Compositions and methods for gene editing

Abstract

To provide materials and methods for treating a patient with one or more conditions associated with ANGPTL3 whether ex vivo or in vivo, as well as materials and methods for editing and / or modulating the expression of ANGPTL3 gene in a cell by genome editing.SOLUTION: The present invention provides a method for producing a population of Angiopoietin-like 3 (ANGPTL3)-modified cells, the method comprising: introducing into cells (a) a guide RNA (gRNA) or nucleic acid encoding a gRNA that targets an ANGPTL3 genomic locus, and (b) a RNA-guided endonuclease or nucleic acid encoding an RNA-guided endonuclease; and producing a population of cells that comprise a modification in the ANGPTL3 gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application No. 62 / 461,829, filed February 22, 2017, U.S. Provisional Patent Application No. 62 / 526,562, filed June 29, 2017, and U.S. Provisional Patent Application No. 62 / 587,832, filed November 17, 2017, each of which is incorporated by reference in its entirety herein.

[0002] Sequence Listing This application has been submitted with a sequence listing in electronic format. The sequence listing file, named C154270001WO00-SEQLIST-HJD.txt, was created on October 27, 2017 and is 13.2 MB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0003] The present disclosure relates in some aspects to the field of gene editing, e.g., modification of the angiopoietin-like 3 (ANGPTL3) gene. [Background technology]

[0004] Genome editing refers to strategies and techniques for targeted, specific modification of an organism's genetic information (genome). Genome editing is a very active field of research due to its wide range of possible applications, especially in the field of human health. For example, genome editing can be used to modify (e.g., correct or knock out) genes with deleterious mutations or to investigate the function of genes. Early techniques developed to insert transgenes into living cells were often limited by the random nature of the insertion of new sequences into the genome. Random insertion into the genome can disrupt the normal regulation of neighboring genes, resulting in serious undesirable effects. Furthermore, random integration techniques are largely reproducible, as there is no guarantee that the sequence will be inserted in the same location in two different cells. Recent genome editing strategies, such as zinc finger nucleases (ZFNs), transcription activators like effector nucleases (TALENs), homing endonucleases (HEs), and Mega TALs, allow for the modification of specific regions of DNA, thereby increasing the precision of modifications compared to earlier techniques. These new platforms offer much higher reproducibility, but still have limitations.

[0005] Despite the efforts of researchers and medical professionals worldwide addressing genetic disorders, and despite the promise of genome editing approaches, there remains a need to develop safe and effective therapeutics relevant to ANGPTL3-related indications.

[0006] By using genome editing tools to make permanent modifications to the genome that can address an ANGPTL3-related disorder or condition with a single treatment, the resulting therapy can completely treat a given ANGPTL3-related indication and / or disease. Summary of the Invention

[0007] In some aspects, the present disclosure provides highly efficient gene editing methods for modifying the angiopoietin-like 3 (ANGPTL3) gene. For example, in some embodiments, the gene editing methods herein can be used to modify at least 50%, at least 60%, or at least 70% of the cells of a population. Surprisingly, the cells of these modified cell populations, in some embodiments, exhibit a 5-fold (or greater) reduction in ANGPTL3 protein secretion. Thus, these methods may be particularly useful for treating ANGPTL3-related indications, such as dyslipidemia. Furthermore, in some embodiments, the methods provided herein use a cross-species (cross-reactive) gene editing system that allows for more accurate extrapolation of experimental data from animal models to humans.

[0008] In some aspects, provided herein are methods for producing a population of angiopoietin-like 3 (ANGPTL3) modified cells, the methods comprising introducing into cells (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA (e.g., as a cross-reactive gRNA) that targets the ANGPTL3 locus (e.g., SEQ ID NO: 5304), and (b) an RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease (e.g., Cas9), and producing a population of cells comprising a modification (e.g., an insertion, deletion, or at least one nucleotide mutation) of the ANGPTL3 genomic locus. In some embodiments, the gRNA comprises a (20 bp) spacer sequence complementary to a sequence within the ANPTL3 genomic locus (e.g., within the ANGPTL3 gene, e.g., chromosomes 1:62,597,486 to 1:62,606,304). An insertion is the introduction of at least one nucleotide, a deletion is the removal of at least one nucleotide, and a mutation is a change of at least one nucleotide (e.g., from one nucleotide such as C to another such as A).

[0009] In some embodiments, at least 50% of the cells of the population comprise a modification of the ANGPTL3 gene (e.g., an insertion, deletion, or at least one nucleotide mutation). For example, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the population may comprise a modification of the ANGPTL3 gene. In some embodiments, 50%-100% of the cells of the population comprise a modification of the ANGPTL3 gene. For example, 50%-60%, 50%-65%, 50%-70%, 50%-75%, 50%-80%, 50%-85%, 50%-90%, or 50%-95% of the cells of the population may comprise a modification of the ANGPTL3 gene. In some embodiments, 50%-70% of the cells of the population comprise a modification of the ANGPTL3 gene.

[0010] In some embodiments, the ANGPTL3 protein secreted by the cells of the population is reduced at least 2-fold compared to the control. For example, the ANGPTL3 protein secreted by the cells of the population can be reduced at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold compared to the control. In some embodiments, the ANGPTL3 protein secreted by the cells of the population is reduced at least 5-fold compared to the control. In some embodiments, the ANGPTL3 protein secreted by the cells of the population is reduced 2-fold to 5-fold compared to the control.

[0011] In some embodiments, the control is a population of unmodified cells and / or a population of cells that did not receive a gRNA that includes a spacer sequence that is complementary to a region of the ANGPTL3 gene. In some embodiments, the control is a population of cells that receive a gRNA that includes a spacer sequence that is complementary to a region of a non-ANGPTL3 gene.

[0012] In some embodiments, the RNA-guided endonuclease is Cas9 endonuclease. In some embodiments, the RNA-guided nuclease is Cpf1 nuclease. Other RNA-guided nucleases may be used. In some embodiments, the Cas9 endonuclease or Cpf1 endonuclease is selected from S.pyogenes Cas9, S.aureus Cas9, N.meningitides Cas9, S.thermophilus CRISPR1 Cas9, S.thermophilus CRISPR3 Cas9, T.denticola Cas9, L.bacterium ND2006 Cpf1, and Acidaminococcus sp.BV3L6 Cpf1.

[0013] In some embodiments, the gRNA is a single guide RNA (sgRNA) that includes a targeting sequence (crRNA sequence) and an RNA-guided nuclease recruitment sequence (tracrRNA).

[0014] In some embodiments, the gRNA targets a regulatory element (e.g., a promoter, enhancer, or other regulatory element) of the ANGPTL3 genomic locus.

[0015] In some embodiments, the gRNA is cross-reactive to humans and cynomolgus monkeys (e.g., the spacer sequence of the gRNA is complementary to a region of the human ANGPTL3 gene and complementary to a region of the cynomolgus monkey ANGPTL3 gene).

[0016] In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2′-O-methyl nucleotides at the 3′ and 5′ ends of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2′-O-methyl nucleotides at the 3′ end of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2′-O-methyl nucleotides at the 5′ end of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2′-O-methyl nucleotides at the 3′ end and / or three 5′ ends of the gRNA.

[0017] In some embodiments, the cells comprise hepatocytes.

[0018] In some embodiments, the spacer sequence comprises a sequence selected from CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071), GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069), and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070). In some embodiments, the spacer sequence comprises GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069). In some embodiments, the spacer sequence comprises GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070). In some embodiments, the spacer sequence comprises CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071).

[0019] In some embodiments, the population of cells is present in a subject having an ANGPTL3-associated condition. In some embodiments, the ANGPTL3-associated condition is dyslipidemia (abnormal amounts of lipids (e.g., triglycerides, cholesterol, and / or fatty phospholipids)).

[0020] In some embodiments, the gRNA and RNA-guided nuclease are formulated (pre-complexed) as a ribonucleoprotein particle (RNP).

[0021] In some embodiments, the nucleic acid of (a) and / or (b) is present on a viral vector, optionally an adeno-associated viral (AAV) vector.

[0022] In some embodiments, (a) the gRNA or a nucleic acid encoding a gRNA, and / or (b) the RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease are formulated in a liposome or lipid nanoparticle (LNP).

[0023] Also provided herein in some embodiments is a cross-reactive guide RNA (gRNA) or a nucleic acid encoding a cross-reactive gRNA comprising a spacer sequence selected from GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069) and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).

[0024] Thus, in some embodiments, provided herein are cellular, ex vivo, and in vivo methods for making permanent changes to genomes by introducing at least one nucleotide insertion, deletion, or mutation into or near the angiopoietin-like 3 (ANGPTL3) gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene, by genome editing and reducing or eliminating the expression or function of ANGPTL3 gene products, which can be used to treat ANGPTL3-related conditions or disorders, such as dyslipidemia.Also provided herein are components and compositions, and vectors for carrying out such methods.

[0025] Also provided herein is a method for editing ANGPTL3 gene in a cell by genome editing, comprising introducing one or more deoxyribonucleic acid (DNA) endonucleases (e.g., Cas9) into the cell to create one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) in or near the ANGPTL3 gene or ANGPTL3 regulatory elements, which create one or more permanent insertions, deletions, or mutations of at least one nucleotide in or near the ANGPTL3 gene, thereby reducing or eliminating the expression or function of ANGPTL3 gene product.In some embodiments, a gRNA targeting the ANGPTL3 genomic locus is also introduced into the cell. [Brief description of the drawings]

[0026] Various aspects of the materials and methods disclosed and described herein can be better understood with reference to the accompanying drawings.

[0027] [Figure 1A] A depiction of a type II CRISPR / Cas system. [Figure 1B] Another depiction of a type II CRISPR / Cas system. [Diagram 2] 1 is a graph showing the efficiency of gRNA cleavage by S. pyogenes Cas9 in HEK293T cells targeting the ANGPTL3 gene. [Diagram 3] 1 is a graph showing the efficiency of gRNA cleavage by S. pyogenes Cas9 in HEK293T cells targeting the ANGPTL3 gene. [Figure 4] 1 is a graph showing the efficiency of gRNA cleavage by S. pyogenes Cas9 in HEK293T cells targeting the ANGPTL3 gene. [Figure 5A] Depiction of the cleavage efficiency of gRNA targeting ANGPTL3 in primary human hepatocytes. [Figure 5B]1 is a depiction of the cleavage efficiency of gRNA targeting ANGPTL3 in primary hepatocytes isolated from cynomolgus monkeys. [Figure 6A] Depiction of the cleavage efficiency of gRNA targeting ANGPTL3 in primary human hepatocytes. [Figure 6B] Illustrates the effect of gRNA-mediated gene editing on ANGPTL3 protein secretion in primary human hepatocytes. [Figure 7A] FIG. 1 is a depiction of the cleavage efficiency of gRNA targeting ANGPTL3 in primary human hepatocytes. [Figure 7B] Illustrates the effect of gRNA-mediated gene editing on ANGPTL3 protein secretion in primary human hepatocytes. [Figure 8] Illustrates the effect of gRNA-mediated gene editing on ANGPTL3 protein secretion in monkey hepatocytes.

[0028] Brief Description of the Sequence Listing SEQ ID NOs: 1 to 620 are Cas endonuclease ortholog sequences.

[0029] SEQ ID NOs:621-631 are intentionally left blank.

[0030] SEQ ID NOs: 632 to 4,715 are microRNA sequences.

[0031] SEQ ID NOs:4,716 through 4,733 are intentionally left blank.

[0032] SEQ ID NOs: 4,734 to 5,302 are AAV serotype sequences.

[0033] SEQ ID NO:5,303 is the ANGPTL3 nucleotide sequence.

[0034] SEQ ID NO:5,304 is a gene sequence including 5 kilobase pairs upstream and / or downstream of the ANGPTL3 gene.

[0035] SEQ ID NOs: 5,305 to 5,398 are 20 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with the T. denticola Cas9 endonuclease.

[0036] SEQ ID NOs:5,399-5,595 are 20 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with S. thermophilus Cas9 endonuclease.

[0037] SEQ ID NOs:5,596-6,079 are 20 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with S. aureus Cas9 endonuclease.

[0038] SEQ ID NOs: 6,080 to 6,633 are 20 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with N. meningitides Cas9 endonuclease.

[0039] SEQ ID NOs: 6,634-10,171 are 20 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with S. pyogenes Cas9 endonuclease.

[0040] SEQ ID NOs: 10,172 to 17,018 are 22 bp spacer sequences for targeting within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene with Acidaminococcus, Lachnospiraceae, and Francisella Novicida Cpf1 endonuclease.

[0041] SEQ ID NOs:17,019 through 17,048 are intentionally left blank.

[0042] SEQ ID NO: 17,049 is a sample guide RNA (gRNA) for S. pyogenes Cas9 endonuclease.

[0043] SEQ ID NOs: 17,050 to 17,052 show sample sgRNA sequences.

[0044] SEQ ID NOs: 17,054 to 17,057 show sample guide target sequences.

[0045] SEQ ID NOs: 17,059 to 17,066 show sample sgRNA sequences.

[0046] SEQ ID NOs: 17,053 and 17,067 are exemplary unpaired regions of nucleotides within the duplex between the minimal CRISPR RNA and the minimal tracrRNA.

[0047] SEQ ID NOs: 17,068 to 17,071 are examples of ANGPTL3 gRNA spacer sequences. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] I. Introduction Genome editing The present disclosure provides strategies and techniques for targeted and specific modification of the genetic information (genome) of an organism. As used herein, the term "modification" or "modification of genetic information" refers to any change in the genome of a cell. In the context of the treatment of genetic disorders, modification includes, but is not limited to, insertion, deletion, and correction. As used herein, the term "insertion" refers to the addition of one or more nucleotides in a DNA sequence. Insertions can range from small insertions of a few nucleotides to the insertion of large segments such as cDNAs or genes. The term "deletion" refers to the loss or removal of one or more nucleotides in a DNA sequence, or the loss or removal of the function of a gene. In some cases, deletions can include, for example, the loss of a few nucleotides, an exon, an intron, a gene segment, or the entire sequence of a gene. In some cases, deletion of a gene refers to the elimination or reduction of the function or expression of a gene or its gene product. This can occur not only from the deletion of sequences within or near a gene, but also from other events that disrupt the expression of the gene (e.g., insertions, nonsense mutations). The term "correction" as used herein refers to the alteration of one or more nucleotides of the genome in a cell, whether by insertion, deletion, or substitution. Such correction may result in a more favorable genotypic or phenotypic outcome, whether structural or functional, for the corrected genomic site. One non-limiting example of "correction" includes the correction of a mutant or defective sequence to a wild-type sequence that restores the structure or function of the gene or its gene product(s). Depending on the nature of the mutation, correction may be achieved through various strategies disclosed herein. In one non-limiting example, a missense mutation may be corrected by replacing the region containing the mutation with its wild-type counterpart. As another example, a gene duplication mutation (e.g., a repeat expansion) may be corrected by removing the extra sequence.

[0049] In some embodiments, the modification may also include knocking in, knocking out, or knocking down of a gene. As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such DNA sequence to be knocked in may include an entire gene or multiple genes, and may include regulatory sequences associated with the gene or any part or fragment thereof. For example, a cDNA encoding a wild-type protein may be inserted into the genome of a cell carrying a mutant gene. A knock-in strategy need not replace all or part of a defective gene. In some cases, a knock-in strategy may further include replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the elimination of a gene or the expression of a gene. For example, a gene can be knocked out by either the deletion or addition of a nucleotide sequence that leads to the disruption of the reading frame. As another example, a gene may be knocked out by replacing a part of the gene with an unrelated sequence. Finally, as used herein, the term "knock-down" refers to the reduction of expression of a gene or its gene product(s). Gene knockdown may result in the activity or function of a protein being attenuated or protein levels being reduced or eliminated.

[0050] Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in a precise or predetermined manner. Examples of genome editing methods described herein include methods that use site-specific nucleases to cleave deoxyribonucleic acid (DNA) at precise target locations in the genome, thereby creating single-stranded or double-stranded DNA breaks at specific locations in the genome. Such breaks can be natural endogenous cellular processes, such as homology-directed repair (HDR) and non-homologous end joining (NHEJ), which are regularly repaired, as recently reviewed in Cox et al., Nature Medicine 21(2), 121-31 (2015). These two major DNA repair processes are comprised of a family of alternative pathways. NHEJ directly joins DNA ends resulting from double-stranded breaks, sometimes with the loss or addition of nucleotide sequences, which may disrupt or enhance gene expression. HDR utilizes homologous or donor sequences as templates for inserting defined DNA sequences into the breakpoints. Homologous sequences can be present in the endogenous genome, such as sister chromatids. Alternatively, the donor can be an exogenous nucleic acid such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, or virus that has a region of high homology with the nuclease-cleaved locus but can also contain additional sequences or sequence changes, including deletions, that can be integrated into the cleaved target locus. A third repair mechanism can be microhomology-mediated end joining (MMEJ), also called "alternative NHEJ," in which the genetic outcome is similar to NHEJ, in which small deletions and insertions can occur at the cleavage site. MMEJ can utilize homologous sequences of several base pairs adjacent to the DNA cleavage site to drive more favorable DNA end joining repair outcomes, and recent reports have further elucidated the molecular mechanisms of this process.See, for example, Cho and Greenberg, Nature 518, 174-76 (2015); Kent et al., Nature Structural and Molecular Biology, Adv. Online doi:10.1038 / nsmb.2961 (2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); Ceccaldi et al., Nature 528, 258-62 (2015). In some cases, it may be possible to predict likely repair outcomes based on analysis of potential microhomologies at the DNA break site.

[0051] Each of these genome editing mechanisms can be used to create desired genome modifications.The step of genome editing process can create one or two DNA breaks, the latter as double-strand breaks or two single-strand breaks at the target locus near the intended mutation site.This can be achieved by using site-specific polypeptides, as described and illustrated herein.

[0052] CRISPR endonuclease system CRISPR (clustered regularly interspaced short palindromic repeats) genomic loci can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, CRISPR loci code for products that function as a type of immune system that helps defend prokaryotes against foreign invaders such as viruses and phages. There are three stages of CRISPR locus function: integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invading nucleic acids. Five types of CRISPR systems (e.g., type I, type II, type III, type U, type V) have been identified.

[0053] CRISPR loci contain many short repetitive sequences called "repeats". When expressed, the repeats can form secondary structures (e.g., hairpins) and / or contain unstructured single-stranded sequences. The repeats usually occur in clusters and frequently diverge between species. The repeats are regularly arranged with unique intervening sequences called "spacers", resulting in a repeat-spacer-repeat locus architecture. The spacers are identical or highly homologous to known foreign invader sequences. The spacer-repeat units encode crisprRNAs (crRNAs), which are processed into the mature form of the spacer-repeat units. The crRNA contains the "seed" or spacer sequences responsible for targeting the target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequences target the foreign invader nucleic acid). The spacer sequences are located at the 5' or 3' end of the crRNA.

[0054] CRISPR loci also contain polynucleotide sequences encoding CRISPR-associated (Cas) genes. Cas genes encode endonucleases involved in the biosynthesis and interference stages of prokaryotic crRNA function. Some Cas genes contain homologous secondary and / or tertiary structures.

[0055] Type II CRISPR system Biogenesis of crRNA in type II CRISPR systems in nature requires a trans-activated CRISPR RNA (tracrRNA). Non-limiting examples of type II CRISPR systems are shown in Figures 1A and 1B. The tracrRNA can be modified by endogenous RNaseIII and then hybridized to the crRNA repeats of the pre-crRNA array. Endogenous RNaseIII can be recruited to cleave the pre-crRNA. The cleaved crRNA can be subjected to exoribonuclease trimming to produce a mature crRNA form (e.g., 5' trimming). The tracrRNA can remain hybridized to the crRNA, and the tracrRNA and crRNA associate with a site-specific polypeptide (e.g., Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex can guide the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of the crRNA to the target nucleic acid can activate Cas9 for target nucleic acid cleavage. The target nucleic acid of type II CRISPR system is called protospacer adjacent motif (PAM). In nature, PAM is essential to facilitate the binding of site-specific polypeptide (e.g., Cas9) to target nucleic acid. Type II system (also called Nmeni or CASS4) is further subdivided into type II-A (CASS4) and II-B (CASS4a). Jinek et al., Science, 337(6096):816-821 (2012) shows that CRISPR / Cas9 system is useful for RNA-programmable genome editing, and International Patent Application Publication No. WO2013 / 176772 provides many examples and applications of CRISPR / Cas endonuclease system for site-specific gene editing.

[0056] Type V CRISPR system Type V CRISPR systems have some key differences from type II systems. For example, Cpf1 is a single RNA-guided endonuclease that lacks a tracrRNA, in contrast to type II systems. Indeed, Cpf1-associated CRISPR arrays can be processed into mature crRNAs without the need for additional trans-activating tracrRNAs. Type V CRISPR arrays can be processed into short mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with a 19-nucleotide direct repeat followed by a 23-25 ​​nucleotide spacer sequence. In contrast, mature crRNAs in type II systems begin with a 20-24 nucleotide spacer sequence followed by approximately 22 nucleotide direct repeats. Also, Cpf1 can utilize a T-rich protospacer adjacent motif, which allows the Cpf1-crRNA complex to efficiently cleave target DNAs preceded by a short T-rich PAM, in contrast to the G-rich PAM that follows the target DNA in type II systems. Thus, type V systems cleave at a point distal to the PAM, whereas type II systems cleave at a point adjacent to the PAM. Furthermore, in contrast to type II systems, Cpf1 cleaves DNA via staggered DNA double-strand breaks in 4- or 5-nucleotide 5′ overhangs; type II systems cleave by blunt double-strand breaks. Like type II systems, Cpf1 contains a predicted RuvC-like endonuclease domain, but in contrast to type II systems, it lacks the second HNH endonuclease domain.

[0057] Cas genes / polypeptides and protospacer adjacent motifs Exemplary CRISPR / Cas polypeptides include the Cas9 polypeptide published in Fonfara et al., Nucleic Acids Research, 42:2577-2590 (2014). The CRISPR / Cas gene naming system has been significantly rewritten since the discovery of the Cas genes. Fonfara et al. also provide the PAM sequences of Cas9 polypeptides from various species (see also SEQ ID NOs: 1-620).

[0058] II. Compositions and Methods Provided herein are cellular ex vivo and in vivo methods for using genome editing tools to make permanent changes in genomes by deleting or mutating ANGPTL3 gene or other DNA sequences that code for ANGPTL3 gene regulatory elements.Such methods use endonucleases such as CRISPR-related (Cas9, Cpf1, etc.) nucleases to permanently edit ANGPTL3 gene or other DNA sequences that code for ANGPTL3 gene regulatory elements in or near the genomic locus.In this way, the examples described in this disclosure can help reduce or eliminate the expression of ANGPTL3 gene with a single treatment (rather than providing a potential treatment for the patient's lifetime).

[0059] Site-specific polypeptides (endonucleases, enzymes) Site-specific polypeptides are nucleases used to cut DNA in genome editing. Site-specific polypeptides can be administered to cells or patients as either one or more polypeptides, or one or more mRNAs encoding the polypeptides. Any of the enzymes or orthologs listed in SEQ ID NOs: 1-620 or disclosed herein can be utilized in the methods herein.

[0060] In the context of the CRISPR / Cas9 or CRISPR / Cpf1 system, the site-specific polypeptide can bind to the guide RNA, which then identifies the site of the target DNA to which the polypeptide is directed. In the CRISPR / Cas9 or CRISPR / Cpf1 system disclosed herein, the site-specific polypeptide can be an endonuclease, such as a DNA endonuclease.

[0061] The site-directed polypeptide may comprise multiple nucleic acid cleavage (i.e., nuclease) domains. Two or more nucleic acid cleavage domains may be linked together via a linker. For example, the linker may comprise a flexible linker. The linker may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

[0062] Naturally occurring wild-type Cas9 enzyme contains two nuclease domains: HNH nuclease domain and RuvC domain. As used herein, the term "Cas9" refers to both naturally occurring Cas9 and recombinant Cas9. The Cas9 enzyme contemplated herein can contain an HNH or HNH-like nuclease domain, and / or a RuvC or RuvC-like nuclease domain.

[0063] The HNH or HNH-like domain contains an McrA-like fold. The HNH or HNH-like domain contains two antiparallel β-strands and one α-helix. The HNH or HNH-like domain contains a metal binding site (e.g., a divalent cation binding site). The HNH or HNH-like domain can cleave one strand of a target nucleic acid (e.g., the complementary strand of the crRNA target strand).

[0064] The RuvC or RuvC-like domain contains an RNaseH or RNaseH-like fold. The RuvC / RNaseH domain is involved in a variety of nucleic acid-based functions, including acting on both RNA and DNA. The RNaseH domain contains five β strands surrounded by multiple α helices. The RuvC / RNaseH or RuvC / RNaseH-like domain contains a metal binding site (e.g., a divalent cation binding site). The RuvC / RNaseH or RuvC / RNaseH-like domain can cleave one strand of a target nucleic acid (e.g., the non-complementary strand of a double-stranded target DNA).

[0065] The site-specific polypeptide can introduce double-stranded or single-stranded breaks in nucleic acids, such as genomic DNA. The double-stranded break can stimulate the cell's endogenous DNA repair pathways (e.g., homology-dependent repair (HDR) or NHEJ or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ)). NHEJ can repair a cleaved target nucleic acid without the need for a homologous template. This can result in small deletions or insertions (indels) in the target nucleic acid at the cleavage site, which can result in disruption or alteration of gene expression. HDR can occur when a homologous repair template or donor is available. The homologous donor template can contain sequences that are homologous to sequences adjacent to the target nucleic acid cleavage site. Sister chromatids can be used as repair templates by cells. However, for the purposes of genome editing, the repair template can be supplied as an exogenous nucleic acid, such as a plasmid, a double-stranded oligonucleotide, a single-stranded oligonucleotide, or a viral nucleic acid. An exogenous donor template can be used to introduce additional nucleic acid sequences (such as transgenes) or modifications (such as single or multiple base changes or deletions) between the adjacent homologous regions such that the added or modified nucleic acid sequences are also integrated into the target locus. MMEJ can produce similar genetic outcomes to NHEJ in that small deletions and insertions can occur at the break site. MMEJ can utilize several base pairs of homologous sequences adjacent to the break site to promote favorable end-joining DNA repair outcomes. In some cases, it may be possible to predict likely repair outcomes based on analysis of potential microhomologies of the nuclease target region.

[0066] Therefore, in some cases, exogenous polynucleotide sequence can be inserted into target nucleic acid cleavage site using homologous recombination. Exogenous polynucleotide sequence is referred to herein as "donor polynucleotide" (or donor or donor sequence). Donor polynucleotide, a part of donor polynucleotide, a copy of donor polynucleotide, or a part of a copy of donor polynucleotide can be inserted into target nucleic acid cleavage site. Donor polynucleotide can be exogenous polynucleotide sequence, i.e., a sequence that does not naturally occur at target nucleic acid cleavage site.

[0067] Modification of target DNA by NHEJ and / or HDR can lead to, for example, mutation, deletion, alteration, integration, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocation, and / or gene mutation. The process of deleting genomic DNA and integrating non-natural nucleic acid into genomic DNA is an example of genome editing.

[0068] The site-directed polypeptide may comprise an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to the wild-type exemplary site-directed polypeptide [e.g., Cas9 from S. pyogenes, US2014 / 0068797, SEQ ID NO: 8 or Sapranauskas et al., Nucleic Acids Res, 39(21)"9275-9282(2011)] and various other site-directed polypeptides. The site-directed polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to the wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids. The site-directed polypeptide may comprise up to 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to the wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids. The site-directed polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to the wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids within the HNH nuclease domain of the site-directed polypeptide. The site-directed polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to the wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids within the HNH nuclease domain of the site-directed polypeptide.The site-directed polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids within the RuvC nuclease domain of the site-directed polypeptide. The site-directed polypeptide may comprise up to 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 consecutive amino acids within the RuvC nuclease domain of the site-directed polypeptide.

[0069] The site-directed polypeptide may include a modified form of the wild-type exemplary site-directed polypeptide. The modified form of the wild-type exemplary site-directed polypeptide may include a mutation that reduces the nucleic acid cleavage activity of the site-directed polypeptide. The modified form of the wild-type exemplary site-directed polypeptide may have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity of the wild-type exemplary site-directed polypeptide (e.g., Cas9 from S.pyogenes as described above). The modified form of the site-directed polypeptide may not have substantial nucleic acid cleavage activity. When the site-directed polypeptide is a modified form that does not have substantial nucleic acid cleavage activity, it is referred to as "enzymatically inactive" herein.

[0070] Modified forms of site-directed polypeptides can include mutations that allow them to induce single-strand breaks (SSBs) on target nucleic acids (e.g., by cleaving only one of the sugar phosphate backbones of a double-stranded target nucleic acid). In some embodiments, the mutations can result in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity in one or more of the multiple nucleic acid cleavage domains of a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, as described above). In some embodiments, the mutations can result in one or more of the multiple nucleic acid cleavage domains retaining the ability to cleave a complementary strand of a target nucleic acid, but reducing the ability to cleave a non-complementary strand of the target nucleic acid. The mutations can result in one or more of the multiple nucleic acid cleavage domains retaining the ability to cleave a non-complementary strand of a target nucleic acid, but reducing the ability to cleave a complementary strand of the target nucleic acid. For example, residues of the wild-type exemplary S.pyogenes Cas9 polypeptide, such as Asp10, His840, Asn854, and Asn856, are mutated to inactivate one or more of the nucleic acid cleavage domains (e.g., nuclease domains). The residues to be mutated can correspond to residues Asp10, His840, Asn854, and Asn856 of the wild-type exemplary S.pyogenes Cas9 polypeptide (e.g., as determined by sequence and / or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A, or N856A. Those skilled in the art will recognize that mutations other than alanine substitutions may be suitable.

[0071] In some embodiments, the D10A mutation can be combined with one or more of the H840A, N854A, or N856A mutations to produce a site-directed polypeptide that is substantially devoid of DNA cleavage activity. The H840A mutation can be combined with one or more of the D10A, N854A, or N856A mutations to produce a site-directed polypeptide that is substantially devoid of DNA cleavage activity. The N854A mutation can be combined with one or more of the H840A, D10A, or N856A mutations to produce a site-directed polypeptide that is substantially devoid of DNA cleavage activity. The N856A mutation can be combined with one or more of the H840A, N854A, or D10A mutations to produce a site-directed polypeptide that is substantially devoid of DNA cleavage activity. A site-directed polypeptide that includes one substantially inactive nuclease domain is called a "nickase."

[0072] Nickase variants of RNA-guided endonucleases, such as Cas9, can be used to increase the specificity of CRISPR-mediated genome editing. Wild-type Cas9 is typically guided by a single guide RNA designed to hybridize with a specific ~20 nucleotide sequence of the target sequence (such as an endogenous genomic locus). However, some mismatches can be tolerated between the guide RNA and the target locus, effectively reducing the length of required homology at the target site to, for example, only 13 nt of homology, thereby increasing the likelihood of binding and double-stranded nucleic acid cleavage by the CRISPR / Cas9 complex elsewhere in the target genome, also known as off-target cleavage. Because the nickase variants of Cas9 only cleave one strand each, to create a double-stranded break, a pair of nickases must bind to opposite strands in close proximity to the target nucleic acid, thereby creating a pair of nicks, which is equivalent to a double-stranded break. This requires two separate guide RNAs, one for each nickase, to bind to opposite strands in close proximity to the target nucleic acid. This requirement essentially doubles the minimum length of homology required for double-stranded breaks, thereby reducing the likelihood that double-stranded break events will occur elsewhere in the genome, where the two guide RNA sites (if present) are unlikely to be close enough to each other to allow the formation of double-stranded breaks.As described in the art, nickases can also be used to promote HDR vs. NHEJ.HDR can be used to introduce selected changes into target sites in the genome by using specific donor sequences that effectively mediate the desired changes.

[0073] The contemplated mutations may include substitutions, additions, and deletions, or any combination thereof. The mutation converts the mutated amino acid to alanine. The mutation converts the mutated amino acid to another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). The mutation converts the mutated amino acid to a non-natural amino acid (e.g., selenomethionine). The mutation converts the mutated amino acid to an amino acid mimic (e.g., a phosphorus mimic). The mutation may be a conservative mutation. For example, the mutation converts the mutated amino acid to an amino acid that resembles the size, shape, charge, polarity, conformation, and / or rotamer of the mutated amino acid (e.g., a cysteine / serine mutation, a lysine / asparagine mutation, a histidine / phenylalanine mutation). Mutations can cause a shift in the reading frame and / or the creation of a premature stop codon. Mutations can cause changes in the regulatory regions of a gene or locus that affect the expression of one or more genes.

[0074] The site-directed polypeptides (e.g., variant, mutant, enzymatically inactive and / or conditionally enzymatically inactive site-directed polypeptides) can target nucleic acids. The site-directed polypeptides (e.g., variant, mutant, enzymatically inactive and / or conditionally enzymatically inactive site-directed polypeptides) can target DNA. The site-directed polypeptides (e.g., variant, mutant, enzymatically inactive and / or conditionally enzymatically inactive site-directed polypeptides) can target RNA.

[0075] The site-directed polypeptide can include one or more non-native sequences (eg, the site-directed polypeptide is a fusion protein).

[0076] The site-directed polypeptide can include an amino acid sequence that includes at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), a nucleic acid binding domain, and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain).

[0077] The site-directed polypeptide can comprise an amino acid sequence that comprises at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes) and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain).

[0078] The site-directed polypeptide can comprise an amino acid sequence that comprises at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleavage domains, one or both of which comprises at least 50% amino acid identity to a nuclease domain from a Cas9 from a bacterium (e.g., S. pyogenes).

[0079] The site-directed polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), and a non-native sequence (e.g., a nuclear localization signal) or a linker that connects the site-directed polypeptide to the non-native sequence.

[0080] The site-directed polypeptide can comprise an amino acid sequence that comprises at least 15% amino acid identity to a Cas9 from a bacteria (e.g., S. pyogenes), two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), and the site-directed polypeptide comprises a mutation in one or both of the nucleic acid cleavage domains that reduces the cleavage activity of the nuclease domain by at least 50%.

[0081] The site-directed polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes) and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), wherein one of the nuclease domains comprises a mutation of aspartic acid 10 and / or one of the nuclease domains comprises a mutation of histidine 840 that reduces the cleavage activity of the nuclease domain(s) by at least 50%.

[0082] One or more site-specific polypeptides, e.g., DNA endonucleases, may comprise two nickases that together produce one double-stranded break at a specific locus in the genome, or may cause two double-stranded breaks at a specific locus in the genome. Alternatively, one site-specific polypeptide, e.g., DNA endonuclease, may produce or cause one double-stranded break at a specific locus in the genome.

[0083] Non-limiting examples of Cas9 orthologs from other bacterial strains include Acaryochloris marina MBIC11017, Acetohalobium arabaticum DSM 5501, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans ATCC 23270, Alicyclobacillus acidocaldarius LAA1, Alicyclobacillus acidocaldarius subsp.acidocaldarius DSM 446, Allochromatium vinosum DSM 180, Ammonifex degensii KC4, Anabaena variabilis ATCC 29413, Arthrospira maxima CS-328, Arthrospira platensis str.Paraca, Arthrospira sp.PCC 8005, Bacillus pseudomycoides DSM 12442, Bacillus selenitireducens MLS10, Burkholderiales bacterium 1_1_47, Caldicellulosiruptor becscii DSM 6725, Candidatus Desulforudis audaxviator MP104C, Caldicellulosiruptor hydrothermalis_108、Clostridium phage c-st、Clostridium botulinum A3 str.Loch Maree、Clostridium botulinum Ba4 str.657、Clostridium difficile QCD-63q42、Crocosphaera watsonii WH 8501、Cyanothece sp.ATCC 51142、Cyanothece sp.CCY0110、Cyanothece sp.PCC 7424、Cyanothece sp.PCC 7822、Exiguobacterium sibiricum 255-15、Finegoldia magna ATCC 29328、Ktedonobacter racemifer DSM 44963、Lactobacillus delbrueckii subsp.bulgaricus PB2003 / 044-T3-4、Lactobacillus salivarius ATCC 11741、Listeria innocua、Lyngbya sp.PCC 8106、Marinobacter sp.ELB17、Methanohalobium evestigatum Z-7303、Microcystis phage Ma-LMM01、Microcystis aeruginosa NIES-843、Microscilla marina ATCC 23134、Microcoleus chthonoplastes PCC 7420、Neisseria meningitidis、Nitrosococcus halophilus Nc4、Nocardiopsis dassonvillei subsp.dassonvillei DSM 43111、Nodularia spumigena CCY9414、Nostoc sp.PCC 7120, Oscillatoria sp.PCC 6506, Pelotomaculum_thermopropionicum_SI, Petrotoga mobilis SJ95, Polaromonas naphthalenivorans CJ2, Polaromonas sp.JS666, Pseudoalteromonas haloplanktis TAC125, Streptomyces pristinaespiralis ATCC 25486, Streptomyces pristinaespiralis ATCC 25486, Streptococcus thermophilus, Streptomyces viridochromogenes DSM 40736, Streptosporangium roseum DSM 43021, Synechococcus sp.PCC 7335, and Thermosipho africanus TCF52B (Chylinski et al., RNA Biol., 2013, 10(5):726-737).

[0084] In addition to Cas9 orthologs, other Cas9 variants, such as fusion proteins of inactive dCas9, and effector domains with different functions, can serve as platforms for gene regulation. Any of the aforementioned enzymes can be useful in the present disclosure.

[0085] Further examples of endonucleases that may be utilized in the present disclosure are shown in SEQ ID NOs: 1-620. These proteins may be modified prior to use or may be encoded within a nucleic acid sequence such as DNA, RNA, or mRNA, or a vector construct such as a plasmid or AAV vector as taught herein. Additionally, they may be codon optimized.

[0086] SEQ ID NOs: 1-620 disclose a non-exhaustive list of endonuclease sequences.

[0087] Genome-targeting nucleic acids The present disclosure provides a genomic targeting nucleic acid that can direct the activity of an associated polypeptide (e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genomic targeting nucleic acid can be an RNA. The genomic targeting RNA is referred to herein as a "guide RNA" or "gRNA." The guide RNA can include at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest and a CRISPR repeat sequence. In a type II system, the gRNA also includes a second RNA, referred to as a tracrRNA sequence. In a type II guide RNA (gRNA), the CRISPR repeat sequence and the tracrRNA sequence hybridize to each other to form a duplex. In a type V guide RNA (gRNA), the crRNA forms a duplex. In both systems, the duplex can bind to a site-directed polypeptide, thereby causing the guide RNA and the site-directed polypeptide to form a complex. The genomic targeting nucleic acid can provide target specificity to the complex by association with the site-directed polypeptide. Thus, the genomic targeting nucleic acid can direct the activity of the site-directed polypeptide.

[0088] Exemplary guide RNAs include a spacer sequence of 15-200 bases, whose genomic location is based on the GRCh38 human genome assembly. The ANGPTL3 gene can be located at chromosome 1:62,597,486-62,606,304 (Genome Reference Consortium-GRCh38).

[0089] Exemplary guide RNAs include spacer sequences based on the RNA version of the DNA sequence presented in SEQ ID NO: 5,305-17,018. As will be appreciated by those skilled in the art, each guide RNA can be designed to include a spacer sequence that is complementary to its genomic target sequence. For example, each of the spacer sequences, e.g., the RNA version of the DNA sequence presented in SEQ ID NO: 5,305-17,018, can be placed into a single RNA chimera or crRNA (with the corresponding tracrRNA). See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).

[0090] The genome-targeting nucleic acid can be a dual molecule guide RNA. The genome-targeting nucleic acid can be a single molecule guide RNA.

[0091] The double molecule guide RNA may comprise two RNA strands. The first strand comprises, from 5' to 3', an optional spacer extension sequence, a spacer sequence, and a minimal CRISPR repeat sequence. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3'tracrRNA sequence, and an optional tracrRNA extension sequence.

[0092] The single molecule guide RNA (sgRNA) of the type II system may include, from 5' to 3', an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension may include elements that provide additional functions (e.g., stability) to the guide RNA. The single molecule guide linker may join the minimal CRISPR repeat and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension may include one or more hairpins.

[0093] The sgRNA may comprise a spacer sequence of 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of variable length of 17-30 nucleotides at the 5' end of the sgRNA sequence (see Table 1).

[0094] The sgRNA may not include a uracil at the 3' end of the sgRNA sequence, such as SEQ ID NO: 17,051 in Table 1. The sgRNA may include one or more uracils at the 3' end of the sgRNA sequence, such as SEQ ID NO: 17,052 in Table 1. For example, the sgRNA may include one uracil (U) at the 3' end of the sgRNA sequence. The sgRNA may include two uracils (UU) at the 3' end of the sgRNA sequence. The sgRNA may include three uracils (UUU) at the 3' end of the sgRNA sequence. The sgRNA may include four uracils (UUUU) at the 3' end of the sgRNA sequence. The sgRNA may include five uracils (UUUUU) at the 3' end of the sgRNA sequence. The sgRNA may include six uracils (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may contain 7 uracils (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may contain 8 uracils (UUUUUUUU) at the 3' end of the sgRNA sequence.

[0095] The sgRNA can be unmodified or modified. For example, a modified sgRNA can contain one or more 2'-O-methyl and / or 2'-O-methyl phosphorothioate nucleotides. [Table 1]

[0096] The single molecule guide RNA (sgRNA) of the Type V system can contain, in the 5' to 3' direction, minimal CRISPR repeats and a spacer sequence.

[0097] By way of illustration, guide RNAs used in the CRISPR / Cas9 or CRISPR / Cpf1 systems, or other smaller RNAs, can be easily synthesized by chemical means, as shown below and described in the art. Chemical synthesis procedures are continually expanding, but purification of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more difficult as the length of polynucleotides increases significantly beyond 100 nucleotides or so. One approach used to generate longer RNAs is to produce two or more molecules that are ligated together. Much longer RNAs, such as those that code for Cas9 or Cpf1 endonucleases, are more easily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and / or enzymatic generation of the RNA, for example modifications that increase stability, reduce the likelihood or extent of innate immune responses, and / or enhance other attributes, as described in the art.

[0098] Spacer extension sequence In some embodiments of the genome-targeting nucleic acid, the spacer extension sequence can modify activity, provide stability, and / or provide a location for modification of the genome-targeting nucleic acid. The spacer extension sequence can modify on-target or off-target activity or specificity. In some embodiments, a spacer extension sequence can be provided. The spacer extension sequence can have a length of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides or more. The spacer extension sequence may have a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides. The spacer extension sequence may be less than 10 nucleotides in length. The spacer extension sequence may be between 10 and 30 nucleotides in length. The spacer extension sequence may be between 30 and 70 nucleotides in length.

[0099] The spacer extension sequence may contain another moiety (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). This moiety may decrease or increase the stability of the nucleic acid targeting the nucleic acid. This moiety may be a transcription terminator segment (i.e., a transcription termination sequence). This moiety may function in eukaryotic cells. This moiety may function in prokaryotic cells. This moiety may function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include a 5' cap (e.g., a 7-methylguanylate cap (m7 G)), a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and / or a modification or sequence that provides binding sites for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).

[0100] Spacer sequence The spacer sequence hybridizes to the sequence of the target nucleic acid of interest. The spacer of the genome targeting nucleic acid can interact with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). The nucleotide sequence of the spacer can vary depending on the sequence of the target nucleic acid of interest.

[0101] In the CRISPR / Cas system herein, the spacer sequence can be designed to hybridize to the target nucleic acid located 5' of the PAM of the Cas9 enzyme used in the system. The spacer can be a perfect match to the target sequence or can have a mismatch. Each Cas9 enzyme has a specific PAM sequence that it recognizes in the target DNA. For example, S. pyogenes recognizes a PAM in the target nucleic acid that contains the sequence 5'-NRG-3', where R contains either A or G, and N is any nucleotide, and N is immediately 3' of the target nucleic acid targeted by the spacer sequence.

[0102] The target nucleic acid sequence may include 20 nucleotides. The target nucleic acid may include less than 20 nucleotides. The target nucleic acid may include more than 20 nucleotides. The target nucleic acid may include at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid may include up to 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid sequence may include 20 bases immediately 5' to the first nucleotide of the PAM. For example, in a sequence including 5'-NNNNNNNNNNNNNNNNNNNRG-3' (SEQ ID NO: 17049), the target nucleic acid may include a sequence corresponding to N, where N is any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM. This target nucleic acid sequence is often referred to as the PAM strand, and the complementary nucleic acid sequence is often referred to as the non-PAM strand. One of skill in the art will recognize that the spacer sequence hybridizes to the non-PAM strand of the target nucleic acid (Figures 1A and 1B).

[0103] The spacer sequence that hybridizes to the target nucleic acid may have a length of at least about 6 nucleotides (nt). The spacer sequence may be at least about 6 nt, at least about 10 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt, or at least about 40 nt, from about 6 nt to about 80 nt, from about 6 nt to about 50 nt, from about 6 nt to about 45 nt, from about 6 nt to about 40 nt, from about 6 nt to about 35 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 19 nt, from about 10 nt to about 50 nt, from about 10 nt to about 45 nt, from about 1 It may be 0 nt to about 40 nt, about 10 nt to about 35 nt, about 10 nt to about 30 nt, about 10 nt to about 25 nt, about 10 nt to about 20 nt, about 10 nt to about 19 nt, about 19 nt to about 25 nt, about 19 nt to about 30 nt, about 19 nt to about 35 nt, about 19 nt to about 40 nt, about 19 nt to about 45 nt, about 19 nt to about 50 nt, about 19 nt to about 60 nt, about 20 nt to about 25 nt, about 20 nt to about 30 nt, about 20 nt to about 35 nt, about 20 nt to about 40 nt, about 20 nt to about 45 nt, about 20 nt to about 50 nt, or about 20 nt to about 60 nt. In some embodiments, the spacer sequence may include 20 nucleotides. In some embodiments, the spacer may include 19 nucleotides. In some embodiments, the spacer may include 18 nucleotides. In some examples, the spacer can comprise 22 nucleotides.

[0104] In some embodiments, the percent complementarity between the spacer sequence and the non-PAM strand of the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is up to about 30%, up to about 40%, up to about 50%, up to about 60%, up to about 65%, up to about 70%, up to about 75%, up to about 80%, up to about 85%, up to about 90%, up to about 95%, up to about 97%, up to about 98%, up to about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six adjacent 5'-terminal nucleotides of the target sequence of the complementary strand of the target nucleic acid. The percent complementarity between the spacer sequence and the target nucleic acid may be at least 60% over about 20 contiguous nucleotides. The length of the spacer sequence and the target nucleic acid may differ by 1-6 nucleotides, which may be considered as one or more bulges.

[0105] Spacer sequences can be designed or selected using computer programs.Computer programs can use variables such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, %GC, genomic frequency of occurrence (e.g., of identical or similar sequences that differ at one or more spots as a result of mismatch, insertion or deletion), methylation status, the presence of SNPs, etc.

[0106] Minimal CRISPR repeats In some embodiments, a minimal CRISPR repeat sequence is a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference CRISPR repeat sequence (e.g., crRNA from S. pyogenes).

[0107] In some embodiments, the minimum CRISPR repeat sequence comprises nucleotides that can hybridize to the minimum tracrRNA sequence in cells. The minimum CRISPR repeat sequence and the minimum tracrRNA sequence can form a duplex, i.e., a double-stranded structure of base pairs. Together, the minimum CRISPR repeat sequence and the minimum tracrRNA sequence can bind to a site-specific polypeptide. At least a portion of the minimum CRISPR repeat sequence can hybridize to the minimum tracrRNA sequence. In some embodiments, at least a portion of the minimum CRISPR repeat sequence comprises at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimum tracrRNA sequence. At least a portion of the minimal CRISPR repeat sequence may comprise at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimal tracrRNA sequence.

[0108] The minimal CRISPR repeat sequence may have a length of about 7 nucleotides to about 100 nucleotides. For example, the length of the minimal CRISPR repeat sequence is about 7 nucleotides (nt) to about 50 nt, about 7 nt to about 40 nt, about 7 nt to about 30 nt, about 7 nt to about 25 nt, about 7 nt to about 20 nt, about 7 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. In some embodiments, the minimal CRISPR repeat sequence is about 9 nucleotides in length. In some embodiments, the minimal CRISPR repeat sequence is about 12 nucleotides in length.

[0109] The minimal CRISPR repeat sequence may be at least about 60% identical to a reference minimal CRISPR repeat sequence (e.g., wild-type crRNA from S. pyogenes) over a stretch of at least 6, 7, or 8 consecutive nucleotides. For example, the minimal CRISPR repeat sequence may be at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90%, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a reference minimal CRISPR repeat sequence over a stretch of at least 6, 7, or 8 consecutive nucleotides.

[0110] Minimal tracrRNA sequence A minimal tracrRNA sequence can be a sequence that has at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a wild-type tracrRNA from S. pyogenes).

[0111] The minimal tracrRNA sequence can comprise nucleotides that hybridize to the minimal CRISPR repeat sequence in a cell. The minimal tracrRNA sequence and the minimal CRISPR repeat sequence form a duplex, i.e., a double-stranded structure of base pairs. Together, the minimal tracrRNA sequence and the minimal CRISPR repeat can bind to a site-specific polypeptide. At least a portion of the minimal tracrRNA sequence can hybridize to the minimal CRISPR repeat sequence. The minimal tracrRNA sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimal CRISPR repeat sequence.

[0112] The minimal tracrRNA sequence may have a length of about 7 nucleotides to about 100 nucleotides. For example, the minimal CRISPR repeat sequence may be about 7 nucleotides (nt) to about 50 nt, about 7 nt to about 40 nt, about 7 nt to about 30 nt, about 7 nt to about 25 nt, about 7 nt to about 20 nt, about 7 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt in length. The minimal tracrRNA sequence may be approximately 9 nucleotides in length. The minimal tracrRNA sequence may be approximately 12 nucleotides. The minimal tracrRNA can be composed of tracrRNA nts 23-48 as described in Jinek et al., supra.

[0113] The minimal tracrRNA sequence may be at least about 60% identical to a reference minimal tracrRNA (e.g., wild-type, S. pyogenes derived tracrRNA) over a stretch of at least 6, 7, or 8 consecutive nucleotides. For example, the minimal tracrRNA sequence may be at least about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to a reference minimal tracrRNA sequence over a stretch of at least 6, 7, or 8 consecutive nucleotides.

[0114] The duplex between the minimal CRISPR RNA and the minimal tracrRNA can form a double helix.The duplex between the minimal CRISPR RNA and the minimal tracrRNA can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.The duplex between the minimal CRISPR RNA and the minimal tracrRNA can comprise at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

[0115] A duplex can contain mismatches (i.e., the two strands of the duplex are not 100% complementary). A duplex can contain at least about 1, 2, 3, 4, or 5 mismatches. A duplex can contain up to about 1, 2, 3, 4, or 5 mismatches. A duplex can contain up to 2 mismatches.

[0116] Bulge In some cases, there may be a "bulge" in the duplex between the minimal CRISPR RNA and the minimal tracrRNA. A bulge is an unpaired region of nucleotides in a duplex. The bulge may contribute to the binding of the duplex to a site-specific polypeptide. The bulge may include an unpaired 5'-rrrn-3' (SEQ ID NO: 17,053) (r is any purine and n includes a nucleotide that can form a wobble pair with a nucleotide on the opposite strand) on one side of the duplex, and an unpaired nucleotide region on the other side of the duplex. The number of unpaired nucleotides on both sides of the duplex may be different.

[0117] In one embodiment, the bulge can include an unpaired purine (e.g., adenine) on the minimal CRISPR repeat strand of the bulge. In some embodiments, the bulge can include an unpaired 5'-AAGn-3' (SEQ ID NO: 17,067) on the minimal tracrRNA sequence strand of the bulge, where n includes a nucleotide that can form a wobble pair with a nucleotide on the minimal CRISPR repeat strand.

[0118] The bulge on the minimal CRISPR repeat side of the duplex can comprise at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. The bulge on the minimal CRISPR repeat side of the duplex can comprise at most 1, 2, 3, 4, or 5 or more unpaired nucleotides. The bulge on the minimal CRISPR repeat side of the duplex can comprise one unpaired nucleotide.

[0119] The bulge on the side of the minimal tracrRNA sequence of the duplex can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. The bulge on the side of the minimal tracrRNA sequence of the duplex can contain at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. The bulge on the second side of the duplex (e.g., on the side of the minimal tracrRNA sequence of the duplex) can contain 4 unpaired nucleotides.

[0120] The bulge can include at least one wobble pair. In some embodiments, the bulge can include at most one wobble pair. The bulge can include at least one purine nucleotide. The bulge can include at least three purine nucleotides. The bulge sequence can include at least five purine nucleotides. The bulge sequence can include at least one guanine nucleotide. In some embodiments, the bulge sequence can include at least one adenine nucleotide.

[0121] hairpin In various examples, one or more hairpins can be located 3' of the minimal tracrRNA in the 3' tracrRNA sequence.

[0122] The hairpin may begin at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides 3' from the last nucleotide pair of the minimal CRISPR repeat and minimal tracrRNA sequence duplex. The hairpin may begin at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides 3' from the last nucleotide pair of the minimal CRISPR repeat and minimal tracrRNA sequence duplex.

[0123] A hairpin can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more contiguous nucleotides. A hairpin can comprise up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more contiguous nucleotides.

[0124] The hairpin can include a CC dinucleotide (ie, two consecutive cytosine nucleotides).

[0125] The hairpin can include duplex nucleotides (e.g., nucleotides within the hairpin that are hybridized together). For example, the hairpin can include a CC dinucleotide that hybridizes to a GG dinucleotide in the hairpin duplex of the 3' tracrRNA sequence.

[0126] One or more of the hairpins can interact with the guide RNA interacting region of the site-directed polypeptide.

[0127] In some embodiments, there are two or more hairpins, and in other embodiments, there are three or more hairpins.

[0128] 3′tracrRNA sequence The 3' tracrRNA sequence can include a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from S. pyogenes).

[0129] The 3'tracrRNA sequence may have a length of about 6 nucleotides to about 100 nucleotides. For example, the 3'tracrRNA sequence may have a length of about 6 nucleotides (nt) to about 50 nt, about 6 nt to about 40 nt, about 6 nt to about 30 nt, about 6 nt to about 25 nt, about 6 nt to about 20 nt, about 6 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. The 3'tracrRNA sequence may have a length of approximately 14 nucleotides.

[0130] The 3'tracrRNA sequence may be at least about 60% identical to a reference 3'tracrRNA sequence (e.g., a wild-type 3'tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 consecutive nucleotides. For example, the 3'tracrRNA sequence may be at least about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to a reference 3'tracrRNA sequence (e.g., a wild-type 3'tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 consecutive nucleotides.

[0131] The 3'tracrRNA sequence can contain two or more duplexed regions (e.g., hairpins, hybridization regions). The 3'tracrRNA sequence can contain two duplexed regions.

[0132] The 3'tracrRNA sequence can include a stem-loop structure. The 3'tracrRNA stem-loop structure can include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides. The 3'tracrRNA stem-loop structure can include up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The stem-loop structure can include a functional moiety. For example, the stem-loop structure can include an aptamer, a ribozyme, a protein interaction hairpin, a CRISPR array, an intron, or an exon. The stem-loop structure can include at least about 1, 2, 3, 4, or 5 or more functional moieties. The stem-loop structure can include up to about 1, 2, 3, 4, or 5 or more functional moieties.

[0133] The hairpin of the 3' tracrRNA sequence can comprise a P domain. In some embodiments, the P domain can comprise a double-stranded region in the hairpin.

[0134] tracrRNA extension sequence The tracrRNA extension sequence may be provided whether in the context of a single or dual molecular guide. The tracrRNA extension sequence may have a length of about 1 nucleotide to about 400 nucleotides. The tracrRNA extension sequence may have a length of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or more than 400 nucleotides. The tracrRNA extension sequence may have a length of about 20 to about 5000 or more nucleotides. The tracrRNA extension sequence may have a length of more than 1000 nucleotides. The tracrRNA extension sequence may have a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, or more nucleotides. The tracrRNA extension sequence may have a length of less than 1000 nucleotides. The tracrRNA extension sequence may comprise a length of less than 10 nucleotides. The tracrRNA extension sequence may be between 10 and 30 nucleotides in length. The tracrRNA extension sequence may be between 30 and 70 nucleotides in length.

[0135] The tracrRNA extension sequence can include a functional portion (e.g., a stability control sequence, a ribozyme, an endoribonuclease binding sequence). The functional portion can include a transcription terminator segment (i.e., a transcription termination sequence). The functional portion can have a total length of about 10 nucleotides (nt) to about 100 nucleotides, about 10 nt to about 20 nt, about 20 nt to about 30 nt, about 30 nt to about 40 nt, about 40 nt to about 50 nt, about 50 nt to about 60 nt, about 60 nt to about 70 nt, about 70 nt to about 80 nt, about 80 nt to about 90 nt, or about 90 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. The functional portion can function in eukaryotic cells. The functional moiety is capable of functioning in a prokaryotic cell. The functional moiety is capable of functioning in both eukaryotic and prokaryotic cells.

[0136] Non-limiting examples of suitable tracrRNA extension functional moieties include 3′ poly-adenylation tails, riboswitch sequences (e.g., to allow for regulated stability and / or regulated accessibility by proteins and protein complexes), sequences that form dsRNA duplexes (i.e., hairpins), sequences that target the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, etc.), modifications or sequences that provide tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, sequences that allow fluorescent detection, etc.), and / or modifications or sequences that provide binding sites for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.). The tracrRNA extension sequence can include a primer binding site or a molecular index (e.g., a barcode sequence). The tracrRNA extension sequence can include one or more affinity tags.

[0137] Single molecule guide linker sequence The linker sequence of the single molecule guide nucleic acid may have a length of about 3 nucleotides to about 100 nucleotides. In Jinek et al., Science, 337(6096):816-821(2012), for example, a simple 4-nucleotide "tetraloop" (-GAAA-) was used. Exemplary linkers have a length of about 3 nucleotides (nt) to about 90 nt, about 3 nt to about 80 nt, about 3 nt to about 70 nt, about 3 nt to about 60 nt, about 3 nt to about 50 nt, about 3 nt to about 40 nt, about 3 nt to about 30 nt, about 3 nt to about 20 nt, or about 3 nt to about 10 nt. For example, the linker may have a length of about 3 nt to about 5 nt, about 5 nt to about 10 nt, about 10 nt to about 15 nt, about 15 nt to about 20 nt, about 20 nt to about 25 nt, about 25 nt to about 30 nt, about 30 nt to about 35 nt, about 35 nt to about 40 nt, about 40 nt to about 50 nt, about 50 nt to about 60 nt, about 60 nt to about 70 nt, about 70 nt to about 80 nt, about 80 nt to about 90 nt, or about 90 nt to about 100 nt. The linker of the single molecule guide nucleic acid may be 4 to 40 nucleotides. The linker can be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker can be up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

[0138] The linker can include any of a variety of sequences, but in some embodiments, the linker does not include sequences with extensive homology regions with other portions of the guide RNA, which may result in intramolecular binding that may interfere with other functional regions of the guide. In Jinek et al., Science, 337(6096):816-821 (2012) above, a simple four nucleotide sequence -GAAA- was used, but many other sequences, including longer sequences, can be used as well.

[0139] The linker sequence can include a functional moiety. For example, the linker sequence can include one or more features including an aptamer, a ribozyme, a protein interaction hairpin, a protein binding site, a CRISPR array, an intron, or an exon. The linker sequence can include at least about 1, 2, 3, 4, or 5 or more functional moieties. In some embodiments, the linker sequence can include up to about 1, 2, 3, 4, or 5 or more functional moieties.

[0140] Nucleic acid modifications (chemical and structural modifications) In some embodiments, the polynucleotide introduced into a cell can contain one or more modifications that can be used individually or in combination, e.g., to enhance activity, stability or specificity, alter delivery, reduce innate immune responses in host cells, or otherwise enhance, as further described herein and known in the art.

[0141] In certain instances, modified polynucleotides can be used in CRISPR / Cas9 or CRISPR / Cpf1 systems, where the guide RNA (either single molecule guide or two molecule guide) and / or the DNA or RNA encoding the Cas9 or Cpf1 endonuclease introduced into the cell can be modified as described and illustrated below. Such modified polynucleotides can be used in CRISPR / Cas9 or CRISPR / Cpf1 systems to edit any one or more genomic loci.

[0142] Using the CRISPR / Cas9 or CRISPR / Cpf1 system as a non-limiting example of such applications, modification of guide RNA can be used to enhance the formation or stability of CRISPR / Cas9 or CRISPR / Cpf1 genome editing complexes that include guide RNA, which can be single molecule guide or double molecule, and Cas9 or Cpf1 endonuclease. Modification of guide RNA can also or alternatively be used to enhance the initiation, stability, or kinetics of interaction of genome editing complexes with target sequences in the genome, which can be used, for example, to enhance on-target activity. Modification of guide RNA can also or alternatively be used to enhance specificity, for example, the relative rate of genome editing at on-target sites, compared to effects at other (off-target) sites.

[0143] Modifications can also, or alternatively, be used to increase the stability of the guide RNA, for example by increasing its resistance to degradation by ribonucleases (RNases) present in the cell, thereby increasing its half-life within the cell. Modifications that increase the half-life of the guide RNA can be particularly useful in embodiments in which the Cas9 or Cpf1 endonuclease is introduced into the cell to be edited via an RNA that needs to be translated to produce the endonuclease, since increasing the half-life of the guide RNA introduced simultaneously with an endonuclease-encoding RNA can be used to increase the time that the guide RNA and the encoded Cas9 or Cpf1 endonuclease coexist within the cell.

[0144] Modifications can also, or alternatively, be used to reduce the likelihood or extent to which an RNA introduced into a cell will induce an innate immune response. As described below and in the art, such responses, which have been well characterized in the context of RNA interference (RNAi), including small interfering RNA (siRNA), tend to be associated with reduced RNA half-life and / or induction of cytokines or other factors associated with the immune response.

[0145] One or more modifications can also be made to an RNA encoding an endonuclease introduced into a cell, including, but not limited to, modifications that increase the stability of the RNA (e.g., by increasing degradation by RNases present in the cell), enhance translation of the resulting product (i.e., the endonuclease), and / or reduce the likelihood or extent to which the RNA introduced into a cell will elicit an innate immune response.

[0146] Combinations of modifications, such as those mentioned above and others, can be used as well. For example, in the case of CRISPR / Cas9 or CRISPR / Cpf1, one or more modifications can be made to the guide RNA (including those exemplified above) and / or one or more modifications can be made to the RNA encoding the Cas endonuclease (including those exemplified above).

[0147] By way of illustration, guide RNAs used in CRISPR / Cas9 or CRISPR / Cpf1 systems, or other smaller RNAs, can be easily synthesized by chemical means, as shown below and described in the art, allowing many modifications to be easily incorporated. Chemical synthesis procedures are continually expanding, but purification of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more difficult as the length of polynucleotides increases significantly beyond 100 nucleotides or so. One approach that can be used to generate longer chemically modified RNAs is to generate two or more molecules and ligate them together. Much longer RNAs, such as those that code for Cas9 endonuclease, are more easily generated enzymatically. Although the variety of modifications available for use with enzymatically produced RNAs is small, there are still modifications that can be used to, for example, increase stability, reduce the likelihood or extent of innate immune responses, and / or enhance other attributes, as described below and further in the art.

[0148] As examples of various types of modifications, particularly those frequently used in smaller chemically synthesized RNAs, modifications can include one or more nucleotides modified at the 2' position of the sugar, in some embodiments, 2'-O-alkyl, 2'-O-alkyl-O-alkyl, or 2'-fluoro modified nucleotides. In some examples, RNA modifications include 2'-fluoro, 2'-amino, or 2'-O-methyl modifications to pyrimidines, abasic residues, or ribose of the inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides, and these oligonucleotides have been shown to have higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides for a given target.

[0149] Many nucleotide and nucleoside modifications have been shown to make the oligonucleotides they are incorporated into more resistant to nuclease digestion than natural oligonucleotides.These modified oligonucleotides survive intact for longer periods of time than unmodified oligonucleotides.Specific examples of modified oligonucleotides include those that contain modified backbones, such as phosphorothioates, phosphotriesters, methylphosphonates, short alkyl or cycloalkyl intersugar linkages, or short heteroatom or heterocyclic intersugar linkages. Some oligonucleotides are those with phosphorothioate backbones, and heteroatom backbones, particularly CH2-NH-O-CH2, CH, -N(CH3)-O-CH2 (known as the methylene (methylimino) or MMI backbone), CH2-ON(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2, and ON(CH3)-CH2-CH2 backbones, where the natural phosphodiester backbone is represented as an OPO-CH, amide backbone [see De Mesmaeker et al., Ace. Chem. Res., 28:366-374 (1995)], morpholino backbone structure (see Summerton and Weller, U.S. Pat. No. 5,034,506), peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone and the nucleotides are attached directly or indirectly to the aza nitrogen atoms of the polyamide backbone; see Nielsen et al., Science (See 1991,254,1497).Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3' alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, as well as those with inverted polarity (where adjacent pairs of nucleoside units are linked, 3'-5' to 5'-3' or 2'-5' to 5'-2'). U.S. Patent Nos. 3,687,808, 4,469,863, 4,476,301, 5,023,243, 5,177,196, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,717, 5,321,131, 5,399,676, 5,405,93 See Nos. 9, 5,453,496, 5,455,233, 5,466,677, 5,476,925, 5,519,126, 5,536,821, 5,541,306, 5,550,111, 5,563,253, 5,571,799, 5,587,361, and 5,625,050.

[0150] Morpholino oligomeric compounds are described in Braasch and David Corey, Biochemistry, 41(14):4503-4510 (2002), Genesis, Volume 30, Issue 3, (2001), Heasman, Dev. Biol., 243:209-214 (2002), Nasevicius et al., Nat. Genet., 26:216-220 (2000), Lacerra et al., Proc. Natl. Acad. Sci., 97:9591-9596 (2000), and U.S. Patent No. 5,034,506, issued July 23, 1991.

[0151] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 122:8595-8602 (2000).

[0152] Modified oligonucleotide backbones that do not contain an internal phosphorus atom have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonic acid and sulfonamide backbones; amide backbones; and those with mixed N, O, S, CH2 components. U.S. Patent Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,264,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, 5,489,677, 5,541,30 See US Pat. Nos. 5,561,225, 5,596,086, 5,602,240, 5,610,289, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439.

[0153] One or more substituted sugar moieties may also be included at the 2' position, for example, one of the following: OH, SH, SCH3, F, OCN, OCH3, OCHO(CH2)nCH3, O(CH2)nNH2, or O(CH2)nCH3 (wherein n is 1 to about 10); C1-C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving group; reporter group; intercalating agent; group for improving the pharmacodynamic properties of oligonucleotides; or group for improving the pharmacodynamic properties of oligonucleotides and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CHOCH3), also known as 2'-O-(2'methoxyethyl) (Martin et al, HeIv. Chim. Acta, 1995, 78, 486). Other modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2CH2CH3) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of pentofuranosyl groups.

[0154] In some embodiments, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide unit can be replaced with novel groups. The base unit can be maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In a PNA compound, the sugar backbone of an oligonucleotide can be replaced with an amide containing backbone, such as, for example, an aminoethylglycine backbone. The nucleobase can be retained and directly or indirectly bound to the aza nitrogen atom of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al, Science, 254:1497-1500 (1991).

[0155] Guide RNAs may additionally or alternatively include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include nucleobases that are found only rarely or occasionally in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also called 5-methyl-2′ deoxycytosine, and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenines, 2-(aminoalkylamino)adenines, or other hetero-substituted alkyl adenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. Kornberg, A., DNA Replication, WH Freeman & Co., San Francisco, pp75-77 (1980); Gebeyehu et al., Nucl. Acids Res. 15:4513 (1997). "Universal" bases known in the art, such as inosine, may also be included. 5-Me-C substitution has been shown to improve nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, in Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278), and is an embodiment of base substitution.

[0156] Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine. These may include uracil, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine.

[0157] Additionally, nucleobases may include those disclosed in U.S. Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, YS, Chapter 15, Antisense Research and Applications', pages 289-302, Crooke, ST and Lebleu, B.ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to improve nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278), and even more specifically, this is an aspect of base substitution when combined with 2'-O-methoxyethyl sugar modifications.Modified nucleobases are disclosed in U.S. Patent Nos. 3,687,808, 4,845,205, 5,130,302, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,502,178, 5,502,179, 5,502,270, 5,502,271, 5,502,272, 5,502,273, 5,502,274, 5,502,275, 5,502,276, 5,502,277, 5,502,276, 5,502,277, 5,502,278, 5,502,279 ... Nos. 5,525,711, 5,552,540, 5,587,469, 5,596,091, 5,614,617, 5,681,941, 5,750,692, 5,763,588, 5,830,653, and 6,005,096, as well as U.S. Patent Application Publication No. 2003 / 0158403.

[0158] Thus, the term "modified" refers to an unnatural sugar, phosphate, or base that is incorporated into the guide RNA, the endonuclease, or both the guide RNA and the endonuclease. It is not necessary for all positions of a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated into a single oligonucleotide, or into a single nucleoside within an oligonucleotide.

[0159] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.Such moieties include cholesterol moieties [Letsinger et al., Proc. Natl. Acad. Sci. USA, 86:6553-6556 (1989)], cholic acid [Manoharan et al., Bioorg. Med. Chem. Let., 4:1053-1060 (1994)], thioethers such as hexyl-S-tritylthiol [Manoharan et al, Ann. NY Acad. Sci., 660:306-309 (1992) and Manoharan et al., Bioorg. Med. Chem. Let., 3:2765-2770 (1993)], thiocholesterol [Oberhauser et al., Nucl. Acids Res., 20:533-538 (1992)], aliphatic chains such as dodecanediol or undecyl residues [Kabanov et al., Bioorg. Med. Chem. Let., 4:1053-1060 (1994)], and the like. al., FEBS Lett., 259:327-330 (1990) and Svinarchuk et al., Biochimie, 75:49-54 (1993)], phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate [Manoharan et al., Tetrahedron Lett., 36:3651-3654 (1995) and Shea et al., Nucl. Acids Res., 18:3777-3783 (1990)], polyamines or polyethylene glycol chains [Mancharan et al., Nucleosides & Nucleotides, 14:969-973 (1995)], adamantane acetic acid [Manoharan et al., Tetrahedron Lett., 36:3651-3654 (1995)], a palmityl moiety [(Mishra et al., Biochim. Biophys. Acta, 1264:229-237 (1995)], or an octadecylamine or hexylamino-carbonyl-toxycholesterol moiety [Crooke et al., J. Pharmacol. Exp. Ther., 277:923-937 (1996)].U.S. Patent Nos. 4,828,979, 4,948,882, 5,218,105, 5,525,465, 5,541,313, 5,545,730, 5,552,538, 5,578,717, 5,580,731, 5,580,731, 5,591,584, 5,109,124, 5,118,802, 5,138,045, 5,414,07 No. 7, No. 5,486,603, No. 5,512,439, No. 5,578,718, No. 5,608,046, No. 4,587,044, No. 4,605,735, No. 4,667,025, No. No. 4,762,779, No. 4,789,737, No. 4,824,941, No. 4,835,263, No. 4,876,335, No. 4,904,582, No. 4,958,013, No. 5,082, No. 830, No. 5,112,963, No. 5,214,136, No. 5,082,830, No. 5,112,963, No. 5,214,136, No. 5,245,022, No. 5,254,469, No. 5,258,506, No. 5,262,536, No. 5,272,250, No. 5,292,873, No. 5,317,098, No. 5,371,241, No. 5,391,723, No. 5,416,2 See also Nos. 5,451,463, 5,510,475, 5,512,667, 5,514,785, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,595,726, 5,597,696, 5,599,923, 5,599,928, and 5,688,941.

[0160] Sugars and other moieties can be used to target proteins and complexes containing nucleotides, such as cationic polysomes and liposomes, to specific sites. For example, delivery to hepatocytes can be mediated through asialoglycoprotein receptors (ASGPRs). See, for example, Hu, et al., Protein Pept Lett. 21(10):1025-30 (2014). Other systems known in the art and being developed regularly can be used to target the biomolecules and / or their complexes used in this case to specific target cells of interest.

[0161] These targeting moieties or conjugates may include conjugate groups covalently attached to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the present disclosure include intercalating agents, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacodynamic properties of oligomers. Exemplary conjugate groups include cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. In the context of the present disclosure, groups that enhance pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or enhance sequence-specific hybridization with target nucleic acids. In the context of the present disclosure, groups that enhance pharmacodynamic properties include groups that improve uptake, distribution, metabolism, or excretion of the compounds of the present disclosure. Representative conjugate groups are disclosed in International Patent Application No. PCT / US92 / 09196, filed October 23, 1992 (published as WO1993 / 007883), and U.S. Patent No. 6,287,860. Conjugate moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholic acid, thioethers, such as hexyl-5-tritylthiol, thiocholesterol, aliphatic chains, such as dodecanediol or undecyl residues, phospholipids, such as di-hexadecyl-rac-glycerol or triethylammonium, 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, polyamines, or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties.See, for example, U.S. Patent Nos. 4,828,979, 4,948,882, 5,218,105, 5,525,465, 5,541,313, 5,545,730, 5,552,538, 5,578,717, 5,580,731, 5,580,731, 5,591,584, 5,109,124, 5,118,802, 5,138,045, 5,414 ,077, No. 5,486,603, No. 5,512,439, No. 5,578,718, No. 5,608,046, No. 4,587,044, No. 4,605,735, No. 4,667,025, No. 4,762,779, No. 4,789,737, No. 4,824,941, No. 4,835,263, No. 4,876,335, No. 4,904,582, No. 4,958,013, No. 5,08 No. 2,830, No. 5,112,963, No. 5,214,136, No. 5,082,830, No. 5,112,963, No. 5,214,136, No. 5,245,022, No. 5,254,469 , No. 5,258,506, No. 5,262,536, No. 5,272,250, No. 5,292,873, No. 5,317,098, No. 5,371,241, No. 5,391,723, No. 5,416, 203, 5,451,463, 5,510,475, 5,512,667, 5,514,785, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,595,726, 5,597,696, 5,599,923, 5,599,928, and 5,688,941.

[0162] Longer polynucleotides that are not amenable to chemical synthesis and are usually produced by enzymatic synthesis can also be modified by various means. Such modifications can include, for example, the introduction of certain nucleotide analogs, the incorporation of certain sequences or other moieties at the 5' or 3' end of the molecule, and other modifications. As an example, the mRNA encoding Cas9 is approximately 4 kb in length and can be synthesized by in vitro transcription. Modifications of mRNA can be applied, for example, to enhance its translation or stability (e.g., by increasing resistance to degradation in cells), or to reduce the tendency of RNA to induce the innate immune response often observed in cells, and then to introduce exogenous RNA, especially longer RNA such as encoding Cas9.

[0163] Many such modifications have been described in the art, such as polyA tails, 5' cap analogs (e.g., anti-reverse cap analog (ARCA) or m7G(5')ppp(5')G (mCAP)), modified 5' or 3' untranslated regions (UTRs), use of modified bases (e.g., pseudo-UTP, 2-thio-UTP, 5-methylcytidine-5'-triphosphate (5-methyl-CTP) or N6-methyl-ATP, etc.), or treatment with phosphatases to remove the 5' terminal phosphate. These and other modifications are known in the art, and new modifications of RNA are regularly developed.

[0164] There are numerous commercial suppliers of modified RNA, including, for example, TriLink Biotech, AxoLabs, Bio-Synthesis Inc., Dharmacon, and many others. As described in TriLink, for example, 5-methyl-CTP can be used to impart desirable properties such as increased nuclease stability, increased translation, or reduced interaction of innate immune receptors with the transcribed RNA. 5-Methylcytidine-5′-triphosphate (5-methyl-CTP), N6-methyl-ATP, pseudo-UTP, and 2-thio-UTP have also been shown to enhance translation while reducing innate immune stimulation in culture and in vivo, as described in the publications by Kormann et al. and Warren et al. referenced below.

[0165] It has been shown that improved therapeutic effects can be achieved using chemically modified mRNA delivered in vivo. See, for example, Kormann et al., Nature Biotechnology 29, 154-157 (2011). Such modifications can be used, for example, to increase the stability of an RNA molecule and / or reduce its immunogenicity. Using chemical modifications such as pseudo-U, N6-methyl-A, 2-thio-U, and 5-methyl-C to replace only a quarter of the uridine and cytidine residues, 2-thio-U and 5-methyl-C, respectively, resulted in a significant reduction in toll-like receptor (TLR)-mediated recognition of mRNA in mice. By reducing the activation of the innate immune system, these modifications can be used to effectively increase the stability and longevity of mRNA in vivo. See, for example, Kormann et al., supra.

[0166] It has also been shown that repeated administration of synthetic messenger RNA incorporating modifications designed to bypass the innate antiviral response can reprogram differentiated human cells to pluripotency. See, e.g., Warren, et al., Cell Stem Cell, 7(5):618-30 (2010). Such modified mRNAs acting as primary reprogramming proteins can be an efficient means of reprogramming multiple human cell types. Such cells, called induced pluripotent stem cells (iPSCs), have been found to effectively circumvent cellular antivirals using enzymatically synthesized RNA incorporating 5-methyl-CTP, pseudo-UTP, and anti-reverse cap analog (ARCA). See, e.g., Warren et al., supra.

[0167] Other modifications of polynucleotides described in the art include, for example, the use of a polyA tail, the addition of a 5' cap analog (such as m7G(5')ppp(5')G (mCAP)), modification of the 5' or 3' untranslated region (UTR), or treatment with phosphatase to remove the 5' terminal phosphate, and new approaches are regularly being developed.

[0168] Many compositions and techniques applicable to the generation of modified RNA for use herein have been developed in the context of RNA interference (RNAi) modifications, including small interfering RNA (siRNA). siRNA presents particular challenges in vivo, as its effects on gene silencing via mRNA interference are generally transient and may require repeated administration. Furthermore, siRNA is double-stranded RNA (dsRNA), and mammalian cells have evolved immune responses to detect and neutralize dsRNA, which is often a by-product of viral infection. Thus, there are mammalian enzymes such as PKR (dsRNA-responsive kinase) and potentially retinoic acid-inducible gene I (RIG-I) that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3) that can trigger the induction of cytokines in response to such molecules. See, e.g., Angart et al., Pharmaceuticals (Basel) 6(4):440-468 (2013), Kanasty et al., Molecular Therapy 20(3):513-524 (2012), Burnett et al., Biotechnol J. 6(9):1130-46 (2011), and the reviews by Judge and MacLachlan, Hum Gene Ther 19(2):111-24 (2008), and references cited therein.

[0169] As described herein, a wide variety of modifications have been developed and applied to increase RNA stability, reduce innate immune responses, and / or achieve other advantages that may be useful in connection with the introduction of polynucleotides into human cells. See, e.g., the reviews by Whitehead KA et al., Annual Review of Chemical and Biomolecular Engineering, 2:77-96 (2011); Gaglione and Messere, Mini Rev Med Chem, 10(7):578-95 (2010); Chernolovskaya et al., Curr Opin Mol Ther., 12(2):158-67 (2010); Deleavey et al., Curr Protoc Nucleic Acid Chem Chapter 16:Unit 16.3 (2009); Behlke, Oligonucleotides 18(4):305-19 (2008); Fucini et al., Nucleic Acid Ther 22(3):205-210 (2012); Bremsen et al., Front Genet 3:154 (2012).

[0170] As mentioned above, there are many commercial suppliers of modified RNAs, many of which specialize in modifications designed to improve the efficacy of siRNAs. Different approaches are offered based on different findings reported in the literature. For example, Dharmacon notes that the replacement of non-bridging oxygens with sulfur (phosphorothioate, PS) has been widely used to improve the nuclease resistance of siRNAs, as reported by Kole, Nature Reviews Drug Discovery 11:125-140 (2012). Modifications at the 2′ position of ribose have been reported to increase duplex stability (Tm) while improving the nuclease resistance of the internucleotide phosphate bond, which has also been shown to provide protection from immune activity. The combination of moderate PS backbone modifications with small well-tolerated 2′ substitutions (2′-O-methyl, 2′-fluoro, 2′-hydro) has been associated with highly stable siRNAs for in vivo applications reported by Soutschek et al. Nature 432:173-178 (2004), and 2′-O-methyl modifications have been reported to be effective in improving stability reported by Volkov, Oligonucleotides 19:191-202 (2009). With regard to reduced induction of innate immune responses, modification of specific sequences with 2′-O-methyl, 2′-fluoro, and 2′-hydro has been reported to reduce TLR7 / TLR8 interactions while generally maintaining silencing activity. See, for example, Judge et al., Mol. Ther. 13: 494-505 (2006), and Cekaite et al., J. Mol. Biol. 365: 90-108 (2007). Additional modifications such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine have also been shown to minimize the immune effects mediated by TLR3, TLR7, and TLR8. See, for example, Kariko, K. et al., Immunity 23: 165-175 (2005).

[0171] As known in the art and commercially available, for use herein, many conjugates can be applied to polynucleotides such as RNA that can enhance delivery and / or uptake by cells, including, for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers, and aptamers.See, for example, the review by Winkler, Ther. Deliv. 4:791-809 (2013) and the references cited therein.

[0172] Codon Optimization The polynucleotide encoding the site-directed polypeptide can be codon-optimized according to standard methods in the art for expression in a cell containing the target DNA of interest. For example, if the intended target nucleic acid is in a human cell, a human codon-optimized polynucleotide encoding Cas9 is contemplated for use in producing the Cas9 polypeptide.

[0173] Complex of genome-targeting nucleic acid and site-specific polypeptide The genome-targeting nucleic acid interacts with a site-directed polypeptide (e.g., a nucleic acid-guided nuclease such as Cas9), thereby forming a complex. The genome-targeting nucleic acid guides the site-directed polypeptide to the target nucleic acid.

[0174] Ribonucleoprotein complexes (RNPs) The site-specific polypeptide and genome-targeting nucleic acid can each be administered separately to a cell or a patient. Meanwhile, the site-specific polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNAs together with tracrRNA. The pre-complexed material can then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP). The site-specific polypeptide of the RNP can be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. The site-specific polypeptide can be flanked at the N-terminus, C-terminus, or both the N-terminus and the C-terminus by one or more nuclear localization signals (NLS). For example, the Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminus and a second NLS located at the C-terminus. The NLS can be any NLS known in the art, such as the SV40 NLS. The weight ratio of the genome-targeting nucleic acid and the site-specific polypeptide of the RNP can be 1:1. For example, the weight ratio of sgRNA to Cas9 endonuclease in the RNP can be 1:1.

[0175] Nucleic acid-encoded system components The present disclosure provides nucleic acids comprising nucleotide sequences encoding the genome-targeting nucleic acids of the present disclosure, the site-directed polypeptides of the present disclosure, and / or any nucleic acid or protein molecule necessary to carry out aspects of the methods of the present disclosure.

[0176] A nucleic acid encoding a genome-targeting nucleic acid of the present disclosure, a site-specific polypeptide of the present disclosure, and / or any nucleic acid or protein molecule necessary to carry out an embodiment of a method of the present disclosure may comprise a vector (e.g., a recombinant expression vector).

[0177] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, into which additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell upon introduction into the host cell, and are thereby replicated along with the host genome.

[0178] In some embodiments, vectors may be capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors," or more simply, "expression vectors," and serve equivalent functions.

[0179] The term "operably linked" means that the nucleotide sequence of interest is linked to a regulatory sequence(s) in a manner that allows expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Those skilled in the art will understand that the design of the expression vector may depend on factors such as the choice of target cells, the desired expression level, and the like.

[0180] Contemplated expression vectors include, but are not limited to, vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, mammary tumor virus), and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors can be used as long as they are compatible with the host cell.

[0181] In some embodiments, the vector can include one or more transcription and / or translation control elements. Depending on the host / vector system used, any of a number of suitable transcription and translation control elements can be used in the expression vector, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. The vector can be a self-inactivating vector that inactivates either viral sequences or components of the CRISPR mechanism or other elements.

[0182] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that function in eukaryotic cells) include those derived from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retroviruses, human elongation factor-1 promoter (EF1), chicken beta-actin promoter (CAG), mouse stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus promoter (PGK), and hybrid constructs containing the cytomegalovirus (CMV) enhancer fused to mouse metallothionein-I.

[0183] For the expression of small RNA, including guide RNA used in conjunction with Cas endonuclease, various promoters can be advantageous, such as RNA polymerase III promoters, including U6 and H1.The description and parameters for enhancing the use of such promoters are known in the art, and additional information and approaches are regularly described.See, for example, Ma, H. et al., Molecular Therapy-Nucleic Acids 3, e161 (2014) doi: 10.1038 / mtna.2014.12.

[0184] The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also contain appropriate sequences for amplifying expression. The expression vector may also contain a nucleotide sequence encoding a non-natural tag (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that is fused to the site-specific polypeptide, thus resulting in a fusion protein.

[0185] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some cases, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.).

[0186] The genome targeting nucleic acid and / or the nucleic acid encoding the site-specific polypeptide of the present disclosure can be packaged on the surface or on the surface of a delivery vehicle for delivery to cells.Contemplated delivery vehicles include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles.As described in the art, various targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations.

[0187] Introduction of the complexes, polypeptides, and nucleic acids of the present disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0188] Therapeutic approach Provided herein is a method for treating a patient with dyslipidemia. An embodiment of such a method is an ex vivo cell-based therapy. For example, a patient's liver is biopsied. Liver-specific progenitor cells or primary hepatocytes are then isolated from the biopsy. The chromosomal DNA of these progenitor cells or primary hepatocytes is then modified using the materials and methods described herein. Finally, the progenitor cells or primary hepatocytes are transplanted into the patient. Any source or type of cell can be used as progenitor cells.

[0189] Another aspect of such a method is ex vivo cell-based therapy. For example, patient-specific induced pluripotent stem cells (iPSCs) can be created. The chromosomal DNA of these iPSCs can then be edited using the materials and methods described herein. The genome-edited iPSCs can then be differentiated into other cells. Finally, the differentiated cells are transplanted into the patient.

[0190] Yet another aspect of such a method is ex vivo cell-based therapy. For example, mesenchymal stem cells can be isolated from a patient, which can be isolated from the patient's bone marrow or peripheral blood. Then, the chromosomal DNA of these mesenchymal stem cells can be edited using the materials and methods described herein. Then, the genome-edited mesenchymal stem cells can be differentiated into any type of cell, for example, hepatocytes. Finally, the differentiated cells, for example, hepatocytes, are transplanted into the patient.

[0191] One advantage of ex vivo cell therapy approach is that comprehensive analysis of therapeutic agent can be performed before administration. Nuclease-based therapy can have some degree of off-target effect. Gene editing can be performed ex vivo to characterize edited cell population before transplantation. The present disclosure includes sequencing the whole genome of edited cells to ensure that off-target effect, if any, is at the genome location associated with minimal risk to patient. In addition, specific cell populations, including clonal populations, can be isolated before transplantation.

[0192] Another advantage of ex vivo cell therapy concerns the genetic modification of iPSCs compared to other primary cell sources. iPSCs are abundant, making it easier to obtain the large numbers of cells required for cell-based therapies. Moreover, iPSCs are an ideal cell type to perform clonal isolation. This allows screening for the correct genomic modification without risking reduced viability. In contrast, other primary cells, such as hepatocytes, are only viable for a few passages and are difficult to clonally expand. Thus, the manipulation of iPSCs for the treatment of dyslipidemia can be much easier and the time required to perform the desired genetic modifications can be reduced.

[0193] The methods may also include in vivo-based therapies, in which the chromosomal DNA of a patient's cells is edited using the materials and methods described herein.

[0194] Certain cells present attractive targets for ex vivo treatments and therapies, but increased efficacy in delivery may allow for direct in vivo delivery to such cells. Ideally, targeting and editing is directed to the relevant cells. Using promoters that are only active in certain cells and / or developmental stages can also prevent cleavage of other cells. Additional promoters can be inducible, allowing for temporal control if the nuclease is delivered as a plasmid. The time that the delivered RNA and protein remain in the cell can also be tuned using added treatments or domains to alter half-life. In vivo treatments eliminate many treatment steps, but lower delivery rates may require higher editing rates. In vivo treatments can eliminate the problems and losses from ex vivo treatments and engraftment.

[0195] The advantage of in vivo gene therapy may be the ease of therapeutic production and administration.The same therapeutic approach and treatment method can be used to treat multiple patients, for example, many patients who share the same or similar genotype or allele.In contrast, ex vivo cell therapy usually requires the use of the patient's own cells, which are isolated, manipulated, and then returned to the same patient.

[0196] Also provided herein is a cellular method for editing ANGPTL3 gene in cells by genome editing.For example, cells can be isolated from patients or animals.Then, the chromosomal DNA of cells can be edited using the materials and methods described herein.

[0197] The methods provided herein, whether cellular or ex vivo or in vivo methods, can involve reducing (knockdown) or eliminating (knockout) expression of the ANGPTL3 gene by introducing one or more insertions, deletions, or mutations into or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene.

[0198] For example, knockdown or knockout strategies may involve disrupting the reading frame of the ANGPTL3 gene by introducing random insertions or deletions (indels) that occur due to imprecise NHEJ repair pathways. This can be achieved by inducing one single-strand or double-strand break into the gene of interest with one or more CRISPR endonucleases and gRNAs (e.g., crRNA+tracrRNA, or sgRNA), or two or more single-strand or double-strand breaks into the gene of interest with two or more CRISPR endonucleases and two or more sgRNAs. This approach may require the development and optimization of sgRNAs of the ANGPTL3 gene.

[0199] Alternatively, knockdown or knockout strategies can also involve the deletion of one or more segments in or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene. This deletion strategy requires at least one pair of gRNAs (e.g., crRNA+tracrRNA, or sgRNA) that can bind to two different sites in or near the ANGPTL3 gene and one or more CRISPR endonucleases. The CRISPR endonuclease, composed of two gRNAs, induces two double-stranded breaks at the desired positions. After cleavage, the two ends, with or without blunt ends or overhangs, can be joined by NHEJ, resulting in the deletion of the intervening segment. The NHEJ repair pathway can result in insertion, deletion, or mutation at the junction.

[0200] In addition to the genome editing strategies described above, another strategy involves modulating the expression, function, or activity of ANGPTL3 by editing regulatory sequences.

[0201] In addition to the above editing options, Cas9 or similar proteins can be used to target effector domains to the same target site that can be identified for editing, or to additional target sites within the range of the effector domain. A series of chromatin modifying enzymes, methylases, or demethylases can be used to modify the expression of the target gene. One possibility is to reduce the expression of the ANGPTL3 protein if the mutation results in an undesirable activity. These types of epigenetic control have several advantages, especially since they are limited in possible off-target effects.

[0202] In addition to coding and splicing sequences, many types of genomic target sites may exist.

[0203] Regulation of transcription and translation involves many different classes of sites that interact with cellular proteins or nucleotides. Often DNA binding sites of transcription factors or other proteins can be targeted for mutation or deletion to study the role of the site, but they can also be targeted to alter gene expression. Sites can be added through non-homologous end joining NHEJ or by direct genome editing with homology directed repair (HDR). The increasing use of genomic sequences, RNA expression, and genome-wide studies of transcription factor binding have improved the ability to identify how sites lead to developmental or temporal gene regulation. These control systems can be direct or involve extensive cooperative regulation that may require integration of activity from multiple enhancers. Transcription factors typically bind to degenerate DNA sequences between 6 and 12 bp in length. The low level of specificity provided by individual sites suggests that complex interactions and rules are involved in the binding and functional outcome. Less degenerate binding sites can provide a simpler means of regulation. Artificial transcription factors can be designed to specify longer sequences with fewer similar sequences in the genome and less chance of off-target cleavage. Any of these types of binding sites can be mutated, deleted, or created to allow for changes in gene regulation or expression (Canver, MC et al., Nature (2015)).

[0204] Another class of gene regulatory regions with these characteristics are microRNA (miRNA) binding sites. miRNAs are non-coding RNAs that play an important role in post-transcriptional gene regulation. miRNAs can regulate the expression of 30% of all mammalian protein-coding genes. In addition to specific and potent gene silencing by double-stranded RNA (RNAi), even smaller non-coding RNAs have been discovered (Canver, MC et al., Nature (2015)). The largest class of non-coding RNAs important for gene silencing are miRNAs. In mammals, miRNAs are initially transcribed as long RNA transcripts, which can be separate transcriptional units, parts of protein introns, or other transcripts. The long transcripts are called primary miRNAs (pri-miRNAs), which contain imperfectly base-paired hairpin structures. These pri-miRNAs can be cleaved into one or more shorter precursor miRNAs (pre-miRNAs) by the microprocessor, a nuclear protein complex involving Drosha.

[0205] Pre-miRNAs are short stem-loops, approximately 70 nucleotides in length, with 2-nucleotide 3′ overhangs, that are exported into mature 19–25 nucleotide miRNA:miRNA* duplexes. The miRNA strand with lower base-pair stability (guide strand) can be loaded onto the RNA-induced silencing complex (RISC). The passenger strand (marked with *) can function but is usually degraded. The mature miRNA tethers RISC to partially complementary sequence motifs of target mRNAs, mainly found within the 3′ untranslated region (UTR), inducing post-transcriptional gene silencing (Bartel, D.P. Cell 136, 215-233 (2009); Saj, A. & Lai, E.C. Curr Opin Genet Dev 21, 504-510 (2011)).

[0206] miRNAs may be important in development, differentiation, cell cycle, and growth control, and in virtually all biological pathways in mammals and other multicellular organisms. miRNAs are also involved in cell cycle control, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication, and immune response.

[0207] A single miRNA can target hundreds of different mRNA transcripts, while an individual miRNA transcript can be targeted by many different miRNAs. In the latest release (v.21) of miRBase, over 28645 microRNAs have been annotated. Some miRNAs are encoded by multiple loci, some of which can be expressed from tandemly co-transcribed clusters. This feature allows for complex regulatory networks with multiple pathways and feedback control. miRNAs can be an integral part of these feedback and regulatory circuits and can help regulate gene expression by keeping protein production within limits (Herranz, H. & Cohen, SM Genes Dev 24, 1339-1344 (2010); Posadas, DM & Carthew, RW Curr Opin Genet Dev 27, 1-6 (2014)).

[0208] miRNA may also be important in many human diseases related to abnormal miRNA expression. This association highlights the importance of miRNA regulatory pathways. Recent miRNA deletion studies have linked miRNA to the regulation of immune response (Stern-Ginossar, N. et al., Science 317, 376-381 (2007)).

[0209] miRNAs also have a strong connection to cancer and can play a role in various types of cancer. miRNAs have been found to be downregulated in many tumors. miRNAs can be important in regulating key cancer-related pathways such as cell cycle control and DNA damage response, and therefore can be used for diagnosis and can be targeted clinically. MicroRNAs can delicately regulate the balance of angiogenesis, whereby experiments depleting all microRNAs suppress tumor angiogenesis (Chen, S. et al., Genes Dev 28, 1054-1067 (2014)).

[0210] As has been shown for protein-coding genes, miRNA genes can also be affected by epigenetic changes that occur with cancer. Many miRNA loci are associated with CpG islands, increasing the opportunity for regulation by DNA methylation (Weber, B., Stresemann, C., Brueckner, B. & Lyko, F. Cell Cycle 6, 1001-1005 (2007)). Most studies have used treatment with chromatin-remodeling drugs to reveal epigenetically silenced miRNAs.

[0211] In addition to their role in RNA silencing, miRNAs can also activate translation (Posadas, DM & Carthew, RW Curr Opin Genet Dev 27, 1-6 (2014)). Knocking out miRNA sites can lead to decreased expression of target genes, whereas introducing these sites can increase expression.

[0212] Individual miRNAs can be most effectively knocked out by mutating the seed sequence (bases 2-8 of the microRNA), which may be important for binding specificity. Cleavage in this region and subsequent misrepair by NHEJ can effectively disable miRNA function by blocking binding to the target site. miRNAs can also be inhibited by specific targeting of special loop regions adjacent to the palindromic sequence. Catalytically inactive Cas9 can also be used to inhibit shRNA expression (Zhao, Y. et al., Sci Rep 4, 3943 (2014)). In addition to targeting miRNAs, binding sites can also be targeted and mutated to prevent silencing by miRNAs.

[0213] In accordance with the present disclosure, microRNAs (miRNAs) or any of their binding sites can be incorporated into the compositions of the present disclosure.

[0214] The composition may have, without limitation, the sequence of any of the microRNAs listed in SEQ ID NOs: 632-4,715, the reverse complement of a microRNA listed in SEQ ID NOs: 632-4,715, or a region including the microRNA antiseed region of any of the microRNAs listed in SEQ ID NOs: 632-4,715.

[0215] The compositions of the present disclosure may include one or more microRNA target sequences, microRNA sequences, or microRNA seeds. Such sequences may correspond to any known microRNA, such as those taught in U.S. Patent Publication No. US2005 / 0261218 and U.S. Patent Publication No. US2005 / 0059005. As non-limiting examples, known microRNAs in the human genome, their sequences, and their binding site sequences are listed in SEQ ID NOs: 632-4,715.

[0216] The microRNA sequence comprises a "seed" sequence, i.e., the sequence of the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence. The microRNA seed may comprise positions 2-8 or positions 2-7 of the mature microRNA. In some embodiments, the microRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature microRNA) and the seed complementary site of the corresponding miRNA target is adjacent to an adenine (A) opposite microRNA position 1. In some embodiments, the microRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature microRNA) and the seed complementary site of the corresponding miRNA target is adjacent to an adenine (A) opposite microRNA position 1. See, e.g., Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6; 27(1):91-105. The bases of the microRNA seed have perfect complementarity with the target sequence.

[0217] Identification of microRNAs, microRNA target regions, and their expression patterns and roles in biology have been reported (Bonauer et al.,Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413(2011 Dec 20.doi:10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al,Cell,2007 129:1401-1414; Gentner and Naldini,Tissue Antigens.2012 80:393-403).

[0218] For example, if a composition is not intended to be delivered to the liver but ultimately resides there, miR-122, a liver-enriched microRNA, may inhibit expression of the delivered sequence if one or more target sites for miR-122 are incorporated into the polynucleotide encoding that target sequence. The introduction of one or more binding sites for a different microRNA can be engineered to further reduce the longevity, stability, and translation of the protein, thus providing an additional layer of resistance to attack.

[0219] As used herein, the term "microRNA site" refers to a microRNA target site or microRNA recognition site, or any nucleotide sequence to which a microRNA binds or associates. It is understood that "binding" may follow conventional Watson-Crick hybridization rules or may reflect a stable association of the microRNA with a target sequence at or adjacent to the microRNA site.

[0220] Conversely, for purposes of the compositions of the present disclosure, microRNA binding sites can be engineered (i.e., removed) from the sequences in which they naturally occur in order to increase protein expression in particular tissues, e.g., the miR-122 binding site can be removed to improve protein expression in the liver.

[0221] Specifically, microRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killer cells. Immune cell-specific microRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and undesirable immune responses after gene therapy and tissue / organ transplantation. Immune cell-specific microRNAs also regulate many aspects of hematopoietic cell (immune cell) development, proliferation, differentiation, and apoptosis. For example, miR-142 and miR-146 are expressed exclusively in immune cells and are particularly abundant in myeloid dendritic cells. Introducing a miR-142 binding site into the 3'-UTR of a polypeptide of the present disclosure can selectively suppress gene expression in antigen-presenting cells through miR-142-mediated mRNA degradation, limiting antigen presentation in professional APCs (e.g., dendritic cells), thereby preventing antigen-mediated immune responses after gene delivery (see Annoni A et al., Blood, 2009, 114, 5152-5161).

[0222] In one embodiment, a microRNA binding site known to be expressed in immune cells, particularly antigen-presenting cells, is incorporated into the polynucleotide to suppress expression of the polynucleotide in APCs by microRNA-mediated RNA degradation and mitigate antigen-mediated immune responses, while expression of the polynucleotide is maintained in non-immune cells that do not express the immune cell-specific microRNA.

[0223] Many microRNA expression studies have been conducted and described in the art to profile the differential expression of microRNAs in various cancer cells / tissues and other diseases. Some microRNAs are abnormally overexpressed in certain cancer cells, while others are underexpressed. For example, microRNAs have been implicated in cancer cells (WO2008 / 154098, US2013 / 0059015, US2013 / 0042333, WO2011 / 157294), cancer stem cells (US2012 / 0053224), pancreatic cancer and disease (US2009 / 0131348, US2011 / 0171646, US2010 / 0286232, US8389210), asthma and inflammation ( US8415096), prostate cancer (US2013 / 0053264), hepatocellular carcinoma (WO2012 / 151212, US2012 / 0329672, WO2008 / 054828, US8252538), lung cancer cells (WO2011 / 076143, WO2013 / 033640, WO2009 / 070653, US2010 / 0323357), cutaneous T-cell lymphoma (WO2013 / 011378), colorectal cancer cells (WO2011 / 0281756, WO2011 / 076142), cancer-positive lymph nodes (WO2009 / 100430, US2009 / 0263803), nasal Pharyngeal cancer (EP2112235), chronic obstructive pulmonary disease (US2012 / 0264626, US2013 / 0053263), thyroid cancer (WO2013 / 066678), ovarian cancer cells (US201) 2 / 0309645, US2011 / 095623), breast cancer cells (WO2008 / 154098, WO2007 / 081740, US2012 / 0214699), leukemia and lymphoma (WO2008 / 073915, US2009 / 0092974, US2012 / 0316081, US2012 / 0283310, WO2010 / 018563).

[0224] Non-limiting examples of microRNA sequences and target tissues and / or cells are set forth in SEQ ID NOs: 632-4,715.

[0225] Genome engineering strategies In some embodiments, the methods of the present disclosure may involve editing one or both alleles. Gene editing to correct an allele(s) has the advantage of permanently altering the target gene or gene product.

[0226] The steps of the ex vivo method of the present disclosure may include editing hepatocytes isolated from a patient using genome manipulation.Alternatively, the steps of the ex vivo method of the present disclosure may include editing patient-specific iPSCs or mesenchymal stem cells.Similarly, the steps of the in vivo method of the present disclosure may include editing cells of a dyslipidemia patient using genome manipulation.Similarly, the steps of the cellular method of the present disclosure may include editing the ANGPTL3 gene of human cells by genome manipulation.

[0227] Dyslipidemia patients may show different mutations in ANGPTL3 gene. Any CRISPR endonuclease can be used in the method of the present disclosure, and each CRISPR endonuclease has its own associated PAM, which may or may not be disease-specific.

[0228] For example, the expression of the ANGPTL3 gene can be disrupted or eliminated by introducing random insertions or deletions (indels) that occur due to imprecise NHEJ repair pathways. The target region can be the coding sequence (i.e., exons) of the ANGPTL3 gene. Inserting or deleting nucleotides into the coding sequence of a gene can cause a "frameshift" that disrupts the normal three-letter codon pattern. In this way, gene expression, and thus protein production, can be reduced or eliminated. This approach can also be used to target introns, intron:exon junctions, or regulatory DNA elements of the ANGPTL3 gene, where alterations in the sequence can disrupt the expression of the ANGPTL3 gene.

[0229] As another example, NHEJ can also be used to delete segments within or near genes, either directly or by cleavage with a gRNA or multiple gRNAs targeting multiple locations to modify splice donor or acceptor sites. This can be useful when small random indels are inefficient at knocking out the target gene. A pair of guide strands is used for this type of deletion.

[0230] In the absence of a donor, several non-homologous repair pathways can be used to join ends from DNA breaks or ends from different breaks, in which the DNA ends are joined with little or no base pairing at the junction. In addition to standard NHEJ, there are similar repair mechanisms, such as alt-NHEJ. When there are two breaks, the intervening segment can be deleted or inverted. NHEJ repair pathways can result in insertions, deletions, or mutations at the junction.

[0231] NHEJ can also lead to homology-independent targeted integration. For example, inclusion of a nuclease target site on the donor plasmid can promote transgene integration into chromosomal double-strand breaks after nuclease cleavage in vivo in both the donor and chromosome (Cristea., Biotechnol Bioeng. 2013 Mar;110(3):871-80). NHEJ was used to insert a 15 kb inducible gene expression cassette into a defined locus in a human cell line after nuclease cleavage. (See, e.g., Maresca, M., Lin, VG, Guo, N. & Yang, Y., Genome Res 23, 539-546 (2013), Cristea et al. Biotechnology and Bioengineering 2013, 871-80, 10.1002 / bit.24733). The integrated sequence can disrupt the reading frame of the ANGPTL3 gene or alter the structure of the gene.

[0232] As a further alternative, homology-directed repair (HDR) can also be used to knock out genes or modify gene function. HDR is essentially an error-free mechanism that uses a homologous DNA sequence provided as a template during DSB repair. The rate of HDR is a function of the distance between the mutation and the cut site, so it is important to select overlapping or closest target sites. The template can contain extra sequences flanked by homologous regions or can contain sequences that differ from the genomic sequence, allowing sequence editing.

[0233] For example, HDR knockout strategies may involve disrupting the structure or function of the ANGPTL3 gene by inserting into the gene or replacing a portion of the gene with a non-functional or unrelated sequence. This can be achieved by inducing one single-stranded or double-stranded break into the gene of interest with one or more CRISPR endonucleases and gRNAs (e.g., crRNA+tracrRNA, or sgRNA), or two or more single-stranded or double-stranded breaks into the gene of interest with one or more CRISPR endonucleases and two or more gRNAs in the presence of an exogenously introduced donor DNA template to direct the cellular DSB response to HDR (the donor DNA template can be a short single-stranded oligonucleotide, a short double-stranded oligonucleotide, or a long single-stranded or double-stranded DNA molecule). This approach may require the development and optimization of the gRNA and donor DNA molecule of the ANGPTL3 gene.

[0234] Homology-directed repair is a cellular mechanism for repairing DSBs. The most common form is homologous recombination. There are additional pathways for HDR, including single-strand annealing and alternative HDR. Genome engineering tools allow researchers to manipulate the cellular homologous recombination pathway to create site-specific modifications to the genome. It has been shown that cells can repair double-strand breaks using synthetic donor molecules provided in trans. Thus, by introducing a double-strand break near a specific mutation and providing an appropriate donor, targeted changes can be made to the genome. Specific cleavage increases the rate of HDR by 10% compared to cells that received only homologous donors. 6 This is a 1,000-fold increase over the rate of 1 in 1 cell. The rate of homology-directed repair (HDR) at a particular nucleotide is a function of the distance to the cut site, so it is important to select overlapping or closest target sites. Gene editing has an advantage over gene addition because editing in situ leaves the rest of the genome unaffected.

[0235] Donors provided for editing by HDR vary significantly but can contain the intended sequence with small or large flanking homology arms to allow annealing to genomic DNA. The homology regions flanking the introduced genetic change can be as small as 30 bp or less, or as large as multi-kilobase cassettes that can include promoters, cDNA, etc. Both single-stranded and double-stranded oligonucleotide donors have been used. These oligonucleotides range in size from under 100 nt to over several kb, although longer ssDNA can also be generated and used. Double-stranded donors such as PCR amplicons, plasmids, and minicircles can be used. Generally, the packaging limit for an individual donor is less than 5 kb, but it has been found that AAV vectors can be a very effective means of delivery of donor templates. Active transcription of the donor increased HDR by 3-fold, indicating that inclusion of a promoter can increase conversion. Conversely, CpG methylation of the donor reduced gene expression and HDR.

[0236] In addition to wild-type endonucleases such as Cas9, there are nickase mutants in which one or other nuclease domains are inactivated and only one DNA strand is cleaved. HDR can be directed from individual Cas nickases or using a pair of nickases flanking the target region. The donor can be single-stranded, nicked, or dsDNA.

[0237] Donor DNA can be supplied together with nuclease or by a variety of different methods, for example, by transfection, nanoparticles, microinjection, or viral transduction independently. A series of tethering options have been proposed to increase the availability of the donor for HDR. Examples include binding the donor to a nuclease, binding to a nearby DNA-binding protein, or binding to a protein involved in binding or repairing DNA ends.

[0238] The choice of repair pathway can be guided by many culture conditions, such as those affecting the cell cycle, or by targeting DNA repair and related proteins. For example, key NHEJ molecules such as KU70, KU80, and DNA ligase IV can be inhibited to increase HDR.

[0239] In addition to genome editing by NHEJ or HDR, site-specific gene insertion using both the NHEJ pathway and HDR has been performed. A combination approach may be applied in certain settings, possibly including intron / exon boundaries. NHEJ can prove effective for ligation at introns, whereas error-free HDR may be more suitable in coding regions.

[0240] The ANGPTL3 gene contains many exons, as shown in Table 3. Any one or more of these exons or nearby introns can be targeted to create one or more insertions or deletions that disrupt the reading frame and ultimately eliminate ANGPTL3 protein activity.

[0241] In some embodiments, the method can provide a gRNA pair that performs deletion by cutting gene twice at the position adjacent to undesired sequence.The sequence can include one or more exons, introns, intron:exon junctions, other DNA sequences that code regulatory elements of ANGPTL3 gene, or combinations thereof.Cutting can be achieved by a pair of DNA endonucleases that each create DSB in genome, or by multiple nickases that create DSB in genome together.

[0242] Alternatively, the method can provide one gRNA to make one double-stranded break in the coding or splicing sequence. The double-stranded break can be made by a single DNA endonuclease or by multiple nickases that together create a DSB in the genome.

[0243] Splicing donors and acceptors are generally within 100 base pairs of adjacent introns. In some examples, the methods can provide gRNAs that cleave approximately + / - 100 to 3100 bp with respect to each exon / intron junction of interest.

[0244] For any of the genome editing strategies, gene edits can be confirmed by sequencing or PCR analysis.

[0245] Selection of target sequence As further described and exemplified herein, shifting the location of the 5' and / or 3' boundaries relative to a particular reference locus, depending in part on the endonuclease system selected for editing, can be used to facilitate or enhance particular applications of gene editing.

[0246] In a first non-limiting example of such target sequence selection, many endonuclease systems have rules or criteria that can guide the initial selection of a potential target site for cleavage, such as, in the case of CRISPR Type II or Type V endonucleases, the requirement for a PAM sequence motif at a specific position adjacent to the DNA cleavage site.

[0247] In another non-limiting example of target sequence selection or optimization, the frequency of off-target activity (i.e., frequency of DSBs occurring at sites other than the selected target sequence) of a particular combination of target sequence and gene editing endonuclease can be evaluated relative to the frequency of on-target activity. In some cases, cells correctly edited at the desired locus may have a selective advantage compared to other cells. Illustrative but non-limiting examples of selective advantage include improved replication rate, persistence, resistance to certain conditions, acquisition of attributes such as improved engraftment success or persistence in vivo after introduction into a patient, and other attributes associated with maintaining or increasing the number or viability of such cells. In other cases, cells correctly edited at the desired locus can be appropriately selected by one or more screening methods used to identify, classify, or otherwise select correctly edited cells. Both selective advantage and directed selection methods can take advantage of the phenotype associated with the modification. In some cases, cells can be edited more than once to create a second modification that creates a new phenotype used to select or purify the intended cell population. Such a second modification can be made by adding a second gRNA to a selectable or screenable marker. In some cases, a DNA fragment containing the cDNA and a selectable marker can be used to correctly edit the cell at the desired locus.

[0248] Regardless of whether any selective advantage is applicable in a particular case or any directed selection is applied, the selection of target sequence can also be guided by off-target frequency considerations to enhance the effectiveness of application and / or reduce the possibility of undesired modification at sites other than the desired target.As further described and illustrated herein and in the art, the occurrence of off-target activity can be influenced by many factors, including the similarity and dissimilarity between target site and various off-target sites, and the specific endonuclease used.Bioinformatics tools can be utilized to assist in the prediction of off-target activity, and frequently such tools can also be used to identify the most likely sites of off-target activity, which can then be evaluated in an experimental setting to evaluate the relative frequency of off-target to on-target activity, thereby allowing the selection of sequences with high relative on-target activity.Illustrative examples of such techniques are provided herein, and others are known in the art.

[0249] Another aspect of the selection of target sequences concerns homologous recombination events. Sequences that share homologous regions can serve as a focus for homologous recombination events that result in the deletion of intervening sequences. Such recombination events occur regularly during the normal replication process of chromosomes and other DNA sequences, and at other times when DNA sequences are synthesized, for example, in the case of repair of double-strand breaks (DSBs), which occur regularly during the normal cell replication cycle, but can be enhanced by the occurrence of various events (such as UV light and other inducers of DNA breaks) or the presence of certain agents (such as various chemical inducers). Many of these inducers cause DSBs to occur indiscriminately in the genome, and DSBs can be induced and repaired regularly in normal cells. During repair, the original sequence can be reconstructed completely and faithfully, but in some cases, small insertions or deletions (called "indels") are introduced at the DSB site.

[0250] As in the case of the endonuclease system described herein, DSBs can also be specifically induced at specific locations, which can be used to cause directed or preferential gene modification events at selected chromosomal locations. The tendency of homologous sequences to be targeted for recombination in the context of DNA repair (and replication) can be exploited in many situations, and is the basis of one application of gene editing systems such as CRISPR, which use homology-directed repair to insert a sequence of interest into a desired chromosomal location, provided by the use of a "donor" polynucleotide.

[0251] Homologous regions between specific sequences, which may be small regions of "microhomology" that may contain only 10 base pairs or less, can also be used to cause the desired deletion. For example, a single DSB can be introduced at a site that shows microhomology with a nearby sequence. In the normal repair process of such DSBs, the frequent result is the deletion of the intervening sequence as a result of recombination promoted by the DSB and the accompanying cellular repair process.

[0252] However, in some circumstances, selecting target sequences within the region of homology can result in much larger deletions, including gene fusions (if the deletion is in a coding region), which may or may not be desirable in certain situations.

[0253] The examples provided herein further describe the selection of various target regions for the creation of DSBs designed to induce insertions, deletions, or mutations that result in the reduction or elimination of ANGPTL3 protein activity, as well as the selection of specific target sequences within such regions that are designed to minimize off-target events relative to on-target events.

[0254] Human cells As described and exemplified herein, the primary target of gene editing to improve dyslipidemia or any disorder related to ANGPTL3 is human cells.For example, in ex vivo method, human cells can be somatic cells, and after being modified using the described technique, can generate differentiated cells, such as hepatocytes or progenitor cells.For example, in in vivo method, human cells can be hepatocytes, kidney cells, or cells from other affected organs.

[0255] By performing gene editing on autologous cells that are derived from a patient in need and are therefore already a perfect match, it is possible to generate cells that can be safely reintroduced into the patient, effectively giving rise to a cell population that will be effective in ameliorating one or more clinical conditions associated with the patient's disease.

[0256] Stem cells are capable of both proliferation and the generation of more progenitor cells, which in turn have the capacity to generate a large number of mother cells that can generate differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while retaining one or more cells with the developmental potential of the parent. The term "stem cell" then refers to a cell that has the capacity or potential to differentiate into a more specialized or differentiated phenotype under certain circumstances, and retains the capacity to proliferate without substantial differentiation under certain circumstances. In one aspect, the term progenitor cell or stem cell refers to a generalized mother cell whose progeny (descendants) often specialize in different directions by differentiation, e.g., by acquiring completely individual characteristics, as occurs in the progressive diversification of embryonic cells and tissues. Cell differentiation is a complex process that usually occurs through many cell divisions. Differentiated cells can be derived from pluripotent cells, which themselves are derived from pluripotent cells, etc. Each of these pluripotent cells may be considered a stem cell, although the range of cell types each may give rise to may vary considerably. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such a capacity may be natural or may be artificially induced by treatment with various factors. In many biological examples, stem cells may also be "pluripotent" since they can produce progeny of multiple distinct cell types, although this is not required for "stemness".

[0257] Self-renewal may be another important aspect of stem cells. In theory, self-renewal may occur by either of two main mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype. Alternatively, some of the stem cells in a population may divide symmetrically into two stems, such that some stem cells in the population are maintained as a whole, while other cells in the population give rise to only differentiated progeny. Generally, "progenitor cells" have a more primitive cell phenotype (i.e., at an earlier stage along a developmental pathway or progression than fully differentiated cells). In many cases, progenitor cells also possess significant or very high proliferation potential. Progenitor cells can give rise to multiple distinct differentiated cell types or a single differentiated cell type, depending on the developmental pathway and the environment in which the cells develop and differentiate.

[0258] In the context of cell ontogeny, the adjectives "differentiated" or "differentiating" are relative terms. A "differentiated cell" is one that has progressed further along the developmental pathway than the cell to which it is being compared. Thus, stem cells can differentiate into lineage-restricted progenitor cells (such as myocyte progenitors), which in turn can differentiate into other types of precursor cells further along the pathway (such as myocyte precursors), and then into terminally differentiated cells, such as myocytes, that play characteristic roles in a particular tissue type and may or may not retain the ability to proliferate further.

[0259] induced pluripotent stem cells The genetically engineered human cells described herein can be induced pluripotent stem cells (iPSCs). The advantage of using iPSCs is that the cells can be derived from the same subject to which the progenitor cells are administered. That is, somatic cells can be obtained from a subject, reprogrammed into induced pluripotent stem cells, and then redifferentiated into progenitor cells (e.g., autologous cells) that are administered to the subject. Because the progenitor cells are essentially from an autologous source, the risk of engraftment rejection or allergic reaction can be reduced compared to using cells from another subject or group of subjects. Furthermore, the use of iPSCs eliminates the need for cells obtained from an embryonic source. Thus, in one aspect, the stem cells used in the disclosed methods are not embryonic stem cells.

[0260] Although differentiation is generally irreversible in physiological situations, several methods have recently been developed for reprogramming somatic cells into iPSCs. Exemplary methods are known to those of skill in the art and are briefly described below.

[0261] The term "reprogramming" refers to a process that alters or reverses the differentiation state of differentiated cells (e.g., somatic cells). In other words, reprogramming refers to a process that reverses the differentiation of cells to a more undifferentiated or more primitive cell type. It should be noted that culturing many primary cells can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells that are included in the term differentiated cells does not make these cells undifferentiated (e.g., undifferentiated) or pluripotent cells. The transition of differentiated cells to pluripotency requires a reprogramming stimulus that exceeds the stimulus that leads to a partial loss of differentiation characteristics in culture. Reprogrammed cells also have the characteristic of the ability to be passaged for long periods without loss of growth potential, compared to their parent primary cells, which generally only have the capacity for a limited number of divisions in culture.

[0262] The reprogrammed cell can be either partially or terminally differentiated prior to reprogramming. Reprogramming can involve the complete reversal of the differentiated state of a differentiated cell (e.g., somatic cell) to a pluripotent or multipotent state. Reprogramming can involve the complete or partial reversal of the differentiated state of a differentiated cell (e.g., somatic cell) to an undifferentiated cell (e.g., embryonic-like cell). Reprogramming can result in the expression of certain genes by the cell, which expression further contributes to reprogramming. In certain examples described herein, reprogramming of a differentiated cell (e.g., somatic cell) can be considered to return the differentiated cell to an undifferentiated state (e.g., undifferentiated cell). The resulting cell is called a "reprogrammed cell" or "induced pluripotent stem cell (iPSC or iPS cell)".

[0263] Reprogramming may involve altering (e.g., reversing) at least some of the genetic patterns of nucleic acid modifications (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, and the like, that occur during cell differentiation. Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent, or from maintaining the existing, fully undifferentiated state of a cell that is already a multipotent cell (e.g., a myogenic stem cell). Reprogramming is also distinct from promoting self-renewal or proliferation of a cell that is already pluripotent or multipotent, although the compositions and methods described herein may be used for such purposes in some examples.

[0264] Many methods are known in the art that can be used to generate pluripotent stem cells from somatic cells, and any such method for reprogramming somatic cells to a pluripotent phenotype would be suitable for use in the methods described herein.

[0265] Reprogramming methodologies have been described to generate pluripotent cells using defined combinations of transcription factors. Mouse somatic cells can be converted into ES cell-like cells with expanded developmental potential by direct transduction of Oct4, Sox2, Klf4, and c-Myc. See, e.g., Takahashi and Yamanaka, Cell 126(4):663-76 (2006). iPSCs resemble ES cells because they restore much of the pluripotency-associated transcriptional circuitry and epigenetic landscape. Moreover, mouse iPSCs fulfill all standard assays of pluripotency, specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [e.g., Maherali and Hochedlinger, Cell Stem Cell.3(6):595-605 (2008)], and tetraploid complementation.

[0266] Human iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, have been established as a core set of transcription factors governing pluripotency. See, for example, Budniatzky and Gepstein, Stem Cells Transl Med.3(4):448-57(2014); Barrett et al., Stem Cells Trans Med 3:1-6 sctm.2014-0121(2014); Focosi et al., Blood Cancer Journal 4:e211(2014), and references cited therein. The production of iPSCs can be achieved historically by using viral vectors to introduce nucleic acid sequences encoding stem cell-associated genes into adult somatic cells.

[0267] iPSCs can be generated or derived from terminally differentiated somatic cells, similar to adult or somatic stem cells. That is, non-pluripotent progenitor cells can be made pluripotent or multipotent by reprogramming. In such cases, it may not be necessary to include the number of reprogramming factors required to reprogram terminally differentiated cells. Furthermore, reprogramming can be induced by non-viral introduction of reprogramming factors, for example, by introduction of the protein itself, or by introduction of a nucleic acid that encodes the reprogramming factor, or by introduction of a messenger RNA that produces the reprogramming factor upon translation (e.g., Warren et al., Cell Stem Cell, 7(5):618-30(2010)). Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell-associated genes, including, for example, Oct-4 (also called Oct-3 / 4 or Pouf51), Sox1, Sox2, Sox3, Sox15, Sox18, NANOG, Klf1, Klf2, Klf4, Klf5, NR5A2, c-Myc, 1-Myc, n-Myc, Rem2, Tert, and LIN28. Reprogramming using the methods and compositions described herein may further include introducing one or more of Oct-3 / 4, a member of the Sox family, a member of the Klf family, and a member of the Myc family into somatic cells. The methods and compositions described herein may further include introducing one or more of each of Oct-4, Sox2, Nanog, c-MYC, and Klf4 for reprogramming. As mentioned above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein. However, when cells differentiated from the reprogrammed cells are used, for example, in human therapy, in one aspect, the reprogramming is not affected by the method of modifying the genome, and thus, in such instances, reprogramming can be achieved without the use of, for example, viral or plasmid vectors.

[0268] The efficiency of reprogramming (i.e., the number of reprogrammed cells) derived from a population of starting cells can be enhanced by the addition of various agents, e.g., small molecules, as shown in Shi et al., Cell-Stem Cell 2:525-528 (2008), Huangfu et al., Nature Biotechnology 26(7):795-797 (2008), and Marson et al., Cell-Stem Cell 3:132-135 (2008). Thus, agents or combinations of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used to generate patient-specific or disease-specific iPSCs. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned medium, BIX-01294 (G9a histone methyltransferase), PD0325901 (MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.

[0269] Other non-limiting examples of reprogramming promoters include suberoylanilide hydroxamic acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, depudecin (e.g., (-)-depudecin), HC toxin, nullscript (4-(1,3-dioxo-1H,3H-benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), phenylbutyric acid (e.g., sodium phenylbutyrate), and valproic acid ((VP A) and other short chain fatty acids), Scriptaid, suramin sodium, trichostatin A (TSA), APHA compound 8, apicidin, sodium butyrate, pivaloyloxymethylbutyrate (Pivanex, AN-9), trapoxin B, chlamydocin, depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetylglutamic acid), and MS-27 -275), MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnamic acid bishydroxamic acid), JNJ16241199, tubacin, A-161906, proxamide, oxamflatin, 3-Cl-UCHA (e.g., 6-(3-chlorophenylureido)caproic acid hydroxamic acid), AOE (2-amino-8-oxo-9,10-epoxydecanoic acid), CHAP31 and CHAP50. Other reprogramming promoters include, for example, dominant negative forms (e.g., catalytically inactive forms) of HDACs, siRNA inhibitors of HDACs, and antibodies that specifically bind to HDACs. Such inhibitors are available, for example, from BIOMOL International, Fukasawa Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.

[0270] To confirm induction of pluripotent stem cells for use in the methods described herein, isolated clones can be tested for expression of stem cell markers. Such expression in cells derived from somatic cells identifies the cells as induced pluripotent stem cells. Stem cell markers can be selected from a non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl. In some cases, cells expressing, for example, Oct4 or Nanog are identified as pluripotent. Methods for detecting the expression of such markers can include, for example, RT-PCR and immunological methods to detect the presence of encoded polypeptides, such as Western blot or flow cytometry analysis. Detection can include not only RT-PCR but also detection of protein markers. Intracellular markers can best be identified by protein detection methods such as RT-PCR, or immunocytochemistry, whereas cell surface markers are readily identified by, for example, immunocytochemistry.

[0271] The pluripotent stem cell properties of the isolated cells can be confirmed by tests that evaluate the ability of the iPSCs to differentiate into cells of each of the three germ layers. As an example, teratoma formation in nude mice can be used to evaluate the pluripotency of the isolated clones. The cells can be introduced into nude mice and histology and / or immunohistochemistry can be performed on tumors arising from the cells. For example, growth of a tumor containing cells from all three germ layers further indicates that the cells are pluripotent stem cells.

[0272] liver cells In some embodiments, the genetically engineered human cells described herein are hepatocytes. Hepatocytes are the major parenchymal cells of the liver. Hepatocytes account for 70-85% of the liver's mass. These cells are involved in protein synthesis, protein storage, carbohydrate conversion, cholesterol, bile salt, and phospholipid synthesis, detoxification, modification, and excretion of exogenous and endogenous substances, and initiation of bile formation and secretion.

[0273] Generation of patient-specific iPSCs A step of the ex vivo method of the present disclosure may include generating one patient-specific iPS cell, multiple patient-specific iPS cells, or patient-specific iPS cell line. As described in Takahashi and Yamanaka 2006, Takahashi, Tanabe et al. 2007, there are many established methods in the art for generating patient-specific iPS cells. For example, the generating step may include a) isolating somatic cells, such as skin cells or fibroblasts, from a patient, and b) introducing a set of pluripotency-associated genes into the somatic cells to induce the cells into pluripotent stem cells. The set of pluripotency-associated genes may be one or more genes selected from the group consisting of OCT4, SOX1, SOX2, SOX3, SOX15, SOX18, NANOG, KLF1, KLF2, KLF4, KLF5, c-MYC, n-MYC, REM2, TERT, and LIN28.

[0274] Performing a biopsy or aspiration of the patient's liver or bone marrow A biopsy or aspiration is a sample of tissue or fluid taken from the body. There are many different types of biopsy or aspiration. Almost all of them involve the use of a sharp tool to remove a small amount of tissue. If the biopsy is on the skin or other sensitive area, a numbing agent may be applied first. The biopsy or aspiration may be performed according to any of the methods known in the art. For example, in a biopsy, a needle is inserted through the skin of the abdomen into the liver to capture liver tissue. For example, in a bone marrow aspiration, a large needle is used to enter the pelvic bone and collect bone marrow.

[0275] Isolation of liver-specific progenitor cells or primary hepatocytes Liver-specific progenitor cells and primary hepatocytes can be isolated according to any method known in the art. For example, human hepatocytes are isolated from fresh surgical specimens. Healthy liver tissue is used to isolate hepatocytes by collagenase digestion. The resulting cell suspension is filtered through a 100 mm nylon mesh, sedimented by centrifugation at 50 g for 5 min, resuspended, and washed 2-3 times with cold washing solution. Human hepatic stem cells are obtained by culturing under stringent conditions hepatocytes obtained from fresh liver specimens. Hepatocytes seeded on collagen-coated plates are cultured for 2 weeks. After 2 weeks, surviving cells are removed and characterized for the expression of stem cell markers (Herrera et al., STEM CELLS 2006;24:2840-2850).

[0276] Isolation of mesenchymal stem cells Mesenchymal stem cells can be isolated from patient's bone marrow or peripheral blood, etc., according to any method known in the art. For example, bone marrow aspirate can be collected in a syringe containing heparin. Cells can be washed and centrifuged with Percoll. Cells can be cultured in Dulbecco's Modified Eagle Medium (DMEM) (low glucose) containing 10% fetal bovine serum (FBS) (Pittinger MF, Mackay AM, Beck SC et al., Science 1999;284:143-147).

[0277] Genetically modified cells The term "genetically modified cell" refers to a cell that contains at least one genetic modification introduced by genome editing (e.g., using CRISPR / Cas9 or CRISPR / Cpf1 systems). In some ex vivo examples herein, the genetically modified cell may be a genetically modified progenitor cell. In some in vivo examples herein, the genetically modified cell may be a genetically modified hepatocyte. Genetically modified cells that contain an exogenous genome-targeting nucleic acid and / or an exogenous nucleic acid encoding a genome-targeting nucleic acid are contemplated herein.

[0278] The term "control treated population" describes a population of cells that has been treated with the same medium, viral induction, nucleic acid sequence, temperature, culture density, flask size, pH, etc., except for the addition of genome editing components. Any method known in the art can be used to measure transcription of ANGPTL3 gene or protein expression or activity (e.g., Western blot analysis of ANGPTL3 protein) or to quantitate ANGPTL3 mRNA.

[0279] The term "isolated cell" refers to a cell that has been removed from the organism in which it was originally found, or the progeny of such a cell. Optionally, the cell can be cultured in vitro, for example, under defined conditions or in the presence of other cells. Optionally, the cell can be later introduced into a second organism or reintroduced into the organism from which it (or the cell from which it was derived) was isolated.

[0280] The term "isolated population" with respect to an isolated cell population refers to a cell population that is removed and separated from a mixed or heterogeneous cell population.In some cases, the isolated population can be a substantially pure cell population compared to the heterogeneous population from which the cells are isolated or enriched.In some cases, the isolated population can be an isolated population of human progenitor cells, e.g., a substantially pure population of human progenitor cells, compared to the heterogeneous population of cells that includes human progenitor cells and the cells from which the human progenitor cells are derived.

[0281] The term "substantially enhanced" with respect to a particular cell population refers to a cell population in which the occurrence of a particular cell type is increased by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 400-fold, at least 1000-fold, at least 5000-fold, at least 20,000-fold, at least 100,000-fold or more over existing or reference levels, depending on the desired level of such cells, for example, to ameliorate dyslipidemia.

[0282] The term "substantially enriched" with respect to a particular cell population refers to a population of cells that is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70% or more with respect to the cells that make up the total cell population.

[0283] The term "substantially enriched" or "substantially pure" with respect to a particular cell population refers to a population of cells that is at least about 75%, at least about 85%, at least about 90%, or at least about 95% pure with respect to the cells that make up the total cell population. That is, the term "substantially pure" or "essentially purified" with respect to a population of progenitor cells refers to a population of cells that contains about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less than 1% of cells that are not progenitor cells as that term is defined herein.

[0284] Differentiation of genome-edited iPSCs into other cell types Another step of the ex vivo method of the present disclosure may include differentiating the genome-edited iPSCs into hepatocytes. The differentiation step can be carried out according to any method known in the art. For example, hiPSCs are differentiated into definitive endoderm using various treatments including activin and B27 supplement (Life Technology). The definitive endoderm is further differentiated into hepatocytes, and the treatments include FGF4, HGF, BMP2, BMP4, Oncostatin M, Dexametason, etc. (Duan et al, STEM CELLS; 2010; 28: 674-686, Ma et al, STEM CELLS TRANSLATIONAL MEDICINE 2013; 2: 409-419).

[0285] Differentiation of genome-edited mesenchymal stem cells into hepatocytes Another step of the ex vivo method of the present disclosure may include differentiating the genome-edited mesenchymal stem cells into hepatocytes. The differentiation step can be carried out according to any method known in the art. For example, hMSCs are treated with various factors and hormones, including insulin, transferrin, FGF4, HGF, and bile acid (Sawitza I et al, Sci Rep. 2015; 5: 13320).

[0286] Transplantation of cells into patients Another step of the ex vivo method of the present disclosure may include transplanting the hepatocytes into the patient. This transplantation step may be accomplished using any transplantation method known in the art. For example, the genetically modified cells may be directly injected into the patient's blood or may be otherwise administered to the patient.

[0287] Another step of the ex vivo method of the present disclosure includes transplanting the progenitor cells or primary hepatocytes into the patient. This transplantation step can be accomplished using any transplantation method known in the art. For example, the genetically modified cells can be directly injected into the patient's liver or can be administered to the patient in other ways.

[0288] III. Formulation and Delivery Pharmaceutically acceptable carriers The ex vivo methods of administering progenitor cells to a subject contemplated herein involve the use of a therapeutic composition comprising the progenitor cells.

[0289] The therapeutic composition can include a physiologically acceptable carrier along with the cell composition, and optionally at least one additional bioactive agent as described herein dissolved or dispersed therein as an active ingredient. In some cases, the therapeutic composition is not substantially immunogenic when administered to a mammalian or human patient for therapeutic purposes, unless desired.

[0290] In general, the progenitor cells described herein may be administered as a suspension containing a pharma- ceutically acceptable carrier. Those skilled in the art will recognize that the pharma-ceutically acceptable carrier used in the cell composition does not contain an amount of buffers, compounds, cryopreservatives, preservatives, or other agents that substantially interfere with the viability of the cells delivered to the subject. The cell-containing formulation may, for example, contain an osmotic buffer that allows the integrity of the cell membrane to be maintained, and optionally, nutrients that maintain cell viability or enhance engraftment upon administration. Such formulations and suspensions are known to those skilled in the art and / or can be adapted for use with progenitor cells as described herein using routine experimentation.

[0291] The cell composition can also be presented as an emulsion or liposomal composition, so long as the emulsification procedure does not adversely affect the viability of the cells. The cells and any other active ingredients can be mixed with excipients that are pharma- ceutically acceptable and compatible with the active ingredients, in amounts suitable for use in the therapeutic methods described herein.

[0292] The additional agent included in the cell composition can include pharma- ceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include acid addition salts (formed with free amino groups of the polypeptide) formed with inorganic acids such as, for example, hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups can also be derived from inorganic bases such as, for example, sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

[0293] Physiologically acceptable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no material in addition to active ingredient and water, or buffers such as sodium phosphate at physiological pH, physiological saline, or phosphate buffered saline. Still further, aqueous carriers can contain multiple buffer salts, as well as salts such as sodium and potassium chloride, dextrose, polyethylene glycol, and other solutes. Liquid compositions can also contain liquid phases in addition to water and in addition to the exclusion of water. Examples of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound used in the cell composition that is effective in treating a particular disorder or condition can depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.

[0294] Guide RNA formulations The guide RNA of the present disclosure can be formulated with pharma- ceutically acceptable excipients, such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending on the particular mode of administration and dosage form. The guide RNA composition can be formulated to achieve a physiologically compatible pH, which may range from about pH 3 to about pH 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In some cases, the pH can be adjusted to a range of about pH 5.0 to about pH 8. In some cases, the composition can include a therapeutically effective amount of at least one compound described herein, together with one or more pharma- ceutically acceptable excipients. Optionally, the composition can include a combination of compounds described herein, or can include a second active ingredient useful for the treatment or prevention of bacterial growth (e.g., but not limited to, an antibacterial or antimicrobial agent), or can include a combination of reagents of the present disclosure.

[0295] Suitable excipients include carrier molecules, including large, slowly metabolized macromolecules, such as, for example, proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients can include antioxidants (such as, but not limited to, ascorbic acid), chelating agents (such as, but not limited to, EDTA), carbohydrates (such as, but not limited to, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (such as, but not limited to, oils, water, saline, glycerol, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[0296] delivery The guide RNA polynucleotide (RNA or DNA) and / or endonuclease polynucleotide(s) (RNA or DNA) may be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, the endonuclease polypeptide(s) may be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In further alternative embodiments, the DNA endonuclease may be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or with one or more crRNAs and tracrRNAs.

[0297] Polynucleotide can be delivered by non-viral delivery vehicles, including but not limited to nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small RNA conjugates, aptamer-RNA chimeras, RNA fusion protein complexes.Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18:1127-1133 (2011) (focusing on the non-viral delivery vehicles of siRNA, which are also useful for the delivery of other polynucleotides).

[0298] For polynucleotides of the present disclosure, formulations can be selected from, for example, any of those taught in International Patent Application No. PCT / US2012 / 069610.

[0299] Polynucleotides such as guide RNAs, sgRNAs, and mRNAs encoding endonucleases can be delivered to cells or patients by lipid nanoparticles (LNPs).

[0300] LNP refers to any particle having a diameter less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, nanoparticles may range in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.

[0301] LNPs can be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, may be included in LNPs as "helper lipids" to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include reduced efficacy due to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses.

[0302] LNPs may also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[0303] Any lipid or combination of lipids known in the art can be used to produce LNPs. Examples of lipids used to produce LNPs are DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are PEG-DMG, PEG-CerC14, and PEG-CerC20.

[0304] Lipids can be combined in any molar ratio to produce LNPs. Additionally, polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce LNPs.

[0305] As mentioned above, each of the site-specific polypeptide and genome targeting nucleic acid can be administered separately to cells or patients. Meanwhile, the site-specific polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNAs together with tracrRNA. The pre-complexed material can then be administered to cells or patients. Such pre-complexed material is known as ribonucleoprotein particle (RNP).

[0306] RNA can form specific interactions with RNA or DNA. This property is exploited in many biological processes, but it also carries the risk of promiscuous interactions in the nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which the RNA is precomplexed with endonucleases. Another advantage of RNPs is the protection of the RNA from degradation.

[0307] The endonuclease of RNP can be modified or unmodified.Similarly, gRNA, crRNA, tracrRNA, or sgRNA can be modified or unmodified.Many modifications are known in the art and can be used.

[0308] The endonuclease and sgRNA can be combined in a molar ratio of typically 1:1. Alternatively, the endonuclease, crRNA and tracrRNA can be combined in a molar ratio of typically 1:1:1. However, a wide range of molar ratios can be used to produce RNPs.

[0309] AAV (adeno-associated virus) Recombinant adeno-associated virus (AAV) vectors can be used for delivery. The techniques of producing rAAV particles, in which the AAV genome to be packaged, containing the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to the cell, are standard in the art. The production of rAAV requires the presence of the following components in a single cell (referred to herein as packaging cell): rAAV genome, AAV rep and cap genes separated from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep and cap genes can be from any AAV serotype from which recombinant virus can be derived, and can also be from an AAV serotype different from the rAAV genome ITR, including but not limited to the AAV serotypes described herein. The production of pseudotyped rAAV is disclosed, for example, in International Patent Application Publication No. WO01 / 83692.

[0310] AAV serotype AAV particles packaging polynucleotides encoding compositions of the present disclosure, such as endonucleases, donor sequences, or RNA guide molecules of the present disclosure, may comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, AAV particles may utilize or be based on a serotype selected from any of the following serotypes, and variants thereof: AAV1, AAV10, AAV106.1 / Hu.37, AAV11, AAV114.3 / Hu.40, AAV12, AAV127.2 / Hu.41, AAV127.5 / Hu.42, AAV128.1 / Hu.43, AAV128.3 / Hu.44, AAV130.4 / Hu.48, AAV145.1 / Hu.53, AAV145.5 / Hu. 54, AAV145.6 / Hu.55, AAV16.12 / Hu.11, AAV16.3, AAV16.8 / Hu.10, AAV161.10 / Hu.60, AAV161.6 / Hu.61, AAV1-7 / RH.48, AAV1-8 / RH.49 , AAV2, AAV2.5T, AAV2-15 / RH.62, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2-3 / RH.61, AAV24.1, AAV2-4 / RH .50, AAV2-5 / RH.51, AAV27.3, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV2G9, AAV-2-pRE-miRNA-101, AAV3, AAV3.1 / Hu.6, AAV3.1 / Hu.9, AAV3 -11 / RH.53, AAV3-3, AAV33.12 / Hu.17, AAV33.4 / Hu.15, AAV33.8 / Hu.16, AAV3-9 / RH.52, AAV3A, AAV3b, AAV4, AAV4-19 / RH.55, AAV42.12 , AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-1b, AAV42-2, AAV42-3A, AAV42-3b, AAV42-4, AAV42-5A, AAV42-5b, AAV4 2-6b, AAV42-8, AAV42-AA, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5、AAV46.2 / Hu.28、AAV46.6 / Hu.29、AAV4-8 / R11.64、AAV4-8 / RH.64、AAV4-9 / RH.54、AAV5、AAV52.1 / Hu.20、AAV52 / Hu.19、AAV5-22 / RH.58、AAV5-3 / RH.57、AAV54.1 / Hu.21、AAV54.2 / Hu.22、AAV54.4R / Hu.27、AAV54.5 / Hu.23、AAV54.7 / Hu.24、AAV58.2 / Hu.25、AAV6、AAV6.1、AAV6.1.2、AAV6.2、AAV7、AA V7.2、AAV7.3 / Hu.7、AAV8、AAV-8b、AAV-8H、AAV9、AAV9.11、AAV9.13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAV 3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAV-b、AAVC1、AAVC2、AAVC5、AAVCH.5、AAVCH.5R1、AAVCy.2、AAVCy.3、AAVCy.4、AAVCy.5、AAVCy.5R1、AAVCy.5R2、AAVCy. Cy.5R3、AAVCy.5R4、AAVCy.6、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAV-H、AAVH-1 / Hu.1、AAVH2、AAVH-5 / Hu.3、AAVH6、AAVHE1.1、AAVHER1.14、AAVHER1.16 、AAVHER1.18、AAVHER1.23、AAVHER1.35、AAVHER1.36、AAVHER1.5、AAVHER1.7、AAVHER1.8、AAVHER2.16、AAVHER2.29、AAVHER2.30、AAVHER2.31、AAVHER 2.36、AAVHER2.4、AAVHER3.1、AAVHu.1、AAVHu.10、AAVHu.11、AAVHu.11、AAVHu.12、AAVHu.13、AAVHu.14 / 9、AAVHu.15、AAVHu.16、AAVHu.17、AAVHu.18 、AAVHu.19、AAVHu.2、AAVHu.20、AAVHu.21、AAVHu.22、AAVHu.23.2、AAVHu.24、AAVHu.25、AAVHu.27、AAVHu.28、AAVHu.29、AAVHu.29R、AAVHu.3、AAVHu.31、AAVHu.32、AAVHu.34、AAVHu.35、AAVHu.37、AAVHu.39、AAVHu.4、AAVHu.40、AAVHu.41、AAVHu.42、AAVHu.43、AAVHu.44、AAVHu.44R1、AAVHu.44R2、AAVHu.44R3、AAVHu.45、AAVHu.46、AAVHu.47、AAVHu.48、AAVHu.48R1、AAVHu.48R2、AAVHu.48R3、AAVHu.49、AAVHu.5、AAVHu.51、AAVHu.52、AAVHu.53、AAVHu.54、AAVHu.55、AAVHu.56、AAVHu.57、AAVHu.58、AAVHu.6、AAVHu.60、AAVHu.61、AAVHu.63、AAVHu.64、AAVHu.66、AAVHu.67、AAVHu.7、AAVHu.8、AAVHu.9、AAVHu.t 19、AAVLG-10 / RH.40、AAVLG-4 / RH.38、AAVLG-9 / Hu.39、AAVLG-9 / Hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK03、AAV-LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、AAVN721-8 / RH.43、AAV-PAEC、AAV-PAEC11、AAV-PAEC12、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAVpi.1、AAVpi.2、AAVpi.3、AAVRH.10、AAVRH.12、AAVRH.13、AAVRH.13R、AAVRH.14、AAVRH.17、AAVRH.18、AAVRH.19、AAVRH.2、AAVRH.20、AAVRH.21、AAVRH.22、AAVRH.23、AAVRH.24、AAVRH.25、AAVRH.2R、AAVRH.31、AAVRH.32、AAVRH.33、AAVRH.34、AAVRH.35、AAVRH.36、AAVRH.37、AAVRH.37R2、AAVRH.38、AAVRH.39、AAVRH.40、AAVRH.43、AAVRH.44, AAVRH.45, AAVRH.46, AAVRH.47, AAVRH.48, AAVRH.48, AAVRH.48.1, AAVRH.48.1.2, AAVRH.48.2, AAV RH.49, AAVRH.50, AAVRH.51, AAVRH.52, AAVRH.53, AAVRH.54, AAVRH.55, AAVRH.56, AAVRH.57, AAVRH.58 , AAVRH.59, AAVRH.60, AAVRH.61, AAVRH.62, AAVRH.64, AAVRH.64R1, AAVRH.64R2, AAVRH.65, AAVRH.67, AAVRH.68, AAVRH.69, AAVRH.70, AAVRH.72, AAVRH.73, AAVRH.74, AAVRH.8, AAVRH.8R, AAVRH8R, AAVRH8R Examples of AAVs that may be used include, but are not limited to, A586R mutant, AAVRH8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, caprine AAV, Japanese AAV 10, true type AAV (ttAAV), UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0311] In some embodiments, the AAV serotype can be or have a mutation of the AAV9 sequence described by N Pulicherla et al. (Molecular Therapy 19(6):1070-1078(2011)), such as, but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[0312] In some embodiments, the AAV serotype may be or may have a sequence as described in US6156303, such as, but not limited to, AAV3B (SEQ ID NOs: 1 and 10 of US6156303), AAV6 (SEQ ID NOs: 2, 7, and 11 of US6156303), AAV2 (SEQ ID NOs: 3 and 8 of US6156303), AAV3A (SEQ ID NOs: 4 and 9 of US6156303), or a derivative thereof.

[0313] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12):5887-5911 (2008). The amino acid sequence of AAVDJ8 may contain two or more mutations to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence set forth as SEQ ID NO:1 in U.S. Pat. No. 7,588,772 contains two mutations: (1) R587Q (arginine (R, Arg) at amino acid 587 is changed to glutamine (Q, Gln)) and (2) R587Q (arginine (R, Arg) at amino acid 587 is changed to glutamine (Q, Gln)). and (2) R590T (arginine (R, Arg) at amino acid 590 is changed to threonine (T, Thr)). Another non-limiting example may include three mutations: (1) K406R (lysine (K, Lys) at amino acid 406 is changed to arginine (R, Arg)), (2) R587Q (arginine (R, Arg) at amino acid 587 is changed to glutamine (Q, Gln)), and (3) R590T (arginine (R, Arg) at amino acid 590 is changed to threonine (T, Thr)).

[0314] In some embodiments, the AAV serotype may be or have a sequence as described in International Patent Publication WO2015 / 121501, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015 / 121501), "UPenn AAV10" (SEQ ID NO: 8 of WO2015 / 121501), "Japanese AAV10" (SEQ ID NO: 9 of WO2015 / 121501), or a variant thereof.

[0315] According to the present disclosure, the selection or use of AAV capsid serotypes can be derived from various species. In one example, the AAV can be avian AAV (AAAV). The AAAV serotypes can be or have sequences as described in US Pat. No. 9,238,800, such as, but not limited to, AAAV (SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14 of US Pat. No. 9,238,800), or variants thereof.

[0316] In one example, the AAV can be bovine AAV (BAAV). The BAAV serotype can be or have a sequence as described in U.S. Patent No. 9,193,769, such as, but not limited to, BAAV (SEQ ID NOs: 1 and 6 of U.S. Patent No. 9,193,769), or a variant thereof. The BAAV serotype can be or have a sequence as described in U.S. Patent No. 7,427,396, such as, but not limited to, BAAV (SEQ ID NOs: 5 and 6 of U.S. Patent No. 7,427,396), or a variant thereof.

[0317] In one example, the AAV can be a caprine AAV. Caprine AAV serotypes can be or have a sequence as described in U.S. Patent No. 7,427,396, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Patent No. 7,427,396), or a variant thereof.

[0318] In other examples, the AAV may be engineered as a hybrid AAV from two or more parent serotypes. In one example, the AAV may be AAV2G9, which contains sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be or have sequences as described in U.S. Patent Publication No. US2016 / 0017005.

[0319] In one example, the AAV can be a serotype generated by an AAV9 capsid library with mutations at amino acids 390-627 (VP1 numbering) as described in Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011). Serotypes and corresponding nucleotide amino acids and amino acid substitutions include, but are not limited to, AAV9.1 (G1594C, D532H), AAV6.2 (T1418A and T1436X, V473D and I479K), AAV9.3 (T1238A, F413Y), AAV9.4 (T1250C and A1617T), AAV9.5 (T1250C and A1617T), AAV9.6 (T1250C and A1617T), AAV9.7 (T1250C and A1617T), AAV9.8 (T1250C and A1617T), AAV9.9 (T1250C and A1617T), AAV9.10 (T1250C and A1617T), AAV9.11 (T1250C and A1617T), AAV9.12 (T1250C and A1617T), AAV9.13 (T1250C and A1617T), AAV9.14 (T1450C and A1617T), AAV9.15 (T1450C and A1617T), AAV9.16 (T1450C and A1617T), AAV9.17 (T1450C and A1617T), AAV9.18 (T1450C and A1617T), AAV9.19 (T1450C and A1617T), AAV9.16 , F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A, F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362 C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A 1667C;D556A), AAV9.34(A1534G, C1794T;N512D), AAV9.35(A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AA V9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y , L602F), AAV9.46(G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.4 7(G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G13 01A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54(C1531A, T1609A; L511I, L537M ), AAV9.55(T1605A;F535L), AAV9.58(C1475T, C1579A;T492I, H527N), AAV.59(T1336C;Y446H), AAV 9.61(A1493T;N498I), AAV9.64(C1531A, A1617T;L511I), AAV9.65(C1335T, T1530C, C1568A;A523D) , AAV9.68(C1510A;P504T), AAV9.80(G1441A;G481R), AAV9.83(C1402A, A1500T;p468T, E500D), AAV 9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C ;L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T;S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T;M559L), and AAV9.95 (T1605A;F535L).

[0320] In one example, the AAV can be a serotype that includes at least one AAV capsid CD8+ T cell epitope. As a non-limiting example, the serotype can be AAV1, AAV2, or AAV8.

[0321] In one example, the AAV can be a variant such as PHP.A or PHP.B as described in Deverman. 2016. Nature Biotechnology. 34(2):204-209.

[0322] In one example, the AAV can be a serotype selected from any of those found in SEQ ID NOs: 4,734-5,302 and Table 2.

[0323] In one example, the AAV can be encoded by a sequence, fragment, or variant as set forth in SEQ ID NOs: 4,734-5,302.

[0324] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches include Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984), Tratschin et al., Mo 1. Cell. Biol. al., J.Virol.,62:1963(1988), and Lebkowski et al.,1988 Mol.Cell.Biol.,7:349(1988), Samulski et al. al. (1989, J. Virol., 63:3822-3828), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244-1250, Paul et al. al. (1993) Human Gene Therapy 4:609-615, Clark et al. (1996) Gene Therapy 3:1124-1132, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595.

[0325] The serotype of the AAV vector can be adapted to the target cell type. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes, among others: [Table 2]

[0326] In addition to adeno-associated virus vectors, other viral vectors can be used, including, but not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein-Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus.

[0327] In some embodiments, the Cas9 mRNA, the sgRNA targeting one or two loci of the ANGPTL3 gene, and the donor DNA can each be formulated separately into a lipid nanoparticle or all co-formulated into a single lipid nanoparticle.

[0328] In some embodiments, the Cas9 mRNA can be formulated in a lipid nanoparticle, and the sgRNA and donor DNA can be delivered in an AAV vector.

[0329] Options are available to deliver the Cas9 nuclease as a DNA plasmid, as an mRNA, or as a protein. The guide RNA can be expressed from the same DNA or can also be delivered as RNA. The RNA can be chemically modified to alter or improve its half-life or to reduce the likelihood or extent of an immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow for efficient delivery, and split versions of Cas9 and small orthologs of Cas9 can be packaged into AAVs, as can the donors for HDR. There is also a range of non-viral delivery methods that can deliver each of these components, or non-viral and viral methods can be used in combination. For example, nanoparticles can be used to deliver proteins and guide RNAs, while AAVs can be used to deliver donor DNA.

[0330] IV. Dosage and Administration The terms "administer", "introduce" and "implant" are used interchangeably in the context of placing cells, e.g., progenitor cells, into a subject by a method or route that results in at least partial localization of the introduced cells at a desired site, such as a site of injury or repair, so that a desired effect(s) is / are produced. Cells, e.g., progenitor cells, or their differentiated progeny, can be administered by any suitable route that results in delivery to a desired location in a subject where at least a portion of the transplanted cells or components of the cells survive. The survival period of the cells after administration to a subject can be as short as a few hours, e.g., 24 hours, days, as long as years, or even the lifespan of the patient. For example, in some embodiments described herein, an effective amount of hepatic progenitor cells is administered via a systemic administration route, such as an intraperitoneal or intravenous route.

[0331] The terms "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any subject for whom diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0332] When provided prophylactically, the progenitor cells described herein can be administered to a subject prior to any symptoms of dyslipidemia. Thus, prophylactic administration of the progenitor cell population is useful for preventing dyslipidemia.

[0333] The progenitor cell population administered according to the methods described herein can include allogeneic progenitor cells obtained from one or more donors. Such progenitor cells can be of any cell or tissue origin, such as liver, muscle, heart, etc. "Allogeneic" refers to a progenitor cell or biological sample that includes precursors obtained from one or more donors of the same species, where the genes at one or more loci are not identical. For example, the hepatic progenitor cell population administered to the subject can be derived from one or more unrelated donor subjects, or from one or more non-identical siblings. In some cases, a syngeneic progenitor cell population can be used, such as those obtained from genetically identical animals or identical twins. The progenitor cells can be autologous cells. That is, the progenitor cells are obtained or isolated from a subject and administered to the same subject. That is, the donor and the recipient are the same.

[0334] The term "effective amount" refers to the amount of a progenitor cell population or its progeny necessary to prevent or alleviate at least one or more signs or symptoms of dyslipidemia, and relates to an amount of a composition sufficient to provide a desired effect, e.g., to treat a subject with dyslipidemia. Thus, the term "therapeutically effective amount" refers to an amount of a progenitor cell or a composition comprising progenitor cells sufficient to promote a particular effect when administered to a typical subject suffering from or at risk of dyslipidemia. An effective amount also includes an amount sufficient to prevent or delay the onset of a disease symptom, alter the course of a disease symptom (e.g., but not limited to, slow the progression of a disease symptom), or reverse a disease symptom. It is understood that for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using routine experimentation.

[0335] For use in the various embodiments described herein, an effective amount of progenitor cells is at least 10 2 Progenitor cells, at least 5 x 10 2 Progenitor cells, at least 10 3 Progenitor cells, at least 5 × 10 3 Progenitor cells, at least 10 4 Progenitor cells, at least 5 × 10 4 Progenitor cells, at least 105 Progenitor cells, at least 2 × 10 5 Progenitor cells, at least 3 × 10 5 Progenitor cells, at least 4 × 10 5 Progenitor cells, at least 5 × 10 5 Progenitor cells, at least 6 × 10 5 Progenitor cells, at least 7 × 10 5 Progenitor cells, at least 8 × 10 5 Progenitor cells, at least 9 × 10 5 Progenitor cells, at least 1 × 10 6 Progenitor cells, at least 2 × 10 6 Progenitor cells, at least 3 × 10 6 Progenitor cells, at least 4 × 10 6 Progenitor cells, at least 5 × 10 6 Progenitor cells, at least 6 × 10 6 Progenitor cells, at least 7 × 10 6 Progenitor cells, at least 8 × 10 6 Progenitor cells, at least 9 × 10 6 The progenitor cells may be derived from one or more donors or may be derived from an autologous source. In some embodiments described herein, the progenitor cells may be expanded in culture prior to administration to a subject in need thereof.

[0336] A small and gradual reduction in the levels of ANGPTL3 expressed in cells of a patient with an ANGPTL3-associated disorder may be beneficial in improving one or more symptoms of the disease, increasing long-term survival, and / or reducing side effects associated with other treatments. When such cells are administered to a human patient, the presence of progenitor cells that reduce the levels of ANGPTL3 is beneficial. In some cases, effective treatment of a subject reduces ANGPTL3 levels by at least about 3%, 5%, or 7% compared to the total ANGPTL3 in the treated subject. In some examples, the reduction in ANGPTL3 is at least about 10% of total ANGPTL3. In some examples, the reduction in ANGPTL3 is at least about 20%-30% of total ANGPTL3. Similarly, the introduction of a relatively limited subpopulation of cells with significantly reduced levels of ANGPTL3 may be beneficial for various patients, as in some circumstances normalized cells have a selective advantage over diseased cells. However, even modest levels of progenitor cells with reduced levels of ANGPTL3 may be beneficial for improving one or more aspects of a patient's dyslipidemia. In some examples, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of hepatic progenitor cells in a patient to whom such cells are administered have reduced levels of ANGPTL3.

[0337] "Administered" refers to the delivery of the progenitor cell composition to a subject by a method or route that results in at least partial localization of the cell composition at a desired site. The cell composition can be administered by any suitable route that results in effective treatment in the subject, i.e., administration results in delivery to a desired location in the subject and at least a portion of the delivered composition, i.e., at least 1×10 4 The cells are delivered to the desired location for a period of time.

[0338] In one aspect of the method, the pharmaceutical composition is administered by any of a variety of routes, including, but not limited to, enteral (into the gut), gastrointestinal, epidural (into the dura), oral (via mouth), transdermal, peridural, intracerebral (into the brain), intraventricular (into the cerebroventricular), epicutaneous (application to the skin), intradermal, (to the skin itself), subcutaneous (under the skin), intranasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous injection (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (injection or injection into the abdominal cavity), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathological cavity), intracavitary ( at the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through mucous membranes), transvaginal, insufflation (nose), sublingual, sublabial, enema, eye drop (on the conjunctiva), ear drop, auricular (in or through the ear), buccal (towards the cheek), conjunctival, dermal, dental (one or more teeth), electroosmosis, intracervical, intraluminal, intratracheal, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, intra-amniotic, intra-articular, intrabiliary, intra-bronchial, intra-capsular, intrachondral (intracartilage), intra-caudal (in cauda equina), intra-cisternal (in the cisterna magna), intra-corneal (intra-corneal), dentalintracornal), intracoronary (inside the coronary arteries), intracavernosal (in the expandable spaces of the corpus cavernosum), intradiscal (inside the intervertebral disc), intraductal (inside the ducts of a gland), intraduodenal (inside the duodenum), intradural (in the dura or subdural), intraepidermal (into the epidermis), intraesophageal (into the esophagus), intragastric (inside the stomach), intragingival (inside the gums), intraileal (in the distal part of the small intestine), intralesional (into or introduced directly into a local lesion), intraluminal (in the lumen of a tube), intralymphatic (in the lymph), intramedullary (into the medullary cavity of a bone), intrameningeal (inside the meninges), intramyocardial (inside the heart muscle), intraocular (inside the eye), intraovarian (inside the ovaries), intrapericardial (inside the pericardium), intrapleural (inside the pleura), intraprostatic (inside the prostate), intrapulmonary (inside the lungs or their bronchi), intranasal (inside the nasal cavity or periorbital sinus), intraspinal (inside the spinal column), intrasynovial (inside the synovial cavity of a joint), intratendinous (inside tendons), intratesticular (inside the testicles), intrathecal (inside the cerebrospinal fluid at any level of the neuraxis), intrathoracic (inside the thorax), intraductal (inside the renal tubules of an organ), intratumoral (inside a tumor), intratympanic (inside the middle ear), intravascular (in one or more blood vessels), intraventricular (inside the heart), iontophoresis (by electric current where ions of a soluble salt are transferred to the tissues of the body), irrigation (to bathe or flush an open wound or body cavity), laryngeal (directly into the larynx), nasogastric (from the nose to the stomach), occlusive dressing (topical route of administration then covered with a dressing that occludes the area), ophthalmic (to the external eye), oropharyngeal (directly into the mouth and pharynx), parenteral, transdermal, periarticular, peridural, perineural, periodontal, rectal, respiratory (local or systemic) For effect, it may be administered via routes such as intratracheal), retrobulbar (behind the pons or behind the eyeball), intramyocardial (into the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (across or through the placenta), tracheal (through the tracheal wall), transtympanic (across the tympanic membrane or through the tympanic cavity), ureteral (into the ureter), urethral (into the urethra), vaginal, caudal block, diagnostic, nerve block, bile duct perfusion, cardiac perfusion, photopheresis, and spinal.

[0339] Methods of administration include injection, infusion, infusion, and / or ingestion. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, subarachnoid, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, intrasternal injection and infusion. In some embodiments, the route is intravenous. For delivery of cells, administration can be by injection or infusion.

[0340] The cells can be administered systemically. The phrases "systemic administration," "systemically administered," "peripheral administration," and "peripherally administered" refer to the administration of a progenitor cell population other than directly to a target site, tissue, or organ, where it instead enters the subject's circulatory system and is therefore subject to metabolic and other similar processes.

[0341] The efficacy of a treatment, including a composition for the treatment of dyslipidemia, can be determined by a skilled clinician. However, a treatment is considered to be an "effective treatment" if one or all signs or symptoms of the level of ANGPTL3 are modified in a beneficial manner (e.g., reduced by at least 10%), or other clinically recognized symptoms or markers of the disease are improved or ameliorated. Efficacy can also be measured by an individual not getting worse, as assessed by the need for hospitalization or medical intervention (e.g., the progression of the disease is stopped or at least slowed). Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of an individual or animal disease (some non-limiting examples include humans or mammals), including (1) inhibiting the disease, e.g., stopping or slowing the progression of the symptoms, or (2) alleviating the disease, e.g., causing regression of the symptoms, and (3) preventing or reducing the likelihood of the occurrence of the symptoms.

[0342] Treatment according to the disclosure can ameliorate one or more symptoms associated with dyslipidemia by reducing or altering the amount of ANGPTL3 in an individual.

[0343] V. Characteristics and properties of the angiopoietin-like 3 (ANGPTL3) gene ANGPTL3 is associated with diseases and disorders such as, but not limited to, arteriosclerosis, atherosclerosis, cardiovascular disease, coronary heart disease, diabetes, diabetes mellitus, non-insulin-dependent diabetes mellitus, fatty liver, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, hypobetalipoproteinemia, inflammation, insulin resistance, metabolic disease, obesity, oral malignant neoplasms, lipid metabolism disorders, lip and oral cancer, dyslipidemia, metabolic syndrome X, hypotriglyceridemia, Opitz trigonocephaly syndrome, ischemic stroke, hypertriglyceridemia, hypobetalipoproteinemia (familial 2), familial hypobetalipoproteinemia, and ischemic cerebrovascular disease. Editing the ANGPTL3 gene using any of the methods described herein can be used to treat, prevent, and / or alleviate symptoms of the diseases and disorders described herein.

[0344] The ANGPTL3 gene encodes the angiopoietin-like 3 protein, a determinant of high-density lipoprotein (HDL) levels in humans. It is positively correlated with plasma triglycerides and HDL cholesterol. ANGPTL3 activity is expressed primarily in the liver. ANGPTL3 is associated with dyslipidemia. Dyslipidemia is an inherited disorder characterized by elevated levels of lipids in the blood, which contribute to the development of arterial clots (atherosclerosis). These lipids include plasma cholesterol, triglycerides, or high-density lipoproteins. Dyslipidemia increases the risk of heart attack, stroke, or other circulatory concerns. Current management includes lifestyle changes, such as exercise and dietary modifications, and the use of lipid-lowering medications, such as statins. Nonstatin lipid-lowering medications include bile acid sequestrants, cholesterol absorption inhibitors, homozygous familial hypercholesterolemia medications, fibrates, nicotinic acid, omega-3 fatty acids, and / or combination products. Treatment options usually depend on the specific lipid abnormality, but different lipid abnormalities often coexist. Treatment in children is more challenging because dietary changes are difficult to implement and the efficacy of lipid-lowering therapy is unproven.

[0345] ANGPTL3 is also known to cause hypobetalipoproteinemia. Hypobetalipoproteinemia is a genetic disorder (autosomal recessive) that affects 1 in 1000 to 1 in 3000 people worldwide. Common symptoms of hypobetalipoproteinemia include plasma concentrations of LDL cholesterol or apolipoprotein B below the 5th percentile, which impairs the body's ability to absorb and transport fat and can lead to retinal degeneration, neuropathy, coagulation disorders, or abnormal fat accumulation in the liver, called fatty liver. In severely affected patients, fatty liver may progress to chronic liver disease (cirrhosis). Current treatment of hypobetalipoproteinemia includes severe restriction of long-chain fatty acids to 15 grams per day to improve fat absorption. In infants with hypobetalipoproteinemia, brief supplementation of medium-chain triglycerides can be effective, but amounts must be closely monitored to avoid liver toxicity. Another option to treat hypobetalipoproteinemia is to administer high doses of vitamin E to prevent neurological complications. Alternatively, if elevated prothrombin time suggests vitamin K depletion, supplementation with vitamin A (10,000 to 25,000 IU daily) may be effective.

[0346] In one example, the target tissue for the compositions and methods described herein is liver tissue.

[0347] In one example, the gene is angiopoietin-like 3 (ANGPTL3), which may also be referred to as angiopoietin 5, ANGPT5, ANG-5, angiopoietin-like protein 3, angiopoietin-5, FHBL2, and ANL3. The cytogenetic location of ANGPTL3 is 1p31.3, with genomic coordinates on chromosome 1 on the forward strand at positions 62,597,487-62,606,159. The nucleotide sequence of ANGPTL3 is set forth as SEQ ID NO: 5303. USP1 is the upstream gene of ANGPTL3 on the forward strand, and ATG4C is the downstream gene of ANGPTL3 on the forward strand. DOCK7 is the gene located on the opposite reverse strand to ANGPTL3. The NCBI Gene ID for ANGPTL3 is 27329, the Uniprot ID is Q9Y5C1, and the Ensembl Gene ID is ENSG00000132855. ANGPTL3 has 2 SNPs, 9 introns, and 12 exons. Exon identifiers from Ensembl and start / stop sites of introns and exons are shown in Table 3. [Table 3]

[0348] Table 4 provides information on all transcripts of the ANGPTL3 gene based on the Ensembl database. Table 4 provides the transcript ID from Ensembl, the NCBI RefSeq ID corresponding to that transcript, the translation ID from Ensembl, the NCBI RefSeq ID corresponding to the protein, the biotype of the transcript sequence as classified by Ensembl, and the exons and introns of the transcript based on the information in Table 3. [Table 4]

[0349] There are two SNPs in ANGPTL3, and the UniProt VAR numbers for this ANGPTL3 gene are VAR_049071 and VAR_067283.

[0350] In one embodiment, the guide RNA used in the present disclosure may include at least one 20 nucleotide (nt) target nucleic acid sequence listed in Table 5. Table 5 provides the gene symbol and sequence identifier (Gene SEQ ID NO), the gene sequence including 1-5 kilobase pairs upstream and / or downstream of the target gene (Extended Gene SEQ ID NO), and the 20 nt target nucleic acid sequence (20 nt Target Sequence SEQ ID NO). The sequence listing each target gene includes the strand that targets the gene (indicated in the sequence listing as (+) or (-) strand), the associated PAM type, and the PAM sequence for each of the 20 nt target nucleic acid sequences (SEQ ID NOs. 5305-17018). It is understood in the art that spacer sequences where "T" is "U" can be RNA sequences that correspond to the 20 nt sequences listed in Table 5. [Table 5]

[0351] In one example, a guide RNA used in the present disclosure may include at least one spacer sequence, which may be an RNA sequence corresponding to a 20 nucleotide (nt) target sequence, such as, but not limited to, any of SEQ ID NOs: 5305-17018, where "T" is "U".

[0352] In one example, the guide RNA used in the present disclosure may include at least one spacer sequence, which may be an RNA sequence corresponding to a 20 nt sequence, such as, but not limited to, any of SEQ ID NOs: 5305-17018, where "T" is "U".

[0353] In one example, the guide RNA may include a 20 nucleotide (nt) target nucleic acid sequence associated with a PAM type, such as, but not limited to, NAAAAC, NNAGAAW, NNGRRT, NNNNGHTT, NRG, or YTN. As a non-limiting example, the 20 nt target nucleic acid sequence for a particular target gene and a particular PAM type may be an RNA sequence that corresponds to any one of the 20 nt nucleic acid sequences in Table 6, where "T" is "U". [Table 6]

[0354] In one example, the guide RNA can include a 22 nucleotide (nt) target nucleic acid sequence associated with a YTN PAM type. As a non-limiting example, the 22 nt target nucleic acid sequence of a particular target gene can include a 20 nt core sequence, which can be an RNA sequence corresponding to SEQ ID NOs: 10172-17018 when "T" is "U". As another non-limiting example, the 22 nt target nucleic acid sequence of a particular target gene can include a core sequence, which can be a fragment, segment, or region of an RNA sequence corresponding to any of SEQ ID NOs: 10172-17018 when "T" is "U".

[0355] VI. Other Therapeutic Approaches Gene editing can be performed using nucleases engineered to target specific sequences. To date, there are four main types of nucleases: meganucleases and their derivatives, zinc finger nucleases (ZFNs), transcription activators like effector nucleases (TALENs), and the CRISPR-Cas9 nuclease system. Nuclease platforms differ in design difficulty, target density, and mode of action, especially since the specificity of ZFNs and TALENs is due to protein-DNA interactions, while RNA-DNA interactions mainly guide Cas9.

[0356] In the method of the present disclosure, CRISPR endonuclease such as Cas9 can be used.However, the teachings described herein such as therapeutic targeting site can be applied to other forms of endonuclease such as ZFN, TALEN, HE or MegaTAL, or a combination of nucleases can be used.However, in order to apply the teachings of the present disclosure to such endonuclease, it will be necessary to engineer proteins that are directed to specific targeting sites, among others.

[0357] Additional binding domains can be fused to the Cas9 protein to increase specificity. The target sites of these constructs map to identified gRNA-directed sites but require additional binding motifs such as zinc finger domains. In the case of Mega-TALs, meganucleases can be fused to the TALE DNA binding domain. The meganuclease domain increases specificity and provides cleavage. Similarly, inactivated or dead Cas9 (dCas9) can be fused to a cleavage domain, requiring adjacent binding sites for the sgRNA / Cas9 target site and the fused DNA binding domain. This would require some protein engineering of dCas9 in addition to catalytic inactivation to reduce binding without additional binding sites.

[0358] Zinc Finger Nucleases Zinc finger nucleases (ZFNs) are modular proteins composed of an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease FokI. Because FokI functions only as a dimer, a pair of ZFNs must be engineered to bind cognate target "half-site" sequences on opposing DNA strands with precise spacing to allow the formation of catalytically active FokI dimers. Dimerization of the FokI domain, which has no sequence specificity by itself, generates a DNA double-strand break between the ZFN half-sites as the initiating step of genome editing.

[0359] The DNA-binding domain of each ZFN is typically composed of three to six zinc fingers of abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides on one strand of the target DNA sequence, although interstrand interactions with a fourth nucleotide are also important. Modification of amino acids in the fingers at positions that make key contacts with DNA will modify the sequence specificity of a particular finger. Thus, a four-fingered zinc finger protein will selectively recognize a 12bp target sequence, and the target sequence is a complex of triplet preferences to which each finger contributes, although triplet preferences can be influenced to different degrees by adjacent fingers. An important aspect of ZFNs is that by simply modifying individual fingers, they can be easily retargeted to almost any genomic address, although doing this well requires considerable expertise. In most applications of ZFNs, proteins with four to six fingers are used, each recognizing 12 to 18bp. Thus, a pair of ZFNs will typically recognize a binding target sequence of 24-36 bp, not including the typical 5-7 bp spacer between the half-sites. The binding sites may be further separated by a larger spacer, including 15-17 bp. A target sequence of this length is likely unique in the human genome, assuming that repetitive sequences or gene homologs are excluded during the design process. Nevertheless, ZFN protein-DNA interactions are not absolute in specificity, and off-target binding and cleavage events can occur either as heterodimers between the two ZFNs, or as homodimers of one or the other of the ZFNs. The latter possibility was effectively eliminated by engineering the dimerization interface of the FokI domain to create "plus" and "minus" variants, also called obligate heterodimer variants, that can only dimerize with each other, not with themselves. Forcing the obligate heterodimer prevents the formation of homodimers. This greatly improved the specificity of ZFNs, as well as any other nucleases that employ these FokI variants.

[0360] A variety of ZFN-based systems have been described in the art, and their modifications are regularly reported, and many references describe the rules and parameters used to guide the design of ZFN.See, for example, Segal et al., Proc Natl Acad Sci USA 96(6):2758-63(1999); Dreier B et al., J Mol Biol.303(4):489-502(2000); Liu Q et al., J BiolChem.277(6):3850-6(2002); Dreier et al., J Biol Chem 280(42):35588-97(2005); and Dreier et al., J BiolChem.276(31):29466-78(2001).

[0361] Transcription activator-like effector nucleases (TALENs) TALENs represent another form of modular nuclease in which an engineered DNA-binding domain is coupled to a FokI nuclease domain, similar to ZFNs, and a pair of TALENs work together to achieve targeted DNA cleavage. The main difference with ZFNs is the nature of the DNA-binding domain and the associated target DNA sequence recognition properties. The TALEN DNA-binding domain is derived from the TALE protein originally described in the plant bacterial pathogen Xanthomonas species. TALEs consist of a tandem array of 33-35 amino acid repeats, each of which recognizes a single base pair in the target DNA sequence, typically up to 20 bp long, with a total target sequence length of up to 40 bp. The nucleotide specificity of each repeat is determined by a repeat variable dipair (RVD), which contains only two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine, and thymine are primarily recognized by four RVDs, Asn-Asn, Asn-Ile, His-Asp, and Asn-Gly, respectively. This constitutes a much simpler recognition code than zinc fingers and therefore represents an advantage over the latter in terms of nuclease design. Nevertheless, similar to ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs also benefit from the use of an obligate heterodimeric variant of the FokI domain to reduce off-target activity.

[0362] Additional variants of the FokI domain have been created, in which catalytic function is disabled. When either half of a TALEN or ZFN pair contains an inactive FokI domain, only single-stranded DNA breaks (nicking) occur at the target site, not DSBs. The results are comparable to the use of CRISPR / Cas9 or CRISPR / Cpf1 "nickase" mutants in which one of the Cas9 cleavage domains has been inactivated. DNA nicks can be used to drive genome editing by HDR, but less efficiently than DSBs. The main advantage is that off-target nicks are repaired rapidly and precisely, unlike DSBs, which are prone to mis-repair via NHEJ.

[0363] Various TALEN-based systems have been described in the art, and their modifications are regularly reported.See, for example, Boch, Science 326(5959):1509-12(2009); Mak et al., Science 335(6069):716-9(2012); and Moscou et al., Science 326(5959):1501(2009).The use of TALEN based on "Golden Gate" platform or cloning scheme has been described by several groups. See, e.g., Cermak et al., Nucleic Acids Res. 39(12):e82(2011); Li et al., Nucleic Acids Res. 39(14):6315-25(2011); Weber et al., PLoS One. 6(2):e16765(2011); Wang et al., J Genet Genomics 41(6):339-47, Epub 2014 May 17(2014); and Cermak T et al., Methods Mol Biol. 1239:133-59(2015).

[0364] Homing endonucleases Homing endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and cleave DNA with high specificity, often at unique sites in the genome. There are at least six known HE families, classified by structure including GIY-YIG, His-Cis box, HNH, PD-(D / E)xK, and Vsr-like, derived from a wide range of hosts (including eukaryotes, protists, bacteria, archaea, cyanobacteria, and phages). Similar to ZFNs and TALENs, HEs can be used to create DSBs at target loci as the first step in genome editing. In addition, some natural and engineered HEs cleave only a single strand of DNA, thereby functioning as site-specific nickases. The large target sequences of HEs and the specificity they offer make HEs attractive candidates to create site-specific DSBs.

[0365] Various HE-based systems have been described in the art, and modifications are regularly reported. See, for example, the reviews by Steentoft et al., Glycobiology 24(8):663-80 (2014), Belfort and Bonocora, Methods Mol Biol.1123:1-26 (2014), Hafez and Hausner, Genome 55(8):553-69 (2012), and the references cited therein.

[0366] MegaTAL / Tev-mTALEN / MegaTev As further examples of hybrid nucleases, the MegaTAL and Tev-mTALEN platforms use a fusion of a TALE DNA-binding domain and a catalytically active HE, taking advantage of both the tunable DNA binding and specificity of the TALE and the cleavage sequence specificity of the HE. See, for example, Boissel et al., NAR 42:2591-2601 (2014), Kleinstiver et al., G3 4:1155-65 (2014), and Boissel and Scharenberg, Methods Mol. Biol. 1239:171-96 (2015).

[0367] In a further variation, the MegaTev architecture is a fusion of Meganuclease (Mega) with a nuclease domain derived from GIY-YIG homing endonuclease I-TevI ​​(Tev). The two active sites are positioned approximately 30 bp apart on the DNA substrate, generating two DSBs with incompatible sticky ends. See, for example, Wolfs et al., NAR 42, 8816-29 (2014). It is expected that other combinations of existing nuclease-based approaches will evolve and help achieve the targeted genome modifications described herein.

[0368] dCas9-FokI or dCpf1-Fok1 and other nucleases Combining the structural and functional properties of the above nuclease platforms provides further approaches to genome editing that can potentially overcome some of the inherent deficiencies. As an example, CRISPR genome editing systems typically use a single Cas9 endonuclease to create DSBs. Targeting specificity is driven by a 20- or 24-nucleotide sequence of the guide RNA that undergoes Watson-Crick base pairing with the target DNA (plus, in the case of Cas9 from S. pyogenes, an additional two bases in the adjacent NAG or NGG PAM sequence). While such sequences are long enough to be unique in the human genome, the specificity of the RNA / DNA interaction is not absolute and considerable perturbations can be tolerated, especially in the 5′ half of the target sequence, effectively reducing the number of bases that drive specificity. One solution to this is to use Cas9 that retains only the RNA-guided DNA binding function or to completely inactivate the Cpf1 catalytic function and instead fuse the FokI domain to an inactivated Cas9. See, e.g., Tsai et al., Nature Biotech 32:569-76 (2014), and Guilinger et al., Nature Biotech. 32:577-82 (2014). Because FokI must dimerize to be catalytically active, two guide RNAs are required to bring two FokI fusions into close proximity to dimerize and cleave DNA. This essentially doubles the number of bases at the complexed target site, thereby increasing the stringency of targeting by CRISPR-based systems.

[0369] As a further example, fusion of a TALE DNA-binding domain to a catalytically active HE such as I-TevI ​​is expected to take advantage of both the tunable DNA binding and specificity of the TALE and the cleavage sequence specificity of I-TevI, which may further reduce off-target cleavage.

[0370] VII. Kit The present disclosure provides a kit for carrying out the methods described herein.The kit may include one or more of genome targeting nucleic acid, the polynucleotide encoding genome targeting nucleic acid, the site-directed polypeptide, the polynucleotide encoding site-directed polypeptide, and / or any nucleic acid or protein molecule required to carry out the aspects of the methods described herein, or any combination thereof.

[0371] The kit can include (1) a vector comprising a nucleotide sequence encoding a genome-targeting nucleic acid, (2) a site-directed polypeptide or a vector comprising a nucleotide sequence encoding a site-directed polypeptide, and (3) reagents for reconstituting and / or diluting the vector(s) or polypeptide.

[0372] The kit can include (1) a vector comprising (i) a nucleotide sequence encoding a genome-targeting nucleic acid, and (ii) a nucleotide sequence encoding a site-directed polypeptide, and (2) reagents for reconstituting and / or diluting the vector.

[0373] In any of the above kits, the kit can include a single molecule guide genome targeting nucleic acid. In any of the above kits, the kit can include a dual molecule genome targeting nucleic acid. In any of the above kits, the kit can include two or more dual molecule guides or single molecule guides. The kit can include a vector encoding the nucleic acid targeting nucleic acid.

[0374] In any of the above kits, the kit can further include a polynucleotide to be inserted to effect the desired genetic modification.

[0375] The components of the kit may be in separate containers or may be combined in a single container.

[0376] Any of the above kits may further include one or more additional reagents, such as selected from buffers, buffers for introducing polypeptides or polynucleotides into cells, washing buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, adapters for sequencing, etc. The buffers may be stabilization buffers, reconstitution buffers, dilution buffers, etc. The kits may also include one or more components that can be used to facilitate or enhance on-target binding or DNA cleavage by the endonuclease, or to improve targeting specificity.

[0377] In addition to the above-mentioned components, the kit can further include instructions for carrying out the method using the components of the kit. The instructions for carrying out the method can be recorded on a suitable recording medium. For example, the instructions can be printed on a substrate such as paper or plastic. The instructions can be present as a package insert, on the container of the kit or on a label of its components, etc. (i.e., associated with the packaging or subpackaging). The instructions can be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In some cases, the actual instructions are not present in the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) can be provided. An example of this case is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0378] VIII. CERTAIN METHODS AND COMPOSITIONS Accordingly, the present disclosure relates, inter alia, to the following non-limiting methods according to the present disclosure: in a first method, method 1, the present disclosure provides a method of editing an angiopoietin-like 3 (ANGPTL3) gene in a cell by genome editing, the method comprising the step of introducing one or more deoxyribonucleic acid (DNA) endonucleases into a cell to introduce one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs) in or near the ANGPTL3 gene or an ANGPTL3 regulatory element that results in one or more permanent insertions, deletions, or mutations of at least one nucleotide in or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.

[0379] In another method, Method 2, the disclosure provides an ex vivo method for treating a patient having an ANGPTL3-associated condition or disorder, the method including isolating hepatocytes from the patient, editing within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene in the hepatocytes, and transplanting the genome-edited hepatocytes into the patient.

[0380] In another method, Method 3, the disclosure provides a method of Method 2, wherein the editing step includes introducing into the hepatocyte one or more deoxyribonucleic acid (DNA) endonucleases to create one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs) in or near the ANGPTL3 gene or an ANGPTL3 regulatory element that result in one or more permanent insertions, deletions, or mutations of at least one nucleotide in or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.

[0381] In another method, Method 4, the disclosure provides an ex vivo method for treating a patient having an ANGPTL3-associated condition or disorder, the method including generating patient-specific induced pluripotent stem cells (iPSCs), editing within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene in the iPSCs, differentiating the genome-edited iPSCs into hepatocytes, and transplanting the hepatocytes into the patient.

[0382] In another method, Method 5, the disclosure provides a method of Method 4, wherein the editing step includes introducing one or more deoxyribonucleic acid (DNA) endonucleases into the iPSCs to create one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs) within or near the ANGPTL3 gene or an ANGPTL3 regulatory element that result in one or more permanent insertions, deletions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.

[0383] In another method, Method 6, the disclosure provides an ex vivo method for treating a patient having an ANGPTL3-associated condition or disorder, the method including isolating mesenchymal stem cells from the patient, editing within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene in the mesenchymal stem cells, differentiating the genome-edited mesenchymal stem cells into hepatocytes, and transplanting the hepatocytes into the patient.

[0384] In another method, Method 7, the disclosure provides the method of Method 6, wherein the editing step includes introducing one or more deoxyribonucleic acid (DNA) endonucleases into the mesenchymal stem cells to create one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs) in or near the ANGPTL3 gene or an ANGPTL3 regulatory element that result in one or more permanent insertions, deletions, or mutations of at least one nucleotide in or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.

[0385] In another method, method 8, the disclosure provides an in vivo method for treating a patient having an ANGPTL3-associated disorder, the method comprising editing the ANGPTL3 gene in a cell of the patient.

[0386] In another method, method 9, the disclosure provides the method of method 8, wherein the editing step includes introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to create one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs) in or near the ANGPTL3 gene or an ANGPTL3 regulatory element that result in one or more permanent insertions, deletions, or mutations of at least one nucleotide in or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.

[0387] In another method, method 10, the disclosure provides any of methods 8 or 9, wherein the cell is a hepatocyte.

[0388] In another method, method 11, the disclosure provides the method of method 10, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are delivered to liver cells by local injection, systemic injection, or a combination thereof.

[0389] In another method, method 12, the disclosure provides a method of modifying a contiguous genomic sequence of an ANGPTL3 gene in a cell, the method including contacting the cell with one or more deoxyribonucleic acid (DNA) endonucleases to create one or more single-stranded breaks (SSBs) or double-stranded breaks (DSBs).

[0390] In another method, method 13, the disclosure provides the method of method 12, wherein the contiguous genomic sequence modifications occur in one or more exons of the ANGPTL3 gene.

[0391] In another method, Method 14, the disclosure provides any one of Methods 1-13, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are selected from any of those listed in SEQ ID NOs: 1-620 and variants having at least 70% homology to any of those listed in SEQ ID NOs: 1-620.

[0392] In another method, method 15, the disclosure provides the method of method 14, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more proteins or polypeptides.

[0393] In another method, method 16, the disclosure provides the method of method 14, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more polynucleotides encoding the one or more DNA endonucleases.

[0394] In another method, method 17, the disclosure provides the method of method 16, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more ribonucleic acid (RNA) encoding the one or more DNA endonucleases.

[0395] In another method, method 18, the disclosure provides the method of method 17, wherein the one or more ribonucleic acids (RNAs) are one or more chemically modified RNAs.

[0396] In another method, method 19, the disclosure provides the method of method 18, wherein one or more ribonucleic acids (RNAs) are chemically modified within a coding region.

[0397] In another method, method 20, the disclosure provides any one of methods 16-19, wherein the one or more polynucleotides or one or more ribonucleic acids (RNAs) are codon optimized.

[0398] In another method, method 21, the disclosure provides any one of methods 1-20, wherein the method further comprises introducing one or more gRNAs or one or more sgRNAs into the cell.

[0399] In another method, method 22, the disclosure provides the method of method 21, wherein the one or more gRNAs or one or more sgRNAs include a spacer sequence complementary to a segment of the coding sequence of the ANGPTL3 gene.

[0400] In another method, Method 23, the disclosure provides the method of Method 21, wherein the one or more gRNAs or one or more sgRNAs include a spacer sequence complementary to a sequence adjacent to the ANGPTL3 gene or other sequence encoding a regulatory element of the ANGPTL3 gene.

[0401] In another method, method 24, the disclosure provides any of methods 21-23, wherein one or more gRNAs or one or more sgRNAs are chemically modified.

[0402] In another method, Method 25, the disclosure provides any one of Methods 21-24, wherein the one or more gRNAs or one or more sgRNAs are pre-complexed with one or more deoxyribonucleic acid (DNA) endonucleases.

[0403] In another method, method 26, the disclosure provides the method of method 25, wherein pre-complexing involves covalent attachment of one or more gRNAs or one or more sgRNAs to one or more deoxyribonucleic acid (DNA) endonucleases.

[0404] In another method, method 27, the disclosure provides any one of methods 14-26, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are formulated in a liposome or lipid nanoparticle.

[0405] In another method, Method 28, the disclosure provides any one of Methods 21-27, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are formulated in a liposome or lipid nanoparticle that also contains one or more gRNAs or one or more sgRNAs.

[0406] In another method, method 29, the disclosure provides any one of methods 12 or 21-23, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are encoded in the AAV vector particle, and the AAV vector serotype is selected from those listed in SEQ ID NOs: 4,734-5,302 and Table 2.

[0407] In another method, Method 30, the disclosure provides any of Methods 21-23, wherein the one or more gRNAs or one or more sgRNAs are encoded in an AAV vector particle, and the AAV vector serotype is selected from those listed in SEQ ID NOs: 4,734-5,302 and Table 2.

[0408] In another method, Method 31, the disclosure provides any of Methods 21-23, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are encoded in an AAV vector particle that also encodes one or more gRNAs or one or more sgRNAs, and the AAV vector serotype is selected from those listed in SEQ ID NOs: 4,734-5,302 and Table 2.

[0409] The present disclosure also provides a composition, Composition 1, comprising a single molecule guide RNA that includes at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 5305-17018.

[0410] In another composition, Composition 2, the present disclosure provides the single molecule guide RNA of Composition 1, wherein the single molecule guide RNA further comprises a spacer extension region.

[0411] In another composition, Composition 3, the present disclosure provides the single molecule guide RNA of Composition 1, wherein the single molecule guide RNA further comprises a tracrRNA extension region.

[0412] In another composition, Composition 4, the disclosure provides the single molecule guide RNA of Compositions 1-3, wherein the single molecule guide RNA is chemically modified.

[0413] In another composition, composition 5, the present disclosure provides the single molecule guide RNA of compositions 1-4, where the single molecule guide RNA is pre-complexed with a DNA endonuclease.

[0414] In another composition, composition 6, the present disclosure provides the single molecule guide RNA of composition 5, wherein the DNA endonuclease is Cas9 or Cpf1 endonuclease.

[0415] In another composition, composition 7, the disclosure provides the single molecule guide RNA of composition 6, wherein the Cas9 or Cpf1 endonuclease is selected from S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, T. denticola Cas9, L. bacterium ND2006 Cpf1, and Acidaminococcus sp. BV3L6 Cpf1, and variants having at least 70% homology to these enzymes.

[0416] In another composition, composition 8, the disclosure provides the single molecule guide RNA of composition 7, wherein the Cas9 or Cpf1 enzyme comprises one or more nuclear localization signals (NLS).

[0417] In another composition, composition 9, the disclosure provides a single molecule guide RNA of composition 8, wherein at least one NLS is within or within the amino-terminal 50 amino acids of the Cas9 or Cpf1 endonuclease, and / or at least one NLS is within or within the carboxy-terminal 50 amino acids of the Cas9 or Cpf1 endonuclease.

[0418] In another composition, composition 10, the disclosure provides the single molecule guide RNA of composition 9, wherein the Cas9 or Cpf1 endonuclease is codon optimized for expression in a eukaryotic cell.

[0419] In another composition, composition 11, the disclosure provides DNA encoding the single molecule guide RNA of compositions 1-3.

[0420] In another composition, composition 12, the present disclosure provides DNA encoding the CRISPR / Cas system of compositions 8-10.

[0421] In another composition, composition 13, the disclosure provides a vector comprising the DNA of compositions 11 or 12.

[0422] In another composition, composition 14, the disclosure provides the vector of composition 13, where the vector is a plasmid.

[0423] In another composition, composition 15, the disclosure provides a vector of composition 13, wherein the vector is an AAV vector particle and the AAV vector serotype is selected from those listed in SEQ ID NOs: 4,734 to 5,302 and Table 2.

[0424] IX.Definitions The terms "comprising" or "comprises" are used in reference to compositions, methods, and their respective component(s) that are essential to the invention, but are open to the inclusion of unspecified elements, whether essential or not.

[0425] The term "consisting essentially of" refers to elements required for a particular embodiment. The term allows for the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0426] The term "consisting of" refers to compositions, methods, and their respective components described herein, and excludes any element not recited in that description of an embodiment.

[0427] The singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise.

[0428] Certain numerical values ​​provided herein are preceded by the term "about." The term "about" means a numerical value within ±10% of the recited numerical value.

[0429] When a range of numerical values ​​is presented herein, each intervening value between the lower and upper limits of the range, the values ​​at the upper and lower limits of the range, and all values ​​recited along with the range are encompassed within the disclosure. All possible subranges within the lower and upper limits of the range are also contemplated by the disclosure.

[0430] The details of one or more embodiments of the present invention are described in the accompanying description below. In the practice or testing of the present disclosure, any materials and methods similar or equivalent to those described herein can be used, but the preferred materials and methods are described here. Other features, objects and advantages of the present invention will be apparent from the description. In the description, the singular form includes the plural form unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. In case of conflict, the present description shall prevail.

[0431] Any numerical range recited herein describes all subranges of the same numerical precision (i.e., having the same number of specified digits) contained within the recited range. For example, a recited range of "1.0 to 10.0" describes all subranges between the recited minimum value of 1.0 and the recited maximum value of 10.0, such as "2.4 to 7.6," even if the range "2.4 to 7.6" is not explicitly recited in the body of the specification. Accordingly, applicants reserve the right to amend this specification, including the claims, to explicitly recite any subranges of the same numerical precision contained within the ranges explicitly recited herein. All such ranges are inherently described herein, and amendments to explicitly recite such subranges comply with written description, sufficiency of description, and additional matter requirements, including those of 35 U.S.C. § 112(a) and 123(2) EPC. In addition, unless expressly specified or otherwise required by context, all numerical parameters described herein (e.g., those expressing values, ranges, amounts, percentages, etc.) can be read as if preceded by the word "about", even if the word "about" does not explicitly appear before the numerical value. Further, the numerical parameters described herein should be interpreted in light of the reported number of significant digits, numerical precision and by applying ordinary rounding techniques. It is also understood that the numerical parameters described herein necessarily possess the inherent variability characteristic of the underlying measurement techniques used to determine the numerical value of the parameter.

[0432] The details of one or more aspects of the present disclosure are described in the accompanying description below. In carrying out or testing the present disclosure, any material and method similar or equivalent to those described herein can be used, but the preferred material and method are described here. Other features, objects, and advantages of the present disclosure will be apparent from the description. In the description, the singular form includes the plural form, unless the context clearly indicates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present disclosure belongs. In case of conflict, the present description shall prevail.

[0433] The invention is further illustrated by the following non-limiting examples.

[0434] X. Example The present invention will be more fully understood by reference to the following examples, which provide illustrative, non-limiting aspects of the disclosure.

[0435] The examples describe the use of the CRISPR system as an exemplary genome editing technique to create defined therapeutic genome deletions, insertions, or substitutions, referred to herein as "genomic modifications," in the ANGPTL3 gene that result in permanent deletion or mutation of the ANGPLT3 gene, reducing or eliminating the activity of the ANGPTL3 protein. The introduction of defined therapeutic modifications, as described and exemplified herein, represents a novel therapeutic strategy for the potential improvement of dyslipidemia.

[0436] Example 1 - CRISPR / SpCas9 target site in ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) having the sequence NRG. The gRNA 20 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 6,634 to 10,171 of the Sequence Listing.

[0437] Example 2 - CRISPR / SaCas9 target site in ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) having the sequence NNGRRT. The gRNA 20 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 5,596-6,079-10,171 of the Sequence Listing.

[0438] Example 3 - CRISPR / StCas9 target site in ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) having the sequence NNAGAAW. The gRNA 20 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 5,399 to 5,595 of the Sequence Listing.

[0439] Example 4 - CRISPR / TdCas9 target site in ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) having the sequence NAAAAC. The gRNA 20 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 5,305 to 5,398 of the Sequence Listing.

[0440] Example 5 - CRISPR / NmCas9 target site in ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) having the sequence NNNNGATT. The gRNA 20 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 6,080 to 6,633 in the Sequence Listing.

[0441] Example 6 - CRISPR / Cpf1 target site in the ANGPTL3 gene Regions of the ANGPTL3 gene are scanned for target sites. Each region is scanned for a protospacer adjacent motif (PAM) with the sequence TTN or YTN. The gRNA 22 bp spacer sequence corresponding to the PAM is then identified, as shown in SEQ ID NOs: 10,172 to 17,018 in the Sequence Listing.

[0442] Example 7 - Bioinformatics analysis of the guide strand Candidate guides were then screened and selected in a single or multi-step process that included both theoretical binding and experimentally evaluated activity at both on-target and off-target sites. By way of example, to assess the potential for effects of chromosomal locations other than those intended, candidate guides with sequences that match a particular on-target site, e.g., a site in the ANGPTL3 gene, with an adjacent PAM, were assessed for their ability to cleave off-target sites with similar sequences using one or more of the various bioinformatics tools available for assessing off-target binding, as described and exemplified in more detail below.

[0443] Candidates that are predicted to have relatively low potential for off-target activity are then experimentally evaluated to measure on-target activity at various sites, followed by off-target activity.Preferred guides have high enough on-target activity to achieve the desired level of gene editing at selected loci, and relatively low off-target activity to reduce the possibility of modification at other chromosomal loci.The ratio of on-target activity to off-target activity is often referred to as the "specificity" of guides.

[0444] For initial screening of predicted off-target activity, there are several known published bioinformatics tools that can be used to predict the most likely off-target sites; since binding of the CRISPR / Cas9 or CRISPR / Cpf1 nuclease systems to target sites is driven by Watson-Crick base pairing between complementary sequences, the degree of dissimilarity (and therefore reduced likelihood of off-target binding) essentially relates to primary sequence differences: mismatches and bulges, i.e., bases that change to non-complementary bases, and insertions or deletions of potential off-target sites relative to the target site. An exemplary bioinformatics tool called COSMID (CRISPR Off-Target Sites with Mismatches, Insertions, and Deletions) (available on the web at crispr.bme.gatech.edu) compiles such similarities. Other bioinformatics tools include, but are not limited to, autoCOSMID and CCTop.

[0445] Bioinformatics is used to minimize off-target cleavage in order to reduce the deleterious effects of mutations and chromosomal rearrangements. Studies on the CRISPR / Cas9 system suggested the possibility of high off-target activity due to nonspecific hybridization of the guide strand to DNA sequences with base pair mismatches and / or bulges, especially at positions distant from the PAM region. It is therefore important to have bioinformatics tools that can identify potential off-target sites that have insertions and / or deletions between the RNA guide strand and the genomic sequence in addition to base pair mismatches. We searched the genome for possible off-target sites for CRISPR using a bioinformatics tool based on the off-target prediction algorithm CCTop (CCTop is available on the web at crispr.cos.uni-heidelberg.de / ). The COSMID output ranks the list of potential off-target sites based on the number and location of mismatches, allowing a more informed selection of target sites and avoiding the use of sites with a high probability of off-target cleavage.

[0446] Additional bioinformatics pipelines are employed that evaluate the putative on-target and / or off-target activity of gRNA targeting sites in a region. Other features that can be used to predict activity include information about the cell type in question, DNA accessibility, chromatin state, transcription factor binding sites, transcription factor binding data, and other CHIP sequence data. Additional factors that predict the efficiency of editing are considered, such as the relative position and orientation of the gRNA pair, local sequence features, and microhomology.

[0447] Initial evaluation and screening of CRISPR / Cas9 target sites focused on the ANGPTL3 ~200 bp 5′ upstream sequence, exons 1–6 (out of 7 exons) and introns 1–6 regions. Complete intron sequences were evaluated; or ~100–300 bp of sequence proximal to exon-intron junctions were evaluated for large introns. gRNAs within exonic sequences can be used to create indels that lead to loss of function of the protein due to changes in protein sequence and / or protein truncation. gRNAs in 5′UTR sequences can be used either alone or in combination with gRNAs within exons to remove the translation start site and prevent protein synthesis. gRNAs in introns can be used alone or in combination with gRNAs within exons to remove splice donor and acceptor sites, leading to production of truncated proteins and consequent loss of function.

[0448] Initial bioinformatics analysis identified approximately 203 guides targeting the ANGPTL3 gene. This subset of guides was further analyzed. Guides with predicted off-target sites (one or two mismatches) were eliminated, as were guides overlapping with SNPs with minor allele frequencies above 0.0002. We also prioritized gRNAs for screening based on their position within the Angptl3 sequence. gRNAs targeting the 5′ exon were prioritized. This analysis left a pool of 192 guides that we prioritized for our in vitro transcription-based guide screening protocol (Table 7).

[0449] Example 8 - Testing intracellular preferred guides for on-target activity To identify a large spectrum of gRNAs capable of editing cognate DNA target regions, an in vitro transcribed (IVT) gRNA screen was performed. Relevant genomic sequences were submitted for analysis using gRNA design software. The resulting list of gRNAs was narrowed down to a list of approximately 200 gRNAs based on sequence uniqueness (we only screened gRNAs that did not have an exact match anywhere in the genome) and minimal predicted off-targets. This set of gRNAs was in vitro transcribed and transfected into HEK293T cells constitutively expressing Cas9 using Lipofectamine MessengerMAX. Cells were harvested 48 h after transfection, genomic DNA was isolated, and cleavage efficiency was assessed using TIDE analysis (Figures 2-4).

[0450] Among the 192 guides screened in HEK cells, we identified guides with high editing efficiency and low CCTop off-target scores (Table 7 and Figures 2–4).

[0451] gRNAs with significant activity were then tracked in cultured cells to measure the modification of the ANGPTL3 gene (Examples 11-13). In particular, two guides specifically targeting the human ANGPTL3 sequence and two gRNAs targeting both human and monkey (cross-reactive) ANGPTL3 (100% matched to available cynomolgus and rhesus ANGPTL3 sequences) were selected for the in vitro editing experiments described below (see, for example, Table 8). Off-target events can again be followed. Various cells can be transfected and the level of gene editing and possible off-target events can be measured. These experiments allow the optimization of nuclease and donor design and delivery. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6]

[0452] Example 10 - Cross-reactive activity of gRNA targeting ANGPTL3 in primary hepatocytes This example demonstrates efficient cross-reactive activity of ANGPTL3 gRNA in primary hepatocytes isolated from cynomolgus monkeys and human donors after knockout with lipofectamine transfection complexes containing Cas9 mRNA and gRNA.

[0453] Primary hepatocytes isolated from humans and cynomolgus monkeys (In Vitro ADMET Laboratories, Maryland) were seeded in confluent monolayers and transfected with Cas9 mRNA and gRNA targeting ANGPTL3. The gRNA targeting ANGPTL3, synthesized by AXOLabs, was chemically modified using the following format: n*n*n*NNNNNNNNNNNNNNNNNGUUUUAGAgcuaGAAAuagcAAGUUAAAAUAAGGCUAGUCCGUUAUCaacuuGAAAaaguggcaccgagucggugcu*u*u*U, where Uppercase: unmodified nucleotides, lowercase: nucleotides with 2′-O-methyl modification, n or N: any nucleotide, *: phosphorothioate linkage (SEQ ID NO: 17,058). The modified gRNAs are shown in Table 8.

[0454] Briefly, cells were seeded at 0.35 × 106 cells / well in a confluent monolayer in 24-well collagen type I coated plates (Corning Biocoat Collagen I Multiwell Plates, Cat. no. 356408) and incubated at 37 °C in 5% CO2 in InVitroGRO culture plate medium (BioreclamationIVT, Z990003). Hepatocyte monolayers were transfected 3–5 h after seeding with gRNA complexed with Cas9 mRNA. Human hepatocytes were transfected with either human-specific gRNA or species cross-reactive gRNA, and monkey hepatocytes were transfected with species cross-reactive gRNA. Transfection of gRNA was performed using Lipofectamine™ MessengerMax™ Transfection Reagent (ThermoFisher, Cat. no. LMRNA003) according to the manufacturer's protocol with a final gRNA amount of 200 ng.

[0455] To generate "MOCK" samples, hepatocytes were also transfected with Lipofectamine MessengerMax without Cas9 and gRNA. Additionally, hepatocytes were transfected with Cas9 mRNA and gRNA controls known to be consistently active with known editing efficiency ranges for each hepatocyte species (e.g., C3 gRNA for human hepatocytes or PCSK9 gRNA for monkey hepatocytes). Cells received a media change of fresh InVitroGRO culture medium 16 hours after transfection and were incubated with gRNA-Lipofectamine complexes for 48 hours, at which point they were lysed in prepGEM (ZyGem) following the manufacturer's protocol.

[0456] Hepatocytes were transfected with Cas9 and ANGPTL3 gRNA and mock transfectants were analyzed by Tracking Indels by Decomposition (TIDE) analysis (Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014 Dec 16;42(22):e168. doi:10.1093 / nar / gku936). Briefly, genomic DNA was used as a template for PCR using the KAPA HiFi PCR kit.

[0457] PCR amplicons were purified using the AxyPrep Mag PCR clean-up kit (Axygen). Amplicons were sequenced and analyzed using a degrade algorithm. gRNA activity was measured as the ratio of alleles with various indels (insertion of 1–50 nt, or deletion of 1–50 nt) adjacent to the predicted cleavage site of S.py.Cas9 on the non-targeted strand (i.e., between nucleotide -4 and nucleotide -3 upstream of the PAM (NGG)) and between 3 and 4 nucleotides downstream of the PAM complementary sequence (CCN) on the targeted strand.

[0458] TIDE analysis showed that ANGPTL3 gRNAs EX2, T6, and T9 induced approximately 50%-60% InDels in human hepatocytes, while EX1 gRNA induced an efficiency of less than 20% on average (see Figure 5A). Cross-reactive guides T6 and T9 were active and induced gene editing in monkey hepatocytes. The editing efficiency of gRNA T6 was the highest, with more than 60% InDels in monkey hepatocytes (see Figure 5B). [Table 8]

[0459] Example 11 - ANGPTL3 Protein Secretion in Gene-Edited Primary Human Hepatocytes This example shows the correlation between efficient gene editing with T6 gRNA and reduction of secreted ANGPTL3 protein in primary human hepatocytes.

[0460] 0.35x10 primary human hepatocytes (In Vitro ADMET Laboratories) 6Cells / well were seeded in confluent monolayers on 24-well collagen type I coated plates (Corning Biocoat Collagen I Multiwell Plates, Cat. no. 356408) and incubated at 37 °C in 5% CO2 in InVitroGRO culture plate medium (Bioreclamation IVT, Z990003). Hepatocyte monolayers were transfected 3–5 h after seeding with either ANGPTL3 T6 gRNA or C3 gRNA (a non-related gRNA that efficiently knocks out human C3 but does not edit the ANGPTL3 gene) complexed with Cas9 mRNA. Transfection of gRNA was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final gRNA amount of 200 ng. To generate a "MOCK" sample, hepatocytes were also transfected with Lipofectamine MessengerMax without Cas9 mRNA and gRNA. Cells received a media change with fresh InVitroGRO culture medium 16 hours after transfection. Samples were incubated with gRNA-Lipofectamine complexes for 48 hours, at which point supernatants were collected for human ANGPTL3 protein analysis, and cells were lysed in prepGEM (ZyGem) according to the manufacturer's protocol.

[0461] Hepatocytes transfected with Cas9 and T6 gRNA, or Cas9 and C3 gRNA, as well as "MOCK" transfectants (control group) were analyzed by TIDE. TIDE analysis showed that ANGPTL3 was edited by T6 gRNA (InDel approx. 60%) (Figure 6A). Similarly, C3 gRNA efficiently edited the human C3 gene, with an InDel frequency of approx. 55% in the same human donor (Figure 6A).

[0462] A sandwich enzyme-linked immunosorbent assay (ELISA) for human ANGPTL3 protein (Human ANGPTL3 ELISA Kit, R&D Systems, Cat. No. DY3829) was used to detect the concentration of ANGPTL3 protein in the supernatant collected from the gene editing samples. The results showed that the supernatant of primary hepatocytes with approximately 60% efficiency in editing the ANGPTL3 gene by T6 gRNA contained less than 1 ng / mL of ANGPTL3 protein, indicating a significant reduction in ANGPTL3 protein levels compared to the control group (Figure 6B). The control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein of approximately 2.8 ng / ml (Figure 6B) and approximately 2.6 ng / mL (Figure 6B), respectively. This study shows that effective editing of the ANGPTL3 gene resulted in a functional reduction of secreted ANGPTL3 protein in primary hepatocytes.

[0463] To increase the detection window of ANGPTL3 protein knockdown, co-cultured primary human hepatocytes were cultured and transfected with gRNA and Cas9.

[0464] Primary human hepatocytes (In Vitro ADMET Laboratories) were cultured in the presence of isolated mouse 3T3 fibroblasts (SN Bhatia, UJ Balis, ML Yarmush, M Toner. "Effect of cell-cell interactions in preservation of cellular phenotype: cocultivation of hepatocytes and nonparenchymal cells" The FASEB Journal 13(14), 1883-1900, SN Bhatia, ML Yarmush, M Toner. "Controlling cell interactions of micropatterning in co-cultures: hepatocytes and 3T3 fibroblasts" J. Biomedical Materials Research 34(2), 189-199) in a co-culture format on 24-well collagen I coated plates (Corning Biocoat Collagen I Multiwell). The hepatocytes were cultured in InVitroGRO culture plate medium (Bioreclamation IVT, Z990003) and incubated at 37°C in 5% CO2. Hepatocyte co-cultures were transfected with gRNA (Table 8) and Cas9 mRNA 24 hours after the initiation of culture. Transfection of gRNA was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final gRNA amount of 200ng. Hepatocytes were also transfected with Lipofectamine MessengerMax. Cells received a medium change of fresh InVitroGRO medium 6 hours after transfection gRNA-Lipofectamine complex and every 24 hours for a total of 10 days.

[0465] Co-cultured primary hepatocytes transfected with Cas9 and T6 gRNA, or Cas9 and C3 gRNA, as well as "MOCK" transfectants (control group) were analyzed by TIDE. TIDE analysis showed that ANGPTL3 was edited by T6 gRNA (InDel ~60%) (Figure 7A). Similarly, C3 gRNA efficiently edited the human C3 gene, with an InDel frequency of ~52% in the same human donor (Figure 7A). These data indicate a consistent editing profile of primary human hepatocytes in monoculture and coculture formats.

[0466] A sandwich enzyme-linked immunosorbent assay (ELISA) for human ANGPTL3 protein (Human ANGPTL3 ELISA Kit, R&D Systems, Cat. No. DY3829) was used to detect the concentration of ANGPTL3 protein in the supernatant collected from the gene editing samples. The results showed that the supernatant of primary hepatocytes with approximately 60% efficiency in editing the ANGPTL3 gene by T6 gRNA contained approximately 1 ng / mL of ANGPTL3 protein, indicating a significant reduction in ANGPTL3 protein levels compared to the control group (Figure 7B). The control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein, approximately 29 ng / mL and approximately 31 ng / mL, respectively. Co-cultured primary hepatocytes secreted 5-fold higher levels of ANGPTL3 protein compared to mono-cultured hepatocytes, indicating that disruption of the ANGPTL3 gene reliably reduced secreted ANGPTL3 protein.

[0467] Example 12 - ANGPTL3 protein secretion in gene-edited primary monkey hepatocytes This example shows the correlation between efficient gene editing with T6 gRNA and reduction of secreted ANGPTL3 protein in primary monkey hepatocytes.

[0468] 0.35x10 primary monkey hepatocytes (In Vitro ADMET Laboratories) 6Cells / well were seeded in confluent monolayers on 24-well collagen type I coated plates (Corning Biocoat Collagen I Multiwell Plates, Cat. no. 356408) and incubated at 37 °C in 5% CO2 in InVitroGRO culture plate medium (Bioreclamation IVT, Z990003). Hepatocyte monolayers were transfected 3–5 h after seeding with either ANGPTL3 T6 gRNA or PCSK9 gRNA (a non-related gRNA that efficiently knocks out the PCSK9 gene in the monkey genome but does not edit the ANGPTL3 gene) complexed with Cas9 mRNA. Transfection of gRNA was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final gRNA amount of 200 ng. To generate a "MOCK" sample, hepatocytes were also transfected with Lipofectamine MessengerMax without Cas9 mRNA and gRNA. Cells received a media change with fresh InVitroGRO culture medium 16 hours after transfection. Samples were incubated with gRNA-Lipofectamine complexes for 48 hours, at which point supernatants were collected for human ANGPTL3 protein analysis, and cells were lysed in prepGEM (ZyGem) according to the manufacturer's protocol.

[0469] Monkey hepatocytes transfected with Cas9 and T6 gRNA, T9 gRNA, or PCSK9 gRNA, as well as "MOCK" transfectants (control group), were analyzed by TIDE. TIDE analysis showed that ANGPTL3 was edited by T6 gRNA (InDel approx. 67%) and T9 gRNA (InDel approx. 29%) (Figure 5B). Similarly, PCSK9 gRNA efficiently edited the monkey PCSK9 gene, with an InDel frequency of approx. 41% in the same monkey donor (Figure 5B).

[0470] A sandwich enzyme-linked immunosorbent assay (ELISA) for monkey ANGPTL3 protein (Monkey ANGPTL3 ELISA Kit, LifeSpan Bio, Cat. No. LS_F38518) was used to detect the concentration of ANGPTL3 protein in the supernatant collected from the gene editing samples. The results show that the supernatant of primary hepatocytes with approximately 67% efficiency in editing the ANGPTL3 gene by T6 gRNA contained less than 1 ng / mL of ANGPTL3 protein, indicating a significant reduction in ANGPTL3 protein levels compared to the control group (Figure 8). The control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein, approximately 3 ng / mL and approximately 2.5 ng / mL, respectively. This study shows that effective editing of the ANGPTL3 gene by the cross-reactive gRNA, T6, resulted in a functional reduction of secreted ANGPTL3 protein in primary monkey hepatocytes.

[0471] Example 13 - In vivo testing in relevant animal models After evaluating the CRISPR-Cas9 / guide combinations, lead formulations are tested in vivo in animal models.

[0472] High efficiency of ANGPTL3 gene deletion in primary human hepatocytes. The cross-species ANGPTL3 gRNA combination, complexed with Cas9 mRNA and gRNA, is formulated into lipid nanoparticles for delivery.

[0473] Cynomolgus monkeys are used as a large animal model because preclinical data are available for both monoclonal antibody and antisense oligonucleotide therapies for ANGPTL3 inhibition, which are currently completing Phase I / II clinical trials to evaluate the correlation between ANGPTL3 inhibition and reduction of triglycerides, LDL cholesterol, and HDL cholesterol in patients with familial hypercholesterolemia.

[0474] Lipid nanoparticles complexed with Cas9 mRNA and T6 gRNA will be injected into monkeys, and whole blood samples will be collected hourly on day 1 and every 3 days for 14 days after dosing. A baseline whole blood draw before dosing will also be performed. The control group will include animals injected with saline.

[0475] Body weight will be monitored throughout the study, and plasma and serum samples will be monitored for cytokines and complement activation (inflammatory response) and clinical lipid panels (total cholesterol, HDL, LDL-C, and triglycerides). Upon completion of the 14-day period, liver tissue will be collected and assessed for gene editing of the ANGPTL3 gene.

[0476] Liver tissue will be homogenized from both control and treated animals and analyzed by TIDE analysis for evidence of effective ANGPTL3 gene editing.

[0477] The results of the TIDE analysis and lipid chemistry over the course of the study will provide a correlation between InDel frequency and correction of cholesterol levels, with an emphasis on reducing LDL-C, the key biological marker.

[0478] As noted above, culture in human cells also allows for direct testing of human targets and background human genomes.

[0479] Furthermore, engraftment of modified mouse or human hepatocytes in mouse models allows for preclinical efficacy and safety assessments to be observed, with modified cells being observable several months after engraftment.

[0480] Example 14 - Testing Priority Guides Within Cells for Off-Target Activity The gRNAs with the best on-target activity from the IVT screening in the above examples will be tested for off-target activity using hybrid capture assays, GUIDE-Seq, and whole genome sequencing, in addition to other methods.

[0481] XI. Equivalence and Scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. The scope of the invention is not limited by the above description, but rather is set forth in the appended claims.

[0482] A claim or description between "or" members that includes one or more members of a group is deemed satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless the contrary is indicated or otherwise clear from the context. The present disclosure includes embodiments in which exactly one member of a group is present in, employed in, or otherwise relevant to a given product or process. The present disclosure includes embodiments in which more than one, or the entire group of members is present in, employed in, or otherwise relevant to a given product or process.

[0483] In addition, it should be understood that certain embodiments of the present disclosure that fall within the prior art may be expressly excluded from any one or more of the claims. Such embodiments may be excluded even if the exclusion is not expressly stated herein, since they are deemed known to those skilled in the art. Any particular embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic or active ingredient, any method of manufacture, any method of use, etc.) may be excluded from one or more of the claims for any reason, whether related to the existence of prior art or not.

[0484] The words that have been used are words of description rather than of limitation, and it is to be understood that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the present disclosure in its broader aspects.

[0485] While the present disclosure has been described in some detail with respect to certain illustrated embodiments, it should not be limited to such details or embodiments or to any particular embodiment, but should be interpreted with reference to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and thus effectively encompass the intended scope of the present disclosure.

[0486] Notes on the Examples While the present disclosure provides descriptions of various specific embodiments for the purpose of illustrating various aspects of the disclosure and / or potential applications thereof, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, it should be understood that the invention or inventions described herein are at least as broad as the claims and are not more narrowly defined by the specific exemplary embodiments provided herein.

[0487] Any patent, publication, or other disclosure material identified herein is incorporated herein in its entirety by reference, unless otherwise stated, only to the extent that the incorporated material does not expressly contradict existing descriptions, definitions, statements, or other disclosure material expressly set forth herein. Therefore, to the extent necessary, the express disclosure set forth herein supersedes any conflicting material incorporated by reference. Any material, or portion thereof, that is said to be incorporated herein by reference but that contradicts existing definitions, statements, or other disclosure material set forth herein, is incorporated only to the extent that no conflict occurs between the incorporated material and the existing disclosure material. Applicant reserves the right to amend this specification to explicitly recite any subject matter, or portion thereof, incorporated herein by reference.

Claims

1. 1. A method for producing a population of Angiopoietin-like 3 (ANGPTL3) modified cells, comprising: introducing into cells (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets an ANGPTL3 genomic locus, and (b) an RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease; and producing a population of cells comprising a modification of the ANGPTL3 gene.

2. The method of claim 1 , wherein at least 50% of the cells in the population comprise a modification of the ANGPTL3 gene.

3. The method of claim 2, wherein between 50% and 70% of the cells of the population comprise a modification of the ANGPTL3 gene.

4. The method of any one of claims 1 to 3, wherein ANGPTL3 protein secreted by cells of the population is reduced by at least 2-fold compared to a control.

5. 5. The method of claim 4, wherein ANGPTL3 protein secreted by cells of the population is reduced by at least 5-fold compared to a control.

6. The method of claim 4 or 5, wherein the control is a population of unmodified cells and / or a population of cells that did not receive the gRNA targeting the ANGPTL3 gene.

7. The method of any one of claims 1 to 6, wherein the RNA-guided endonuclease is Cas9 endonuclease or Cpf1 endonuclease.

8. 8. The method of claim 7, wherein the Cas9 endonuclease or Cpf1 endonuclease is selected from S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus CRISPR1 Cas9, S. thermophilus CRISPR3 Cas9, T. denticola Cas9, L. bacterium ND2006 Cpf1, and Acidaminococcus sp. BV3L6 Cpf1.

9. 9. The method of claim 7 or 8, wherein the RNA-guided endonuclease comprises a sequence selected from SEQ ID NO: 1 to SEQ ID NO:

620.

10. The method of any one of claims 7 to 9, wherein the RNA-guided endonuclease is a Cas9 endonuclease.

11. The method of any one of claims 1 to 10, wherein the gRNA is a single guide RNA (sgRNA).

12. The method of any one of claims 1 to 11, wherein the gRNA targets a regulatory element of the ANGPTL3 genomic locus.

13. The method of any one of claims 1 to 12, wherein the gRNA is cross-reactive to human and cynomolgus monkey.

14. The method of any one of claims 1 to 13, wherein the gRNA is a chemically modified gRNA.

15. The method of claim 14, wherein the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 3' and 5' ends of the gRNA.

16. 16. The method of any one of claims 1 to 15, wherein the gRNA comprises a spacer sequence selected from Table 7.

17. The method of any one of claims 1 to 16, wherein the gRNA comprises a spacer sequence selected from CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071), GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069), and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).

18. 18. The method of claim 17, wherein the gRNA comprises the spacer sequence GCCAAUGGCCUCCUUCAGUU (sequence number 17069).

19. 19. The method of any one of claims 1 to 18, wherein the gRNA and RNA-guided nuclease are formulated as a ribonucleoprotein particle (RNP).

20. The method according to any one of claims 1 to 18, wherein the nucleic acid of (a) and / or (b) is present on a viral vector, optionally an adeno-associated viral vector.

21. 21. The method of any one of claims 1 to 20, wherein the gRNA or the nucleic acid encoding the gRNA of (a) and / or the RNA-guided endonuclease or the nucleic acid encoding the RNA-guided endonuclease of (b) are formulated in a liposome or lipid nanoparticle (LNP).

22. The method of any one of claims 1 to 21, wherein the cells comprise hepatocytes.

23. The method of any one of claims 1 to 22, wherein the population of cells is present in a subject having an ANGPTL3-associated condition.

24. A nucleic acid encoding a cross-reactive guide RNA (gRNA) or a cross-reactive gRNA, comprising a spacer sequence selected from GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069) and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).

Images