 in Hep3B cells. The nucleobase sequences of the sense and antisense strands of each of the RAB18-targeting siRNA molecules are shown in Table 4 below. Each siRNA molecule had a 19-base pair duplex region, including two-nucleotide overhangs at both the 3'-end of the sense strand and the 3'-end of the antisense strand. A non-targeting siRNA (siNTC; Invitrogen; catalog number 4390843) was used as a negative control.
[0135] [Table 4]
[0136] To test the potency of RAB18-targeting siRNA molecules, three siRNA molecules each at several concentrations (0.24 nM-50 nM) or sterile water (negative control) were reverse transfected individually in duplicate into Hep3B cells using Lipofectamine RNAiMAX (Invitrogen, Cat. No. 13778075). 24 hours after transfection, cells were lysed and RNA was harvested using MagMAX mirVana Total RNA Isolation kit (Applied Biosystems, Cat. No. A27828) according to the manufacturer's instructions and reverse transcribed for ddPCR analysis using Applied Biosystems High Capacity Reverse Transcription Kit (Cat. No. 4368813). ddPCR measurements of RAB18 normalized to the housekeeping gene TBP were used to calculate the normalized percentage of RAB18 mRNA levels. The results are shown in Figure 4A. Among the three RAB18-targeting siRNA molecules tested, siRAB18-3 showed the highest potency in reducing the expression of RAB18 (Figure 4A), and was therefore selected for further experiments to investigate the function of RAB18 in the silencing activity of GalNAc moiety-conjugated siRNA molecules targeting HPRT1.
[0137] To analyze the effect of RAB18 knockdown on the efficacy of GalNAc-partially conjugated HPRT1 siRNA, Hep3B cells were reverse transfected with non-targeting control siRNA molecules (siNTC) (50 nM) or siRAB18-3 (50 nM). 24 hours after transfection, cells were trypsinized, washed twice in EMEM to remove residual transfection reagent, and then plated in 96-well plates containing either PBS or multiple concentrations of GalNAc-partially conjugated HPRT1 siRNA (duplex no. 8172). Four days after treatment with GalNAc-HPRT1 siRNA conjugates, cells were lysed for RNA isolation and cDNA synthesis as described above. As illustrated in FIG. 4B, RAB18 mRNA measured by ddPCR was maintained at a lower level (23.2%) in siRNA18-3 transfected cells on day 4 after treatment with duplex no. 8172 compared to RAB18 mRNA levels in siNTC transfected cells. HPRT1 mRNA levels were also measured by ddPCR on day 4 after treatment with duplex no. 8172. As shown in FIG. 4C, the potency of GalNAc moiety conjugated HPRT1 siRNA to reduce HPRT1 expression was greater in siRAB18-3 transfected Hep3B cells compared to siNTC transfected cells. Notably, the IC50 of GalNAc-HPRT1 siRNA conjugate in siRAB18-3 transfected cells was 24.8 nM, whereas it was 223.6 nM in siNTC transfected cells (FIG. 4C), a 10-fold improvement in potency.
[0138] Next, to completely eliminate the function of RAB18, we generated two RAB18 knockout pools (RAB18_KO_1 and RAB18_KO_2) by transducing two lentiviral gRNA vectors targeting RAB18 (SIGMA vector: U6-gRNA: PGK-puro-2A-tagBFP) into Hep3BCas9 cells. The structural features of the RAB18 gRNA lentiviral vectors are as follows: RAB18 gRNA Lentiviral Vector Number 1: Sanger Clone ID: HS5000033611; DNA target sequence: TAACTCCCAGCTATTATAGAGG (SEQ ID NO: 11) RAB18 gRNA Lentiviral Vector No. 2: Sanger Clone ID: HS5000033612; DNA target sequence: GCTATTATAGAGGTGCACAGGG (SEQ ID NO: 12)
[0139] The knockout efficiency of RAB18 was demonstrated by Amplicon-EZ sequencing (data not shown). Knocking out the RAB18 gene did not change the cell viability of Hep3BCas9 cells (data not shown). Since RAB18 was identified by the HPRT1-6TG selection screen, the same HPRT1-6TG screening assay was repeated with RAB18 knockout cells. Specifically, on day 0 of the experiment, Hep3BCas9 cells and two RAB18 knockout cells were treated with various concentrations of either GalNAc partially conjugated HPRT1 siRNA (duplex no. 8172) or GalNAc partially conjugated PPIB (peptidyl-prolyl cis-trans isomerase B) siRNA (duplex no. 8714; see Table 5 for sequences). On day 3 of the experiment, the tissue culture medium containing the siRNA conjugates was removed, and then 100 μM 6TG was added to the cells. After treatment with 6TG, the cells were incubated for 4 days. The cells were then split, the medium was removed, and fresh 6TG was added on day 7 and cultured for another 2 days. On day 6 after 6TG treatment, the cell lysis rate was measured using CellTiter-Glo reagent (Promega, Madison, WI). As shown in Figure 5, compared to parental Hep3BCas9 cells, RAB18 knockout cells were approximately 15% more able to survive under 6TG selection when treated with GalNAc-partially conjugated HPRT1 siRNA (58% in RAB18 knockout cells compared to 43% in Hep3BCas9 cells at the highest dose of siRNA tested), indicating that HPRT1 siRNA induced gene silencing better in RAB18 knockout cells than in Hep3BCas9 parental cells. Neither Hep3BCas9 cells nor RAB18 knockout cells treated with GalNAc-partially conjugated siRNA targeting the PPIB gene as an unrelated siRNA control showed enhanced resistance to 6TG treatment (Figure 5).
[0140] Next, the effect of knockout of RAB18 on the silencing potency of three different GalNAc moiety-conjugated siRNA molecules was evaluated. Hep3BCas9 cells and RAB18 knockout cells were treated with three GalNAc moiety-conjugated siRNAs: HPRT1 siRNA (duplex no. 8172), ASGR1 siRNA (duplex no. 16084), and PPIB siRNA (duplex no. 8714) for four days. The sequences of each of the siRNA molecules are shown in Table 5 below. Cells were lysed and RNA was extracted and reverse transcribed for ddPCR analysis as described above. The assay IDs of the primers / probes used to quantify the HPRT1 gene and the housekeeping TBP gene were the same as those described in Example 2. The assay IDs of the primers / probes used to quantify the ASGR1 gene and the PPIB gene were Hs.PT.56a.24725395 and Hs.PT.58.40006718, respectively. ddPCR measurements for each target gene (HPRT1, ASGR1, or PPIB) were normalized to ddPCR measurements for the housekeeping TBP gene and expressed as a percentage of the corresponding mRNA levels in PBS (phosphate-buffered saline)-treated control cells (i.e., cells not treated with GalNAc-siRNA conjugate molecules). For all three GalNAc-siRNA conjugates tested, knockdown of the target gene was better in RAB18 knockout cells compared to parental Hep3BCas9 cells (Figures 6A, 6B, and 6C). The IC50 of the GalNAc-HPRT1 siRNA conjugate in Hep3BCas9 was 83.4 nM compared to 2.6 nM and 4.1 nM for the two RAB18 knockout lines, a 20- to 30-fold change (Figure 6A). A similar increase in siRNA silencing potency was observed with GalNAc-ASGR1 siRNA conjugates in RAB18 knockout cell lines, with IC50s of 198.3 nM in Hep3BCas9 cells and 7.9 nM or 6.5 nM in the two RAB18 knockout cell lines (Figure 6B).Compared with HPRT1 and ASGR1, PPIB is a highly expressed gene in Hep3B cells, but could not be effectively silenced by GalNAc-moiety conjugated PPIB siRNA in Hep3BCas9 cells (Figure 6C). However, this same GalNAc-PPIB siRNA conjugate was able to silence PPIB expression in two RAB18 knockout pools (IC50=205.2 nM or 391.8 nM) (Figure 6C), indicating that suppressing RAB18 can enhance the silencing potency of GalNAc-siRNA conjugate molecules. The siRNA silencing efficacy of all three GalNAc-siRNA conjugate molecules was also evaluated on day 11. In this set of experiments, cells were treated with GalNAc-siRNA conjugate molecules for 4 days and then maintained in medium without GalNAc-siRNA conjugate molecules for an additional 7 days, at which point the cells were lysed and RNA was extracted and reverse transcribed for ddPCR analysis. Although the silencing effect decreased as the cells proliferated over time, the silencing potency was greater in RAB18 knockout cells than in Hep3BCas9 cells. For example, when treated with GalNAc-HPRT1 siRNA conjugates, the IC50 at day 11 was 363.6 nM in Hep3BCas9 cells compared to 41.3 nM and 58.3 nM for the two RAB18 knockout pools. These results demonstrate that inhibiting RAB18 expression enhances the silencing potency of GalNAc moiety-conjugated siRNA molecules, regardless of the gene targeted by the siRNA molecule.
[0141] To further explore the mechanism by which RAB18 may control the efficacy of ligand-conjugated siRNA molecules, we first tested whether ASGR1 was required for GalNAc-siRNA conjugates to function in RAB18 knockout cells using an antibody blocking assay. Hep3BCas9 cells and RAB18 knockout cells were first preincubated with anti-ASGR1 antibody (clone no. 7E11 described in WO 2017 / 058944), isotype control antibody, or no antibody for 30 min, followed by the addition of GalNAc partially conjugated HPRT1 siRNA (duplex no. 8172) at different concentrations. The final antibody concentration was 50 μg / mL, and 2,000 cells were seeded in each well. After 4 days of incubation in a 37°C tissue culture incubator, cells were lysed and RNA was extracted, reverse transcribed, and subjected to ddPCR analysis as described above. Pretreatment of cells with 7E11 anti-ASGR1 antibody reduced the potency of GalNAc-HPRT1 siRNA conjugates to silence the HPRT1 gene in Hep3BCas9 cells and RAB18 knockout cells (Figure 7). Similar results were obtained when identical experiments were performed using GalNAc-ASGR1 siRNA conjugates and GalNAc-PPIB siRNA conjugates to silence the ASGR1 and PPIB genes, respectively (data not shown). The results of this series of experiments indicate that ASGR1 is required for delivery of GalNAc-siRNA conjugates to Hep3B cells and RAB18 knockout cells.
[0142] After confirming that knocking out RAB18 enhances the siRNA potency of GalNAc moiety-conjugated siRNA molecules delivered via ASGPR, we investigated whether knocking out RAB18 could enhance the siRNA potency of siRNA molecules delivered by lipofectamine-mediated transfection. To address this question, Hep3BCas9 cells and RAB18 knockout cells were treated with various concentrations of unconjugated HPRT1 siRNA (duplex number 17629; sequence listed in Table 5) with or without lipofectamine RNAiMAX reagent (Invitrogen, Waltham, MA). As shown in Figure 8, when HPRT1 siRNA molecules were delivered to cells by lipofectamine-mediated transfection, the potency of the siRNA molecules to reduce HPRT1 expression was similar between Hep3BCas9 cells (IC50=0.2nM) and RAB18 knockout cells (IC50=0.3nM). This finding indicates that suppressing RAB18 activity does not enhance the activity of siRNA molecules delivered by lipofectamine-mediated transfection.
[0143] Taken together, the experimental results described in this example demonstrate that inhibiting the expression of RAB18 significantly enhances, by at least 20-fold, the silencing efficacy of siRNA molecules delivered to cells via cell surface receptors such as ASGPR. RAB18 is involved in the regulation of lipid droplet (LD) formation (Xu et al., J Cell Biol, Vol. 217; 975-995, 2018; Martin et al., J Biol Chem, Vol. 280; 42325-42335, 2005), inhibition of COPI-independent retrograde transport from the Golgi apparatus to the endoplasmic reticulum (ER) (Dejgaard et al., J Cell Sci, Vol. 121; 2768-2781, 2008), regulation of secretory granules and peroxisomes (Vazquez-Martinez et al., Traffic, Vol. 8; 867-882, 2007; Gronemeyer et al., FEBS Lett, Vol. 587; 328-338, 2013), and promotion of hepatitis C virus (HCV) association on LD membranes (Salloum et al., J Cell Biol, Vol. 217; 975-995, 2018; Martin et al., J Biol Chem, Vol. 280; 42325-42335, 2005). RAB18 has been implicated in various physiological processes, including regulation of ER structure (Gerondopoulos et al., J Cell Biol, Vol. 205; 707-720, 2014), and regulation of normal ER structure (Gerondopoulos et al., J Cell Biol, Vol. 205; 707-720, 2014). The mechanism by which RAB18 can regulate the silencing activity of oligonucleotide compounds remains unclear, but may be related to the function of RAB18 in regulating ER-LD tethering. As described in Example 2 and shown in Table 3 above, knocking out genes ZW10 and STX18 (encoding syntaxin 18) by multiplexed synthetic gRNA enhances siRNA silencing potency, indicating that genes that interact with RAB18 to regulate ER-LD tethering exert the same inhibitory effect on siRNA silencing activity.The ER has been reported to be a central nucleation site for siRNA-mediated silencing, and an ER membrane-resident protein (CLIMP-63) has been shown to interact with and stabilize Dicer (Stalder et al., EMBO J, Vol. 32; 1115-1127, 2013; Pepin et al., Nucleic Acids Res, Vol. 40; 11603-11617, 2012). Suppression of RAB18 function may enhance the retrograde transport of endosomes containing siRNA or other oligonucleotide compounds internalized by receptor-mediated endocytosis to the ER, a potential intracellular silencing site for siRNA molecules. RAB18 is a ubiquitously expressed gene across multiple tissue types and is highly conserved across species. Thus, suppression of RAB18 expression or activity in cells and tissues other than the liver may also enhance the efficacy of ligand-conjugated siRNA molecules.
[0144] siRNA molecule Table 5 below lists the sense and antisense sequences for each of the ligand-conjugated siRNA molecules used in the experiments described in Examples 1-3, as well as the type of ligand conjugated to the siRNA molecule. The nucleotide sequences in Table 5 are listed according to the following notation: a, u, g, and c = the corresponding 2'-O-methyl ribonucleotide; Af, Uf, Gf, and Cf = the corresponding 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotide; and invAb = an inverted abasic nucleotide (i.e., an abasic nucleotide that is linked to an adjacent nucleotide through its 3'-substituent when on the 3' end of the strand (3'-3' linkage) or through its 5'-substituent when on the 5' end of the strand (5'-5' internucleotide linkage). The insertion of "s" in the sequence indicates that two adjacent nucleotides are linked by a phosphorothiodiester group (e.g., a phosphorothioate internucleotide linkage). Unless otherwise indicated, all other nucleotides are linked by 3'-5' phosphodiester groups. For molecules conjugated to GalNAc ligands, a GalNAc moiety having the structure shown in formula VII (supra) was conjugated to the 5' end of the sense strand of the indicated siRNA molecule via phosphorothioate linkage. Duplex No. 17102 was conjugated to cholesterol via the 5' end of the sense strand, while duplex No. 6709 was conjugated to anti-ASGR1 antibody via the 3' end of the sense strand.
[0145] [Table 5]
[0146] Example 4. Inhibition of RAB18 expression enhances the silencing effect of GalNAc-conjugated antisense oligonucleotides Single-stranded antisense oligonucleotides (ASOs) are another type of oligonucleotide compound that is widely used to silence gene expression. To see whether RAB18 also regulates the efficacy of ASO-mediated gene silencing, the effect of knocking out RAB18 on ASO silencing efficacy was studied. Hep3BCas9 parental cells and RAB18 knockout cells described in Example 3 were treated for 4 days with either PBS or one of two GalNAc moiety conjugated ASO molecules (compound numbers 15469 and 15470) at multiple concentrations targeting the HPRT1 gene, or a control GalNAc moiety conjugated ASO molecule (compound number 15472) targeting the PNPLA3 gene. The sequences of each of the three GalNAc moiety conjugated ASO molecules are shown in Table 6 below. For Hep3BCas9 parental cells and RAB18 knockout cells, cell suspensions were prepared in EMEM+10% FBS medium at a concentration of 4E+05 cells / ml. This cell solution was plated in a 96-well plate in a volume of 50 μl / well. Immediately after plating the cells, 50 μl of GalNAc-ASO conjugates at various concentrations diluted in EMEM+10% FBS medium were added to each well. The 96-well plate was then incubated in a tissue culture incubator at 37° C. for 4 days. On the fourth day after treatment with GalNAc-partially conjugated ASO molecules, cells were lysed and RNA samples were extracted from each well and reverse transcribed into cDNA. The silencing effect of each of the different GalNAc-partially conjugated ASO molecules on the mRNA expression of HPRT1 was then measured by ddPCR analysis. The ddPCR measurements of the HPRT1 gene were normalized to the ddPCR measurements of the housekeeping TBP gene and expressed as a percentage of the corresponding mRNA levels in control cells treated with PBS (i.e., cells not treated with GalNAc-ASO conjugated molecules).
[0147] As shown in Figure 9, treatment with a control GalNAc-conjugated ASO molecule targeting the PNPLA3 gene (compound number 15472) did not affect the expression level of HPRT1 in either Hep3BCas9 cells or RAB18 knockout cells. In the group treated with GalNAc-conjugated ASO molecules targeting HPRT1, enhanced silencing effect on HPRT1 expression was observed in RAB18 knockout cells when compared with Hep3BCas9 parental cells (Figure 9). For example, the IC50 value of compound number 15469 in Hep3BCas9 parental cells was 2501 nM, while the IC50 value of the same compound in RAB18 knockout cells was 100 nM, resulting in a 25-fold enhancement in silencing potency. These results indicate that RAB18 regulates a step in cells that is used similarly by both GalNAc-conjugated siRNA molecules and GalNAc-conjugated ASO molecules. Therefore, inhibiting the expression of RAB18 is an effective approach to enhance the silencing activity of ligand-conjugated siRNA molecules as well as ligand-conjugated ASO molecules.
[0148] ASO molecule The nucleotide sequences of the single-stranded antisense oligonucleotide (ASO) compounds in Table 6 are listed according to the following notation: dA, dT, dG, and dC = the corresponding deoxyribonucleotides; [ka] (underlined and bold) = the corresponding β-D-methyleneoxy (4'-CH2-O-2') nucleotide ("locked nucleic acid" or LNA); and C* = a nucleotide containing a 5-methylcytosine base. [ka] and an LNA comprising a 5-methylcytosine base. The insertion of "s" in the sequence indicates that two adjacent nucleotides are linked by a phosphorothioate group (e.g., a phosphorothioate internucleotide bond). Unless otherwise indicated, all other nucleotides are linked by a 3'-5' phosphodiester group. All three single-stranded ASO molecules were conjugated at the 5' end to a GalNAc moiety having the structure shown in Formula VII (supra) via a phosphorothioate bond.
[0149] [Table 6]
[0150] All publications, patents, and patent applications described and cited herein are hereby incorporated by reference in their entirety. It is understood that the disclosed invention is not limited to the specific methods, procedures, and materials described, as these may vary. It is also understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to limit the scope of the appended claims.
[0151] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following claims.
Claims
1. 1. An in vitro method for reducing expression of a target gene in a cell, comprising: contacting the cell with an inhibitor of a suppressor protein, wherein the suppressor protein is RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, or VPS37A; contacting the cell with a first oligonucleotide compound comprising a sequence substantially complementary to a sequence of the target gene, wherein the oligonucleotide compound is covalently bound to a ligand of a receptor expressed on the surface of the cell; A method comprising:
2. The method of claim 1, wherein the suppressor protein is RAB18, ZW10, or STX18.
3. The method of claim 1 , wherein the suppressor protein is RAB18.
4. 10. The method of claim 1, wherein said inhibitor of said suppressor protein is a second oligonucleotide compound comprising a sequence substantially complementary to an mRNA sequence encoding said suppressor protein.
5. The method of claim 4 , wherein the second oligonucleotide compound is single-stranded.
6. The method of claim 4 , wherein the second oligonucleotide compound is double-stranded.
7. The method of claim 1, wherein the first oligonucleotide compound comprises at least one modified nucleotide and / or one or more phosphorothioate internucleotide linkages. b) said second oligonucleotide compound comprises at least one modified nucleotide and / or comprises one or more phosphorothioate internucleotide linkages; or c) a) and b); The method of claim 4.
8. 8. The method of claim 7, wherein the modified nucleotide is a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-alkyl modified nucleotide, a 2'-O-allyl modified nucleotide, a BNA, a deoxyribonucleotide, or a combination thereof.
9. The method of any one of claims 1 to 8, wherein the target gene is a human gene and / or expression of the target gene is associated with a disease or disorder.
10. 9. The method of any one of claims 1 to 8, wherein the first oligonucleotide compound is a single-stranded antisense oligonucleotide comprising a sequence substantially complementary to a sequence of the target gene.
11. 9. The method of any one of claims 1 to 8, wherein the first oligonucleotide compound is an siRNA comprising a sense strand and an antisense strand, and the antisense strand comprises a sequence substantially complementary to a sequence of the target gene.
12. 9. The method of any one of claims 1 to 8, wherein the ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folate moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or antigen-binding fragment thereof.
13. The method of any one of claims 1 to 8, wherein the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine.
14. The method of claim 13, wherein the ligand comprises a multivalent galactose moiety or a multivalent N-acetyl-galactosamine moiety.
15. 15. The method of claim 14, wherein the multivalent galactose or N-acetyl-galactosamine moiety is trivalent or tetravalent.
16. 1. A pharmaceutical composition comprising an inhibitor of a suppressor protein for use in a therapeutic method for reducing expression of a target gene in a subject, wherein the suppressor protein is RAB18, ZW10, STX18, SCFD2, NAPG, SAMD4B, or VPS37A; The method comprises: the pharmaceutical composition, and a first oligonucleotide compound comprising a sequence substantially complementary to a sequence of said target gene, said first oligonucleotide compound being covalently attached to a first ligand; to said subject.
17. 17. The pharmaceutical composition of claim 16, wherein the suppressor protein is RAB18, ZW10, or STX18.
18. 17. The pharmaceutical composition of claim 16, wherein the suppressor protein is RAB18.
19. 17. The pharmaceutical composition of any one of claims 16, wherein said inhibitor of said suppressor protein is a second oligonucleotide compound comprising a sequence substantially complementary to an mRNA sequence encoding said suppressor protein.
20. 20. The pharmaceutical composition of claim 19, wherein the second oligonucleotide compound is single-stranded.
21. 20. The pharmaceutical composition of claim 19, wherein the second oligonucleotide compound is double-stranded.
22. The method of claim 21, wherein: a) the first oligonucleotide compound, the second oligonucleotide compound, or both the first and second oligonucleotide compounds comprise at least one modified nucleotide; b) the first oligonucleotide compound, the second oligonucleotide compound, or both the first and second oligonucleotide compounds comprise one or more phosphorothioate internucleotide linkages; or c) a) and b); 20. The pharmaceutical composition of claim 19.
23. 23. The pharmaceutical composition of claim 22, wherein the modified nucleotide is a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-alkyl modified nucleotide, a 2'-O-allyl modified nucleotide, a BNA, a deoxyribonucleotide, or a combination thereof.
24. 24. The pharmaceutical composition of any one of claims 16 to 23, wherein the target gene is a human gene and / or expression of the target gene is associated with a disease or disorder in the subject.
25. The pharmaceutical composition of any one of claims 16 to 23, wherein the first oligonucleotide compound is a single-stranded antisense oligonucleotide comprising a sequence substantially complementary to a sequence of the target gene.
26. The pharmaceutical composition according to any one of claims 16 to 23, wherein the first oligonucleotide compound is an siRNA comprising a sense strand and an antisense strand, and the antisense strand comprises a sequence substantially complementary to a sequence of the target gene.
27. 24. The pharmaceutical composition of any one of claims 19 to 23, wherein the second oligonucleotide is covalently linked to a second ligand, optionally wherein the second ligand is identical to the first ligand.
28. 28. The pharmaceutical composition of claim 27, wherein the first ligand, the second ligand, or both the first and second ligands comprise a cholesterol moiety, a vitamin, a steroid, a bile acid, a folate moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or antigen-binding fragment thereof.
29. 28. The pharmaceutical composition of claim 27, wherein the first ligand, the second ligand, or both the first and second ligands comprise galactose, galactosamine, or N-acetyl-galactosamine.
30. 30. The pharmaceutical composition of claim 29, wherein the first ligand, the second ligand, or both the first and second ligands comprise a multivalent galactose moiety or a multivalent N-acetyl-galactosamine moiety.
31. 31. The pharmaceutical composition of claim 30, wherein the multivalent galactose or N-acetyl-galactosamine moiety is trivalent or tetravalent.
32. 28. The pharmaceutical composition of claim 27, wherein the first ligand, the second ligand, or both the first and second ligands are ligands for a receptor expressed on the surface of liver cells.
33. 33. The pharmaceutical composition of claim 32, wherein the receptor is an asialoglycoprotein receptor.