Novel modulators of the aryl hydrocarbon receptor and methods of use thereof

Abstract

Disclosed herein are compounds that can act as modulators of the aryl hydrocarbon receptor (AHR).Further disclosed herein are methods for treating diseases and disorders, such as inflammatory and autoimmune diseases and disorders, using the compounds disclosed herein.

Description

[Background technology]

[0001] The present disclosure relates to compounds that act as aryl hydrocarbon receptor (AHR) activity modulators, pharmaceutical formulations thereof, and methods of using the compounds to treat diseases and disorders, such as inflammatory and autoimmune diseases and disorders.

[0002] The aryl hydrocarbon receptor (AHR) is a ligand-dependent transcription factor that regulates gene expression in various cells, such as epithelial cells and immune cells. Activation of AHR can lead to changes in inflammatory cytokine profiles and antioxidant responses in the cellular environment, facilitating the healing process of diseased tissues. AHR signaling may play a key role in maintaining skin and ocular homeostasis by regulating the skin immune network, keratinocyte differentiation, skin barrier function and pigmentation, retinal epithelial cells, rod photoreceptors, choroidal endothelial cells, choroidal neovascularization, and responses to oxidative stress. Cells found in the skin and eye that express AHR include keratinocytes, sebocytes, fibroblasts, melanocytes, endothelial cells, Langerhans cells, choroidal endothelial cells, retinal pigment epithelial cells, rod photoreceptors, and immune cells present in the skin and eye. Thus, regulation of the AHR signaling pathway is involved in the pathology of various diseases and disorders of the skin and eye.

[0003] AHR signaling is also known to regulate the composition and function of different cell types in the gastrointestinal tract, and thus has a prominent role in maintaining the balance between health and disease. AHR is involved in several physiological processes, including homeostasis and immune regulation in epithelial barriers, such as those formed by intestinal epithelial cells (IECs). A powerful immune response in the body occurs in the intestine, and therefore there is great interest in elucidating the molecular mechanisms underlying the role of AHR in cells of the intestinal mucosa (IECs and various immune cells, including B cells, T cell receptor γδ T cells (TCRγδ), T helper 17 cells (Th17), regulatory T cells (Treg), type 1 regulatory T cells (Tr1), innate lymphoid cells (ILCs), macrophages (MQs), intraepithelial lymphocytes (IELs), dendritic cells (DCs), and neutrophils). Thus, aberrant AHR activity is involved in several intestinal pathologies, such as intestinal inflammation, infection, and cancer.

[0004] AHR signaling is also known to play a major role in bone remodeling by altering the interaction between bone-forming osteoblasts and bone-resorbing osteoclasts. The overall effect of AHR activation in osteoblasts is the suppression of cell differentiation, and AHR agonism has a dose-dependent effect on osteoblasts, with overactivation and underactivation inhibiting and promoting bone formation, respectively. Although the effects of AHR regulation in osteoclasts are less well understood, the AHR pathway has been implicated in both stimulating and impairing osteoclast differentiation. Thus, the AHR pathway is an attractive target for the treatment of various human diseases in which osteoblasts and osteoclasts are involved in the pathogenesis, including bone-destructive diseases such as osteoporosis and cancer. Summary of the Invention

[0005] One aspect of the disclosure is a compound having the structure of formula (I): [ka] or a pharma- ceutically acceptable salt thereof, wherein R 1 is C 1-6 Alkyl, C 1-6Haloalkyl, C 1-6 Hydroxyalkyl, OC 1-6 Alkyl, C(=O)C 1-6 Alkyl, or C(=CH)C 1-6 is alkyl, R 2 OH, O.C. 1-6 Alkyl, N(R N1 )2, or halo, and each R N1 are independently H or C 1-6 is alkyl, and X 1 is N, C-OH, or C-OC 1-6 alkyl and A is an optionally substituted fused bicyclic heteroaryl group having 8 to 10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S; or [ka] and Y is [ka] O, S, S=O, or SO2, and Z is an optionally substituted phenyl group or an optionally substituted heteroaryl group having 5 or 6 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, and S, with the proviso that R 2 is OH or OC 1-6 is alkyl, and X 1 is C-OH or C-OC 1-6 When Y is alkyl, [ka] or a pharma- ceutically acceptable salt thereof, provided that:

[0006] In some cases, R 1 is C 1-3 In some cases, R 1 teeth, [ka] In some cases, R1 teeth, [ka] In some cases, R 1 teeth, [ka] In some cases, R 2 are OH, OCH3, N(R N1 ) 2, or F, and each R N1 are independently H or CH3. 2 is OH. In some cases, R 2 is OCH3. In some cases, R 2 is NH2. In some cases, R 2 is F. In some cases, X 1 is N. In some cases, X 1 is C-OH. In some cases, X 1 is C-OCH3. In some cases, R 2 is OH, OCH3, NH2, or F, and X 1 is N, C-OH, or C-OCH3. 2 is OH and X 1 is N. In some cases, R 2 is OH and X 1 is C-OH. In some cases, R 2 is NH2 and X 1 is C-OH. In some cases, R 2 is NH2 and X 1 is N. In some cases, R 2 is F and X 1 is C-OH. In some cases, R 2 is OH and X1 is C-OCH3. 1 teeth, [ka] and R 2is OH, OCH3, or NH2, and X 1 is N, C—OH, or C—OCH3.

[0007] In some cases, A is an optionally substituted fused bicyclic heteroaryl group having 8-10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S. In some cases, A is benzoxazolyl, benzimidazolyl, indolyl, isoindolyl, indolizinyl, purinyl, benzofuranyl, benzimidazole, quinolinyl, isoquinolinyl, naphthyridinyl, or pyridopyrazinyl, any of the foregoing being unsubstituted or substituted. In some cases, A is benzoxazolyl, benzimidazolyl, quinolinyl, isoquinolinyl, or naphthyridinyl, any of the foregoing being unsubstituted or substituted. In some cases, A is [ka] [ka] wherein any of the foregoing are unsubstituted or substituted.

[0008] In some cases, A is unsubstituted. In some cases, A is [ka] In some cases, A may [ka] In some cases, A may [ka] It is.

[0009] Optionally, A is substituted. Optionally, A is substituted with 1, 2, or 3 substituents, each of which is independently halo, OH, CN, COOH, COOC. 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-3 Alkyl, or N(R N1 )2, and each R N1 are independently H or C 1-6 Optionally, A is substituted with 1, 2, or 3 substituents, each of which is independently F, Cl, OH, CN, COOH, CH3, OCH3, CF3, OCF3, NH2, NHCH3, or NH(CH3)2. Optionally, A is [ka] [ka] In some cases, A may [ka] It is.

[0010] In some cases, A: [ka] In some cases, Y is [ka] In some cases, Y is O, S, S=O, or SO2. In some cases, Z is an unsubstituted phenyl group or an unsubstituted pyridyl. In some cases, A is [ka] In some cases, A may [ka] Optionally, Z is a substituted phenyl group or a substituted pyridyl group. Optionally, the phenyl group or the heteroaryl group is substituted with one, two, or three substituents, each of which is selected from halo, OH, CN, COOH, COOC, 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, and N(R N1 )2, and each R N1 are independently H or C 1-6 Optionally, the phenyl or pyridyl group is substituted with 1, 2, or 3 substituents, each of which is independently F, Cl, OH, CN, COOH, CH3, OCH3, CF3, OCF3, NH2, NHCH3, or NH(CH3)2. Optionally, A is [ka] It is.

[0011] In some cases, R 1 teeth, [ka] and R 2 is OH, OCH3, or NH2, and X 1 is N, C-OH, or C-OCH3, and A is unsubstituted quinolinyl, unsubstituted isoquinolinyl, unsubstituted benzoxazolyl, or [ka] It is.

[0012] Another aspect of the disclosure provides a compound having a structure listed in Table A, Table B, Table C, or Table D, or a pharma- ceutically acceptable salt thereof. Optionally, the compound is [ka] [ka] or a pharma- ceutically acceptable salt thereof.

[0013] In some cases, the compounds or salts of the present disclosure may contain one or more deuterium atoms, one or more tritium atoms, one or more C 11 Atom, one or more C 13 Atom, one or more C 14 atoms, or any combination of the foregoing.

[0014] Another aspect of the disclosure provides a pharmaceutical formulation comprising a compound or salt of the disclosure and a pharma- ceutically acceptable excipient.

[0015] Yet another aspect of the present disclosure provides a method of modulating aryl hydrocarbon receptor (AHR) activity in a subject, comprising contacting the AHR with a compound or salt of the present disclosure, or a formulation of the present disclosure, in an amount effective to modulate AHR activity.

[0016] Yet another aspect of the present disclosure provides a method for treating or preventing a disease or disorder in a subject, comprising administering to the subject a therapeutically effective amount of a compound or salt of the present disclosure, or a formulation of the present disclosure. In some cases, the disease or disorder is an inflammatory disease or disorder. In some cases, the disease or disorder is a disease or disorder of the gastrointestinal tract, skin, lung, central nervous system, pancreas, eye, bone, or osteoarticular, neuroinflammatory, or neurodegenerative disease and disorder. In some cases, the gastrointestinal tract disease or disorder is selected from the group consisting of colitis, inflammatory bowel disease, Crohn's disease, celiac disease, necrotizing enterocolitis, irritable bowel syndrome, chronic idiopathic constipation, traveler's diarrhea, and colorectal cancer. In some cases, the skin disease or disorder is selected from the group consisting of atopic dermatitis, acne, psoriasis, and vitiligo. In some cases, the eye disease or disorder is age-related macular degeneration. In some cases, the lung disease or disorder is pulmonary fibrosis or chronic obstructive pulmonary disease. In some cases, the bone or bone joint disease or disorder is osteoporosis, rheumatoid arthritis, or bone cancer. In some cases, the disease or disorder is a disease or disorder of the central nervous system. In some cases, the disease or disorder of the central nervous system is Alzheimer's disease and other memory disorders, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease, or motor neuron disease). In some cases, the disease or disorder is a disease or disorder of the pancreas. In some cases, the disease or disorder of the pancreas is type 1 diabetes. In some cases, the disease or disorder is an autoimmune disease or disorder. In some cases, the autoimmune disease or disorder is hidradenitis suppurativa, systemic sclerosis, lupus nephritis, ankylosing spondylitis, non-radiographic axial spondyloarthritis (NR-Ax-SpA), rheumatoid arthritis, juvenile idiopathic arthritis (JIA), Crohn's disease, ulcerative colitis, systemic lupus erythematosus, atopic dermatitis, chronic obstructive pulmonary disease, severe asthma, psoriasis, Sjogren's disease, chronic spontaneous urticaria, cutaneous lupus erythematosus, Still's disease, idiopathic pulmonary fibrosis, dermatomyositis, sarcoidosis, psoriatic arthritis, pustular psoriasis, osteoarthritis, alopecia areata, giant cell arteritis (GCA), ANCA vasculitis, vasculitis, eosinophilic esophagitis, acute respiratory distress syndrome, severe acne, or lichen planus. In some cases, the disease or disorder is a neuroinflammatory disease or disorder.In some cases, the neuroinflammatory disease or disorder is multiple sclerosis, Rasmussen's encephalitis, acute disseminated encephalomyelitis (ADEM), autoimmune encephalitis, transverse myelitis (TM), or anti-NMDA receptor encephalitis. In some cases, the disease or disorder is a neurodegenerative disease or disorder. In some cases, the neurodegenerative disease or disorder is uveitis, optic neuritis, neuromyelitis optica spectrum disorder (NMOSD), or age-related macular degeneration (AMD).

[0017] In some cases, the disease or disorder is diabetes, cancer, a viral infection, or a bacterial infection. In some cases, the viral infection is a flavivirus infection or a coronavirus infection. In some cases, the disease or disorder is a bacterial infection. In some cases, the bacterial infection is a pulmonary infection, a gastrointestinal infection, a skin infection, an ear infection, or sepsis.

[0018] In some cases, the methods of the present disclosure further include administering a therapeutic agent. In some cases, the therapeutic agent is an anti-inflammatory agent. In some cases, the anti-inflammatory agent is selected from mesalazine, naproxen, ibuprofen, diclofenac, celecoxib, sulindac, oxaprozin, piroxicam, indomethacin, meloxicam, fenoprofen, difnisal, etodolac, ketorolac tromethamine, meclofenamate, nabumetone, salsalate, or any combination of the foregoing.

[0019] The disclosure further provides a compound or salt of the disclosure, or a formulation of the disclosure, for use in treating or preventing a disease or disorder in a subject.The disclosure also provides a compound or salt of the disclosure, or a pharmaceutical composition of the disclosure, in a method for treating or preventing a disease or disorder in a subject.

[0020] Further aspects and advantages will be apparent to those skilled in the art from a review of the following detailed description in conjunction with the drawings. While the compounds and methods disclosed herein are susceptible to examples in various forms, the following description includes specific examples, with the understanding that the disclosure is illustrative and is not intended to limit the invention to the specific examples described herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] Thus, there is a need for novel compounds that modulate aryl hydrocarbon receptor (AHR) activity to provide new and effective treatments for diseases and disorders, such as inflammatory diseases and disorders. Thus, compounds that can act as potent modulators of AHR activity, such as compounds of formula (I): [ka] (In the formula, R 1 , R 2 , X 1 and A is as described herein.

[0022] Compounds of the Disclosure In one aspect, a compound having the structure of formula (I): [ka] or a pharma- ceutically acceptable salt thereof, wherein: R 1 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, OC 1-6 Alkyl, C(=O)C 1-6 Alkyl, or C(=CH)C 1-6 is alkyl, R 2 OH, O.C. 1-6 Alkyl, N(R N1 )2, or halo; Each R N1 are independently H or C 1-6 is alkyl, X 1 is N, C-OH, or C-OC 1-6 is alkyl, A is an optionally substituted fused bicyclic heteroaryl group having 8 to 10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S; or [ka] and Y is [ka] O, S, S=O, or SO2; Z is an optionally substituted phenyl group or an optionally substituted heteroaryl group having 5 or 6 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, and S; However, R 2 is OH or OC 1-6 is alkyl, and X 1 is C-OH or C-OC 1-6 When Y is alkyl, [ka] Disclosed herein are compounds, or a pharma- ceutically acceptable salt thereof, provided that:

[0023] In the compound of formula (I), R 1 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, OC 1-6 Alkyl, C(=O)C 1-6 Alkyl, or C(=CH)C 1-6 In some cases, R 1 is C 1-6 In some cases, R 1 is C 1-3 In some cases, R 1 is n-propyl, isopropyl, ethyl, or methyl. 1 is a C alkyl. 1 teeth, [ka] In some cases, R 1 teeth, [ka] In some cases, R 1 teeth, [ka] In some cases, R 1 is C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, OC 1-6 Alkyl, C(=O)C 1-6 Alkyl, or C(=CH)C 1-6 In some cases, R 1 is C 1-6 haloalkyl (e.g., C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, or C haloalkyl). 1 is C 1-6 Optionally, R 1 is CF3, CHF2, or CH2F. In some cases, R 1 is C 1-6 hydroxyalkyl (e.g., C1 hydroxyalkyl, C2 hydroxyalkyl, C3 hydroxyalkyl, C4 hydroxyalkyl, C5 hydroxyalkyl, or C6 hydroxyalkyl). 1 teeth, [ka] In some cases, R 1 is O.C. 1-6 alkyl (e.g., OC1 alkyl, OC2 alkyl, OC3 alkyl, OC4 alkyl, OC5 alkyl, or OC6 alkyl). In some cases, R 1 teeth, [ka] In some cases, R 1 is C(=O)C 1-4 alkyl (e.g., C(=O)C1 alkyl, C(=O)C2 alkyl, C(=O)C3 alkyl, C(=O)C4 alkyl, C(=O)C5 alkyl, or C(=O)C6 alkyl). 1 teeth, [ka] In some cases, R 1 is C(=CH)C 1-6 alkyl (e.g., C(=CH)C1 alkyl, C(=CH)C2 alkyl, C(=CH)C3 alkyl, C(=CH)C4 alkyl, C(=CH)C5 alkyl, or C(=CH)C6 alkyl). 1 teeth, [ka] In some cases, R 1 teeth, [ka] It is.

[0024] In the compound of formula (I), R 2 OH, O.C. 1-6 Alkyl, N(R N1 )2, or halo. 2 OH or OC 1-6 In some cases, R 2 is OH. In some cases, R 2 is O.C. 1-6 alkyl (e.g., OC1 alkyl, OC2 alkyl, OC3 alkyl, OC4 alkyl, OC5 alkyl, or OC6 alkyl). In some cases, R 2 is OCH3. In some cases, R 2 is OH or OCH3. In some cases, R 2 is N(R N1)2, and each R N1 are independently H or C 1-6 alkyl (e.g., CH3, CH2CH3, CH2CH2CH3, or CH(CH3)2). N1 is independently H or CH. N1 is H. In some cases, each R N1 is CH3. In some cases, one R N1 is H and one R N1 is CH3. In some cases, R 2 is NH2. In some cases, R 2 is halo (e.g., F, Cl, Br, or I). 2 is Cl or F. In some cases, R 2 is F. In some cases, R 2 are OH, OCH3, N(R N1 ) 2, or F, and each R N1 is independently H or CH3.

[0025] In the compound of formula (I), X 1 is N, C-OH, or C-OC 1-6 In some cases, X may be an alkyl group. 1 is N. In some cases, X 1 is C-OH. In some cases, X 1 is C-OC 1-6 alkyl (e.g., C-OC1 alkyl, C-OC2 alkyl, C-OC3 alkyl, C-OC4 alkyl, C-OC5 alkyl, or C-OC6 alkyl). 1 is C-OCH3.

[0026] In some cases, R 2 is OH and X 1 is N. In some cases, R 2 is OH and X 1 is C-OH. In some cases, R 2 is NH2 and X 1 is C-OH. In some cases, R2 is NH2 and X 1 is N. In some cases, R 2 is F and X 1 is C-OH. In some cases, R 2 is OH and X1 is C-OCH3. 2 is OCH3 and X1 is C-OH. 2 is OCH3 and X1 is C-OCH3.

[0027] In some cases, R 1 teeth, [ka] and R 2 is OH, OCH3, F, or NH2, and X 1 is N, C-OH, or C-OCH3. 1 teeth, [ka] and R 2 is OH, OCH3, or NH2, and X 1 is N, C—OH, or C—OCH3.

[0028] In the compounds of formula (I), A can be an optionally substituted fused bicyclic heteroaryl group having 8-10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S. In some cases, A is an optionally substituted fused bicyclic heteroaryl group having 8 total ring atoms and 1 or 2 heteroatoms selected from N. In some cases, A is an optionally substituted fused bicyclic heteroaryl group having 9 total ring atoms and 1 or 2 heteroatoms selected from N or O. In some cases, A is an optionally substituted fused bicyclic heteroaryl group having 10 total ring atoms and 1 or 2 heteroatoms selected from N. In some cases, A is benzoxazolyl, benzimidazolyl, indolyl, isoindolyl, isoindolidinyl, purinyl, benzofuranyl, benzimidazole, quinolinyl, isoquinolinyl, naphthyridinyl, or pyridopyrazinyl, any of the foregoing being unsubstituted or substituted. In some cases, A is benzoxazolyl, benzimidazolyl, quinolinyl, isoquinolinyl, or naphthyridinyl, any of the foregoing being unsubstituted or substituted. Substitution is discussed in more detail below. In some cases, A is [ka] [ka] wherein any of the foregoing are unsubstituted or substituted.

[0029] In some cases, A is unsubstituted. In some cases, A is [ka] Optionally, A is unsubstituted, [ka] Optionally, unsubstituted A is selected from the group consisting of: [ka] In some cases, the unsubstituted A is [ka] It is.

[0030] In some cases, A is a fused bicyclic 8-10 membered heteroaryl and is substituted. In some cases, A is substituted with 1, 2, or 3 substituents, each of which is independently halo, OH, CN, COOH, C=OOC. 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, or N(R N1 )2, and each R N1 are independently H or C 1-6 Optionally, A is substituted with one substituent, and the substituent is halo, OH, CN, COOH, C=OOC. 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, or N(R N1 )2, and each R N1 are independently H or C 1-6 In some cases, A is substituted with two substituents, each of which is independently halo, OH, CN, COOH, C=OOC, 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, or N(R N1 )2, and each R N1 are independently H or C 1-6Optionally, A is substituted with three substituents, each of which is independently halo, OH, CN, COOH, C=OOC. 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, or N(R N1 )2, and each R N1 are independently H or C 1-6 Optionally, A is substituted and at least one substituent is alkyl. Optionally, A is substituted and at least one substituent is halo. Optionally, A is substituted and at least one substituent is F. Optionally, A is substituted and at least one substituent is Cl. Optionally, A is substituted and at least one substituent is OH. Optionally, A is substituted and at least one substituent is CN. Optionally, A is substituted and at least one substituent is COOH. Optionally, A is substituted and at least one substituent is C=OOC. 1-6 Optionally, A is substituted and at least one of the substituents is C=OOCH3. Optionally, A is substituted and at least one of the substituents is C=OOCH3. Optionally, A is substituted and at least one of the substituents is C=OOCH3. 1-6 Optionally, A is substituted and at least one of the substituents is CH. Optionally, A is substituted and at least one of the substituents is C. 1-6 haloalkyl (e.g., C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, or C haloalkyl). Optionally, A is substituted and at least one of the substituents is C 1-6Optionally, A is substituted and at least one of the substituents is CF, CHF, or CHF. Optionally, A is substituted and at least one of the substituents is OC. 1-6 Optionally, A is substituted and at least one of the substituents is OCH. Optionally, A is substituted and at least one of the substituents is OC. 1-6 haloalkyl (e.g., OC1 haloalkyl, OC2 haloalkyl, OC3 haloalkyl, OC4 haloalkyl, OC5 haloalkyl, or OC6 haloalkyl). Optionally, A is substituted and at least one of the substituents is OC 1-6 Optionally, A is substituted and at least one of the substituents is OCF3, OCHF2, or OCH2F. Optionally, A is substituted and at least one of the substituents is C=OC 1-6 Optionally, A is substituted and at least one substituent is C=OCH. Optionally, A is substituted and at least one substituent is N(R N1 )2, and each R N1 are independently H or C 1-6 alkyl (e.g., CH3, CH2CH3, CH2CH2CH3, or CH(CH3)2). N1 is independently H or CH. N1 is H. In some cases, each R N1 is CH3. In some cases, one R N1 is H and one R N1 is CH3. Optionally, A is substituted and at least one of the substituents is N(CH3)2, NHCH3, or NH2. Optionally, A is substituted and at least one of the substituents is NH2. Optionally, A is substituted with 1, 2, or 3 substituents, each of which is independently F, Cl, OH, CN, COOH, CH3, OCH3, CF3, OCF3, NH2, NHCH3, or NH(CH3)2. Optionally, A is [ka] [ka] In some cases, A may [ka] In some cases, A may [ka] It is.

[0031] In some cases, A: [ka] In some cases, Y is [ka] Optionally, Y is O, S, S=O, or SO2. [ka] Optionally, Y is O, S, S=O, or SO2. Optionally, Y is O or S. Optionally, Y is S=O or SO2. Optionally, Z is an optionally substituted phenyl group or an optionally substituted heteroaryl group having 5 or 6 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, and S. Optionally, Z is an optionally substituted phenyl group. Optionally, Z is an unsubstituted phenyl group. Optionally, Z is an unsubstituted heteroaryl group having 6 total ring atoms and 1 or 2 heteroatoms selected from N, O, S. Optionally, Z is unsubstituted pyridyl. Optionally, A is [ka] In some cases, Y is O, S, S=O, or SO2, and Z is pyridyl. In some cases, Y is [ka] and Z is phenyl or pyridyl. [ka] Optionally, Z is substituted. Optionally, Z is a substituted phenyl group. Optionally, Z is a substituted heteroaryl group having 6 total ring atoms and 1 or 2 heteroatoms selected from N, O, S. Optionally, Z is a substituted pyridyl group. Optionally, Z is a substituted phenyl group or a substituted pyridyl group. Optionally, Z is substituted with 1, 2, or 3 substituents, each of which is selected from halo, OH, CN, COOH, COOC ... 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Haloalkyl, OC 1-6 Alkyl, OC 1-6 Haloalkyl, C=OC 1-6 Alkyl, and N(R N1 )2, and each R N1are independently H or C 1-6 Optionally, Z is substituted with OH. Optionally, Z is substituted with CN. Optionally, Z is substituted with COOH. Optionally, Z is C=OOC. 1-6 Optionally, Z is substituted with C=OOC3 alkyl. Optionally, Z is substituted with C=OOC4 alkyl. Optionally, Z is substituted with C=OOC5 alkyl, C=OOC6 alkyl, or C=OOC1 alkyl. 1-6 Optionally, Z is substituted with alkyl (e.g., CH3, CH2CH3, CH2CH2CH3, or CH(CH3)2). Optionally, Z is substituted with CH3. Optionally, Z is C 1-6 Optionally, Z is substituted with haloalkyl (e.g., C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, C haloalkyl, or C haloalkyl). 1-6 Optionally, Z is substituted with CF3, CHF2, or CH2F. Optionally, Z is substituted with OC 1-6 Optionally, Z is substituted with OCH3. Optionally, Z is substituted with OC 1-6 Optionally, Z is substituted with OC haloalkyl (e.g., OC1 haloalkyl, OC2 haloalkyl, OC3 haloalkyl, OC4 haloalkyl, OC5 haloalkyl, or OC6 haloalkyl). 1-6 Optionally, Z is substituted with OCF3, OCHF2, or OCH2F. Optionally, Z is substituted with C=OC 1-6 Optionally, Z is substituted with C=OCH3. Optionally, Z is substituted with N(R N1 )2, and each RN1 are independently H or C 1-6 alkyl (e.g., CH3, CH2CH3, CH2CH2CH3, or CH(CH3)2). N1 is independently H or CH. N1 is H. In some cases, each R N1 is CH3. In some cases, one R N1 is H and one R N1 is CH3. Optionally, Z is substituted with N(CH3)2, NHCH3, or NH2. Optionally, Z is substituted with NH2. Optionally, Z is substituted with 1, 2, or 3 substituents, each of which is independently F, Cl, OH, CN, COOH, CH3, OCH3, CF3, OCF3, NH2, NHCH3, or NH(CH3)2. Optionally, A is [ka] It is.

[0032] In some cases, R 1 teeth, [ka] and R 2 is OH, OCH3, or NH2, X1 is N, C-OH, or C-OCH3, A is unsubstituted quinolinyl, unsubstituted isoquinolinyl, unsubstituted benzoxazolyl, or [ka] It is.

[0033] Contemplated compounds of the present disclosure include, but are not limited to, those listed in Tables A, B, C, and D below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 2-1] [Table 2-2] [Table 3] [Table 4-1] [Table 4-2]

[0034] In some cases, A is an optionally substituted fused bicyclic heteroaryl group having 8-10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S, and the compound of formula (I) is selected from the compounds listed in Table A, or a pharma- ceutically acceptable salt of any of the foregoing. In some cases, the compound of formula (I) is [ka] or a pharma- ceutically acceptable salt of any of the foregoing. Optionally, the compound of formula (I) is selected from the compounds listed in Table B, or a pharma- ceutically acceptable salt thereof. Optionally, A is [ka] and the compound of formula (I) is compound 103, 112-117, 125, 135, 136, or a pharma- ceutically acceptable salt of any of the foregoing. [ka] and the compound of formula (I) is 103, 112, 113, 114, 115, 116, 117, 136, or a pharma- ceutically acceptable salt of any of the foregoing. [ka] and the compound of formula (I) is 125, 135, or a pharma- ceutically acceptable salt of any of the foregoing. Optionally, the compound of the present disclosure is 107, 108, 110, 111, 137, or a pharma- ceutically acceptable salt of any of the foregoing. Optionally, the compound of formula (I) is [ka] or a pharma- ceutically acceptable salt of any of the foregoing. Optionally, the compound of formula (I) is selected from the compounds listed in Table C, or a pharma- ceutically acceptable salt thereof. Optionally, the compound of the present disclosure is selected from the compounds listed in Table D, or a pharma- ceutically acceptable salt thereof. Optionally, the compound of formula (I) is [ka] [ka] or a pharma- ceutically acceptable salt of any of the foregoing.

[0035] Unless otherwise indicated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, cis-trans, conformational, and rotational) forms of the structure. For example, the R and S configurations of each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers are included in the disclosure unless only one of the isomers is specifically indicated. Thus, single stereochemical isomers of the compounds of the invention, as well as enantiomeric, diastereomeric, cis / trans, conformational, and rotational mixtures, are within the scope of the disclosure. In some cases, the compounds disclosed herein are stereoisomers. "Stereoisomer" refers to a compound that differs in the chirality of one or more stereocenters. Stereoisomers include enantiomers and diastereomers. The compounds disclosed herein can exist as single stereoisomers or as mixtures of stereoisomers. The stereochemistry of the compounds depicted herein indicates relative, not absolute, stereochemistry, unless otherwise discussed. As used herein, a single stereoisomer, diastereomer, or enantiomer refers to a compound that is at least 50% or more of the depicted stereoisomer, diastereomer, or enantiomer, and in some cases, at least 90% or 95% of the depicted stereoisomer, diastereomer, or enantiomer.

[0036] Compounds disclosed herein having a double bond can exhibit E or Z (not shown) stereochemistry at the double bond. In some cases, compounds of formula (I) exhibit E stereochemistry at the double bond. In various cases, compounds of formula (I) exhibit Z stereochemistry at the double bond. Compounds of formula (I) are sp 3 Carbon atom can have any stereochemical configuration. In some cases, the compound of the present disclosure is optically pure. As used herein, "optically pure" refers to the presence of only one enantiomer of a compound when multiple stereochemical configurations can exist.

[0037] Unless otherwise stated, all tautomeric forms of the compounds of the present disclosure are within the scope of the present disclosure.

[0038] Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, the replacement of hydrogen with deuterium or tritium, or 11 C- 13 C-, or 14 Compounds having this structure, except for the replacement of carbon with a C-enriched carbon, are within the scope of the present disclosure. Such compounds are useful, for example, as analytical tools or probes in biological assays. Such compounds, particularly deuterium analogs, may also be therapeutically useful. Thus, further disclosed herein are deuterated compounds or salts of formula (I) in which one or more isotopes of hydrogen are replaced with deuterium. Further disclosed herein are compounds of formula (I) having one or more tritium atoms. Also, one or more carbon atoms may be replaced with one or more C 11 Atom, one or more C 13 Atom, one or more C 14 Disclosed herein are compounds of formula (I) that are replaced by one or more carbon isotopes, such as atoms, or any combination of the foregoing.

[0039] The compounds of the present disclosure are defined herein by their chemical structure and / or chemical name. If a compound is referred to by both a chemical structure and a chemical name, and the chemical structure and chemical name conflict, the chemical structure is determinative of the compound's identity.

[0040] As used herein, "alkyl" refers to straight-chain and branched saturated hydrocarbon groups containing 1 to 30 carbon atoms, e.g., 1 to 4 carbon atoms (e.g., 1, 2, 3, 4, 5, or 6). n The term means that the alkyl group has "n" carbon atoms. For example, C alkyl refers to an alkyl group having 3 carbon atoms. 1-6Alkyl refers to alkyl groups having any number of carbon atoms (i.e., 1-6 carbon atoms) inclusive of all ranges, as well as all subgroups (e.g., 1-2, 1-3, 1-4, 1-5, 2-3, 2-4, 2-5, 2-6, 3-4, 3-5, 3-6, 4-5, 4-6, 1, 2, 3, 4, 5, and 6 carbon atoms). Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl (2-methylpropyl), and t-butyl (1,1-dimethylethyl). Unless otherwise indicated, the alkyl group can be an unsubstituted alkyl group or a substituted alkyl group.

[0041] As used herein, "alkylene" refers to a divalent saturated aliphatic radical. n The term alkylene means that the group has "n" carbon atoms. For example, C 1-6 Alkylene refers to alkylene groups having any number of carbon atoms, including all of the subgroups as described above for "alkyl" groups.

[0042] As used herein, the term "haloalkyl" refers to an alkyl group in which one or more of the hydrogen atoms are replaced by halogen. Such groups include, but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, 1,1-difluoroethyl, 2-fluoroethyl, 1-chloro-2-fluoromethyl, and 2-fluoroisobutyl. Haloalkyl can be further substituted or unsubstituted, and in some cases, for example, C 1-6 haloalkyl, such as haloalkyl having 1 to 6 carbon atoms.

[0043] As used herein, the term "hydroxyalkyl" refers to an alkyl group in which one or more of the hydrogen atoms have been replaced by a hydroxyl group (OH). Such groups include, but are not limited to, hydroxymethyl, hydroxyethyl, and the like. Hydroxyalkyl can be further substituted or unsubstituted, and in some cases includes, for example, C 1-6 It relates to hydroxyalkyl having 1 to 6 carbon atoms, such as hydroxyalkyl.

[0044] As used herein, the term "aryl" refers to a monocyclic or bicyclic aromatic group having 6 to 14 total ring atoms. Unless otherwise indicated, an aryl group can be unsubstituted or substituted. An aryl group can be isolated (e.g., phenyl) or fused to another aryl group (e.g., naphthyl, or anthracenyl).

[0045] As used herein, the term "heteroaryl" refers to a cyclic aromatic ring having 5-12 total ring atoms (e.g., a monocyclic aromatic ring having 5-6 total ring atoms) and containing 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur atoms in the aromatic ring. Unless otherwise indicated, a heteroaryl group can be unsubstituted or substituted. A heteroaryl group can be isolated (e.g., pyridyl) or fused to another heteroaryl group (e.g., purinyl), a cycloalkyl group (e.g., tetrahydroquinolinyl), a heterocycloalkyl group (e.g., dihydronaphthyridinyl), and / or an aryl group (e.g., benzothiazolyl and quinolyl). Examples of heteroaryl groups include, but are not limited to, pyrazolyl, thienyl, furyl, pyridyl, pyrrolyl, oxazolyl, quinolyl, thiophenyl, isoquinolyl, indolyl, triazinyl, triazolyl, isothiazolyl, isoxazolyl, imidazolyl, benzothiazolyl, pyrazinyl, pyrimidinyl, thiazolyl, and thiadiazolyl. In some cases, a heteroaryl group is fused to another heteroaryl group, where each ring may contain 5 or 6 total ring atoms and 1 to 3 heteroatoms in its aromatic ring. Examples of fused heteroaryl groups include, but are not limited to, benzoxazolyl, benzimidazolyl, indolyl, isoindolyl, indolizinyl, purinyl, benzofuranyl, benzimidazole, quinolinyl, isoquinolinyl, naphthyridinyl, and pyridopyrazinyl.

[0046] As used herein, the term "halo" refers to a fluoro (F), chloro (Cl), bromo (Br), or iodo (I) group.

[0047] A "substituted" functional group (e.g., substituted alkyl, alkylenyl, cycloalkyl, aryl, or heteroaryl refers to alkyl, alkylenyl, cycloalkyl, aryl, or heteroaryl) is a functional group having at least one hydrogen radical replaced with a non-hydrogen radical (i.e., a substituent). Examples of non-hydrogen radicals (or substituents) include, but are not limited to, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, ether, aryl, heteroaryl, heterocycloalkyl, hydroxyl, oxy (or oxo), alkoxyl, ester, thioester, acyl, carboxyl, cyano, nitro, amino, sulfhydryl, and halo. When a substituted alkyl group contains more than one non-hydrogen radical, the substituents can be attached to the same carbon or to two or more different carbon atoms.

[0048] Pharmaceutically acceptable salts The compounds described herein can be in free form or, where appropriate, as salts.Pharmaceutically acceptable salts are particularly interesting because they are useful for administering the compounds described herein for medical purposes.Pharmaceutically unacceptable salts are useful in the manufacturing process, for the purpose of isolation and purification, and in some cases, for use in the separation of stereoisomeric forms of the compounds of the present disclosure or their intermediates.

[0049] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of a compound that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue adverse effects, such as toxicity, irritation, allergic response, and the like, and is commensurate with a reasonable benefit / risk ratio.

[0050] Pharmaceutically acceptable salts are well known in the art.For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in J.Pharmaceutical Sciences, 1977,66,1-19, which is incorporated herein by reference.The pharmaceutically acceptable salts of the compounds described herein include those derived from suitable inorganic and organic acids and bases.These salts can be prepared in situ during the final isolation and purification of the compound.

[0051] When the compounds described herein contain a basic group, or a sufficiently basic bioisostere, an acid addition salt can be prepared by 1) reacting the purified compound in its free base form with a suitable organic or inorganic acid and 2) isolating the salt thus formed. In practice, the acid addition salt may be a more convenient form for use, and use of the salt amounts to use of the free base form.

[0052] Examples of pharma- ceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric, hydrobromic, phosphoric, sulfuric, and perchloric acids, or with organic acids such as acetic, oxalic, maleic, tartaric, citric, succinic, or malonic acids, or by using other methods used in the art, such as ion exchange. Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, glycolate, gluconate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxy-ethoxybenzoate ... Examples of salts that can be used include benzenesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate.

[0053] When the compounds described herein contain a carboxyl group or a sufficiently acidic bioisostere, a base addition salt can be prepared by 1) reacting the purified compound in its acid form with a suitable organic or inorganic base, and 2) isolating the salt thus formed. In practice, the use of a base addition salt may be a more convenient form, and the use of the salt form is essentially equivalent to the use of the free acid form. Salts derived from appropriate bases include alkali metals (e.g., sodium, lithium, and potassium), alkaline earth metals (e.g., magnesium and calcium), ammonium, and N +(C1-4 alkyl)4 salts. The present disclosure also contemplates the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may be obtained by such quaternization.

[0054] Basic addition salts include pharmaceutically acceptable metal salts and amine salts. Suitable metal salts include sodium, potassium, calcium, barium, zinc, magnesium, and aluminum. Sodium and potassium salts are usually preferred. Further pharmaceutically acceptable salts include amine cations formed with non-toxic ammonium, quaternary ammonium, and counterions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates, where appropriate. Suitable inorganic basic addition salts are prepared from metal bases including sodium hydride, sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminum hydroxide, lithium hydroxide, magnesium hydroxide, zinc hydroxide, and the like. Suitable amine basic addition salts are prepared from amines that are frequently used in medicinal chemistry due to their low toxicity and acceptability for medical applications. Ammonia, ethylenediamine, N-methyl-glucamine, lysine, arginine, ornithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris(hydroxymethyl)-aminomethane, tetramethylammonium hydroxide, triethylamine, dibenzylamine, ephenamine, dehydroabietylamine, N-ethylpiperidine, benzylamine, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, ethylamine, basic amino acids, dicyclohexylamine, etc.

[0055] Other acids and bases may be used in the preparation of salts which, while not themselves pharma- ceutically acceptable, are useful as intermediates to obtain the compounds described herein and their pharma- ceutically acceptable acid or base addition salts.

[0056] It is understood that the compounds disclosed herein can exist as mixtures / combinations of different pharma-ceutically acceptable salts. Also contemplated are mixtures / combinations of the free form of the compounds and pharma-ceutically acceptable salts.

[0057] Pharmaceutical preparations Also provided herein is a pharmaceutical formulation comprising an effective amount of a compound of the present disclosure and one or more pharma- ceutically acceptable excipients. As used herein, the term "formulation" is used interchangeably with "composition."

[0058] An "effective amount" includes a "therapeutically effective amount" and a "prophylactically effective amount." The term "therapeutically effective amount" refers to an amount effective to treat and / or ameliorate a disease or condition in a subject. The term "prophylactically effective amount" refers to an amount effective to prevent and / or substantially reduce the likelihood of a disease or condition in a subject. As used herein, the terms "patient" and "subject" may be used interchangeably and refer to animals such as dogs, cats, cows, horses, and sheep (i.e., non-human animals) as well as humans. A particular patient or subject is a mammal (e.g., a human). The terms "patient" and "subject" include both genders.

[0059] As used herein, the term "excipient" means any pharma- ceutically acceptable additive, carrier, diluent, adjuvant, or other ingredient other than the active pharmaceutical ingredient (API), suitably selected with regard to the intended form of administration and consistent with conventional pharmaceutical practice.

[0060] The compound of the present disclosure can be administered alone or as part of a pharma-ceutically acceptable composition or formulation.In addition, the compound can be administered once, for example, by bolus injection, or can be administered multiple times, for example, by a series of tablets, or can be delivered substantially uniformly over a period of time, for example, by using transdermal delivery.It should also be noted that the dose of the compound can vary over time.

[0061] The compounds disclosed herein and other pharmaceutically active compounds can be administered to a subject or patient by any suitable route, for example, orally, topically, rectally, parenterally (e.g., subcutaneous injection, intravenous, intramuscular, intrasternal, and intrathecal injection or infusion techniques), or as a buccal, inhalation, or nasal spray, as desired. Administration can be to produce a systemic effect (e.g., enterally or parenterally). All methods that can be used by those skilled in the art to administer pharmaceutically active agents are contemplated. In some cases, the disclosed formulations can be administered orally or topically.

[0062] Suitable oral compositions or formulations according to the present disclosure include, but are not limited to, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, syrups, or elixirs. Compositions or formulations suitable for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions.

[0063] Liquid dosage forms for oral administration include, but are not limited to, pharma- ceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs.In addition to the active compounds, liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and mixtures thereof.In addition to inert diluents, oral compositions may also contain adjuvants, such as wetting agents, emulsifiers, and suspending agents, sweeteners, flavoring agents, and flavoring agents.

[0064] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert pharma- ceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium laurate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents.

[0065] Solid compositions of a similar type may also be used as fillers for soft and hard filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycols, and the like. Solid dosage forms of tablets, dragees, capsules, pills, and granules may be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may optionally contain opacifying agents, and may also be of a composition that releases the active ingredient only, or preferably in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that may be used include polymeric substances and waxes. Solid compositions of a similar type may also be used as fillers for soft and hard filled gelatin capsules using excipients such as lactose or milk sugar, and high molecular weight polethylene glycols, and the like.

[0066] The active compound may also be in microencapsulated form with one or more excipients as described above. The solid dosage forms of tablets, dragees, capsules, pills, and granules may be prepared with coatings and shells, such as enteric coatings, release controlling coatings, and other coatings well known in the pharmaceutical formulation art. In such solid dosage forms, the active compound may be mixed with at least one inert diluent, such as sucrose, lactose, or starch. Such dosage forms may also contain, as is normal practice, additional substances other than the inert diluent, such as tableting lubricants and other tableting aids, such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may also contain buffering agents. They may optionally contain opacifying agents, and may also be of a composition that releases the active ingredient only, or preferably in a certain part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that may be used include polymeric substances and waxes.

[0067] The pharmaceutical compositions and formulations described herein can be administered topically or transdermally, especially when the target of treatment includes areas or organs that are easily accessible by topical application, including diseases of the eye, skin, or lower intestinal tract.Suitable topical formulations are easily prepared for each of these areas or organs.Topical application for the lower intestinal tract can be carried out, for example, in a rectal suppository formulation or in a suitable enema formulation.The dosage forms for topical or transdermal administration of the compounds described herein include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, suppositories, or patches.

[0068] For topical application, pharmaceutical compositions can be formulated into suitable ointments, creams, lotions, or gels, containing the active ingredient suspended or dissolved in one or more carriers, and any necessary preservatives or buffers as may be required.Carriers for topical administration of the compounds of the present disclosure include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax, and water.Alternatively, pharmaceutical compositions can be formulated into suitable lotions or creams, containing the active ingredient suspended or dissolved in one or more pharma- ceutically acceptable carriers.Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2 octyl dodecanol, benzyl alcohol, and water.

[0069] Ophthalmic formulations, ear drops, and eye drops are also contemplated as being within the scope of the present disclosure. Additionally, the present disclosure contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in a suitable medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by providing a rate-controlling membrane or dispersing the compound in a polymer matrix or gel.

[0070] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions, or emulsions in non-toxic parenterally acceptable diluents or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, USP, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally used as a solvent or suspending medium. For this purpose, any bland fixed oil can be used, including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

[0071] The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water, or other sterile injectable medium prior to use.

[0072] In order to prolong the effect of the compounds described herein, it is often desirable to slow down the absorption of the compound from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material that is poorly water soluble. The rate of absorption of the compound then depends on its rate of dissolution, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsulated matrices of the compound in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of compound to polymer and the nature of the particular polymer used, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Injectable depot formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0073] Compositions for rectal or vaginal administration are specifically suppositories, which can be prepared by mixing the compounds described herein with a suitable non-irritating excipient or carrier, such as cocoa butter, polyethylene glycol or a suppository wax, which is solid at ambient temperature but liquid at body temperature and thus will melt in the rectum or vaginal cavity and release the active compound.

[0074] Sterile injectable forms of the compositions disclosed herein may be aqueous or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be used are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally used as a solvent or suspending medium. For this purpose, any bland fixed oil may be used, including synthetic mono- or di-glycerides. Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharma- ceutical acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated form. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants, such as carboxymethylcellulose, or similar dispersants commonly used in the formulation of pharma- ceutically acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants, such as Tweens, Spans, and other emulsifiers or bioavailability enhancers, commonly used in the manufacture of pharma- ceutically acceptable solid, liquid, or other dosage forms, may also be used for formulation purposes.

[0075] Pharmaceutical compositions may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the art of pharmaceutical formulation and may be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons and / or other conventional solubilizing or dispersing agents.

[0076] The compounds for use in the methods of the present disclosure can be formulated in unit dosage form. The term "unit dosage form" refers to a physically discrete unit suitable as a unitary dosage for the subject undergoing treatment, each unit containing a predetermined amount of active material calculated to produce a desired therapeutic effect, optionally with a suitable pharmaceutical carrier. The unit dosage form can be one daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form can be the same or different for each dose.

[0077] The compounds of the present disclosure can be administered to a subject or patient at dosage levels ranging from about 0.1 to about 3,000 mg per day. For a normal adult human having a body weight of about 70 kg, a dosage ranging from about 0.01 to about 100 mg per kilogram body weight is typically sufficient. The specific dosage and dosage range used can potentially depend on a number of factors, including the requirements of the subject or patient, the severity of the condition or disease being treated, and the pharmacological activity of the compound being administered. Determination of dosage ranges and optimal dosages for a particular subject or patient is within the skill of the art.

[0078] Treatment methods The compounds disclosed herein (e.g., compounds of formula (I), compounds listed in Tables A, B, C, and D) and their pharma- ceutically acceptable salts can modulate the aryl hydrocarbon receptor (AHR) pathway, for example, by modulating AHR in cells. In some cases, the compounds disclosed herein act as agonists of AHR. In some cases, the compounds disclosed herein act as antagonists of AHR. AHR is a ligand-activated transcription factor that is involved in a variety of conditions, including regulating the immune system during steady state and during infection and inflammation. The AHR pathway has been recognized for its role in the pathogenesis of inflammatory skin diseases such as atopic dermatitis, acne, psoriasis, and vitiligo, intestinal pathologies such as inflammatory bowel disease, necrotizing enterocolitis, and other autoimmune diseases, as well as bone and joint diseases and disorders, including colorectal cancer, rheumatoid arthritis, eye diseases such as age-related macular degeneration, and lung diseases such as pulmonary fibrosis and chronic obstructive pulmonary disease. The AHR pathway is also recognized for its role in the pathogenesis of diseases and disorders, including neuroinflammatory diseases and disorders, neurodegenerative diseases and disorders, cancer, diabetes, viral, and bacterial infections.

[0079] Thus, the present disclosure provides a method of modulating aryl hydrocarbon receptor (AHR) in a cell, comprising contacting the cell with a therapeutically effective amount of a compound or salt disclosed herein (e.g., a compound of formula (I), a compound listed in Tables A, B, C, and D, and a pharma- ceutically acceptable salt of any of the foregoing), or a formulation thereof, in an amount effective to modulate AHR. In some cases, the contacting occurs in vitro. In some cases, the contacting occurs in vivo. In some cases, the contacting includes administering to a subject in need thereof. As used herein, the terms "patient" and "subject" may be used interchangeably and refer to animals such as dogs, cats, cows, horses, and sheep (i.e., non-human animals), as well as humans. A particular patient is a mammal (e.g., a human). In some cases, the subject suffers from an inflammatory disease or disorder. In some cases, the subject suffers from a disease or disorder of the digestive tract, skin, lungs, eyes, or bone joints. In some cases, the subject suffers from cancer or a viral infection.

[0080] Another aspect of the disclosure provides a method of treating a disease or disorder in a subject, comprising administering to the subject a therapeutically effective amount of a compound or salt disclosed herein (such as a compound of Formula (I) or a compound listed in Tables A, B, C, or D), or a formulation thereof. In some cases, the terms "treating," "treat," or "treatment," and the like, can include preventative (e.g., prophylactic) and palliative treatment. In some cases, the disease or disorder is an inflammatory disease or disorder. In some cases, the disease or disorder is a disease or disorder of the gastrointestinal tract, skin, lung, central nervous system ("CNS"), pancreas, eye, bone, or osteoarticular disease or disorder, a neuroinflammatory disease, or a neurodegenerative disease. In some cases, the disease or disorder is diabetes, cancer, a viral infection, or a bacterial infection.

[0081] In some cases, the gastrointestinal disease or disorder is colitis, inflammatory bowel disease, Crohn's disease, celiac disease, necrotizing enterocolitis, irritable bowel syndrome, chronic idiopathic constipation, traveler's diarrhea, or colorectal cancer. In some cases, the gastrointestinal disease or disorder is colitis, inflammatory bowel disease, Crohn's disease, celiac disease, necrotizing enterocolitis, or irritable bowel syndrome. In some cases, the eye disease or disorder is abnormal eye movement, inflammatory eye disease, autoimmune eye disease, genetic eye disease, degenerative eye disease, angiogenic eye disease, dry and wet age-related macular degeneration ("AMD"), uveitis, retinitis pigmentosa ("RP"), primary open angle glaucoma ("POAG"), primary congenital glaucoma, Behcet's disease, or Leber's congenital amaurosis ("LCA"). In some cases, the skin disease or disorder is atopic dermatitis, acne, psoriasis, or vitiligo. In some cases, the bone or osteoarticular disease or disorder is osteoporosis, rheumatoid arthritis, or bone cancer. In some cases, the central nervous system disease or disorder is Alzheimer's disease and other memory disorders, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease, or motor neuron disease). In some cases, the pancreatic disease or disorder is type 1 diabetes. In some cases, the autoimmune disease or disorder is hidradenitis suppurativa, systemic sclerosis, lupus nephritis, ankylosing spondylitis, non-radiographic axial spondyloarthritis (NR-Ax-SpA), rheumatoid arthritis, juvenile idiopathic arthritis (JIA), Crohn's disease, ulcerative colitis, systemic lupus erythematosus, atopic dermatitis, chronic obstructive pulmonary disease, severe asthma, psoriasis, Sjogren's disease, chronic spontaneous urticaria, cutaneous lupus erythematosus, Still's disease, idiopathic pulmonary fibrosis, dermatomyositis, sarcoidosis, psoriatic arthritis, pustular psoriasis, osteoarthritis, alopecia areata, giant cell arteritis (GCA), ANCA vasculitis, vasculitis, eosinophilic esophagitis, acute respiratory distress syndrome, severe acne, or lichen planus. In some cases, the neuroinflammatory disease or disorder is multiple sclerosis, Rasmussen's encephalitis, acute disseminated encephalomyelitis (ADEM), autoimmune encephalitis, transverse myelitis (TM), or anti-NMDA receptor encephalitis. In some cases, the neurodegenerative disease or disorder is uveitis, optic neuritis, neuromyelitis optica spectrum disorder (NMOSD), or age-related macular degeneration (AMD).

[0082] In some cases, the disease or disorder is diabetes (e.g., type 1 diabetes or type 2 diabetes). In some cases, the disease or disorder is cancer. Contemplated cancers that can be treated using the compounds and methods described herein include, but are not limited to, blood cancer, lymphoma, myeloma, leukemia, neurological cancer, skin cancer, breast cancer, prostate cancer, respiratory cancer, reproductive cancer, digestive tract cancer, colorectal cancer, lung cancer, head and neck cancer, gastrointestinal cancer, liver cancer, pancreatic cancer, genitourinary cancer, bone cancer, kidney cancer, and vascular cancer.

[0083] In some cases, the disease or disorder is a viral infection. In some cases, the compounds of the present disclosure (e.g., compounds of formula (I), compounds listed in Tables A, B, C, and D, and pharma- ceutically acceptable salts of any of the foregoing), or compositions thereof, are useful for treating viral infections. In some cases, viral infections treated using the compounds and methods described herein include, but are not limited to, coronavirus infections (e.g., SARS, MERS, and COVID-19, such as SARS-CoV infection, MERS-CoV infection, and SARS-CoV-2 infection, respectively), and flavivirus infections (e.g., West Nile virus infection, dengue virus infection, tick-borne encephalitis virus infection, yellow fever virus infection, Zika virus infection, and several other viruses that can cause encephalitis).

[0084] In some cases, the disease or disorder is a bacterial infection. In some cases, the compounds of the present disclosure (e.g., compounds of formula (I), compounds listed in Tables A, B, C, and D, and pharma- ceutically acceptable salts of any of the foregoing), or compositions thereof, are useful for treating bacterial infections. In some cases, the bacterial infections treated using the compounds and methods described herein include, but are not limited to, pulmonary infections, gastrointestinal infections, skin infections, ear infections, or sepsis.

[0085] Another aspect of the disclosure provides for the use of a compound disclosed herein (such as a compound of Formula (I) or a compound listed in Tables A, B, C, or D), a pharma- ceutically acceptable salt thereof, or a formulation comprising a compound or salt disclosed herein, in the treatment of an inflammatory disease or disorder, a neuroinflammatory disease or disorder, or a neurodegenerative disease or disorder, such as a disease or disorder of the gastrointestinal tract, skin, lung, central nervous system, pancreas, eye, bone, or osteoarticular.

[0086] Also contemplated is the use of a compound disclosed herein (such as a compound of Formula (I), or a compound listed in Tables A, B, C, or D), a pharma- ceutically acceptable salt thereof, or a formulation comprising a compound or salt disclosed herein, for the manufacture of a medicament in the treatment of inflammatory diseases or disorders, neuroinflammatory diseases and disorders, or neurodegenerative diseases and disorders, such as diseases or disorders of the gastrointestinal tract, skin, lungs, central nervous system, pancreas, eye, bone, or osteoarticular.

[0087] Also contemplated is the use of a compound disclosed herein (such as a compound of Formula (I) or a compound listed in Tables A, B, C, or D), a pharma- ceutically acceptable salt thereof, or a formulation comprising a compound or salt disclosed herein, to treat inflammatory diseases or disorders, neuroinflammatory diseases and disorders, or neurodegenerative diseases and disorders, such as diseases or disorders of the gastrointestinal tract, skin, lungs, central nervous system, pancreas, eye, bone, or osteoarticular.

[0088] In some cases, the compounds of formula (I) disclosed herein, or pharma- ceutically acceptable salts thereof, can be administered in combination with another therapeutic agent to treat a disease or disorder, such as a disease or disorder disclosed herein. In some cases, the combination therapy can be used to treat an inflammatory disease or disorder, such as a disease or disorder of the gastrointestinal tract, skin, eye, lung, or bone and joint. As used herein, the terms "co-administration," "administration with," "administration in combination with," and the like, encompass administration of selected therapeutic agents to a single patient, and are intended to include therapeutic regimens in which agents are administered by the same or different routes of administration, or at the same or different times. Thus, in any of the methods disclosed herein, the treatment of a disease or disorder disclosed herein, such as an inflammatory disease or disorder (e.g., a disease or disorder of the gastrointestinal tract, skin, lung, central nervous system, pancreas, eye, bone, or osteoarticular, neuroinflammatory disease and disorder, or neurodegenerative disease and disorder) includes co-administration of a compound of the present disclosure (a compound of formula (I) or a compound listed in Tables A, B, C, or D), a pharma- ceutically acceptable salt thereof, or a formulation comprising a compound or salt disclosed herein, in combination with another therapeutic agent. In some cases, the other therapeutic agent is an anti-inflammatory agent. Anti-inflammatory agents contemplated for co-administration with the compounds of the present disclosure include, for example, mesalazine, naproxen, ibuprofen, diclofenac, celecoxib, sulindac, oxaprozin, piroxicam, indomethacin, meloxicam, fenoprofen, difnisal, etodolac, ketorolac tromethamine, meclofenamate, nabumetone, salsalate, or any combination of the foregoing.

[0089] In jurisdictions that prohibit the patenting of processes performed on the human body, the meaning of "administering" a composition to a human subject or patient should be limited to prescribing a controlled substance to be self-administered by any technique (e.g., orally, inhalation, topical application, injection, insertion, etc.). The broadest reasonable interpretation consistent with the statute or regulation governing patentable subject matter is intended. In jurisdictions that do not prohibit the patenting of processes performed on the human body, "administering" a composition includes both the process performed on the human body and the aforementioned acts.

[0090] Synthesis of Compounds of the Disclosure The compounds of the present disclosure can be synthesized by any method known in the art. For example, the compounds of the present disclosure (the compounds of formula (I) and the compounds listed in Tables A, B, C, and D) can be synthesized according to Schemes 1, 2, and 3.

[0091] Compounds where A is an optionally substituted fused bicyclic heteroaryl group having 8-10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S, can be synthesized, for example, via Suzuki coupling, as shown in Scheme 1 below. [ka] Coupling of the desired phenyl or pyridiyl moiety a with the desired fused bicyclic heteroaryl group (Het) conjugated to an organoboronic acid b provides compounds c of the present disclosure.

[0092] A [ka] Compounds of the present disclosure can be synthesized, for example, via a Horner-Wadsworth-Emmons reaction, as shown in Scheme 2 below. [ka] Reaction of the desired aldehyde a' with the desired aryl or heteroaryl group ("Ar / Het") b' and diethyl benzoylphosphonate provides compound c' of the present disclosure.

[0093] Compounds of the present disclosure where Y is O, S, S=O, or SO2 can be synthesized as shown in Scheme 3 below. [ka] Coupling of 1,3,5-trifluoro-2-nitrobenzene a" with the desired aryl or heteroaryl group ("Ar / Het") conjugated to OH or SNa(Y") b" in a nucleophilic aromatic substitution reaction gives compound c", which can be derivatized with NO2, OMe, and / or Y' groups using standard methods known in the art to arrive at compounds of the present disclosure. EXAMPLES

[0094] The following examples are offered for illustrative purposes and are not intended to limit the scope of the invention.

[0095] Example 1 - Preparation of 5-aryl-2-isopropylbenzene-1,3-diol [ka] To a solution of methyl 4-bromo-2,6-difluorobenzoate (A-1, 20.0 g, 0.08 mol) in MeOH (200 mL) was added NaOCH3 (13.0 g, 0.24 mol). The reaction mixture was stirred at 80° C. for 12 h. LCMS showed that the desired MS was detected. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 90 / 10 in 30 min) to give compound A-2. LCMS (ESI): 10 H 11 BrO4[M+H] + Calculated m / z 275.0, measured 275.1.

[0096] To a solution of methyl 4-bromo-2,6-dimethoxybenzoate (16.0 g, 0.058 mol) in THF at 0° C. was added MeMgBr (11.7 mL, 1M in hexanes). The reaction mixture was stirred at 25° C. for 2 h. LCMS showed the desired MS was detected. The residue was quenched with aqueous NH4Cl and removed by vacuum. The residue was extracted with EtOAc (1000 mL) and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give compound A-3. LCMS (ESI): C 11 H 15 BrO3[M+H] + Calculated m / z 274.0, measured 257.1.

[0097] To a solution of 2-(4-bromo-2,6-dimethoxyphenyl)propan-2-ol (13.0 g, 0.047 mol) in DCM (300 mL) at 0° C. was added TFA (13.8 g, 0.141 mol) and triethylsilane (16.4 g, 0.141 mol). The reaction mixture was stirred at 0° C. for 2 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum and the crude residue was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 10 / 90 in 30 min) to give compound A-4. 1 H NMR (400MHz, DMSO-d6, ppm) 6.78 (s, 2H), 3.76 (s, 6H), 3.47 (hept, J = 7.2Hz, 1H), 1.18 (d, J = 7.2Hz, 6H).

[0098] To a solution of 5-bromo-2-isopropyl-1,3-dimethoxybenzene (2.0 g, 0.00775 mol) in DCM (40 mL) was added BBr3 (62.0 ml, 1M in DCM) dropwise at 0° C. The reaction mixture was stirred at 25° C. for 12 h. LCMS showed that the desired MS was detected. The residue was quenched with water. The mixture was concentrated and the crude product was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give compound A-5. 1 H NMR (400MHz, DMSO-d6, ppm) 9.44 (s, 2H), 6.41 (s, 2H), 3.42-3.35 (m, 1H), 1.19 (d, J = 7.2Hz, 6H).

[0099] To a solution of 5-bromo-2-isopropylbenzene-1,3-diol (1.5 g, 0.0065 mol) in 1,4-dioxane / H2O=10:1 (22 mL) was added 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (2.0 g, 0.0078 mol), Pd(dppf)Cl2 (475.0 mg, 0.00065 mmol) and K2CO3 (1.8 g, 0.013 mol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was extracted with EtOAc (200 mL) and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 40 / 60 in 30 min) to give compound A-6. LCMS (ESI): 15 H 23 BO4[M+H] + m / z calculated 279.2, measured 279.1

[0100] To a solution of 2-isopropyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzene-1,3-diol (100.0 mg, 0.36 mmol) in 1,4-dioxane / H2O (8 mL / 2 mL) was added the corresponding bromo derivative (0.36 mmol), Pd(dppf)Cl2 (26.3 mg, 0.0359 mmol), and K2CO3 (99.2 mg, 0.719 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was extracted with EtOAc (200 mL) and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0-40 / 60 in 30 min) and Prep-HPLC (Column: Gemini 5um C18 150×21.2 mm, Mobile phase: ACN-H2O (0.1% FA), Gradient: 20-95, 10.0 min) to give 2-isopropylbenzene-1,3-diol derivatives (e.g., Compound Nos. 1-51). [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10]

[0101] Example 2 - Preparation of 5-aryl-2-isopropylpyridin-3-ol [ka] To a mixture of Na2CO3 (12.5 g, 118.0 mmol) and 3-bromo-5-hydroxypyridine (B-1, 10.3 g, 59.0 mmol) in H2O (200 ml) was added iodine (15.7 g, 62.0 mmol) at 0 °C. The reaction was stirred at room temperature for 1 h. The mixture was then slowly poured into 2M HCl (aq) and the pH was adjusted to about 3. The product was collected by filtration followed by crystallization from EtOH / water to give compound B-2. LCMS (ESI): C5H4BrINO [M+H] + Calculated m / z: 299.8, measured: 300.0.

[0102] To a stirred solution of 5-bromo-2-iodopyridin-3-ol (17.6 g, 58.90 mmol) in DMF (200.00 mL) was added NaH (2.8 g, 70.68 mmol) at 0 °C. After 30 min at 0 °C. MeI (16.0 g, 115.2 mmol) was added at 0 °C. The resulting mixture was stirred at room temperature for 16 h. After completion, the reaction mixture was diluted with NH4Cl (aq) and water (100 mL each) at 0 °C and diluted with EtOAc (150 mL). The separated aqueous layer was extracted with EtOAc (2 x 150 mL) and the combined organic layers were washed with water and saturated sodium chloride, dried over Na2SO4 and concentrated to give a crude residue, which was purified by flash column chromatography (eluted with PE / EtOAc from 100 / 0 to 90 / 10 in 30 min) to give compound B-3. LCMS(ESI):C6H5BrINO[M+H] + Calculated m / z 313.8, measured 313.8.

[0103] A solution of 5-bromo-2-iodo-3-methoxypyridine (7.8 g, 0.0248 mol), 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (B-4, 4.6 g, 0.0272 mol), Cs2CO3 (16.2 g, 0.0496 mol) and Pd(dppf)Cl2 (910.0 mg, 0.0012 mmol) in 200 mL of dioxane:H2O=10:1 was charged with N2 and stirred at 100 °C for 16 h. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluted with PE / DCM 100 / 0 to 85 / 15 in 30 min) to give compound B-5. LCMS (ESI): C9H 11 BrNO[M+H] + Calculated m / z 228.0, measured value 228.0.

[0104] To a solution of 5-bromo-3-methoxy-2-(prop-1-en-2-yl)pyridine (3.4 g, 14.9 mmol) in 150 mL of EtOAc was added PtO2 (440.0 mg, 2.0 mmol). The reaction was stirred at room temperature under H2 (1 atm) for 16 h. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluting with PE / EtOAc 100 / 0 to 85 / 15 in 30 min) to give compound B-6. LCMS (ESI): C9H 13 BrNO[M+H] + Calculated m / z 230.0, measured 230.1.

[0105] BBr3 (10.9 g, 43.5 mmol) was slowly added to a solution of 5-bromo-2-isopropyl-3-methoxypyridine (2.0 g, 8.7 mmol) in 20 mL of DCM. The mixture was then stirred at room temperature for 16 h. The solution was added with DCM (30 mL), washed with aqueous NaHCO3 until the aqueous phase was pH 8-9, and then extracted with DCM (20 mL x 3). The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 85 / 15 in 30 min) to give compound B-7. LCMS (ESI): CH 11 BrNO[M+H] +Calculated m / z 216.0, measured value 216.0.

[0106] A solution of 5-bromo-2-isopropylpyridin-3-ol (40.0 mg, 0.18 mmol), 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (B-8, 56.0 mg, 0.22 mmol), AcOK (54.5 mg, 0.55 mmol), and Pd(dppf)Cl2 (13.5 mg, 0.018 mmol) in 2 mL of dioxane was flushed with N2 and stirred at 80 °C for 16 h to produce B-9. After the reaction was completed as monitored by LCMS, the corresponding bromo derivative (B-10, 0.17 mmol), K2CO3 (23.0 mg, 0.17 mmol), Pd(dppf)Cl2 (7.0 mg, 0.009 mmol), and 0.2 mL of H2O were added. The mixture was filled with N2 and stirred at 80 °C for 16 h. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (e.g., eluted with PE / EtOAc 100 / 0 to 75 / 25 in 30 min) to give 5-aryl-2-isopropylpyridin-3-ols such as compounds 52-102. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10]

[0107] Example 3. Preparation of (E)-2-isopropyl-5-styrylpyridin-3-ol (Compound 103) [ka] To a solution of methyl 5-hydroxypyridine-3-carboxylate (C-1, 5.0 g, 0.033 mol) in THF / H2O (50 ml / 50 ml) was added Na2CO3 (10.4 g, 0.098 mol) and I2 (20.8 g, 0.082 mol). The reaction mixture was stirred at 25° C. for 12 h. The solvent was removed in vacuo and the residue was purified by flash chromatography (eluted with DCM / MeOH 100 / 0 to 90 / 10 in 30 min) to give compound C-2. LCMS (ESI): C7H6INO3 [M+H] + Calculated m / z 280.0, measured 279.8.

[0108] To a solution of compound C-2 (705.0 mg, 2.53 mmol) in dioxane / HO=10:1 (15 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (C-3, 509.5 mg, 3.03 mmol), Pd(PPh3)4 (292.0 mg, 2.53 mmol), and K2CO3 (697.3 mg, 5.05 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 12 h. The solvent was removed in vacuum to give the crude product, which was purified by flash chromatography (eluted with DCM / MeOH 100 / 0 to 90 / 10 in 30 min) to give compound C-4. LCMS (ESI): C 10 H 11 NO3[M+H] + Calculated m / z 194.0, measured value 194.0.

[0109] To a solution of methyl 5-hydroxy-6-(prop-1-en-2-yl)pyridine-3-carboxylate (134.0 mg, 0.69 mmol) in ethyl acetate (10 mL) was added Pd / C (73.8 mg, 10%). The reaction mixture was stirred at 25° C. under 1 atm of hydrogen for 12 h. The residue was filtered through Celite and the filtrate was concentrated under reduced pressure to give compound C-5, which was used directly in the next step. LCMS (ESI): 10 H 13 NO3[M+H] + Calculated m / z 196.0, measured value 196.0.

[0110] To a solution of methyl 5-hydroxy-6-isopropylpyridine-3-carboxylate (104.0 mg, 0.53 mmol) in THF (5 mL) was added LiAlH4 (30.3 mg, 0.80 mmol) slowly at 0 °C. The reaction mixture was stirred at 25 °C for 2 h. The residue was quenched with water and removed by vacuum. The residual crude product was purified by flash chromatography (eluted with DCM / MeOH 100 / 0 to 80 / 20 in 20 min) to give compound C-6. LCMS (ESI): C9H 13 NO2[M+H] + Calculated m / z 168.0, measured value 168.0.

[0111] To a solution of 5-(hydroxymethyl)-2-isopropylpyridin-3-ol (80.0 mg, 0.48 mmol) in DCM (5 mL) was added PCC (154.7 mg, 0.72 mmol) slowly at 0° C. The reaction mixture was stirred at 25° C. for 4 h. The solvent was removed by vacuum to give the crude product, which was purified by flash chromatography (DCM / MeOH=100 / 0 to 80 / 20) to give compound C-7. LCMS (ESI): C9H 11 NO2[M+H] + Calculated m / z 166.0, measured value 166.0.

[0112] To a solution of diethyl benzylphosphonate (C-8, 134.7 mg, 0.59 mmol) in THF (3 mL) was added NaH (19.0 mg, 0.79 mmol, 60%) at 0 °C. After 2 h, 5-hydroxy-6-isopropylpyridine-3-carbaldehyde (65.0 mg, 0.39 mmol) in THF was added dropwise at 0 °C. The reaction mixture was stirred at 25 °C for 16 h. After completion, the mixture was poured onto ice and extracted with EtOAc (10 mL × 3), then the combined organic layers were washed with saturated NaCl (20 mL) and dried over anhydrous Na2SO4. After filtration, the solvent was evaporated under reduced pressure and the crude product was purified by silica column chromatography (PE / EtOAc = 100 / 0 to 50 / 50) to give compound 103. LCMS (ESI): C 16 H 17 NO[M+H] + Calculated m / z 240.1, measured 240.1. 1 H NMR(400MHz,CDCl3,ppm):8.26(s,1H), 7.49(d,J=7.6Hz,2H), 7.36(t,J=7.2Hz,2H) , 7.28(d,J=5.6Hz,2H), 7.11-6.97(m,2H), 3.61-3.15(m,1H), 1.33(d,J=6.8Hz,6H).

[0113] Example 4 - Preparation of (E)-1-isopropyl-6-methoxy-4-styrylpyridin-2(1H)-one (Compound 104) [ka] To a solution of 4-bromo-2,6-dichloropyridine (2.0 g, 8.8 mmol), (E)-2-phenylethenyl]boranediol (1.56 g, 10.5 mmol), and K2CO3 (2.43 g, 17.6 mmol) in dioxane / HO=10:1 (42 mL) stirred at room temperature under nitrogen was added Pd(dppf)Cl2 (643.0 mg, 0.88 mmol). The reaction mixture was stirred at 80 °C for 16 h. The mixture was quenched with water (50 mL) and extracted with EtOAc (3×100 mL), and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give 2,6-dichloro-4-[(E)-2-phenylethenyl]pyridine. LCMS (ESI):C 13 H9Cl2N[M+H] + Calculated m / z 250.0, measured value 250.0.

[0114] To a solution of 2,6-dichloro-4-[(E)-2-phenylethenyl]pyridine (1.8 g, 7.2 mmol) in MeOH (50 mL) stirred under nitrogen was added a solution of MeONa (7.8 g, 144 mmol). The reaction mixture was stirred at 65° C. for 3 h. The mixture was quenched with water (50 mL), extracted with EtOAc (3×50 mL), and the organic layer was washed with brine, dried over Na2SO4, filtered, and concentrated to give the crude product, 2,6-dimethoxy-4-[(E)-2-phenylethenyl]pyridine. LCMS (ESI): C 15 H 15 O2N[M+H] + Calculated m / z 242.1, measured 242.1.

[0115] To a solution of 2,6-dimethoxy-4-[(E)-2-phenylethenyl]pyridine (1.6 g, 6.64 mmol) in DMF (32 ml) stirred at room temperature under nitrogen was added MeSNa (697.0 mg, 9.96 mmol). The reaction mixture was stirred at 130° C. for 1 h. The mixture was quenched with water (50 ml), extracted with EtOAc (3×50 mL), and the organic layer was washed with brine, dried over Na2SO4, filtered, and concentrated to give the crude product, 6-methoxy-4-[(E)-2-phenylethenyl]pyridin-2-ol. LCMS (ESI): C 14 H 13 O2N[M+H] + Calculated m / z 228.2, measured 228.2.

[0116] To a solution of 6-methoxy-4-[(E)-2-phenylethenyl]-1H-pyridin-2-one (1.2 g, 5.3 mmol), 2-iodopropane (1.8 g, 10.6 mmol) in THF (24 mL) stirred under nitrogen, Cs2CO3 (3.4 g, 10.6 mmol) was added. The reaction mixture was stirred at 60 °C for 16 h. The mixture was quenched with water (50 mL), extracted with EtOAc (3 x 50 mL), and the organic layer was washed with brine, dried over Na2SO4, filtered, and concentrated to give the crude product, which was purified by reverse phase column (eluted with 100 / 0 to 50 / 50 H2O / MeCN in 30 min) to give compound 104 and compound D-6.

[0117] Example 5 - Preparation of (E)-6-hydroxy-1-isopropyl-4-styrylpyridin-2(1H)-one (Compound 105) [ka] To a solution of 2,6-dimethoxy-4-[(E)-2-phenylethenyl]pyridine (50.0 mg, 0.19 mmol) in DMF (2 mL) stirred at room temperature under nitrogen was added MeSNa (52.0 mg, 0.74 mmol). The reaction mixture was stirred at 110° C. for 2 h. The reaction was monitored by LCMS. After the reaction was complete, the mixture was concentrated in vacuo to give the crude product, which was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 50-95, 10.0 min) to give compound 105.

[0118] Example 6 - Preparation of (E)-6-isopropoxy-4-styrylpyridin-2-ol (Compound 106) [ka] To a solution of 2-isopropoxy-6-methoxy-4-[(E)-2-phenylethenyl]pyridine (300.0 mg, 1.1138 mmol) in DMF (7 mL) was added MeSNa (155.9 mg, 2.2276 mmol). The reaction was stirred at 120° C. for 2 h. The reaction was monitored by LCMS. After the reaction was complete, the mixture was concentrated in vacuo to give the crude product, which was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% NH3.H2O), gradient: 30-95, 10.0 min) to give compound 106.

[0119] Example 7-1-Preparation of {2,6-dimethoxy-4-[(E)-2-phenylethenyl]phenyl}ethenone (Compound 107) [ka] To a solution of 1-bromo-3,5-dimethoxybenzene (1.0 g, 0.46 mmol) in toluene was added AlCl3 (610.0 mg, 0.46 mol) at 0°C. After 2 h, acetyl chloride (540.0 mg, 0.69 mmol) was added. The reaction was stirred for 0.5 h. The reaction was monitored by TLC. After the reaction was completed, the reaction mixture was then quenched with ice water and extracted with EtOAc (100 ml x 3). The combined organic phase was washed with saturated NaCl (500 ml), dried over anhydrous Na2SO4, filtered and concentrated to give the crude product, which was purified by column chromatography on silica gel (eluted with PE / EtOAc from 100 / 0 to 20 / 80 in 30 min) to give 1-(4-bromo-2,6-dimethoxyphenyl)ethenone. 1 H NMR (400MHz, CDCl3, ppm): 6.69 (s, 2H), 3.44 (s, 6H), 2.42 (s, 3H).

[0120] To a solution of 1-(4-bromo-2,6-dimethoxyphenyl)ethenone (1.0 g, 3.86 mmol) in dioxane (50 mL) and HO (5 mL) was added [(E)-2-phenylethenyl]boranediol (628.3 mg, 4.26 mmol), KCO (1.1 g, 7.72 mmol) and Pd(dppf)Cl (282.0 mg, 0.386 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. The reaction was monitored by LCMS. After the reaction was complete, the reaction mixture was cooled and concentrated on a rotary evaporator under reduced pressure. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 20 / 80 in 30 min) to give compound 107.

[0121] Example 8 - Preparation of 3,5-dimethoxy-4-(prop-1-en-2-yl)benzaldehyde (Compound 108) [ka] To a solution of 1-{2,6-dimethoxy-4-[(E)-2-phenylethenyl]phenyl}ethenone (170.0 mg, 0.602 mmol) in DCM (5 mL) was added tribromoborane (1.2 mL, 1M in DCM) at 0° C. The reaction mixture was stirred at 25° C. for 16 h. The reaction was monitored by TLC. After the reaction was complete, the residue was quenched with ice water, adjusted to 7-8 with NaHCO3 (aq), and extracted with DCM (10 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, and concentrated in vacuum. The residue was purified by preparative HPLC (column: Gemini 5um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 35-65, 9 min) to give compound 108.

[0122] Example 9 - Preparation of 5-isopropyl-3-[(E)-2-phenylethenyl]-1,2-oxazol-4-ol (Compound 109) [ka] To a solution of ethyl 4-chloro-3-oxobutanoate (8.8 g, 0.0535 mol) in AcOH (50 mL) was added NaNO2 (4.6 g, 0.0668 mol) in water (40 mL) dropwise at -10 °C. The resulting solution was stirred at -10 °C for 2 h. The reaction mixture was then treated with water (50 mL) and extracted with EtOAc (3 x 100 mL). The organic lager was dried over Na2SO4 and concentrated to give ethyl (2E)-4-chloro-2-(hydroxyimino)-3-oxobutanoate (11.0 g, red oil, yield: 99.4%), which was used directly in the next step without purification. LCMS (ESI): C6H9ClNO4 [M+H] + Calculated m / z = 194.1, found 194.1.

[0123] To a solution of ethyl (2E)-4-chloro-2-(hydroxyimino)-3-oxobutanoate (11.0 g, 0.0570 mol) in DMF (80 ml) was added urea (43.7 g, 0.7272 mol). The reaction mixture was stirred at 100° C. for 30 min. After completion, saturated aqueous ice water solution (100 mL) was added. The residue was extracted with EtOAc (3×100 mL). The organic phase was washed with saturated brine, dried over Na2SO4, filtered and concentrated to give the crude product, ethyl 4-hydroxy-1,2-oxazole-3-carboxylate, which was used directly in the next step without purification. LCMS (ESI): C6H8NO4[M+H] + Calculated m / z 158.0, measured 158.2.

[0124] To a solution of ethyl 4-hydroxy-1,2-oxazole-3-carboxylate (3.0 g, 19.1 mmol) in DMF (20 ml) was added BnBr (4.9 g, 28.6 mmol) and Cs2CO3 (12.4 g, 38.2 mmol). The reaction was stirred at 60 °C for 2 h. The solvent was extracted with EtOAc and H2O, and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluting with PE / EtOAc 100 / 0 to 75 / 25 in 30 min) to give ethyl 4-(benzyloxy)-1,2-oxazole-3-carboxylate. LCMS (ESI): C 13 H 14 NO4[M+H] + Calculated m / z 248.2, measured 248.2.

[0125] To a solution of ethyl 4-(benzyloxy)-1,2-oxazole-3-carboxylate (2.7 g, 10.9 mmol) in DMF (15 mL) was added NBS (3.9 g, 21.8 mmol). The reaction was stirred at 60° C. for 16 h. The solvent was extracted with EtOAc and H2O, and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 75 / 25 in 30 min) to give ethyl 4-(benzyloxy)-5-bromo-1,2-oxazole-3-carboxylate. LCMS: (ESI): C 13 H 13 BrNO4[M+H] + Calculated m / z=327.8, measured 327.8.

[0126] To a solution of ethyl 4-(benzyloxy)-5-bromo-1,2-oxazole-3-carboxylate (2.0 g, 6.13 mmol) in 1,4-dioxane / H2O (20 mL / 2 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.4 g, 7.97 mmol), Pd(dppf)Cl2 (450.0 mg, 0.61 mmol) and K2CO3 (1.7 g, 12.3 mmol). The reaction mixture was stirred at 80° C. under nitrogen for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluting with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give ethyl 4-(benzyloxy)-5-(prop-1-en-2-yl)-1,2-oxazole-3-carboxylate. LCMS (ESI): C 16 H 18 NO4[M+H] + Calculated m / z 288.2, measured 288.2.

[0127] To a solution of ethyl 4-(benzyloxy)-5-(prop-1-en-2-yl)-1,2-oxazole-3-carboxylate (1.1 g, 3.83 mmol) in MeOH (25 mL) was added Pd / C (200.0 mg, 20 wt%). The reaction mixture was stirred under H2 (1 atm) at 25°C for 16 h. LCMS showed that the desired MS was detected. The reaction mixture was filtered through Celite and concentrated to give ethyl 4-hydroxy-5-isopropyl-1,2-oxazole-3-carboxylate. LCMS (ESI): CH 14 NO4[M+H] + Calculated m / z 200.2, measured value 200.2.

[0128] To a solution of ethyl 4-hydroxy-5-isopropyl-1,2-oxazole-3-carboxylate (500.0 mg, 2.5 mmol) in DMF (5 mL) was added TBSCl (760.0 mg, 5.0 mmol) and imidazole (512.6 mg, 7.5 mmol). The reaction mixture was stirred at 25 °C for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum, the residue was extracted with DCM (50 mL), the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give ethyl 4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazole-3-carboxylate. LCMS (ESI): C 15 H 28 NO4Si[M+H] + Calculated m / z 314.0, measured value 314.0.

[0129] To a solution of 4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazole-3-carboxylate (700.0 mg, 2.23 mmol) in THF (7 mL) was added LiAlH4 (101.7 mg, 2.7 mmol). The reaction mixture was stirred at 25 °C for 2 h. LCMS showed the desired MS was detected. The reaction was quenched with Na2SO4.10H2O. The solvent was removed by vacuum, the residue was extracted with EtOAc (50 mL), the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give {4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazol-3-yl}methanol. LCMS (ESI): C 13 H 27 NO3Si[M+H] + Calculated m / z 272.2, measured 272.2.

[0130] To a solution of {4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazol-3-yl}methanol (170.0 mg, 0.627 mmol) in DCM (5 mL) was added DMP (532.1 mg, 1.25 mmol). The reaction mixture was stirred at 25 °C for 16 h. LCMS showed the desired MS was detected. The solvent was extracted with DCM (202 mL) and the organic layer was washed with brine, dried over Na2SO4, filtered and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 95 / 5 in 10 min) to give 4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazol-3-carbaldehyde. LCMS (ESI): C 13 H 24 NO3Si[M+H] + Calculated m / z 269.1, measured 269.1.

[0131] To a solution of diethyl benzylphosphonate (30.5 mg, 0.134 mmol) in DMF (2 mL) was added 18-crown-6 (14.7 mg, 0.056 mmol) and NaOMe (30 wt%, 48.0 mg, 0.267 mmol). After 30 min, the mixture was cooled to 0 °C, and then 4-[(tert-butyldimethylsilyl)oxy]-5-isopropyl-1,2-oxazole-3-carbaldehyde (30.0 mg, 0.111 mmol) was added. The reaction mixture was stirred at 25 °C for 2 h. LCMS showed that the desired MS was detected. The solvent was quenched with water (1 mL) and the solution was directly purified on a reverse phase column (eluted with 100 / 0 to 0 / 100 HO (0.1% FA)-MeCN in 30 min) to give compound 109.

[0132] Example 10 - Preparation of 1,3-dimethoxy-5-[(E)-2-phenylethenyl]-2-(prop-1-en-2-yl)benzene (Compound 110) [ka] To a solution of methyl 4-bromo-3,5-dimethoxybenzoate (5.0 g, 0.0182 mol) in saturated K2CO3 (300 mL) and dioxane (300 mL) was added Pd(dppf)Cl2 (1.3 g, 0.0018 mol) and 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (4.6 g, 0.0273 mol). The reaction mixture was stirred at 80 °C under N2 for 16 h. The reaction was monitored by TLC. After the reaction was completed, it was then cooled to ambient temperature. The mixture was extracted with EtOAc (300 mL x 3). The combined organic phase was washed with saturated NaCl (1 L), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel (eluted with PE / EtOAc from 0 / 100 to 88 / 12 in 30 min) to give methyl 3,5-dimethoxy-4-(prop-1-en-2-yl)benzoate. 1H NMR (400MHz, CDCl3, ppm) 7.26 (s, 2H), 5.36-5.35 (m, 1H), 4.88-4.87 (m, 1H), 3.92 (s, 3H), 3.86 (s, 6H), 2.01 (s, 3H).

[0133] To a solution of methyl 3,5-dimethoxy-4-(prop-1-en-2-yl)benzoate (3.5 g, 0.148 mol) in THF (60 mL) was added LiAlH4 (2.1 g, 0.0547 mol) slowly at 0°C. The resulting was stirred at 25°C for 1 h. The reaction was monitored by TLC. After the reaction was completed, water (20 mL) was added slowly to the mixture to quench the excess LiAlH4, and the mixture was acidified with 10% HCl (aq). The organic layer was washed with saturated NaCl (200 mL x 2), dried over Na2SO4, and the solvent was evaporated under reduced pressure to give [3,5-dimethoxy-4-(prop-1-en-2-yl)phenyl]methanol, which was used directly in the next step without purification. 1 H NMR (400MHz, DMSO-d6, ppm): 6.61 (s, 2H), 5.15 (s, 1H), 4.71-4.66 (m, 1H), 3.71 (s, 6H), 1.88 (s, 3H).

[0134] To a solution of [3,5-dimethoxy-4-(prop-1-en-2-yl)phenyl]methanol (1.0 g, 4.8 mmol) in DCM (20 mL) was added PCC (1.55 g, 7.2 mmol). The reaction mixture was stirred at 25° C. for 1 h. The reaction was monitored by TLC. After completion of the reaction, the solvent was removed by vacuum to give the crude product, which was purified by column chromatography on silica gel (eluted with PE / EtOAc 100 / 0 to 92 / 8 in 30 min) to give 3,5-dimethoxy-4-(prop-1-en-2-yl)benzaldehyde. 1 H NMR (400MHz, DMSO-d6, ppm): 9.94 (s, 1H), 7.21 (s, 2H), 5.24 (s, 1H), 4.76 (s, 1H), 3.81 (s, 6H), 1.90 (s, 3H).

[0135] To a solution of diethyl benzylphosphonate (1.2 g, 5.04 mmol) in THF (20 mL) was added NaH (161.3 mg, 6.72 mmol) at 0 °C. After 1 h, [3,5-dimethoxy-4-(prop-1-en-2-yl)phenyl]methanol (700.0 mg, 3.36 mmol) in THF (3 mL) was added dropwise. The reaction mixture was stirred at 25 °C for 16 h. The reaction was monitored by LCMS. After the reaction was completed, the mixture was poured onto ice and extracted with EtOAc (50 mL × 3), then the combined organic layers were washed with saturated NaCl (100 mL) and dried over anhydrous Na2SO4. After filtration, the solvent was evaporated under reduced pressure and the crude product was purified by silica column chromatography (eluted with CH2Cl / CH3OH 100 / 0 to 90 / 10 in 30 min) to give compound 110.

[0136] Example 11 - Preparation of 2-{2,6-dimethoxy-4-[(E)-2-phenylethenyl]phenyl}propan-2-ol (Compound 111) [ka] To a solution of methyl 4-bromo-2,6-difluorobenzoate (1.5 g, 6 mmol) in CH3OH (30 mL) was added MeONa (4.0 mL, 24 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. The reaction was monitored by TLC. After the reaction was completed, it was then cooled to ambient temperature. The mixture was extracted with EtOAc (100 mL x 3). The combined organic phase was washed with saturated NaCl (200 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by column chromatography on silica gel chromatography (eluted with PE / EA 100 / 0 to 20 / 80 in 30 min) to give methyl 4-bromo-2,6-dimethoxybenzoate. 1 H NMR (400MHz, DMSO-d6, ppm) 6.95 (s, 2H), 3.78 (s, 6H), 3.74 (s, 3H).

[0137] To a solution of methyl 4-bromo-2,6-dimethoxybenzoate (1.0 g, 3.6 mmol) in THF (20 mL) was added MeMgBr (4.3 ml, 4.32 mmol) dropwise under nitrogen at −78° C. The reaction mixture was stirred at room temperature under nitrogen for 4 h. The reaction was monitored by TLC. After the reaction was completed, the reaction mixture was quenched into water and extracted with EtOAc (50 mL×3). The combined organic phase was washed with saturated NaCl (100 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 20 / 80 in 30 min) to give 2-(4-bromo-2,6-dimethoxyphenyl)propan-2-ol ethanone. 1 H NMR (400MHz, DMSO-d6, ppm) 6.88 (s, 2H), 5.20 (s, 1H), 3.80 (s, 6H), 1.50 (s, 6H).

[0138] To a solution of 2-(4-bromo-2,6-dimethoxyphenyl)propan-2-ol (100.0 mg, 0.268 mmol) in 1,4-dioxane:H2O=2:1, [(E)-2-phenylethenyl]boranediol (26.9 mg, 0.0.322 mmol), K2CO3 (100.3 mg, 0.536 mmol), and Pd(dppf)Cl2 (26.6 mg, 0.0268 mmol) were added. The reaction mixture was stirred under nitrogen at 100° C. for 16 h. The reaction was monitored by TLC. After the reaction was complete, the resulting mixture was quenched with water and extracted twice with DCM. The combined organic phase was washed with saturated NaCl. It was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel chromatography (eluting with CH2Cl / CH3OH 100 / 0 to 90 / 10 in 30 min) to give 2-{2,6-dimethoxy-4-[(E)-2-phenylethenyl]phenyl}propan-2-ol. 1 H NMR (400MHz, CDCl3, ppm) 7.56(d,J=8.0Hz,2H), 7.36(t,J=7.6Hz,2H), 7.28-7.11(m,3H), 6.86(s,2H), 5.45(s,1H), 3.89(s,6H), 1.58(s,6H).

[0139] To a solution of 2-{2,6-dimethoxy-4-[(E)-2-phenylethenyl]phenyl}propan-2-ol (50.0 mg, 0.1675 mmol) in DMF (2 mL) was added sodium thiomethoxide (47.0 mg, 0.67 mmol). The reaction mixture was stirred at 120° C. for 2 h. The reaction was monitored by TLC. After the reaction was complete, the residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 35-90, 9.0 min) to give compound 111.

[0140] Example 12 - Preparation of 5-[(E)-2-(2-fluorophenyl)ethenyl]-2-isopropylpyridin-3-ol (Compound 112) [ka] To a solution of diethyl [(2-fluorophenyl)methyl]phosphonate (131.9 mg, 0.536 mmol) in THF (5 mL), NaH (26.8 mg, 0.670 mmol, 60% in oil) was added, and the reaction mixture was then stirred at 25° C. for 1 h. The mixture was added with 6-isopropyl-5-methoxypyridine-3-carbaldehyde (80.0 mg, 0.446 mmol), and the reaction mixture was then stirred at 25° C. for 2 h. The mixture was added with water (10 mL) and extracted with EtOAc (20 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluting with PE / EtOAc 100 / 0 to 95 / 5 in 20 min) to give 5-[(E)-2-(2-fluorophenyl)ethenyl]-2-isopropyl-3-methoxypyridineethenyl]pyridine. LCMS (ESI): 17 H 18 FNO[M+H] + Calculated m / z 272.1, measured 272.1.

[0141] To a solution of 5-[(E)-2-(2-fluorophenyl)ethenyl]-2-isopropyl-3-methoxypyridine (60.0 mg, 0.221 mmol) in DCM (5 mL) was added BBr3 (554.0 mg, 2.21 mmol), and the mixture was then stirred at 25 °C for 16 h. Water (10 mL) was added to the solution, and extracted with DCM (10 mL x 3). The organic phases were combined, washed with aqueous NaHCO3 and brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by preparative HPLC (eluted with H2O (0.1% NH3.H2O) / MeCN from 70 / 30 to 5 / 95 in 40 min) to give compound 112.

[0142] Example 13-Preparation of (E)-5-(3-fluorostyryl)-2-isopropylpyridin-3-ol (Compound 113) [ka] To a solution of diethyl [(3-fluorophenyl)methyl]phosphonate (89.0 mg, 0.362 mmol) in THF (5 mL), NaH (22.0 mg, 0.558 mmol, 60% in oil) was added, and the reaction mixture was then stirred at 25° C. for 1 h. The mixture was added with 6-isopropyl-5-methoxypyridine-3-carbaldehyde (50.0 mg, 0.279 mmol), and the reaction mixture was then stirred at 25° C. for 2 h. The mixture was added with water (10 mL) and extracted with EtOAc (20 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 95 / 5 in 20 min) to give (E)-5-(3-fluorostyryl)-2-isopropyl-3-methoxypyridine. LCMS (ESI): C 17 H 19 FNO[M+H] + Calculated m / z 272.1, measured 272.1.

[0143] To a solution of (E)-5-(3-fluorostyryl)-2-isopropyl-3-methoxypyridine (50.0 mg, 0.175 mmol) in DCM (5 mL) was added BBr3 (554.0 mg, 2.21 mmol), and the mixture was then stirred at 25° C. for 16 h. The solution was added water (10 mL) and extracted with DCM (10 mL×3). The organic phases were combined, washed with NaHCO3 (aq) and brine, dried over Na2SO4, filtered, and concentrated in vacuo. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 20-95, 10.0 min) to give compound 113.

[0144] Example 14 - Preparation of 5-[(E)-2-(4-fluorophenyl)ethenyl]-2-isopropylpyridin-3-ol (Compound 114) [ka] To a solution of diethyl [(4-fluorophenyl)methyl]phosphonate (54.0 mg, 0.218 mmol) in THF (5 mL) was added NaH (60%) (16.0 mg, 0.338 mmol). After 30 min, 6-isopropyl-5-methoxypyridine-3-carbaldehyde (30.0 mg, 0.167 mmol) was added. The reaction mixture was stirred at 25 °C for 2 h. LCMS showed that the desired MS was detected. The mixture was added water (10 mL) and extracted with EtOAc (20 mL × 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 95 / 5 in 20 min) to give 5-[(E)-2-(4-fluorophenyl)ethenyl]-2-isopropyl-3-methoxypyridine. LCMS(ESI):C 17 H 19 FNO[M+H] + Calculated m / z 272.1, measured 272.1.

[0145] To a solution of 5-[(E)-2-(4-fluorophenyl)ethenyl]-2-isopropyl-3-methoxypyridine (40.0 mg, 0.133 mmol) in DCM (5 mL) was added BBr3 (332.0 mg, 1.33 mmol), and the mixture was then stirred at 25° C. for 16 h. The solution was added with water (10 mL) and extracted with DCM (10 mL×3). The organic phases were combined, washed with NaHCO3 (aq) and brine, dried over Na2SO4, filtered, and concentrated in vacuo. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 20-95, 10.0 min) to give compound 114.

[0146] Example 15 - Preparation of 2-isopropyl-5-[(E)-2-(2,4,6-trifluorophenyl)ethenyl]pyridin-3-ol (Compound 115) [ka] To a solution of diethyl [(2,4,6-trifluorophenyl)methyl]phosphonate (113.4 mg, 0.402 mmol) in THF (4 mL) was added NaH (20.1 mg, 0.502 mmol, 60% in oil), and after 30 min, 6-isopropyl-5-methoxypyridine-3-carbaldehyde (60.0 mg, 0.334 mmol) in THF (1 ml) was added dropwise at 0° C. The reaction was stirred at 25° C. for 2 h. LCMS showed that the desired MS was detected. The solution was added water (10 mL) and extracted with EtOAc (20 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by reverse phase column (eluted with 0-100 ACN-HO (0.1% FA) in 30 min) to give 2-isopropyl-3-methoxy-5-[(E)-2-(2,4,6-trifluorophenyl)ethenyl]pyridine. LCMS (ESI): 17 H 17 F3NO[M+H] + Calculated m / z 308.2, measured 308.2.

[0147] To 2-isopropyl-3-methoxy-5-[(E)-2-(2,4,6-trifluorophenyl)ethenyl]pyridine (60.0 mg, 0.166 mmol) was added BBr3 (5 mL, 1M in DCM) at 0° C., and the reaction was then stirred at 25° C. for 16 h. LCMS showed that the desired MS was detected. The solution was quenched with ice water, adjusted with aqueous NaHCO3, and extracted with DCM (10 mL×3). The organic phase was washed with and brine, dried over Na2SO4, filtered, and concentrated in vacuo. The crude was directly purified on a reverse phase column (eluted with ACN-H2O (0.1% FA) form 0-100 in 30 min) to give compound 115.

[0148] Example 16-Preparation of (E)-5-(2,4-difluorostyryl)-2-isopropylpyridin-3-ol (Compound 116) [ka] To a solution of 2-[(E)-2-(2,4-difluorophenyl)ethenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (20.0 mg, 0.0752 mmol) in 1,4-dioxane / H2O (4 mL / 1 mL) was added 5-bromo-2-isopropylpyridin-3-ol (17.9 mg, 0.0826 mmol), Pd(dppf)Cl2 (5.5 mg, 0.0074 mmol), and K2CO3 (20.8 mg, 0.1504 mmol). The reaction mixture was stirred under nitrogen at 80° C. for 12 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was quenched with water and extracted with EtOAc, the organic layer was washed with brine, dried over Na2SO4, filtered, and concentrated. The crude product was purified by preparative TLC (eluted with PE / EtOAc 100 / 0 to 75 / 25 in 30 min) to give compound 116.

[0149] Example 17 - Preparation of 2-isopropyl-5-[(E)-2-phenylenyl]pyridin-3-amine (Compound 117) [ka] To a solution of methyl 6-chloro-5-nitropyridine-3-carboxylate (2.0 g, 9.23 mmol) in 1,4-dioxane (20 mL) and H2O (4 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.9 g, 11.1 mmol), Pd(dppf)Cl2 (676.0 mg, 0.923 mmol) and K2CO3 (2.6 g, 18.46 mmol), then the mixture was stirred at 80° C. for 2 h. The solution was added water (20 mL) and extracted with EtOAc (50 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 90 / 10) to give methyl 5-nitro-6-(prop-1-en-2-yl)pyridine-3-carboxylate. LCMS (ESI): C 10 H 10 N2O4[M+H] + Calculated m / z 223.1, measured 223.0

[0150] To a solution of methyl 5-nitro-6-(prop-1-en-2-yl)pyridine-3-carboxylate (1.7 g, 7.56 mmol) in EtOH (16.8 mL) was added Pd / C (336.0 mg), then the mixture was purged with H2 under 2 atm and stirred at 25 °C for 12 h. The solution was filtered, the cake was washed with EtOH (10 mL x 3), and the filtrates were combined. The dissolved material was removed under reduced pressure to give methyl 5-amino-6-isopropylpyridine-3-carboxylate. LCMS (ESI): C 10 H 14 N2O2[M+H] + Calculated m / z 195.2, measured 195.1

[0151] To a solution of methyl 5-amino-6-isopropylpyridine-3-carboxylate (1.0 g, 5.1 mmol) in THF (10 mL) was added LiAlH4 (230.0 mg, 6.18 mmol) at 0° C., and the mixture was then stirred at 0° C. for 1 h. The solution was added with water (10 mL) and extracted with EtOAc (20 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The dissolved material was removed under reduced pressure to give (5-amino-6-isopropylpyridin-3-yl)methanol. LCMS (ESI): C9H 14 NO[M+H] + m / z calculated 167.1, measured 167.1

[0152] To a solution of (5-amino-6-isopropylpyridin-3-yl)methanol (900.0 mg, 5.42 mmol) in i-PrOH (9 mL) was added Boc2O (1.8 g, 8.13 mmol), and the mixture was then stirred at 25° C. for 16 h. The solution was concentrated in vacuo to remove the solvent. The residue was added with water (20 mL) and extracted with EtOAc (50 mL×2). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The dissolved material was removed under reduced pressure to give tert-butyl N-[5-(hydroxymethyl)-2-isopropylpyridin-3-yl]carbamate. LCMS (ESI): C 14 H 22 N2O3[M+H] + Calculated m / z 267.3, measured 267.2.

[0153] To a solution of tert-butyl N-[5-(hydroxymethyl)-2-isopropylpyridin-3-yl]carbamate (1.0 g, 3.76 mmol) in MeCN (15 mL) was added IBX (1.4 g, 4.88 mmol), and the mixture was then stirred at 95° C. for 3 h. The mixture was filtered through filter paper, the cake was washed with MeCN (10 mL×3), and the filtrates were combined. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 95 / 5 in 10 min) to give tert-butyl N-(5-formyl-2-isopropylpyridin-3-yl)carbamate. LCMS (ESI): C 14 H 20 N2O3[M+H] + Calculated m / z 265.1, measured 265.1.

[0154] To a solution of diethyl benzylphosphonate (545.5 mg, 2.27 mmol) in THF (10 mL), NaH (68.1 mg, 2.84 mmol, 60% in oil) was added and after 1 h at 25 °C, tert-butyl N-(5-formyl-2-isopropylidin-3-yl)carbamate (500.0 mg, 1.89 mmol) dissolved in THF (5 ml) was added and stirred at 40 °C for 2 h. The solution was added water (10 mL) and extracted with EtOAc (20 mL × 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 90 / 10 to 80 / 20 in 15 min) to give tert-butyl N-{2-isopropyl-5-[(E)-2-phenylethenyl]pyridin-3-yl}carbamate. LCMS(ESI):C 21 H 26 N2O2[M+H] + Calculated m / z 339.2, measured 339.2.

[0155] To a solution of tert-butyl N-{2-isopropyl-5-[(E)-2-phenylethenyl]pyridin-3-yl}carbamate (300.0 mg, 0.886 mmol) in 1,4-dioxane (5 mL) was added HCl (1 mL, 12 M) at 0° C., and then the reaction mixture was stirred at 25° C. for 2 h. The solution was concentrated in vacuum to remove 1,4-dioxane. The residue was dissolved in water (5 ml) and adjusted to pH=9 with aqueous NaHCO3. The mixture was then extracted with EtOAc (10 ml×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuum. The residue was purified by silica gel chromatography (eluted with PE / EtOAc from 90 / 10 to 80 / 20 in 15 min) to give compound 117.

[0156] Example 18 - Preparation of 2-isopropyl-5-(quinolin-3-yl)pyridin-3-amine (Compound 118) [ka] To a solution of 5-bromo-3-nitro-2-(prop-1-en-2-yl)pyridine (200.0 mg, 0.823 mmol), tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (250.7 mg, 0.987 mmol), Pd(dppf)Cl2 (60.2 mg, 0.082 mmol), and AcOK (161.5 mg, 1.64 mmol) in 1,4-dioxane (5 ml). The reaction mixture was stirred at 80° C. under Ar2 for 16 h. LCMS showed the desired MS was detected. 2-Bromoquinoline (100.0 mg, 0.48 mmol), Pd(dppf)Cl2 (35.2 mg, 0.048 mmol), K2CO3 (265.1 mg, 1.922 mmol) in H2O (1 mL) were added. The reaction mixture was stirred at 80 °C under Ar2 for another 6 h. The mixture was added water (30 mL) and extracted with EtOAc (20 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give 3-(5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl)isoquinoline.

[0157] To a solution of 3-(5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl)isoquinoline (80.0 mg, 0.275 mmol) in MeOH (10 mL) was added Pd / C (40.0 mg, 10% Pd). The reaction mixture was stirred at 25° C. under H2 (1 atm) for 16 h. The mixture was filtered and the filtrate was collected. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.05% NH3.H2O), gradient: 30-70, 9.0 min) to give compound 118.

[0158] Example 19 - Preparation of 2-isopropyl-5-(quinolin-2-yl)pyridin-3-amine (Compound 119) [ka] To a solution of 5-bromo-3-nitro-2-(prop-1-en-2-yl)pyridine (200.0 mg, 0.823 mmol), tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (250.7 mg, 0.987 mmol), Pd(dppf)Cl2 (60.2 mg, 0.082 mmol), and AcOK (161.5 mg, 1.64 mmol) in 1,4-dioxane (5 mL). The reaction mixture was stirred at 80° C. under Ar2 for 16 h. LCMS showed the desired MS was detected. 2-Bromoquinoline (100.0 mg, 0.48 mmol), Pd(dppf)Cl2 (35.2 mg, 0.048 mmol), K2CO3 (265.1 mg, 1.922 mmol) in H2O (1 mL) were added. The reaction mixture was stirred at 80 °C under Ar2 for another 6 h. The mixture was added water (30 mL) and extracted with EtOAc (20 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give 2-(5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl)isoquinoline.

[0159] To a solution of 2-[5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl]quinoline (80.0 mg, 0.273 mmol) in MeOH (10 mL) was added Pd / C (40.0 mg, 10% Pd). The reaction mixture was stirred under H2 at 25°C for 16 h. The mixture was filtered and the filtrate was collected. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.05% NH3.H2O), gradient: 30-95, 10.0 min) to give compound 119.

[0160] Example 20 - Preparation of 2-isopropyl-5-(quinolin-3-yl)pyridin-3-amine (Compound 120) [ka] To a solution of 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline (200.0 mg, 0.82 mmol), 5-bromo-3-nitro-2-(prop-1-en-2-yl)pyridine (228.6 mg, 0.90 mmol), Pd(dppf)Cl2 (57.4 mg, 0.078 mmol), and K2CO3 (216.7 mg, 1.57 mmol) in 1,4-dioxane:H2O=10:1 (11 mL). The reaction mixture was stirred at 80 °C under N2 for 12 h. LCMS showed the desired MS was detected. The mixture was added water (10 mL) and extracted with EtOAc (20 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography (eluting with PE / EtOAc 100 / 0 to 90 / 10 in 20 min) to give 2-[5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl]quinoline. LCMS (ESI): C 17 H 14 N3O2[M+H] + Calculated m / z 292.1, measured 292.2.

[0161] To a solution of 2-[5-nitro-6-(prop-1-en-2-yl)pyridin-3-yl]quinoline (80.0 mg, 0.27 mmol) in MeOH (10 ml) was added Pd / C (40.0 mg, 10% Pd). The reaction mixture was stirred at 25° C. under H2 (1 atm) for 16 h. The mixture was filtered and the filtrate was collected. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.05% NH3.H2O), gradient: 30-60, 9.0 min) to give compound 120.

[0162] Example 21 - Preparation of 5-(1,3-benzoxazol-2-yl)-2-isopropylpyridin-3-amine (Compound 121) [ka] To a solution of tert-butyl N-(5-formyl-2-isopropylpyridin-3-yl)carbamate (200.0 mg, 0.757 mmol) in EtOH (5 mL) was added 2-aminophenol (99.1 mg, 0.908 mmol) and MnO2 (263.1 mg, 3.027 mmol), then the reaction mixture was purged with O2 three times and stirred at 50 °C for 12 h. The mixture was filtered to remove MnO2. The solution was added water (10 mL) and extracted with EtOAc (20 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The solvent was removed under reduced pressure. The residue was purified by silica gel chromatography (eluting with PE / EtOAc 100 / 0 to 90 / 10 in 10 min) to give tert-butyl N-[5-(1,3-benzoxazol-2-yl)-2-isopropylpyridin-3-yl]carbamate. LCMS (ESI): C 20 H 23 N3O3[M+H] + Calculated m / z 354.2, measured 354.1.

[0163] To a solution of tert-butyl N-[5-(1,3-benzoxazol-2-yl)-2-isopropylpyridin-3-yl]carbamate (150.0 mg, 0.424 mmol) in 1,4-dioxane (5 mL) was added HCl (0.5 mL, 12 M) at 0° C., and then the reaction mixture was stirred at 25° C. for 16 h. The solution was concentrated in vacuum to remove 1,4-dioxane. The residue was dissolved in water (5 ml) and adjusted to pH=9 with aqueous NaHCO3. The mixture was then extracted with EtOAc (10 ml×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuum. The residue was purified by preparative TLC to give compound 121.

[0164] Example 22 - Preparation of 5-(benzo[d]oxazol-2-yl)-2-isopropyl-3-methoxyphenol (Compound 122) [ka] To a solution of 2-(4-isopropyl-3,5-dimethoxyphenyl)benzo[d]oxazole (100.0 mg, 0.3363 mmol) in DCM (3 mL) was added BBr3 (0.6 mL, 1 M in DCM). The reaction mixture was stirred at 25 °C for 2 h. The reaction was quenched with water and extracted with DCM (10 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 50-95, 10.0 min) to give compound 122.

[0165] Example 23-Preparation of (E)-2-(4-methoxy-6-styrylpyridazin-3-yl)propan-2-ol (Compound 123) [ka] Sodium methoxide (30 wt% in methanol, 2.7 mL) was added to a stirred solution of methyl 4,6-dichloropyridazine-3-carboxylate (3.0 g, 514.49 mmol) in THF (100 mL) cooled to 0 °C. The reaction mixture was stirred at room temperature overnight, LCMS showed the desired MS was detected, and then poured into 1N HCI (20 mL). The resulting solution was then neutralized with saturated NaHCO3. EtOAc (100 mL) was added and the layers were separated. The aqueous layer was extracted twice with EtOAc (100 mL) and the combined extracts were washed with brine (50 mL), dried (NaSO4) and evaporated. The residue was then purified by flash chromatography (eluting with PE / EtOAc 100 / 0 to 60 / 40 in 30 min) to give methyl 6-chloro-4-methoxypyridazine-3-carboxylate. LCMS (ESI): C7H7ClN2O3 [M+H] + Calculated m / z 203.0, measured 203.1.

[0166] To a solution of methyl 6-chloro-4-methoxypyridazine-3-carboxylate (970.0 mg, 4.79 mmol) in 1,4-dioxane / HO (50 mL / 10 mL) was added (E)-styrylboronic acid (919.3 mg, 6.21 mmol), Pd(dppf)Cl2 (349.8 mg, 0.48 mmol), and KF (554.3 mg, 9.56 mmol). The reaction mixture was stirred at 80° C. under nitrogen for 12 hours. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was extracted with EtOAc (200 mL×3), and the organic layer was washed with brine, dried over Na2SO4, and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 50 / 50 in 30 min) to give (E)-methyl 4-methoxy-6-styrylpyridazine-3-carboxylate. LCMS (ESI): 15 H 14 N2O3[M+H] + Calculated m / z 271.1, measured 271.2.

[0167] To a solution of (E)-methyl 4-methoxy-6-styrylpyridazine-3-carboxylate (560.0 mg, 2.07 mmol) in THF (50 mL) was added MeMgBr (1.38 ml, 4.14 mmol, 3M in hexanes) at 0° C. The reaction was stirred at room temperature under nitrogen for 2 h. LCMS showed the desired MS was detected. The solvent was quenched with saturated aqueous NH4Cl. The solvent was extracted with EtOAc (150 mL×3). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was then purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 50 / 50 in 30 min) to give compound 123.

[0168] Example 23-Preparation of (E)-3-isopropyl-6-styrylpyridazin-4-ol (Compound 124) [ka] To a solution of compound 123 (90.0 mg, 0.33 mmol) in HOAc (3 mL), HI (57 wt% in water, 0.26 mL) was added and stirred at 100 °C for 1 h. LCMS showed that the desired MS was detected before removing the solvent. Water (5 mL) was added to the residue and the mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 20-95, 9.0 min) to give compound 124.

[0169] Example 25 - Preparation of 3-fluoro-5-[(E)-2-phenylethenyl]-2-propylphenol (Compound 125) [ka] To 5-bromo-1,3-difluoro-2-iodobenzene (2.0 g, 6.3 mmol) in MeOH (20 ml) was added MeONa (30% in MeOH, 2.1 ml). The reaction was stirred at 60° C. for 16 h. The reaction solvent was removed by vacuum to give a white solid. The solvent was diluted with DCM (20 mL) and water (20 mL). The aqueous phase was extracted with DCM (20 mL). The organic phases were combined, washed with brine, dried over anhydrous NaSO4, and concentrated to give the crude product, which was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 98 / 2 in 30 min) to give 5-bromo-1-fluoro-2-iodo-3-methoxybenzene. 1 H NMR (400 MHz, CDCl 3, ppm)6.91(dd,J=7.2.2.0Hz,1H), 6.76(t,J=1.6Hz,1H), 3.90(s,3H).

[0170] To a solution of 5-bromo-1-fluoro-2-iodo-3-methoxybenzene (2.0 g, 6.04 mmol) in 1,4-dioxane / H2O (40 mL / 4 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.5 g, 9.07 mmol), Pd(dppf)Cl2 (442.2 mg, 0.604 mmol), and K2CO3 (3.9 g, 12.08 mmol). The reaction mixture was stirred at 100 °C under nitrogen for 16 h. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluted with PE / EA 100 / 0 to 98 / 2 in 30 min) to give 5-bromo-1-fluoro-3-methoxy-2-(prop-1-en-2-yl)benzene. 1 H NMR (400 MHz, CDCl 3, ppm)6.90(dd,J=8.4,1.6Hz,1H).,6.82(t,J=1.6Hz 1H), 5.35(dd,J=3.2,1.6Hz,1H), 4.97-4.96(m,1H), 3.82(s,3H), 2.01(s,3H).

[0171] To a solution of 5-bromo-1-fluoro-3-methoxy-2-(prop-1-en-2-yl)benzene (200.0 mg, 0.816 mmol) in EtOAc (5 ml) was added Pt / C (20.0 mg, 10 wt%). The reaction mixture was stirred under H2 (1 atm) at 25°C for 16 h. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluted with PE / EA 100 / 0 to 95 / 5 in 30 min) to give 5-bromo-1-fluoro-3-methoxy-2-propylbenzene. 1 H NMR(400MHz,CDCl3,ppm)6.84(dd,J=8.8,1.6Hz,1H).,6.77(t,J=1.6Hz 1H), 3.83-3.80(m,3H), 2.55(td,J=7.6,1.6Hz,2H), 1.51(dt,J=14.8,7.6Hz,2H), 0.91(t,J=8.0Hz,3H).

[0172] To a solution of 5-bromo-1-fluoro-3-methoxy-2-propylbenzene (50.0 mg, 0.202 mmol) in 1,4-dioxane / HO (2 mL / 0.2 mL) was added [(E)-2-phenylethenyl]boranediol (44.9 mg, 0.304 mmol), Pd(dppf)Cl2 (11.8 mg, 0.020 mmol), and K2CO3 (55.9 mg, 0.405 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluted with PE / EA 100 / 0 to 95 / 5 in 30 min) to give 1-fluoro-3-methoxy-5-[(E)-2-phenylethenyl]-2-propylbenzene. 1 H NMR(400MHz,CD3OD,ppm)7.56(d,J=8.0Hz,2H), 7.37-7.33(m,2H), 7.27-7.23(m,1H), 7.16-7.08(m ,2H), 6.95-6.86(m,2H), 3.90(s,3H), 2.664-2.59(m,2H), 1.60-1.51(m,2H), 0.94(t,J=8.0Hz,3H).

[0173] To 1-fluoro-3-methoxy-5-[(E)-2-phenylethenyl]-2-propylbenzene (45.0 mg, 0.166 mmol) was added BBr3 (1 M in DCM, 5 mL), and the reaction was then stirred at 25° C. for 16 h. The solution was added water (10 mL) and extracted with DCM (10 mL×3). The organic phases were combined, washed with aqueous NaHCO3 and brine, dried over Na2SO4, filtered, and concentrated in vacuo. The solvent was removed under reduced pressure to give the crude product. The crude product was directly purified on a reverse phase column (eluted with 0-100 ACN-H2O (0.1% FA) in 30 min) to give compound 125.

[0174] Example 26 - Preparation of 6-isopropyl-2-phenyl-2H,3H-furo[2,3-b]pyridin-5-ol (Compound 127) [ka] m-CPBA (1.31 g, 7.61 mmol) was added to a stirred solution of 5-bromo-2-isopropyl-3-methoxypyridine (350.0 mg, 1.52 mmol) in ethyl acetate (5 mL) at 0° C. The resulting reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with saturated sodium bicarbonate solution (5 ml) and the ethyl acetate layer was separated. The aqueous layer was extracted with 10% methanol in dichloromethane (5×10 ml). The combined organic layers were dried over anhydrous Na2SO4, filtered and the solvent was evaporated under reduced pressure to give 5-bromo-2-isopropyl-3-methoxypyridin-1-ium-1-olate. LCMS (ESI): CH 12 BrNO2[M+H] + Calculated m / z 248.2, measured 248.2.

[0175] To a solution of 5-bromo-2-isopropyl-3-methoxypyridin-1-ium-1-olate (1.5 g, 6.10 mmol) in dry THF (45 ml) was added TFAA (5.1 g, 24.38 mmol) and triethylamine (4.5 ml, 32.4 mmol) at 0° C., and the reaction was then stirred at 0-10° C. for 2 h. The solvent was evaporated under reduced pressure, the residue was dissolved in 100 mL of dichloromethane, and washed with water (25 ml×2). The organic phases were combined, dried over Na2SO4, filtered, and concentrated in vacuo. The solution was directly purified on a reverse phase column (eluted with 0-100 ACN-H2O (0.1% FA) in 30 min) to give 3-bromo-6-isopropyl-5-methoxypyridin-2-ol. LCMS (ESI): C9H 12 BrNO2[M+H] + Calculated m / z 246.1, measured 246.1.

[0176] To a solution of 3-bromo-6-isopropyl-5-methoxypyridin-2-ol (80.0 mg, 0.325 mmol) in 1,4-dioxane / HO (2 mL / 0.2 mL) was added [(E)-2-phenylethenyl]boranediol (72.1 mg, 0.488 mmol), Pd(dppf)Cl2 (23.8 mg, 0.033 mmol), and K2CO3 (89.9 mg, 0.650 mmol). The reaction mixture was stirred at 80 °C under nitrogen for 16 h. LCMS showed the desired MS was detected. The solvent was removed by vacuum. The residue was purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give 6-isopropyl-5-methoxy-3-[(E)-2-phenylethenyl]pyridin-2-ol. LCMS (ESI): C 17 H 19 NO[M+H] + Calculated m / z 270.2, measured 270.2.

[0177] To 6-isopropyl-5-methoxy-3-[(E)-2-phenylethenyl]pyridin-2-ol (40.0 mg, 0.149 mmol) in DCM (5 ml) was added BBr3 (1 mL) and the reaction was then stirred at 25° C. for 16 h. The solution was added with water (10 mL) and extracted with DCM (20 mL×3). The organic phases were combined, washed with aqueous NaHCO3 and brine, dried over Na2SO4, filtered and concentrated in vacuo. The crude was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 25-95, 11.5 min) to give compound 127.

[0178] Example 27 - Preparation of (E)-4-hydroxy-3-isopropyl-1-methyl-6-styrylpyridin-2(1H)-one (Compound 128) [ka] To a solution of 4-chloropicolinic acid (17.0 g, 108.28 mmol) in MeOH (800 mL) was added H2SO4 (4 mL, 18.4 mol / L) stirred at 80 °C for 72 h. The mixture was cooled to room temperature. The solvent was concentrated under vacuum, saturated NaHCO3 was poured in, and the mixture was extracted with EtOAc (4 x 800 mL). The combined organic layers were washed with brine (300 mL), dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was then purified by flash chromatography to give methyl 4-methoxypicolinate (eluted with PE / EtOAc 100 / 0 to 50 / 50 in 30 min) and methyl 4-chloropicolinate (9.0 g, 52.32 mmol) (eluted with PE / EtOAc 100 / 0 to 10 / 90 in 30 min).

[0179] To a solution of methyl 4-chloropicolinate (9.0 g, 52.32 mmol) in MeOH (800 mL) was added sodium methoxide (30 wt% in methanol, 7.8 g) stirred at reflux for 12 h. The mixture was cooled to room temperature and then poured into 1N HCl. The solvent was removed. Water (200 mL) was added to the residue and the mixture was extracted with EtOAc (4×500 mL). The combined organic layers were washed with brine (200 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was then purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 50 / 50 in 30 min) to give 4-methoxypicolinate. LCMS (ESI): C8H 10 NO3[M+H] + Calculated m / z 168.1, measured 168.2.

[0180] To a solution of 4-methoxypicolinate (6.2 g, 37.13 mmol) in DCM (250 mL) was added a portion of mCPBA (77%, 13.3 g, 59.54 mmol) at 0 °C and stirred at room temperature for 22 h. Additional mCPBA (77%, 5.0 g, 22.33 mmol) was added and the mixture was stirred for another 5 h. The reaction was diluted with ethyl acetate (300 mL) and washed with saturated aqueous sodium bicarbonate (100 mL). The separated aqueous phase was extracted with DCM / MeOH=9 / 1 (5 x 500 mL) and the combined organic layers were dried over Na2SO4, filtered and concentrated under reduced pressure. The resulting material was purified by silica gel column chromatography (0-10% methanol in dichloromethane) to give 4-methoxy-2-(methoxycarbonyl)pyridine 1-oxide. LCMS (ESI): C8H 10 NO4[M+H] + Calculated m / z 184.1, measured value 184.0.

[0181] To a solution of 4-methoxy-2-(methoxycarbonyl)pyridine 1-oxide (3.5 g, 19.12 mmol) and triethylamine (5.8 g, 57.43 mmol) in THF (200 mL) was added trifluoroacetic anhydride (12.0 g, 57.46 mmol) dropwise over 5 min at 0 °C. The mixture was stirred at 0 °C for an additional 4 h. Upon completion, the reaction was diluted with dichloromethane (5 x 500 mL) and extracted with a mixture of saturated aqueous sodium bicarbonate (200 mL) and brine (200 mL). The organic rubber was separated, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting crude material was purified by silica gel column chromatography (0-10% methanol in dichloromethane) to give methyl 6-hydroxy-4-methoxypicolinate. LCMS (ESI): C8H9NO4[M+H] + Calculated m / z 184.1, measured 184.2.

[0182] To a mixture of methyl 6-hydroxy-4-methoxypicolinate (3.2 g, 17.52 mmol), potassium carbonate (3.6 g, 26.24 mmol) in DMF (150 mL), iodoethane (5.0 g, 35.00 mmol) was added and the mixture was stirred at room temperature overnight. After completion, water (150 mL) was added to the residue and the mixture was extracted with EtOAc (3×200 mL). The combined organic layers were washed with brine (200 mL×3), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was then purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 60 / 40 in 30 min) to give methyl 6-hydroxy-4-methoxypicolinate. LCMS (ESI): C8H 10 NO4[M+H] + Calculated m / z 198.1, measured 198.2.

[0183] To a solution of methyl 6-hydroxy-4-methoxypicolinate (1.7 g, 8.63 mmol) in DMF (100 mL) was added NBS (1.5 g, 8.42 mmol) stirred at 50 °C for 12 h. The mixture was cooled to room temperature. After completion, water (100 mL) was added to the residue and the mixture was extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (3 x 300 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was then purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 65 / 35 in 30 min) to give methyl 5-bromo-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carboxylate. LCMS (ESI): C9H 11 BrNO4[M+H] + Calculated m / z 276.0, measured 276.1.

[0184] To a solution of methyl 5-bromo-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carboxylate (1.8 g, 6.52 mmol) in 1,4-dioxane:H2O=5:1 (100 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.3 g, 7.82 mmol), Pd(Dppf)Cl2 (477.4 mg, 0.65 mmol), and KF (756.5 mg, 13.05 mmol) stirred at 80 °C under nitrogen for 12 h. The mixture was cooled to room temperature. The solvent was removed. Water (100 mL) was added to the residue and the mixture was extracted with EtOAc (3 x 200 mL). The combined organic layers are washed with brine (50 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue is then purified by flash chromatography (eluting with PE / EtOAc 100 / 0 to 70 / 30 in 30 min) to give methyl 4-methoxy-1-methyl-6-oxo-5-(prop-1-en-2-yl)-1,6-dihydropyridine-2-carboxylate. LCMS (ESI): C 12 H 16 NO4[M+H] + Calculated m / z 238.1, measured 238.2.

[0185] To a solution of methyl 4-methoxy-1-methyl-6-oxo-5-(prop-1-en-2-yl)-1,6-dihydropyridine-2-carboxylate (420.0 mg, 1.76 mmol) in MeOH (50 mL) was added Pd / C (10%, 187.8 mg, 0.18 mmol) stirred at room temperature under H2 (1 atm) for 1 h. The mixture was filtered and concentrated in vacuo. The crude product (approximately 390.0 mg) is used in the next step without further purification. LCMS (ESI): C 12 H 18 NO4[M+H] + Calculated m / z 240.1, measured 240.2.

[0186] To a solution of methyl 5-isopropyl-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carboxylate (crude, ca. 390.0 mg) in THF (50 mL) was added LiAlH4 (74.4 mg, 1.96 mmol) which was stirred slowly at 0° C. for 0.5 h. Water (20 mL) and 10% aqueous NaOH (10 mL) were added to the mixture and the mixture was extracted with EtOAc (3×50 mL). The combined organic layers were washed with brine (30 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The crude product was used in the next step without further purification. LCMS (ESI): C 11 H 18 NO3[M+H] + Calculated m / z 212.1, measured 212.2.

[0187] To a solution of 6-(hydroxymethyl)-3-isopropyl-4-methoxy-1-methylpyridin-2(1H)-one (crude, ca. 120.0 mg) in MeCN (15 mL) was added IBX (191.1 mg, 0.68 mmol) stirred at 80 °C for 6 h. The mixture was cooled to room temperature. The solvent was removed. Water (10 mL) was added to the residue and the mixture was extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was then purified by flash chromatography (eluted with PE / EtOAc 100 / 0 to 50 / 50 in 30 min) to give 5-isopropyl-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-. LCMS (ESI): C 11 H 16 NO3[M+H] + Calculated m / z 210.1, measured 210.2.

[0188] To a solution of 5-isopropyl-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carbaldehyde (51.0 mg, 0.24 mmol) in DMF (10 mL) was added dimethyl benzylphosphonate (73.2 mg, 0.37 mmol), NaOMe (30 wt% in methanol, 88.7 mg, 0.49 mmol) and 18-crown-6 (12.9 mg, 0.05 mmol) stirred at 50° C. for 3 h. The mixture was cooled to room temperature. The solvent was removed. Water (5 mL) was added to the residue and the mixture was extracted with EtOAc (3×15 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was then purified by flash chromatography (eluting with PE / EtOAc 100 / 0 to 40 / 60 in 30 min) to give 5-isopropyl-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carbaldehyde. LCMS (ESI): C 18 H 22 NO2[M+H] + Calculated m / z 284.2, measured 284.2.

[0189] To a solution of 5-isopropyl-4-methoxy-1-methyl-6-oxo-1,6-dihydropyridine-2-carbaldehyde (42.0 mg, 0.1574. mmol) in DCM (5 mL) was added BBr3 (74.2 mg, 0.30 mmol), and the mixture was then stirred at 25 °C for 12 h. The solution was added NaHCO3 (aq) and extracted with DCM (10 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 30-70, 9.0 min) to give compound 128.

[0190] Example 28 - Preparation of 2-isopropyl-5-(phenylthio)benzene-1,3-diol (Compound 129) [ka] To a solution of MeOH (1.81 g, 0.0564 mol) in THF (50 mL) and 2-methyltetrahydrofuran (50 mL) was added t-BuOK (6.3 g, 0.0564 mol) at 25° C. After 30 min. 1,3,5-trifluoro-2-nitrobenzene (5.0 g, 0.0282 mol) was then added at 0° C. The reaction mixture was stirred at 25° C. for 30 min. The residue was quenched with ice water and extracted with EtOAc (100 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The solvent was removed under reduced pressure to give 5-fluoro-1,3-dimethoxy-2-nitrobenzene, which was used directly in the next step without purification. 1 H NMR (400MHz, DMSO-d6, ppm) 6.88 (d, J=12.0Hz, 2H), 3.87 (s, 6H).

[0191] To a solution of 5-fluoro-1,3-dimethoxy-2-nitrobenzene (7.3 g, 0.0361 mol) in DMSO (200 mL) was added sodium benzenethiolate (7.2 g, 0.0542 mol) and Cs2CO3 (23.5 g, 0.0722 mol), then the reaction mixture was stirred at 80 °C for 12 h and then cooled to ambient temperature. The mixture was extracted with EtOAc (100 mL x 3). The combined organic phase was washed with saturated NaCl (300 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 80 / 20 in 30 min) to give (3,5-dimethoxy-4-nitrophenyl)(phenyl)sulfane. LCMS (ESI): C 14 H 14 NO4S[M+H] + Calculated ms / z = 292.3, measured 292.0.

[0192] To a solution of (3,5-dimethoxy-4-nitrophenyl)(phenyl)sulfane (4.0 g, 0.0138 mol) in MeOH (300 mL) was added Pd / C (400.0 mg, 10% Pd), and then the mixture was stirred at 25° C. under 1 atm of H for 12 h. The solution was filtered, the cake was washed with MeOH (10 mL×3), and the filtrates were combined. The solvent was removed under reduced pressure to give 2,6-dimethoxy-4-(phenylthio)aniline. Directly to next step without purification. LCMS (ESI): C 14 H 16 NO2S[M+H] + Calculated m / z 262.3, measured 262.1.

[0193] To a solution of 2,6-dimethoxy-4-(phenylthio)aniline (2.5 g, 0.0096 mol) in ACN (50 mL) was added P-TsOH (5.5 g, 0.0288 mol) at 0 °C for 30 min. NaNO2 (1.3 g, 0.0192 mol) and KI (4.0 g, 0.024 mol) in water (25 mL) were added dropwise at 0 °C. The reaction mixture was stirred at 25 °C for 12 h. The residue was quenched with ice water and extracted with EtOAc (100 mL × 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuum. The residue was purified by silica gel chromatography (eluted with PE / EtOAc from 100 / 0 to 88 / 12) to give 2-iodo-1,3-dimethoxy-5-phenoxybenzene. 1 H NMR (400MHz, DMSO-d6, ppm) 7.41-7.35 (s, 5H), 6.56 (s, 2H), 3.74 (s, 6H).

[0194] To a solution of 2-iodo-1,3-dimethoxy-5-phenoxybenzene (2.3 g, 0.0062 mol) in toluene (100 mL) was added isopropylboronic acid (0.8 g, 0.0093 mol), {Pd(cinnamyl)Cl}2 (160.6 mg, 0.3089 mmol), L (49.1 mg, 0.1235 mmol), and K3PO4·H2O (4.2 g, 0.0186 mol). The mixture was stirred at 100 °C under N2 for 12 h. It was cooled to ambient temperature. The mixture was extracted with EtOAc (100 mL × 3). The combined organic phase was washed with saturated NaCl, dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel chromatography (eluting with PE / EtOAc from 100 / 0 to 90 / 10) to give (4-isopropyl-3,5-dimethoxyphenyl)(phenyl)sulfane. 1 H NMR (400MHz, DMSO-d6, ppm) 7.39-7.27 (m, 5H), 6.59 (s, 2H), 3.69 (s, 6H).

[0195] To a solution of (4-isopropyl-3,5-dimethoxyphenyl)(phenyl)sulfane (510.0 mg, 1.7683 mmol) in DCM (3 mL) was added BBr3 (10 mL, 1 M in DCM) at 0° C. The reaction mixture was stirred at 25° C. for 36 h. The reaction was quenched with MeOH and concentrated in vacuo. The mixture was then adjusted to 7-8 with NaHCO3 (aq), extracted with EtOAc, washed with brine, dried over NaSO4, and concentrated. The residue was purified by preparative HPLC (column: Gemini 5 um C18 150×21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 70-95, 6.0 min) to give compound 129 (132.3 mg, 28.69% yield).

[0196] Example 29 - Preparation of 2-isopropyl-5-(phenylsulfinyl)benzene-1,3-diol (Compound 130) [ka] To a solution of compound 129 (100.0 mg, 0.3467 mmol) in DCM (3 mL) was added M-CPBA (59.8 mg, 0.3467 mmol). The reaction mixture was stirred at 25 °C for 2 h. The reaction was quenched with NaHCO3 (aq) and extracted with EtOAc (100 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 70-95, 6.0 min) to give compound 130.

[0197] Example 30 - Preparation of 2-isopropyl-5-(phenylsulfonyl)benzene-1,3-diol (Compound 131) [ka] To a solution of compound 129 (100.0 mg, 0.3467 mmol) in DCM (3 mL) was added M-CPBA (239.2 mg, 1.3868 mmol). The reaction mixture was stirred at 25 °C for 2 h. The reaction was quenched with NaHCO3 and extracted with EtOAc (100 mL x 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 70-95, 6.0 min) to give compound 131.

[0198] Example 31 - Preparation of 2-isopropyl-5-phenoxybenzene-1,3-diol (Compound 132) [ka] To a solution of MeOH (1.8 g, 0.0564 mol) in THF (50 mL) and 2-methyltetrahydrofuran (50 mL) was added t-BuOK (6.3 g, 0.0564 mol) at 25° C. After 30 min. 1,3,5-trifluoro-2-nitrobenzene (5.0 g, 0.0282 mol) was then added at 0° C. The reaction mixture was stirred at 25° C. for 30 min. The residue was quenched with ice water and extracted with EtOAc (100 mL×3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuo. The solvent was removed under reduced pressure to give 5-fluoro-1,3-dimethoxy-2-nitrobenzene, which was used directly in the next step without purification. 1 H NMR (400MHz, DMSO-d6.ppm): 6.88 (d, J=12.0Hz, 2H), 3.87 (s, 6H).

[0199] To a solution of 5-fluoro-1,3-dimethoxy-2-nitrobenzene (7.3 g, 0.0361 mol) in DMSO (200 mL) was added phenol (5.1 g, 0.0542 mol) and Cs2CO3 (23.5 g, 0.0722 mol), then the reaction mixture was stirred at 80 °C for 12 h and then cooled to ambient temperature. The mixture was extracted with EtOAc (100 mL x 3). The combined organic phase was washed with saturated NaCl (300 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 50 / 1 to 4 / 1 in 30 min) to give 1,3-dimethoxy-2-nitro-5-phenoxybenzene. 1 H NMR (400MHz, DMSO-d6, ppm): 7.45 (t, J = 8.0 Hz, 2H), 7.23 (t, J = 7.6 Hz, 1H), 7.14 (d, J = 8.0 Hz, 2H), 6.48 (s, 2H), 3.78 (s, 6H).

[0200] To a solution of 1,3-dimethoxy-2-nitro-5-phenoxybenzene (4.1 g, 0.0161 mol) in MeOH (300 mL) was added Pd / C (400.0 mg, 10% Pd), and then the mixture was stirred at 25° C. under 1 atm of H2 for 12 h. The solution was filtered, the cake was washed with MeOH (10 mL×3), and the filtrates were combined. The solvent was removed under reduced pressure to give 2,6-dimethoxy-4-phenoxyaniline. Directly to next step without purification. 1 H NMR (400MHz, DMSO-d6, ppm): 7.31 (t, J = 8.0 Hz, 2H), 7.01 (t, J = 7.2 Hz, 1H), 6.89 (d, J = 8.0 Hz, 2H), 6.35 (s, 2H), 4.04 (s, 2H), 3.72 (s, 6H).

[0201] To a solution of 2,6-dimethoxy-4-phenoxyaniline (2.5 g, 0.0103 mol) in ACN (50 mL) was added P-TsOH (5.9 g, 0.0308 mol) at 0 °C. After 30 min at 0 °C. NaNO2 (1.4 g, 0.0205 mol) and potassium iodide (4.3 g, 0.0257 mol) in water (25 mL) were added dropwise at 0 °C. The reaction mixture was stirred at 25 °C for 12 h. The residue was quenched with ice water and extracted with EtOAc (100 mL × 3). The organic phases were combined, washed with brine, dried over Na2SO4, filtered and concentrated in vacuum. The residue was purified by silica gel chromatography (eluted with PE / EtOAc 100 / 0 to 90 / 10 in 30 min) to give 2-iodo-1,3-dimethoxy-5-phenoxybenzene. LCMS(ESI):C14H 14 IO3[M+H] + Calculated m / z 357.0, measured 356.9.

[0202] To a solution of 2-iodo-1,3-dimethoxy-5-phenoxybenzene (2.3 g, 0.0065 mol) in 1,4-dioxane (100 mL) and H2O (20 mL) was added 4,4,5,5-tetramethyl-2-(prop-1-en-2-yl)-1,3,2-dioxaborolane (1.3 g, 0.0078 mol), Pd(dppf)Cl2 (480.0 mg, 0.0006 mmol), and K2CO3 (1.8 g, 0.013 mol). The mixture was stirred at 100 °C under N2 for 12 h. It was cooled to ambient temperature. The mixture was extracted with EtOAc (100 mL x 3). The combined organic phase was washed with saturated NaCl, dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel chromatography (eluting with PE / EtOAc 100 / 0 to 90 / 10 in 30 min) to give 1,3-dimethoxy-5-phenoxy-2-(prop-1-en-2-yl)benzene. LCMS (ESI): C 17 H 19 O3 [M+H] + Calculated m / z 271.1, measured 271.2.

[0203] To a solution of 1,3-dimethoxy-5-phenoxy-2-(prop-1-en-2-yl)benzene (610.0 mg, 2.1299 mmol) in MeOH (200 mL) was added Pd / C (300.0 mg), and then the mixture was stirred at 25° C. under 1 atm of H for 12 h. The solution was filtered, the cake was washed with MeOH (20 mL×3), and the filtrates were combined. The solvent was removed under reduced pressure to give 2-isopropyl-1,3-dimethoxy-5-phenoxybenzene. Directly to next step without purification. 1 H NMR(400MHz,DMSO-d6,ppm):7.42-7.34(m,2H), 7.11(t,J=7.6Hz,1H), 7.03-6. 97(m,2H), 6.28(s,2H), 3.68(s,6H), 3.56-3.41(m,1H), 1.20(d,J=7.2Hz,6H).

[0204] To a solution of 2-isopropyl-1,3-dimethoxy-5-phenoxybenzene (100.0 mg, 0.3672 mmol) in DCM (3 mL) was added BBr3 (3 mL, 1 M in DCM) at 0 °C. The reaction mixture was stirred at 25 °C for 36 h. After completion. the reaction was quenched with MeOH and concentrated in vacuo. The mixture was then adjusted with NaHCO3 (aq) and extracted with EtOAc (100 mL x 3). The combined organic phase was washed with saturated NaCl (300 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 60-95, 9.0 min) to give compound 132.

[0205] Example 32 - Preparation of 2-isopropyl-3-methoxy-5-phenoxyphenol (Compound 133) [ka] To a solution of 2-isopropyl-1,3-dimethoxy-5-phenoxybenzene (100.0 mg, 0.3672 mmol) in DMF (3 mL) was added MeSNa (264.5 mg, 3.6718 mmol). The reaction mixture was then heated at 100 °C for 120 min under microwave irradiation. The reaction was quenched with H2O and concentrated in vacuo. The residue was purified by preparative HPLC (column: Gemini 5um C18 150 x 21.2 mm, mobile phase: ACN-H2O (0.1% FA), gradient: 50-95, 7.0 min) to give compound 133. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6]

[0206] Compounds 139-166 were prepared in a similar manner to the synthesis described above. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6]

[0207] Example 33: AHR agonist reporter assay in human cell lines AHR reporter assays were performed according to the protocol for the Human Aryl Hydrocarbon Receptor (AHR) Reporter Assay System (INDIGO Bioscience, #IB06001-32). AHR reporter cells were thawed and pre-incubated in cell recovery medium (CRM) for 6 hours. The medium was then removed and cells were incubated with compound screening medium (CSM) for 24 hours in the absence (negative control) or presence of increasing concentrations of test compounds (typical dilutions: 128 pM, 640 pM, 3.2 nM, 16 nM, 80 nM, 400 nM, 2 μM, 10 μM in duplicate). For positive inhibition controls, cells were activated with literature AHR agonists. After 24 hours of incubation, the medium was removed and luciferase detection reagent (LDR) was added. Firefly luciferase activity was quantified using a plate reader. Results were normalized by positive and negative controls. Compounds of the present disclosure have been found to act on the AHR as shown in Tables A', B', C', and D' below.

[0208] Example 34 - AHR-regulated CYP1A1 expression in human cell lines To evaluate the AHR agonist activity of test compounds, quantitative PCR analysis was used to determine the expression level of the AHR-regulated gene CYP1A1 in the human monocytic U937 cell line. U937 cells were cultured at 5 × 10 in 200 μL of growth medium in a 96-well cell culture microplate. 5Cells were seeded at a concentration of 10 ... Taqman probes for human CYP1A1 (Hs01054797_g1) and human GAPDH (Hs02786624_g1) were used to analyze fold expression of CYP1A1 over GAPDH. Compounds of the present disclosure were found to initiate expression of CYP1A1 as shown in Tables A', B', C', and D' below.

[0209] Example 35: Nrf2 transcription factor activity assay in human cell lines Nrf2 reporter assay was performed according to the protocol of Human Nuclear Factor (Erythroid-Induced 2)-Like 2 (Nrf2) Reporter Assay System (INDIGO Bioscience, #IB10001). Nrf2 reporter cells were thawed and pre-incubated in cell recovery medium (CRM) for 6 hours. The medium was then removed and cells were incubated with compound screening medium (CSM) for 24 hours in the absence (negative control) or presence of test compounds at increasing concentrations (typical dilutions: 128 pM, 640 pM, 3.2 nM, 16 nM, 80 nM, 400 nM, 2 μM, 10 μM in duplicate). For positive controls, cells were activated with CDDO or Nrf2 agonists as described in the literature. After 24 hours of incubation, the medium was removed and luciferase detection reagent (LDR) was added. Firefly luciferase activity was quantified using a plate reader. Results were normalized by positive and negative controls. Compounds of the present disclosure have been found to act at Nrf2, as shown in Tables A', B', C', and D' below.

[0210] Example 36: AHR-regulated IL-6 inhibition in human primary M1 macrophages To analyze the inflammatory cytokine IL-6 inhibitory activity of the test compounds, quantitative PCR analysis was used to determine the expression level of IL-6 gene expression in human primary M1 macrophage cells. Human M1 macrophages were differentiated from PBMCs. Briefly, on day 1, monocytes were isolated from human PBMCs using EasySe Human Monocyte Enrichment Kit without CD16 depletion (Stemcell, 19058). The isolated monocytes were cultured at 3 × 10 in a 15 cm dish using 30 ml medium containing 50 ng / ml GM-CSF (R&D, 215-GM-050 / CF). 7 On day 5, 30 ml of fresh medium containing 50 ng / ml GM-CSF was added. On day 8, 1.5 × 10 5Cells / well were replated in 24-well plates and 500ul of medium containing 10ng / ml LPS (Sigma, L7770), 20ng / ml IFN-gamma (PeproTech, 300-02), 50ng / ml GM-CSF, and test compound was added. Cells were typically incubated with eight different concentrations of test compound (typical dilutions: 12.8pM, 64pM, 320pM, 1.6nM, 8nM, 40nM, 200nM, 1μM in duplicate). IL-6 expression was inhibited with AHR agonists as described in the literature as a positive inhibitory control; alternatively, unstimulated cells were used as a negative inhibitory control. After 24 hours of stimulation on day 9, the medium was removed and cellular RNA was isolated using RNeasy®Plus 96 kit (Qiagen, 74192) and reverse transcribed into cDNA using PrimeScript RT Reagent Kit (Perfect Real Time) (TaKaRa, RR037A). Primers for human GAPDH (F:GCACCGTCAAGGCTGAGAAC; R:TGGTGAAGACGCCAGTGGA) and human IL-6 (F:GGTACATCCTCGACGGCATCT; R:GTGCCTCTTTGCTGCTTTCAC) were used to analyze the fold expression of IL-6 over GAPDH by quantitative PCR. The data of IL-6 inhibitory activity are shown in Table F' below.

[0211] The data provided herein demonstrate that the compounds of the present disclosure are advantageously potent agonists of the AHR. See the data shown in Tables A', B', C', D', and E' below. Table E' includes data for two reference compounds. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14]

[0212] It should be understood that all combinations of the foregoing concepts and implementations, as well as additional concepts and implementations discussed in more detail below, are contemplated as being part of the inventive subject matter disclosed herein and may be used in any suitable combination to achieve the benefits described herein, in particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein.

[0213] The foregoing description is given solely for clarity of understanding, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those skilled in the art.

[0214] As used throughout this specification, the terms "substantially" and "about" are used to describe and account for small variations, for example, they can refer to ±5% or less, such as ±2% or less, such as ±1% or less, such as ±0.5% or less, such as ±0.2% or less, such as ±0.1% or less, such as ±0.05% or less.

[0215] Throughout this specification and the claims that follow, unless the context clearly indicates otherwise, the term "comprise" and variations such as "comprises" and "comprising" are understood to imply the inclusion of a stated integer or step, or group of integers or steps, but not the exclusion of any other integer or step, or group of integers or steps.

[0216] Throughout this specification, when a composition is described as comprising components or materials, it is contemplated that the composition can also consist essentially of, or consist of, any combination of the recited components or materials, unless otherwise stated. Similarly, when a method is described as comprising particular steps, it is contemplated that the method can also consist essentially of, or consist of, any combination of the recited steps, unless otherwise stated. The inventions illustratively disclosed herein may be suitably practiced in the absence of any element or step not specifically disclosed herein.

[0217] The implementation of the methods disclosed herein and their individual steps can be performed manually and / or with the aid of electronic devices, or using automation provided by electronic devices. Although the processes have been described with reference to specific examples, those skilled in the art will readily appreciate that other ways of performing the operations associated with the methods may be used. For example, the order of various steps may be changed without departing from the scope or spirit of the methods, unless otherwise noted. In addition, some of the individual steps may be combined, omitted, or further subdivided into additional steps.

[0218] All patents, publications, and references cited herein are hereby incorporated by reference in their entirety. In the event of a conflict between this disclosure and the incorporated patents, publications, and references, this disclosure shall control.

Claims

1. A compound having the structure of formula (I): 【Chemistry 1】 or a pharma- ceutically acceptable salt thereof, During the ceremony, R １ is C １－６ Alkyl, C １－６ Haloalkyl, C １－６ Hydroxyalkyl, O.C. １－６ Alkyl, C(=O)C １－６ Alkyl, or C(=CH)C １－６ is alkyl, R ２ OH, O.C. １－６ Alkyl, N(R Ｎ１ ) ２ , or halo; Each R Ｎ１ are independently H or C １－６ is alkyl, X １ is N, C-OH, or C-OC １－６ is alkyl, A is an optionally substituted fused bicyclic heteroaryl group having 8 to 10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S; or 【Chemistry 2】 and Y is, 【Chemistry 3】 O, S, S=O, or SO ２ and Z is an optionally substituted phenyl group or an optionally substituted heteroaryl group having 5 or 6 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, and S; However, R ２ is OH or OC １－６ is alkyl, and X １ is C-OH or C-OC １－６ When Y is alkyl, 【Chemistry 4】 or a pharma- ceutically acceptable salt thereof, provided that:

2. R １ But, C １－６ 2. The compound or salt of claim 1, wherein the aryl group is alkyl.

3. R １ but, 【Chemistry 5】 3. The compound or salt according to claim 1 or 2,

4. R １ but, 【Chemistry 6】 4. The compound or salt of claim 3,

5. R １ but, 【Chemistry 7】 2. The compound or salt of claim 1,

6. R ２ But, OH, OCH ３ , N(R Ｎ１ ) ２ , or F, and each R Ｎ１ are independently H or CH ３ The compound or salt according to any one of claims 1 to 5,

7. R ２ The compound or salt of claim 6, wherein is OH.

8. R ２ But OCH ３ 7. The compound or salt of claim 6,

9. R ２ But NH ２ 7. The compound or salt of claim 6,

10. R ２ The compound or salt of claim 6, wherein is F.

11. X １ The compound or salt according to any one of claims 1 to 10, wherein is N.

12. X １ The compound or salt according to any one of claims 1 to 10, wherein is C-OH.

13. X １ But C-OCH ３ The compound or salt according to any one of claims 1 to 10,

14. R ２ But, OH, OCH ３ , N.H. ２ , or F, and X １ is N, C—OH, or C—OCH ３ The compound or salt according to any one of claims 1 to 6,

15. R ２ is OH, and X １ is N or R ２ is OH, and X １ is C—OH or R ２ But NH ２ And X １ is C—OH or R ２ But NH ２ And X １ is N or R ２ is F and X １ is C—OH or R ２ is OH, and X １ But C-OCH ３ 15. The salt compound of claim 14,

16. R １ but, 【Chemistry 8】 and R ２ But, OH, OCH ３ , or NH ２ And X １ is N, C—OH, or C—OCH ３ 2. The compound or salt of claim 1,

17. 17. The compound or salt of any one of claims 1 to 16, wherein A is an optionally substituted fused bicyclic heteroaryl group having 8 to 10 total ring atoms and 1, 2, or 3 heteroatoms selected from N, O, or S.

18. 18. The compound or salt of claim 17, wherein A is benzoxazolyl, benzimidazolyl, indolyl, isoindolyl, indolizinyl, purinyl, benzofuranyl, benzimidazole, quinolinyl, isoquinolinyl, naphthyridinyl, or pyridopyrazinyl, any of the foregoing being unsubstituted or substituted.

19. 20. The compound or salt of claim 18, wherein A is benzoxazolyl, benzimidazolyl, quinolinyl, isoquinolinyl, or naphthyridinyl, any of the foregoing being unsubstituted or substituted.

20. A, 【Chemistry 9-1】 【Chemistry 9-2】 20. The compound or salt of claim 19, wherein any of the foregoing is unsubstituted or substituted.

21. 21. The compound or salt of any one of claims 1 to 20, wherein A is unsubstituted.

22. A, 【Chemistry 10】 22. The compound or salt of claim 21,

23. A, 【Chemistry 11】 23. The compound or salt of claim 22,

24. A, 【Chemistry 12】 22. The compound or salt of claim 21,

25. 21. The compound or salt of any one of claims 1 to 20, wherein A is substituted.

26. A is substituted with 1, 2, or 3 substituents, each of which is independently halo, OH, CN, COOH, COOC, １－６ Alkyl, C １－６ Alkyl, C １－６ Haloalkyl, O.C. １－６ Alkyl, O.C. １－６ Haloalkyl, C=OC １－６ Alkyl, or N(R Ｎ１ ) ２ and each R Ｎ１ are independently H or C １－６ 26. The compound or salt of claim 25, which is alkyl.

27. A is substituted with 1, 2, or 3 substituents, each of which is independently selected from F, Cl, OH, CN, COOH, CH ３ , O.C.H. ３ , C.F. ３ , O.C.F. ３ , N.H. ２ , N.H.H. ３ , or NH(CH ３ ) ２ 27. The compound or salt of claim 26,

28. A, 【Chemistry 13-1】 【Chemistry 13-2】 28. The compound or salt of claim 27,

29. A, 【Chemistry 14】 29. The compound or salt of claim 28,

30. A, 【Chemistry 15】 The compound or salt according to any one of claims 1 to 16,

31. Y, 【Chemistry 16】 31. The compound or salt of claim 30,

32. Y is O, S, S=O, or SO ２ 31. The compound or salt of claim 30,

33. 33. The compound or salt of any one of claims 30 to 32, wherein Z is an unsubstituted phenyl group or an unsubstituted pyridyl.

34. A, 【Chemistry 17】 34. The compound or salt of claim 33,

35. A, 【Chemistry 18】 34. The compound or salt of claim 33,

36. 33. The compound or salt according to any one of claims 30 to 32, wherein Z is a substituted phenyl group or a substituted pyridyl group.

37. The phenyl or pyridyl group is substituted with one, two, or three substituents, each of which is selected from the group consisting of halo, OH, CN, COOH, COOC, １－６ Alkyl, C １－６ Alkyl, C １－６ Haloalkyl, O.C. １－６ Alkyl, O.C. １－６ Haloalkyl, C=OC １－６ Alkyl, and N(R Ｎ１ ) ２ Each R Ｎ１ are independently H or C １－６ 37. The compound or salt of claim 36, which is alkyl.

38. The phenyl or pyridyl group is substituted with one, two, or three substituents, each of which is independently selected from F, Cl, OH, CN, COOH, CH ３ , O.C.H. ３ , C.F. ３ , O.C.F. ３ , N.H. ２ , N.H.H. ３ , or NH(CH ３ ) ２ 38. The compound or salt of claim 37,

39. A, 【Chemistry 19】 39. The compound or salt of claim 38,

40. R １ but, 【Chemistry 20】 and R ２ But, OH, OCH ３ , or NH ２ And X １ is N, C—OH, or C—OCH ３ and A is unsubstituted quinolinyl, unsubstituted isoquinolinyl, unsubstituted benzoxazolyl, or 【Chemistry 21】 2. The compound or salt of claim 1,

41. A compound having a structure listed in Table A, Table B, Table C, or Table D, or a pharma- ceutically acceptable salt thereof. 【Request 42】 【Chemical 22-1】 【Chemistry 22-2】 42. The compound of claim 41, selected from:

43. The compound or salt may comprise one or more deuterium atoms, one or more tritium atoms, one or more C １１ Atom, one or more C １３ Atom, one or more C １４ 43. The compound or salt of any one of claims 1 to 42, comprising an atom, or any combination of the foregoing.

44. 44. A pharmaceutical formulation comprising a compound or salt according to any one of claims 1 to 43 and a pharma- ceutically acceptable excipient.

45. 45. A method of modulating aryl hydrocarbon receptor (AHR) activity in a subject, comprising contacting the AHR with a compound or salt according to any one of claims 1 to 43, or a formulation according to claim 44, in an amount effective to modulate the AHR activity.

46. 45. A method for treating or preventing a disease or disorder in a subject, comprising administering to the subject a therapeutically effective amount of a compound or salt according to any one of claims 1 to 43, or a formulation according to claim 44.

47. 47. The method of claim 46, wherein the disease or disorder is an inflammatory disease or disorder.

48. 48. The method of claim 47, wherein the disease or disorder is a disease or disorder of the gastrointestinal tract, skin, lungs, central nervous system, pancreas, eye, bone or joint, a neuroinflammatory disease, or a neurodegenerative disease.

49. 49. The method of any one of claims 46 to 48, wherein the disease or disorder of the gastrointestinal tract is selected from the group consisting of colitis, inflammatory bowel disease, Crohn's disease, celiac disease, necrotizing enterocolitis, irritable bowel syndrome, chronic idiopathic constipation, traveler's diarrhea, and colorectal cancer.

50. The method of any one of claims 46 to 48, wherein the skin disease or disorder is selected from the group consisting of atopic dermatitis, acne, psoriasis, and vitiligo.

51. 49. The method of any one of claims 46 to 48, wherein the ocular disease or disorder is abnormal eye motility, inflammatory eye diseases, autoimmune eye diseases, genetic eye diseases, degenerative eye diseases, angiogenic eye diseases, dry and wet age-related macular degeneration ("AMD"), uveitis, retinitis pigmentosa ("RP"), primary open angle glaucoma ("POAG"), primary congenital glaucoma, Behcet's disease, or Leber's congenital amaurosis ("LCA").

52. 49. The method of any one of claims 46 to 48, wherein the pulmonary disease or disorder is pulmonary fibrosis, asthma, or chronic obstructive pulmonary disease.

53. The method according to any one of claims 46 to 48, wherein the bone and joint disease or disorder is osteoporosis, rheumatoid arthritis, or bone cancer.

54. 47. The method of claim 46, wherein the disease or disorder is diabetes, cancer, a viral infection, or a bacterial infection.

55. 55. The method of claim 54, wherein the viral infection is a flavivirus infection or a coronavirus infection.

56. 55. The method of claim 54, wherein the bacterial infection is a pulmonary infection, a gastrointestinal infection, a skin infection, an ear infection, or sepsis.

57. 57. The method of any one of claims 46 to 56, further comprising administration of a therapeutic agent.

58. 58. The method of claim 57, wherein the therapeutic agent is an anti-inflammatory agent.

59. 59. The method of claim 58, wherein the anti-inflammatory agent is selected from mesalazine, naproxen, ibuprofen, diclofenac, celecoxib, sulindac, oxaprozin, piroxicam, indomethacin, meloxicam, fenoprofen, diflunisal, etodolac, ketorolac tromethamine, meclofenamate, nabumetone, salsalate, or any combination of the foregoing.

60. A compound or salt according to any one of claims 1 to 43, or a formulation according to claim 44, for use in the treatment or prevention of a disease or disorder in a subject.

61. 45. Use of a compound or salt according to any one of claims 1 to 43, or a pharmaceutical composition according to claim 44, in a method for treating or preventing a disease or disorder in a subject.

Images