Baculovirus expression system

Abstract

To provide a heterologous recombinant baculovirus (rBV) expression system for production of foreign heterologous proteins in insect cells.SOLUTION: This system comprises: a recombinant baculovirus backbone genome with a deletion in the cathepsin gene into which foreign gene cassettes can be integrated; and an insect cell which can be infected with the Δv-cath-rBV, and in which foreign proteins and / or viral vectors or particles are expressed.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 866,741, filed June 26, 2019, and U.S. Provisional Application No. 63 / 012,568, filed April 20, 2020, each of which is incorporated by reference in its entirety.

[0002] The present invention is in the fields of molecular biology, virology and gene therapy. More specifically, the present invention relates to a baculovirus system for recombinant protein synthesis in insect cells. [Background technology]

[0003] Gene therapy has been developed to treat a number of disorders, such as cancer and gene-related diseases, and involves the use of recombinant proteins produced in mammalian systems using viral vectors.

[0004] Currently, there are several technologies in the field of recombinant protein and viral vector production that use different means to introduce foreign genes into host cells.For example, the traditional method of introducing AAV genes uses the transfection of mammalian cell lines such as HEK-293 or Hela cells with triple or double plasmids (Xiao, Li et al. 1998, Grimm, Kay et al. 2003).Another technology uses herpes simplex virus (HSV) to infect mammalian cells, for example, for AAV production (Zhang, De Alwis-et al. 1999).

[0005] Unfortunately, the AAV production in these systems is low.For example, AAV vector production is hindered by the difficulty of producing sufficient HSV seed stock.Also, AAV vector production is difficult to scale up due to the inherent properties of adherent mammalian cells and the low yield of AAV production.Therefore, the large-scale production of AAV in these systems is problematic enough to obtain sufficient material for clinical trials.

[0006] Other recombinant protein and virus production systems include the use of baculovirus in insect cells (Chen 2008, Kotin 2011). The baculovirus expression vector (or bacmid) system (BEVS) is an established method for the production of recombinant proteins used as vaccines, therapeutic molecules, or diagnostic reagents (van Oers, Pijlman et al. 2015). This system provides increased AAV production yields compared to other AAV production techniques (Galibert and Merten 2011). However, this method has led to degradation of the AAV capsid. It has been reported that removal of the baculovirus chitinase (chiA) and cathepsin (v-cath) genes improves the integrity of secreted recombinant proteins and prevents degradation of the AAV8 capsid (Galibert, Savy et al. 2018). However, removal of the chiA gene also removes the chitinase activity required to degrade chitin, a high molecular weight linear polymer of N-acetyl-D-glucosamine units synthesized in insect cells (Ishimwe, Hodgson et al. 2015). Without chiA activity, AAV particles produced in these insect cells are difficult to isolate from sticky cell lysates, which reduces the recovery of AAV particles.

[0007] Thus, there is a need for improved expression systems that produce useful quantities of recombinant viral vectors and proteins that are not degraded and have useful levels of activity. Summary of the Invention

[0008] It has been discovered that recombinant baculovirus (rBV) with a genome having a deletion of the v-cath gene allows expression of AAV capsid proteins with higher structural integrity from a cassette integrated into the rBV genome. Thus, rAAV isolated from insect cells infected with rBV from which cathepsin has been deleted has a higher infectivity than rAAV isolated from insect cells infected with rBV containing cathepsin.

[0009] These discoveries were utilized to develop the present disclosure, which is directed, in part, to recombinant baculovirus systems, components thereof, and methods using specifically deleted rBV for foreign protein expression.

[0010] In one aspect, the disclosure provides a recombinant baculovirus (rBV) DNA backbone that includes a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion.

[0011] In some embodiments, the DNA fragment comprises a DNA sequence that is homologous to two sequences that flank one or more foreign protein expression cassettes of the donor plasmid. In certain embodiments, the DNA fragment is derived from bMON14272. In some embodiments, the DNA fragment comprises an origin of replication. In certain embodiments, the origin of replication is mini-F replicon, ColE1, oriC, OriV, OriT, or OriS. In certain embodiments, the DNA fragment further comprises a reporter gene. In certain embodiments, the reporter gene is LacZα.

[0012] In some embodiments, the rBV DNA backbone further comprises a selection marker expression gene cassette integrated into the cath-v deletion. In certain embodiments, the selection marker expression gene cassette comprises an antibiotic resistance gene, and in certain embodiments, the antibiotic resistance gene is a kanamycin resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a gentamicin resistance gene, a blasticidin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, or a geneticin resistance gene. In other embodiments, the selection marker expression gene cassette comprises a selection marker gene that encodes a visually detectable protein. In some embodiments, the selection marker gene encodes a colorimetric protein, a fluorescent protein, a chromatographic protein, a chemiluminescent protein, or a luminescent protein.

[0013] The present disclosure also provides a recombinant baculovirus (rBV) genome comprising an rBV DNA backbone and a foreign protein expression cassette. The rBV DNA backbone comprises a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein gene cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for the foreign protein expression cassette to be incorporated into the rBV DNA backbone.

[0014] In some embodiments, the at least one foreign protein gene in the foreign expression cassette comprises at least one viral protein gene and / or at least one mammalian protein gene. In certain embodiments, the viral protein gene encodes an AAV protein, an adenovirus protein, a retrovirus protein, an SV40 protein, or a herpes simplex virus protein. In certain embodiments, the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein. In certain embodiments, the at least one AAV protein is a VP1, VP2, VP3, and / or Rep protein, and in certain embodiments, the at least one SV40 protein is a VP1 major capsid protein.

[0015] In some embodiments, the foreign protein expression cassette comprises an insect promoter, such as a polyhedrin, p10, or p6.9 insect promoter, operably linked to at least one foreign protein gene.

[0016] In some embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are homologous to DNA sequences in the rBV DNA backbone. In certain embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are transposable elements. In certain embodiments, the two DNA sequences that allow the foreign protein expression cassette to be integrated into the DNA backbone are Tn7R and Tn7L.

[0017] In another aspect, the present disclosure provides a recombinant baculovirus (rBV) genome comprising an rBV DNA backbone and a foreign protein cassette. The rBV backbone comprises a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette integrated into the cath-v deletion, and a DNA fragment that allows integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be integrated into the rBV DNA backbone.

[0018] In yet another aspect, the present disclosure provides a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone and a foreign protein expression cassette, the rBV DNA backbone comprising a chitinase gene, a deletion of a v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion, and the foreign protein gene cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be incorporated into the rBV DNA backbone. In some embodiments, the rBV genome comprises an rBV backbone that comprises a foreign protein expression cassette encoding at least one AAV capsid protein.

[0019] In yet another aspect, the present disclosure provides a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone comprising a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette integrated into the cath-v deletion, and a DNA fragment that allows for the integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for the integration of one or more foreign protein expression cassettes into the rBV DNA backbone. In some embodiments, the rBV genome comprises an rBV backbone that comprises a foreign protein expression cassette encoding at least one AAV capsid protein.

[0020] The present disclosure also provides an insect cell comprising a recombinant baculovirus (rBV) vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone comprising a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in the insect cell are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be incorporated into the rBV DNA backbone.

[0021] In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell. In certain embodiments, the insect cell further comprises at least one foreign protein expressed from a foreign protein expression cassette in the rBV backbone of the rBV genome of the rBV vector or particle, and in certain embodiments, the at least one foreign protein is at least one AAV capsid protein.

[0022] Also provided herein is an insect cell comprising a recombinant baculovirus vector or particle comprising an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone comprising a chitinase gene, a deletion of the v-cath gene, a selectable marker gene incorporated into the cath-v deletion, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, so that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be incorporated into the rBV DNA backbone.

[0023] In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell. In certain embodiments, the insect cell further comprises at least one foreign protein expressed from a foreign protein expression cassette in the rBV backbone of the rBV genome of the rBV vector or particle, and in certain embodiments, the at least one foreign protein is at least one AAV capsid protein.

[0024] In another aspect, the present disclosure provides a heterologous expression system comprising an rBV vector or particle and an insect cell. The rBV vector or particle comprises an rBV genome and at least one baculovirus capsid protein, the rBV genome comprising an rBV DNA backbone comprising a chitinase gene, a deletion of a v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in the insect cell are less degraded than if they were expressed from the rBV backbone without the deletion, and a foreign protein expression cassette, the foreign protein expression cassette comprising at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be incorporated into the rBV DNA backbone. The insect cell in the system is susceptible to infection and can express at least one foreign protein encoded by the rBV backbone in the rBV vector or particle.

[0025] In some embodiments, the rBV vector or particle comprises an rBV backbone that includes a foreign protein expression cassette, the foreign protein expression cassette comprising a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0026] In yet another aspect, the present disclosure provides a heterologous expression system comprising an rBV vector or particle and an insect cell. The recombinant baculovirus vector or particle comprises an rBV genome and at least one baculovirus capsid protein. The rBV genome comprises an rBV DNA backbone comprising a chitinase gene, a deletion of the v-cath gene, a selectable marker cassette integrated into the cath-v deletion, and a DNA fragment that allows for integration of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in the insect cell are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for integration of the foreign protein expression cassette into the rBV DNA backbone. The insect cells of the system are susceptible to infection and are capable of expressing at least one foreign protein encoded by the rBV backbone in the rBV vector or particle.

[0027] In some embodiments, the rBV vector or particle comprises an rBV backbone that includes a foreign protein expression cassette, the foreign protein expression cassette comprising a sequence encoding at least one AAV capsid protein. In some embodiments, the insect cell is an Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 cell.

[0028] The present disclosure also provides a non-adhesive insect cell lysate comprising a recombinant baculovirus (rBV) genome and at least one foreign protein encoded by the rBV genome and expressed in the lysate. The present invention includes an rBV DNA backbone that includes a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette includes at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone. and two DNA sequences that enable it to be incorporated into a DNA backbone.

[0029] In some embodiments, the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. In some embodiments, the insect cell lysate is derived from Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 insect cells infected with the rBV genome.

[0030] In another aspect, the present disclosure also provides a non-adhesive insect cell lysate, comprising a recombinant baculovirus (rBV) genome and at least one foreign protein encoded by the rBV genome and expressed in the lysate. The rBV genome comprises an rBV DNA backbone, comprising a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette incorporated in the cath-v deletion, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow the foreign protein expression cassette to be incorporated into the rBV DNA backbone.

[0031] In some embodiments, the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. In some embodiments, the insect cell lysate is derived from Sf9, Sf21, S2, Trichoplusia ni, E4a, or BTI-TN-5B1-4 insect cells infected with the rBV genome.

[0032] In yet another aspect, the disclosure provides a method for producing a foreign protein in an insect cell, comprising infecting the insect cell with a recombinant baculovirus (rBV) vector or particle, culturing the infected cell under conditions conducive to expression of at least one foreign protein gene, and isolating a foreign protein particle comprising the rBV genome and at least one baculovirus capsid protein. The rBV vector or particle comprises an rBV DNA backbone comprising a chitinase gene, a deletion of the v-cath gene, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in the insect cell are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for the incorporation of the foreign protein expression cassette into the rBV DNA backbone.

[0033] In some embodiments, the insect cells are lysed to isolate the foreign protein. In certain embodiments, the foreign protein is at least one recombinant AAV capsid protein.

[0034] The disclosure also provides a recombinant AAV capsid protein produced by this method.

[0035] In another aspect, the disclosure provides a method for producing a foreign protein in an insect cell, comprising infecting the insect cell with a recombinant baculovirus (rBV) vector or particle, culturing the infected cell under conditions conducive to the expression of at least one foreign protein gene, and isolating the foreign protein. The rBV vector or particle comprises an rBV DNA backbone, comprising a chitinase gene, a deletion of the v-cath gene, a selectable marker gene cassette incorporated in the cath-v deletion, and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in the insect cell are less degraded than if they were expressed from an rBV backbone without the deletion. The foreign protein expression cassette comprises at least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene, and two DNA sequences that allow for the incorporation of the foreign protein expression cassette into the rBV DNA backbone.

[0036] In some embodiments, the insect cells are lysed to isolate the foreign protein. In certain embodiments, the foreign protein is at least one recombinant AAV capsid protein.

[0037] The disclosure also provides a recombinant AAV capsid protein produced by this method.

[0038] The foregoing and other objects of the present disclosure, its various features, as well as the disclosure itself, may be more fully understood from the following description when read in conjunction with the accompanying drawings, in which: [Brief description of the drawings]

[0039] [Figure 1A]1 is a diagrammatic representation of a recombinant baculovirus (rBV) DNA backbone or bacmid according to the present disclosure showing the deletion of the v-cath gene between nucleotides 107,034 and 107,904 and replacement of the deletion with a CAT expression cassette and a green fluorescent protein (GFP) expression cassette flanked by two FRTs. (A) Foreign protein expression cassette(s) can be integrated into the rBV DNA backbone via Tn7 transposon sequences. (B) Foreign protein expression cassette(s) can be integrated into the rBV DNA backbone via homologous recombination. [Figure 1B] 1 is a diagrammatic representation of a recombinant baculovirus (rBV) DNA backbone or bacmid according to the present disclosure showing the deletion of the v-cath gene between nucleotides 107,034 and 107,904 and replacement of the deletion with a CAT expression cassette and a green fluorescent protein (GFP) expression cassette flanked by two FRTs. (A) Foreign protein expression cassette(s) can be integrated into the rBV DNA backbone via Tn7 transposon sequences. (B) Foreign protein expression cassette(s) can be integrated into the rBV DNA backbone via homologous recombination. [Figure 2-1] Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51-1066 are the CAT expression cassette, 1067-3223 are the GFP expression cassette, and bases 1-50 and 3224-3275 are the remaining v-cath sequence, the sequence shown in SEQ ID NO:12. [Figure 2-2] Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51-1066 are the CAT expression cassette, 1067-3223 are the GFP expression cassette, and bases 1-50 and 3224-3275 are the remaining v-cath sequence, the sequence shown in SEQ ID NO:12. [Figure 2-3]Schematic diagram of a representative junction DNA sequence between v-cath, the CAT expression cassette, and the GFP expression cassette in the Δv-cath rBV backbone, where bases 51-1066 are the CAT expression cassette, 1067-3223 are the GFP expression cassette, and bases 1-50 and 3224-3275 are the remaining v-cath sequence, the sequence shown in SEQ ID NO:12. [Diagram 3] FIG. 1 is a diagrammatic representation of an exemplary foreign protein expression cassette design, including an insect polyhedrin promoter (polh), AAV Rep and Cap (foreign protein) genes, and a gentamicin selection marker gene (Genta) flanked by Tn7R and Tn7L sites for integration of the cassette into the recombinant baculovirus Δv-cath rBV DNA backbone. [Figure 4-1] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-2] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-3] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-4]4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-5] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-6] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Diagram 4-7] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 4-8] 4 is a schematic diagram of the DNA sequence of the foreign protein expression cassette described in FIG. 3, including a representative polh insect promoter and Tn7L and Tn7R sites for integration of the foreign protein expression cassette into the recombinant baculovirus Δv-cath rBV DNA backbone, where the sequence is shown in SEQ ID NO:13. [Figure 5A]FIG. 5B is a series of diagrammatic representations of an exemplary Δv-cath rBV genome further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into a bMON14272 bacmid, including a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of a luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5B] FIG. 5B is a series of diagrammatic representations of an exemplary Δv-cath rBV genome further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into a bMON14272 bacmid, including a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of a luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5C]FIG. 5B is a series of diagrammatic representations of an exemplary Δv-cath rBV genome further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into a bMON14272 bacmid, including a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of a luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 5D] FIG. 5B is a series of diagrammatic representations of an exemplary Δv-cath rBV genome further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into a bMON14272 bacmid, including a selectable marker CAT expression cassette and a GFP expression cassette inserted at the position of the v-cath deletion (FIG. 5A); a general foreign protein expression cassette carrying Genta, AAV Rep and Cap AAV genes (FIG. 5B); a general foreign protein expression cassette carrying Genta, an AAV genome consisting of a luciferase gene (FIG. 5C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 5D). [Figure 6] 1 is a flow chart showing the process of v-cath removal and production of AAV vectors in insect cells using the rBV system according to the present disclosure. [Figure 7A] FIG. 1 is a diagrammatic representation of the integration of a foreign expression cassette into the Δv-cath rBV DNA backbone by homologous recombination. [Figure 7B] FIG. 1 is a diagrammatic representation of the integration of a foreign expression cassette into the Δv-cath rBV DNA backbone by the transposase. [Figure 8]1 is a graphical representation of the titers of WT-rBV and Δv-cath rBV according to the present disclosure, each containing a Cap6-rep expression cassette, a GFP expression cassette, or a Cap2-7m8-rep expression cassette. [Figure 9] FIG. 1 is a representation of an SDS-PAGE gel stained with Simply Blue showing AAV capsid proteins expressed from different recombinant baculovirus vectors carrying the capsid VP1, VP2, and VP3 genes of different AAV serotypes, both with and without the v-cath gene. [Figure 10] A series of fluorescent image representations of HEK-293 (mammalian) cells transduced with the same amount of AAV vector containing a GFP expression cassette produced by rBV both with and without the v-cath gene, where Figures 10A-10C show the AAV vector expressing GFP produced by WT-rBV, and Figures 10D-10F show the AAV vector expressing GFP produced by rBV lacking v-cath, where 10A and 10D are AAV7m8-GFP, 10B and 10E are AAV8-GFP, and 10C and 10F are AAV6-GFP. [Figure 11] FIG. 1 is a diagrammatic representation of the Δv-cath recombinant baculovirus backbone, which contains only the CAT expression cassette flanked by two FRTs. [Figure 12] FIG. 13 is a diagrammatic representation of the baculovirus backbone, Δv-cath rBV, after removal of the CAT expression cassette, leaving the GFP expression cassette and a single FRT site. [Figure 13] FIG. 13 is a diagrammatic representation of the Δv-cath rBV backbone after removal of the CAT expression cassette, leaving one FRT site. [Figure 14A]1 is a photographic representation of an agarose gel electrophoresis image showing removal of the CAT expression cassette from the Δv-cath rBV backbone. (A) Smaller PCR fragment (2,345 bp) in lanes 1-11 compared to lanes 12 and 13 (3,245 bp), showing removal of the CAT expression cassette from the Δv-cath rBV backbone containing both CAT and GFP expression cassettes. (B) A 651 bp PCR fragment is shown in lanes 1, 5, and 7, showing the correct fragment size after removal of the CAT expression cassette from the Δv-cath rBV backbone leaving only one FRT site. [Figure 14B] 1 is a photographic representation of an agarose gel electrophoresis image showing removal of the CAT expression cassette from the Δv-cath rBV backbone. (A) Smaller PCR fragment (2,345 bp) in lanes 1-11 compared to lanes 12 and 13 (3,245 bp), showing removal of the CAT expression cassette from the Δv-cath rBV backbone containing both CAT and GFP expression cassettes. (B) A 651 bp PCR fragment is shown in lanes 1, 5, and 7, showing the correct fragment size after removal of the CAT expression cassette from the Δv-cath rBV backbone leaving only one FRT site. [Figure 15A] (A; SEQ ID NO: 14) Schematic of DNA sequencing analysis showing the removal of the CAT expression cassette from the Δv-cath rBV backbone containing the CAT and GFP expression cassettes, and (B; SEQ ID NO: 15) the Δv-cath rBV backbone containing only the CAT expression cassette. [Figure 15B] (A; SEQ ID NO: 14) Schematic of DNA sequencing analysis showing the removal of the CAT expression cassette from the Δv-cath rBV backbone containing the CAT and GFP expression cassettes, and (B; SEQ ID NO: 15) the Δv-cath rBV backbone containing only the CAT expression cassette. [Figure 16A]16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, with only one FRT site remaining in place of the v-cath deletion after removal of the CAT expression cassette (FIG. 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (FIG. 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 16D). [Figure 16B] 16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, with only one FRT site remaining in place of the v-cath deletion after removal of the CAT expression cassette (FIG. 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (FIG. 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 16D). [Figure 16C]16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, with only one FRT site remaining in place of the v-cath deletion after removal of the CAT expression cassette (FIG. 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (FIG. 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 16D). [Figure 16D] 16A-16D are a series of diagrammatic representations of an exemplary Δv-cath rBV genome, further comprising a gentamicin selectable marker gene (Genta) and a general foreign protein expression cassette carrying foreign gene 1 and foreign gene 2, each inserted into the bMON14272 bacmid, with only one FRT site remaining in place of the v-cath deletion after removal of the CAT expression cassette (FIG. 16A); a general foreign protein expression cassette carrying Genta, AAV Rep, and Cap AAV genes (FIG. 16B); a general foreign protein expression cassette carrying an AAV genome consisting of Genta, a luciferase gene (FIG. 16C); and a general foreign protein expression cassette carrying Genta and mammalian protein (human antibody heavy chain and human antibody light chain) genes (FIG. 16D). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The disclosures of these patents, patent applications, and publications are hereby incorporated by reference in their entireties into this application in order to more fully describe the state of the art as known to those of skill in the art as of the date of the invention described and claimed herein. In the event of any inconsistency between the patents, patent applications, and publications and this disclosure, the present disclosure will control.

[0041] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The initial definition provided for a group or term herein applies to that group or term throughout this disclosure, unless otherwise stated, either individually or as part of another group.

[0042] The term "bacmid" refers to a shuttle vector that can be propagated in both E. coli and insect cells. The Δv-cath bacmid is a bacmid that has a deletion of the v-cathepsin gene.

[0043] The term "recombinant baculovirus (rBV) DNA backbone" refers to a bacmid comprising the baculovirus genome as described by Luckow et al. (1993), which contains a bacterial origin of replication, antibiotic resistance genes and mini-att Tn7 sites allowing integration of expression cassettes into the backbone, as well as a cathepsin gene.

[0044] The Δv-cath rBV backbone or Δv-cath DNA backbone is a bacmid that has a deletion of the v-cathepsin gene and into which a foreign gene cassette containing viral and / or mammalian genes can be inserted. The terms "Δv-cath" and "v-cath (or cathepsin) gene deletion" are used interchangeably herein.

[0045] The term "recombinant baculovirus (rBV) genome" is used herein to mean a baculovirus DNA genome that contains at least one expression cassette encoding at least one foreign protein. When the rBV genome contains a deleted v-cath gene, it is referred to as a "Δv-cath-rBV genome."

[0046] An rBV vector refers to a recombinant baculovirus that carries the rBV genome, is packaged in a baculovirus capsid, and is capable of infecting insect cells.

[0047] "Virus particle" refers to a biological entity that contains a shell formed by the intracellular expression and efficient assembly of capsid proteins as well as genetic information in the form of RNA or DNA.

[0048] "Selection marker gene" includes genes encoding selection marker proteins, such as, but not limited to, colorimetric proteins or antibiotic resistance proteins, useful for identifying or selecting E. coli cells successfully transformed with the bacmid, and for identifying and selecting insect or mammalian cells successfully infected with rBV.

[0049] A "selectable marker gene cassette" is a DNA sequence encoding a non-native selectable marker gene operably linked to an E. coli or insect promoter and containing two insert sequences that allow for integration of the cassette into a DNA backbone.

[0050] As used herein, the term "foreign protein" refers to a protein that is not encoded by the wild-type baculovirus genome. Such proteins include, but are not limited to, viral proteins and non-insect proteins, such as mammalian proteins.

[0051] A "foreign protein expression cassette" is a DNA sequence encoding at least one non-baculoviral protein, e.g., a viral protein and / or a mammalian protein, operably linked to an insect promoter allowing expression in an insect cell, and may further include a DNA sequence operably linked to a mammalian gene promoter allowing expression in a mammalian cell. The foreign gene expression cassette may further be linked to a selectable marker gene and an insertion sequence allowing integration of the foreign gene expression cassette into the recombinant baculovirus DNA backbone.

[0052] A "donor plasmid" is a DNA vector or plasmid carrying a foreign protein expression cassette flanked by recombination elements, such as transposons, that can be used to transfer the foreign protein expression cassette into a bacmid to create a recombinant baculovirus (rBV) genome.

[0053] The present disclosure relates to a recombinant baculovirus (rBV) expression system for the production in insect cells of foreign heterologous proteins, including mammalian proteins, that are useful for gene therapy. The system includes a recombinant baculovirus genome (Δv-cath-rBV) with a deletion of a cathepsin gene, into which a foreign gene cassette can be integrated, and an insect cell that can be infected by Δv-cath-rBV and in which the foreign protein and / or viral vector or particle is expressed or produced.

[0054] Insect cells infected with rBV with deletions of chitinase A and v-cathepsin are commonly used for the expression of recombinant proteins, especially AAV capsid proteins (Kaba, Salcedo et al. 2004; Galibert, Savy et al. 2018). However, deletion of both chiA and v-cath results in a gelatinous lysate due to the absence of chitinase A to cleave the chitin-rich membrane of insect cells, and the gelatinous nature of the lysate reduces the isolation of proteins from this sticky lysate.

[0055] The system of the present invention unexpectedly allows efficient production of foreign proteins of interest and viral vectors and particles without degradation, in sufficient quantities and infectivity levels to be useful for therapeutic purposes.Compared to systems that use infection of insect cells with rBVs that have both chitinase A gene deletion and v-cathepsin gene deletion, the use of the rBV system of the present invention results in higher AAV yields and higher structural integrity of AAV capsids, especially for certain AAV mutants.This system also allows direct expression of mammalian genes in insect cells.

[0056] Δv-cath-baculovirus backbone The baculovirus DNA backbone according to the present disclosure includes a deletion of the cathepsin gene. One Δv-cath DNA backbone according to the present disclosure is shown in FIG. 1. The deletion is between nucleotides 107,034 and 107,904 based on GenBank ID: NC_001623. In one non-limiting example shown in FIG. 1A, the Δv-cath-DNA backbone includes a mini-art Tn7 site that allows the insertion of one or more foreign gene cassettes and nucleic acids of interest for the expression of foreign proteins. In another example shown in FIG. 1B, DNA fragments of the Δv-cath-rBV DNA backbone from nucleotides 3272-4518 and 5270-6689 based on GenBank ID: 510 001623 were cloned into the pBacPAK shuttle plasmid adjacent to one or more foreign gene cassettes so that the one or more foreign gene cassettes can be inserted into the Δv-cath-rBV DNA backbone by homologous recombination.

[0057] In some rBV backbones, a selection marker cassette is incorporated into the Δv-cath deletion. For example, the v-cath deletion can be replaced with a chloramphenicol (CAT) selection marker expression cassette (CAT promoter-CAT ORF-polyA) flanked by two FRTs (see FIG. 11). Alternatively, in FIG. 1B, the Δv-cath deletion has been replaced with a CAT selection marker expression cassette flanked by two FRTs and a selection marker, green fluorescent protein (GFP) expression cassette (CMV promoter-GFP-WPRE-polyA). The latter selection marker expression cassette is useful for tracking successful infection of insect cells. The cassette can alternatively contain genes encoding other selection markers, for example, other colorimetric, fluorescent, or chemiluminescent marker proteins. Useful fluorescent marker proteins include, but are not limited to, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, and luciferase. Useful colorimetric marker proteins include, but are not limited to, β-galactosidase (lacZ) and secreted placental alkaline phosphatase (SEAP). Useful antibiotic resistance genes are also acceptable selection markers. Such genes include, but are not limited to, kanamycin resistance genes, ampicillin resistance genes, tetracycline resistance genes, gentamicin resistance genes, blasticidin resistance genes, or chloramphenicol resistance genes.

[0058] Another representative Δv-cath rBV DNA backbone is shown in Figure 13. This backbone does not contain a selection marker gene expression cassette. It can be made from the Δv-cath rBV DNA backbone containing the CAT expression cassette by genome engineering using FLP-FRT recombination technology, which can remove the CAT expression cassette between the FRT sites, leaving only one FRT site in the Δv-cath rBV DNA backbone, as illustrated in Figure 11.

[0059] The rBV Δv-cath DNA backbone according to the present disclosure also contains a chitinase gene (positions 105,282-106,937 in Figures 1, 11, 12, and 13). In addition, the backbone contains a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone. Useful examples of this fragment include, but are not limited to, a Tn7 transposon fragment. For example, in the rBV DNA backbone shown in Figure 1A, this fragment resides within the LacZ coding sequence between the kanamycin gene and the mini-F replication sequence in the bMON14272 rBV DNA backbone.

[0060] Synthesis of Δv-cath skeleton The Δv-cath backbone can be generated from a bacmid containing a WT baculovirus genome (AcMNPV (NC_001623)) in which a composite fragment (Kan LacZ+mini-att Tn7 mini-F replicon) has been inserted into the polyhedrin region, as illustrated in bMON14272 (see Example 2), or can be synthesized de novo.

[0061] Starting from a bacmid, a CAT selection marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR amplified using primers 2846 (5'-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAGGCGTTT CCATATGAATATCCTCCTTA-3') (SEQ ID NO:1) and 6281 (5'-ATAACTAGTCAATAATCAATGTCGTGTAGGCTGGAGCTGCTTCGAA-3') (SEQ ID NO:2) and plasmid pKD3 as template. A GFP (or other selection marker) expression cassette can be PCR amplified using primers 5701 (5'-GACATTGATTATTGACTAGTTATTAATAGT-3') (SEQ ID NO:3) and 6282 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCGCGGT TAGATCCAGACATGATAAGAT-3') (SEQ ID NO:4) and plasmid V376 as template. The two PCR fragments can then be ligated using primers 6298 (5'-TAATAAATGACTGCAGTAGACGCAA-3') (SEQ ID NO:5) and 6299 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3') (SEQ ID NO:6) and the two PCR fragments as templates to form a larger PCR fragment. This larger PCR fragment can be recombined with the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene by the λred system (Datsenko and Wanner 2000; Thomason, Sawitzke et al., 2014). The junction sequence between the CAT expression cassette and the GFP expression cassette and the remaining v-cath are shown in Figure 2.

[0062] The Δv-cath DNA backbone without the selection marker gene cassette can be generated from a bacmid, e.g., bMON14272, or synthesized de novo. When starting from a bacmid, the CAT selection marker expression cassette flanked by two flippase recognition targets (FRTs) can be PCR amplified using primers 2845 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTACGGCGTTGTAAACAGCG CGGTT GTGTAGGCTGGAGCTGCT-3') (SEQ ID NO: 7) and 2846 (5'-TAATAAATGACTGCAGTAGACGCAAGTTCGTTTCTCATACCACAG GCGTT TCCATATGAATATCCTCCTTA-3') (SEQ ID NO: 1) and the plasmid pKD3 as template. This PCR fragment containing the CAT expression cassette flanked by two FRTs can be amplified using the λred system (Datsenko and Wanner 2000; Thomason, Sawitzke et al. 2009). The bacmid DNA can be recombined into the v-cath region between nucleotides 107,034 and 107,904 to disrupt the v-cath gene (E. et al., 2014). After selection of the bacmid DNA and confirmation of the cathepsin deletion, the CAT expression cassette can be removed by FLP-FRT recombination technology, leaving only one FRT site in the bacmid as shown in FIG. 13.

[0063] Δv-cath rBV genome The rBV genome according to the present disclosure can replicate in E. coli cells and in insect cells. It comprises a Δv-cath DNA backbone and a foreign protein expression cassette integrated into the Δv-cath rBV genome as described above. The foreign protein expression cassette comprises a gene or genes encoding a foreign protein of interest to be expressed in insect cells, as well as a gene or genes encoding other proteins of interest to be expressed in mammalian cells. Useful genes encoding foreign proteins of interest for expression in insect cells include, but are not limited to, viral proteins and / or mammalian proteins.

[0064] Useful viral proteins expressed can carry a mammalian gene of interest and form the structural part or capsid of a vector that can be delivered to a mammalian cell. For example, a foreign protein expression cassette can include genes encoding AAV viral proteins, such as Rep and capsid (Cap) proteins (Figure 5B). Other viral proteins useful in gene therapy methods include, but are not limited to, hexon, penton complex, fiber protein from adenovirus, matrix, capsid, nucleocapsid protein from retroviruses, such as, but not limited to, lentivirus, VP5, VP23, VP19C, VP26, and capsid-vertex-specific component protein from herpes simplex virus (HSV), and VP1 major protein from SV40.

[0065] Useful mammalian proteins that can be expressed directly in insect cells include, but are not limited to, human immunoglobulins, human serum albumin, erythropoietin-α, and Factor VIII.

[0066] The foreign protein cassette also includes regulatory elements, including, but not limited to, insect cell promoters that allow the expression of operably linked genes in insect cells. Useful insect promoters include, but are not limited to, polyhedrin (polh), p10, OpIE2, or p6.9 insect promoters. When the cassette includes mammalian genes that are expressed in mammalian cells, promoters that allow the expression of these mammalian genes in mammalian cells are operably linked to the genes. Useful mammalian promoters include, but are not limited to, CMV, SV40, pGK, EF1a, synapsin, chicken beta actin, and CamKII promoters.

[0067] The foreign protein expression cassette may also be linked to one or more additional selectable marker genes, which are expressed upon infection of the insect cells and which are different from the selectable marker gene in the selectable marker expression cassette as described above (if present in the rBV backbone).

[0068] The foreign protein expression cassette is flanked by DNA transposable elements that allow it to be integrated into the rBV DNA backbone at a specific nucleic acid site or position. Useful DNA transposable elements include, but are not limited to, Tn7L and Tn7R (FIG. 1A). Alternatively, the foreign protein expression cassette is flanked by sequences homologous to the rBV genome, e.g., sequences between 3,272-4,518 and 5,270-6,689, that allow it to be integrated into the rBV DNA backbone by the homologous recombination mechanism shown in FIG. 1B.

[0069] As shown in FIG. 6, integration of the cassette into the baculovirus backbone can be achieved by transformation of a donor plasmid (e.g., pFastBac-1). The donor plasmid contains an appropriate promoter, enhancer, and polyadenylation signal, as well as one or more foreign protein expression cassettes operably linked to a bacterial selectable marker gene and promoter. The transposase expressed by the helper plasmid catalyzes the transposition of Tn7L and Tn7R flanking the foreign protein expression cassette to specific sites within the mini-att Tn7 region of the bacmid, thereby integrating the foreign expression cassette into the bacmid. Alternatively, the foreign protein expression cassette can be inserted into the appropriate region of the recombinant baculovirus backbone by other methods, including but not limited to, homologous recombination using a donor plasmid containing homologous sequences of rBV flanking the foreign protein expression cassette as shown in FIG. 1B.

[0070] An exemplary generalized rBV genome diagram with a v-cath deletion / insertion of CAT and GFP selection marker expression cassettes and additional insertion of two foreign protein cassettes is shown in FIG. 5A. FIG. 5B shows an rBV genome with a Δv-cath deletion and insertion of AAV Rep and Cap foreign protein expression cassettes. FIG. 5C shows an rBV genome with a Δv-cath deletion / insertion of AAV, gentamicin, and luciferase foreign protein expression cassettes. FIG. 5D shows an rBV genome with a Δv-cath deletion and insertion of a gentamicin / mammalian protein expression cassette insert encoding the light and heavy chains of a human antibody. Alternatively, an rBV genome with a v-cath deletion, no insertion of CAT and GFP selection marker expression cassettes, and additional insertion of two foreign protein cassettes is shown in FIG. 16A. FIG. 16B shows an rBV genome with a Δv-cath deletion and insertion of AAV Rep and Cap foreign protein expression cassettes. Figure 16C shows the rBV genome with the Δv-cath deletion / AAV, gentamicin, and luciferase foreign protein expression cassette insertions, and Figure 16D shows the rBV genome with the Δv-cath deletion and gentamicin / mammalian protein expression cassette inserts encoding the light and heavy chains of a human antibody.

[0071] cell culture Cells that can be infected with rBV vectors or transformed with bacmids include insect cells or prokaryotic cells such as E. coli. Useful E. coli cells include, but are not limited to, Topl0, DH5a, DH10B, TGI, BW23473, BW23474, MW003, Mwoo5, and BL21. Useful insect cells that can be infected with rBV vectors include, but are not limited to, Sf9, Sf21, Express Sf+, and S2 cells from Spodoptera frugiperda, or BTI-TN-5B1-4 (High Five cells) from Trichoplusia ni (Lepidoptera), D. melanogaster, and other cell lines. These cells are commercially available from a number of sources (e.g., ThermoFisher Scientific, ATCC, and Expression Systems). Insect cells can be maintained and grown in a medium that promotes their growth, such as, but not limited to, Gibco Insect Media: ExpiSf CD Medium, Sf-900 III SFM, Express Five They are cultured in SFM, or SF-900 II SEM (ThermoFisher Scientific), ESF921, and ESFAF (Expression Systems).

[0072] rBV infection The rBV can be cultured in a medium that promotes expression of the foreign protein, e.g., Gibco insect medium (ExpiSf), by contacting the cells under conditions that promote virus entry into the cells. Insect cells are infected by culturing in CD medium, Sf-900 III SFM, Express Five SFM), or SF-900 II SEM (ThermoFisher Scientific), ESF921 or ESF AF medium (Expression Systems) for about 3 days at about 28° C. Successful infection can be monitored, for example, by expression of a visually detectable selectable marker protein or expression of a gene incorporated into the rBV genome.

[0073] Foreign Protein Expression and Isolation Foreign proteins, including those that are structural parts of viral vectors carrying mammalian genes or those that are directly expressed from mammalian genes, can be obtained from infected insect cells by lysing the cells and isolating the proteins from the lysate. Lysis can be accomplished by physical forces (e.g., French press or sonication), lysis buffers containing detergents, or enzymatic digestion of the cell matrix, for example, with chitinase naturally expressed by the baculovirus genome.

[0074] The expressed foreign protein or the produced viral particles can be isolated, for example, by chromatographic or electrophoretic methods, or by centrifugation, for example, on a cesium chloride gradient.

[0075] These isolated and purified proteins can then be used, for example, for therapeutic purposes or as research reagents. If the foreign protein is part of a viral vector carrying a mammalian gene, the viral vector can be isolated and then used to infect mammalian cells, for example, for gene therapy.

[0076] Effect of Δv-cath deletion on foreign protein expression To demonstrate that the deletion of the v-cath gene from the baculovirus genome had no effect on baculovirus replication, the replication of wild-type rBV was compared with that of the Δv-cath-rBV according to the present disclosure. Both rBVs carrying the same foreign genes (AAV capsid and rep or GFP) were used to infect insect cells (Sf9). The titers of the WT baculovirus and the Δv-cath deletion mutant rBV were then determined to be comparable, demonstrating that the v-cath deletion had no adverse effect on virus production (FIG. 8).

[0077] To demonstrate that the foreign protein expressed from Δv-cath rBV was not degraded, the expression of the foreign protein in cells infected with Δv-cath rBV was compared with that in cells infected with WT-rBV. The resulting synthesized AAV vector was then purified from cell lysates. After heating both types of AAV particles, their capsid proteins were examined by SDS-PAGE.

[0078] The results shown in Figure 9 demonstrate that deletion of the v-cath gene reduced the degradation of capsid proteins. AAV7m8 was significantly degraded when produced by WT-rBV, in contrast to AAV7m8 capsids produced by Δv-cath-rBV, which showed no degradation (compare lanes 2 and 6). AAV8 (lane 3) and AAV6 (lane 4) capsid proteins were only slightly degraded.

[0079] To demonstrate that Δv-cath rBV can result in higher AAV yields than WT-rBV, AAV7m8-luciferase vectors and AAVphpb-luciferase vectors were produced in Sf9 cells infected with Δv-cath rBV and WT-rBV, respectively. For lysates infected with WT-rBV, a protease inhibitor, leupeptin, was added to the lysis buffer to prevent degradation when preparing cell lysates so that AAV production yields could be retained. No protease inhibitor was added to lysates infected with Δv-cath rBV. After purification, AAV vectors were quantified. The results are shown in Table 1. [Table 1]

[0080] These results indicate that the expression of a foreign protein in cells transduced with Δv-cath rBV is 3- to 4-fold higher than the expression of the same foreign protein in cells transduced with WT-rBV.

[0081] It was also determined that the AAV vectors produced by Δv-cath rBV had higher infectivity in mammalian cells compared to those produced by WT-rBV. Tests were performed in HEK-293 cells using AAV vectors isolated from insect cells infected with either WT-rBV or the deletion mutants. GFP expression was recorded. The results shown in Figures 10A-10F demonstrate that the AAV vectors produced by WT-rBV (Figures 10A-10C) have lower infectivity than those produced by Δv-cath rBV (Figures 10D-10F).

[0082] Reference will now be made to specific examples illustrating the present disclosure, with it being understood that the examples are provided to illustrate representative embodiments and that no limitation of the scope of the present disclosure is intended thereby. EXAMPLES

[0083] Example 1 insect cell culture Sf9 cells (Expression Systems, Davis, CA) were cultured in Corning storage bottles in ESF921 or ESF AF medium (Expression Systems) supplemented with 100 units / mL penicillin and 100 μg / mL streptomycin (HyClone, Logan, UT) at 28°C. Cell densities of approximately 8 × 10 6 Once cells / mL was reached, the cells were split 1:4.

[0084] Example 2 Deletion of the v-cath gene from the baculovirus backbone The protocol of the λred system (Thomason, Sawitzke et al., 2014) was used to perform the deletion. Briefly, a 1.1 kB fragment containing the chloramphenicol acetyltransferase (CAT) expression cassette flanked by two FRTs (Figure 2, bases 51-1066) was PCR amplified using primers 2846 (SEQ ID NO: 1) and 6281 (SEQ ID NO: 2) and plasmid pKD3 (The ODIN, Oakland, CA) as template. A 2.2 Kb fragment containing the GFP expression cassette (Figure 2, bases 1067-3223) was PCR amplified using primers 5701 (SEQ ID NO: 3) and 6282 (SEQ ID NO: 4) and V376 as template. After gel purification, both PCR fragments were ligated using primers 6298 (SEQ ID NO: 5) and 6299 (SEQ ID NO: 6) to form a 3275 bp PCR fragment. The PCR fragment was digested with the restriction enzyme DpnI (New England Biolabs, Ipswich, MA) to remove contaminating plasmid template. Plasmid pKD46 containing red recombinase (The ODIN) was then introduced into DH 10Bac-competent cells (ThermoFisher Scientific) by electroporation to obtain a colony of DH10Bac containing red recombinase. One of the colonies was induced with 0.035% L-(+)-arabinose (Sigma-Aldrich, St. Louis, MO) to express the recombinase. After induction at 37°C for 45 minutes with gentle shaking, the DH10Bac competent cells containing red recombinase were electroporated with the 3275 bp CAT-GFP PCR fragment and incubated for an additional 3 hours to allow recombination to occur. The electroporated DH10Bac-red cells were cultured overnight.

[0085] A colony containing the bacmid with the v-cath deletion was confirmed by DNA sequencing analysis and named DH10Bac-Δv-cath. One of these colonies was selected to prepare competent cells for use in generating recombinant baculovirus lacking v-cath.

[0086] Example 3 Recombinant baculovirus production A recombinant baculovirus shuttle vector (bacmid) capable of recombining with the donor plasmid was used to generate a recombinant baculovirus containing the gene of interest according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). Briefly, the donor plasmid was diluted to a concentration of 2ng / μL in sterile TE buffer (10 mM Tris-HCL, 1 mM EDTA, pH 8.0), and 2 μL of the diluted plasmid DNA was used to transform 20 μL of DH10Bac-wild type (wt) competent cells or DH10Bac-Δv-cath competent cells. After incubation on LB agar plates at 37° C. for 2 days, white colonies were picked and miniprep bacmid DNA was prepared according to the manufacturer's protocol (Invitrogen).

[0087] The miniprep bacmid DNA was then used to transfect Sf9 cells according to a modified manufacturer's protocol (Invitrogen) to generate recombinant baculovirus. Briefly, 5 μg of miniprep bacmid DNA and 5 μl of GenJet reagent (SignaGene Labs, Rockville, MD) were each diluted in 100 μl of ESF AF medium (Expression Systems) in a sterile 1.5 mL microtube. The diluted GenJet reagent was transferred to the diluted bacmid DNA tube and mixed by gently pipetting up and down three times. After incubation at room temperature for approximately 30 minutes, 0.8 mL of ESF AF medium was added to the GenJet-bacmid mixture and mixed by pipetting up and down three times. Sf9 cells were cultured at 1.5 × 10 in 2 mL of ESF AF medium in a 6-well plate. 6The cells were plated at a density of 10 cells / well and incubated in an incubator at 28° C. for approximately 30 minutes to allow for attachment. The medium was removed from each well and then the GenJet-Bacmid mixture was added. After overnight incubation at 28° C. in an incubator, 1 mL of ESF AF medium was added and the plates were incubated at 28° C. for a total of 4 days to generate recombinant baculovirus. The recombinant baculovirus in the medium was collected and stored in the dark at 4° C.

[0088] The recombinant baculoviruses constructed from DH10Bac-wt and DH10Bac-Δv-cath were designated WT-rBV and Δv-cath rBV, respectively.

[0089] Example 4 Effect of v-cath deletion on rBV replication To determine whether the deletion of the v-cath gene affected baculovirus replication, three pairs of WT-rBV and Δv-cath rBV were used. The first pair, WT-rBV-Cap6-Rep and Δv-cath-rBV-Cap6-Rep, carry the AAV6 capsid genes encoding VP1, VP2, and VP3, respectively, and the AAV2 rep genes encoding rep78 and rep52. The second pair, WT-rBV-GFP and Δv-cath rBV-GFP, carry the GFP gene encoding green fluorescent protein, respectively. The third pair, WT-rBV-Cap7m8-Rep and Δv-cath rBV-Cap7m8-Rep, carry the AAV7m8 capsid genes encoding VP1, VP2, and VP3, respectively, and the AAV2 rep genes encoding rep78 and rep52.

[0090] All generated rBVs were used to infect Sf9 cells for amplification. Briefly, 1 mL of each rBV was added to 2 × 10 Sf9 cells in a Corning culture bottle. 6The rBV was added to 200 mL of Sf9 cells at a density of 1000 cells / mL and amplified for 3 days at 28° C. and 180 rpm in a shaker incubator (New Brunswick, Hauppauge, NY). The supernatant was collected by centrifugation at 2,000 rpm for 10 min to remove the cell pellet. The rBV titer of the supernatant was determined by quantitative polymerase chain reaction (QPCR) method as described in Example 5.

[0091] Example 5 Quantification of rBV To determine the titer of recombinant baculovirus, a specific QPCR method for rBV titration developed at Virovek was used. Briefly, 50 μl of rBV supernatant was mixed with 50 μL of 0.2% SDS solution and heated at 95°C for 30 min to release rBV DNA. rBV DNA was diluted 1:100 in QPCR dilution buffer (10 μg / mL yeast tRNA (Sigma Aldrich, Saint Louis, MO), 0.01% Tween 80, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA) and rBV copy numbers were determined using the Chromo 4 Four-Color Real-time Detection System (Bio-Rad, Hercules, CA) with primers corresponding to the gentamicin gene (3065: 5'-ATTTGACTTGGTCAGGGCCG-3'9 (SEQ ID NO:8) and 3066: 5'-TGTTACGCAGCAGGGCAGTC-3' (SEQ ID NO:9)) and SYBR Green PCR Master Mix (ThermoFisher Scientific, Fremont, CA). It was empirically determined that one plaque-forming unit (pfu) contains an average of 20 copies of the rBV genome.

[0092] Example 6 AAV vector production and purification To produce AAV vectors, recombinant baculoviruses were used to infect insect cells. Briefly, 10 moi of recombinant baculovirus containing AAV Rep and Cap genes was co-infected with 5 moi of recombinant baculovirus containing a GFP marker gene flanked by AAV ITRs for 3 days at 28°C. Cell pellets were collected by centrifugation at 3000 rpm for 10 min. Cell pellets were lysed in SF9 lysis buffer (50 mM Tris-HCl (pH 7.8), 50 mM NaCl, 2 mM MgCl 2 The cells were lysed by sonication in 1% Sarkosyl, 1% Triton X-100, and 140 units / mL Benzonase nuclease (Sigma Aldrich). Cell debris was removed by centrifugation at 8,000 rpm for 20 minutes. Approximately 23 mL of the clarified lysate was transferred to an ultraclear centrifuge tube for a SW28 rotor (Beckman Coulter, Brea, CA), followed by 10 mL of 1.32 g / cc and 5 mL of 1.55 g / cc CsCl solution, and centrifuged at 28,000 rpm for approximately 20 hours at 15°C. The AAV vector band was visualized with a beam of light shining from the bottom and collected by a syringe needle. The collected AAV vector was transferred to another centrifuge tube for a 70.1 ti rotor (Beckman Coulter), which was then filled with 1.38 g / cc CsCl solution and sealed. After centrifugation at 65,000 rpm for about 20 hours, the AAV vector band was visualized with a beam of light shining on the bottom and collected with a syringe needle. The AAV vector was buffer exchanged using a PD-10 desalting column (GE Healthcare Bio-Sciences, Pittsburgh, PA). After sterilization by filtration, the AAV vector was used for further experiments.

[0093] Example 7 Quantification of AAV vectors AAV vectors in crude lysate or purified form were quantified by QPCR following a modified protocol from that described by Aurnhamme et al. (Hum. Gene Ther. Meth. (2012) 23(1):18-28). Briefly, AAV samples were first diluted 1:100 in QPCR dilution buffer, and 10 μl of diluted AAV was added to 39 μl of DNase I digestion buffer (10 mM Tris-HCl (pH 8.0), 2.5 mM MgCl ). 2 , 0.5 mM CaCl 2 Contaminating DNA was removed by incubation with 1 μl (2 units) of DNase I enzyme (New England Biolabs) in 1000 mL of 5000 ng / mL PBS at 37° C. for 1 h. The DNase I enzyme was inactivated by mixing with 50 μl of 200 mM EDTA and heating at 95° C. for 30 min. Treated AAV samples were further diluted 1:200 and 10 μl of each AAV sample was used to determine the copy number of AAV vector genomes on a Chromo4 QPCR instrument (Bio-Rad, Hercules, CA).

[0094] Example 8 Retention of capsid integrity in AAV vectors produced by Δv-cath rBV AAV vectors were produced by co-infection of Sf9 cells with Δv-cath rBV or WT-rBV and purified by two rounds of cesium chloride ultracentrifugation as described in Example 6. Equal amounts (1 × 10 11 Purified AAV particles (vg) were heated at 95° C. for 5 min. Capsid proteins were separated by SDS-PAGE and stained with the Simply Blue staining kit to determine the amount of capsid protein degradation (if any) produced by each type of rBV.

[0095] Example 9 Infectivity of AAV vectors produced by rBV AAV vectors produced in Sf9 cells using Δv-cath rBV or WT-rBV were purified and quantified as described above in Example 7. To compare their infectivity, these AAV vectors were used to transduce HEK-293 cells. HEK-293 cells (ATCC-CRL-1573, Manassas, VA) were cultured in Corning 12-well cell culture plates in DMEM medium (Mediatech, Manassas, VA) supplemented with 100 units of penicillin-streptomycin (Corning, NY) containing 10% FBS (Hyclone, Logan, UT) at 4°C for 1 h at 20 °C for 3 h at 20 °C. 2 Plates were cultured at 37°C in an incubator until approximately 70% confluent. AAV samples were each diluted in 1 mL of DMEM containing 20 μm etoposide (AG Scientific, San Diego, CA) but no FBS to obtain 3.0e+9vg / mL. After removing the old medium from the plates, 0.5 mL of diluted AAV sample was added to each well and the plates were incubated at 4°C for 1 h at 20°C for 3 h at 20°C. 2 The plates were incubated overnight at 37°C in an incubator. The next morning, 0.5 mL of DMEM medium containing 20% ​​FBS and 100 units of penicillin-streptomycin was added to each well, and transduction was carried out for 2-3 days. Cells expressing GFP were recorded under a Nikon Eclipse TS100 fluorescence microscope (Nikon Instruments, Melville, NY).

[0096] Example 10 Expression of SV40 capsid protein in insect cells infected with Δv-cath rBV To express SV40 capsid protein, a recombinant baculovirus carrying the SV40 capsid gene was used to infect insect cells. Briefly, 10 moi of recombinant baculovirus was added to 300 mL of Sf9 cells and incubated at 28 °C for 3 days. The cell pellet was collected by centrifugation at 3000 rpm for 10 min. The cell pellet was dissolved in SF9 lysis buffer (50 mM Tris-HCl (pH 7.8), 50 mM NaCl, 2 mM MgCl ). 2The cells were lysed by sonication in 1% Sarkosyl, 1% Triton X-100, and 140 units / mL Benzonase nuclease (Sigma Aldrich). Cell debris was removed by centrifugation at 8,000 rpm for 20 min. Approximately 23 mL of the clarified lysate was transferred to an ultraclear centrifuge tube for a SW28 rotor (Beckman Coulter, Brea, CA), followed by 10 mL of 1.32 g / cc and 5 mL of 1.55 g / cc CsCl solution and centrifuged at 28,000 rpm for approximately 20 h at 15°C. The SV40 virus-like particle band was visualized with a beam of light shining from the bottom and collected by a syringe needle. The collected SV40 virus-like particles were transferred to another centrifuge tube for a 70.1 ti rotor (Beckman Coulter), which was then filled with 1.38 g / cc CsCl solution and sealed. After centrifugation at 65,000 rpm for about 20 hours, the SV40 virus-like particle band was visualized with a beam of light shining on the bottom and collected with a syringe needle. The SV40 virus-like particle was buffer-exchanged using a PD-10 desalting column (GE Healthcare Bio-Sciences, Pittsburgh, PA). After sterilization by filtration, the SV40 virus-like particle was used for further experiments.

[0097] Example 11 Expression of human antibody heavy and light chains in insect cells infected with Δv-cath rBV For protein expression, recombinant baculoviruses carrying human antibody heavy and light chain expression cassettes were used to infect Sf9 cells. Briefly, 10 moi of rBV was used to infect 300 mL of Sf9 cells at 28° C. for 3 days, and both the supernatant and cell pellet were collected, respectively. The cell pellet was lysed in Sf9 lysis buffer as described in Example 6, and the clarified lysate was collected. The expressed human antibodies in the supernatant and lysate were purified using protein A agarose and analyzed by SDS-PAGE.

[0098] Example 12 Removal of the selection marker expression cassette by FLP / FLPe expression Two versions of the cathepsin-deleted baculovirus DNA backbone were constructed: one with a CAT expression cassette flanked by two FRTs and the other with a GFP expression cassette in addition to the CAT expression cassette flanked by two FRTs integrated into the cathepsin deletion region.

[0099] To remove the CAT expression cassette between the FRT sites from the baculovirus backbone, the following experiment was performed. A glycerol stock of bacteria containing DH10Bac-Δcath was streaked onto an LB plate containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol and grown overnight (ON) at 37 °C. The following night, a well-growing colony was picked and grown overnight at 37 °C with agitation in 1 mL of LB medium containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol. The following morning, 30 μL of the ON culture was diluted into 1.4 mL of LB medium containing 10 μg / mL tetracycline and 25 μg / mL chloramphenicol and incubated at an OD of 0.3-0.5. 600The cells were grown at 37°C until 30 min. The cell pellet was collected by centrifugation at 11,000 rpm for 30 s. After removing the supernatant, the cell pellet was placed on ice and resuspended in 1 mL of ice-cold 10% glycerol. The cell pellet was centrifuged again at 11,000 rpm for 30 s to remove most of the supernatant, leaving 20-30 μL in the tube to resuspend the cell pellet. Plasmid pCP20 containing 1 μL (500 ng / μL) of FLP recombinase (The ODIN, Oakland, CA) was added to the resuspended cells maintained on ice and mixed briefly. The cells were then transferred to a chilled electroporation cuvette (Molecular Bioproducts, Inc., Cat#5510-11, Fischer Scientific) and electroporated on a BioRad MicroPulser instrument (Hercules, Ca) at the "bacteria" setting. After electroporation, the cells were added to 1 mL of LB medium without antibiotics and incubated at 30°C for 2 h with agitation. 100 μL of the cell solution was plated on LB plates containing 100 μg / mL ampicillin (Thermo Fisher Scientific, Waltham, MA), 50 μg / mL kanamycin (Thermo Fisher Scientific, Waltham, MA), and 10 μg / mL tetracycline (Thermo Fisher Scientific, Waltham, MA) and grown overnight at 30°C. Eleven well-growing colonies were picked, streaked onto LB plates without antibiotics, and grown overnight at 43°C to allow expression of the recombinase, which recombines to remove the chloramphenicol expression cassette present between the two FRT sites. The next morning, bacteria from each colony were removed with a pipette tip and resuspended in 20 μL of cold Milli Q purified water (Millipore Sigma).

[0100] PCR reactions were performed using 2 μL of resuspended bacteria from each colony to confirm removal of the DNA sequence between the two FRT sites. Forward primer 6298 (5'-TAATAAATGACTGCAGTAGACGCAA-3') (SEQ ID NO: 5) and reverse primer 6299 (5'-GAACAAAATTTTGTTTTATTTGTTTGTGTA-3') (SEQ ID NO: 6) were used to confirm removal of the CAT expression cassette from DH10Bac-Δv-cath, which contains a GFP expression cassette in addition to the CAT expression cassette flanked by two FRTs. Forward primer 2847 (5'-CTACGAGCGCATAATTGCGA-3') (SEQ ID NO: 10) and reverse primer 2848 (5'-GTTTGGTCATGTAGTTAACTTTG-3') (SEQ ID NO: 11) were used to confirm removal of the CAT expression cassette from DH10Bac-Δv-cath, which contains only the FRT-flanked CAT expression cassette. The PCR conditions shown in Table 2 below were used. [Table 2]

[0101] After the PCR reaction, the amplified PCR fragments were electrophoresed on a 1% agarose gel. As shown in Figure 14A, for DII10Bac-Δv-cath containing the CAT and GFP expression cassettes, the PCR fragments from 11 colonies had a fragment size of 2346 bp, while the control colonies #12 and #13 had a fragment size of 3276 bp, indicating that the CAT expression cassette (930 bp) was removed from colonies 1 to 11. DNA sequencing analysis further confirmed that the CAT expression cassette was removed and that the FRT (minimal) sequence and the GFP expression cassette remained in the v-cath deletion region (Figure 15A).

[0102] For DH10Bac-Δv-cath, which contains only the CAT expression cassette flanked by two FRTs, only three colonies (#1, #5, and #7) out of eight colonies that underwent the deletion treatment showed PCR amplification of a fragment size of 651 bp, indicating the deletion of the CAT expression cassette (Figure 14B). DNA sequencing analysis further confirmed that the CAT expression cassette was deleted and only the FRT sequence remained in the v-cath deletion region (Figure 15B).

[0103] Equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described specifically herein which equivalents are intended to be encompassed by the scope of the following claims. In certain embodiments, for example, the following are provided: (Item 1) A recombinant baculovirus (rBV) DNA backbone comprising: A chitinase gene, Deletion of the v-cath gene and and a DNA fragment that allows for the incorporation of one or more foreign protein expression cassettes into the backbone, such that one or more foreign proteins expressed in insect cells are less degraded than if they were expressed from an rBV backbone without the deletion. (Item 2) 2. The rBV DNA backbone of item 1, wherein the DNA fragment comprises DNA sequences homologous to two sequences flanking the one or more foreign protein expression cassettes in a donor plasmid. (Item 3) 2. The rBV DNA backbone of item 1, wherein the DNA fragment is derived from bMON14272. (Item 4) 4. The rBV DNA backbone of item 3, wherein the DNA fragment comprises an origin of replication. (Item 5) 4. The rBV DNA backbone of item 3, wherein the DNA fragment further comprises a reporter gene. (Item 6) 2. The rBV DNA backbone of item 1, further comprising a selectable marker expression gene cassette integrated into the cath-v deletion. (Item 7) rBV DNA backbone according to item 1, A foreign protein expression cassette, comprising: At least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene; and a foreign protein expression cassette comprising two DNA sequences that enable the foreign protein expression cassette to be integrated into the rBV DNA backbone; and (Item 8) 8. The rBV genome of item 7, wherein the at least one foreign protein gene in the foreign expression cassette comprises at least one viral protein gene and / or at least one mammalian protein gene. (Item 9) The rBV genome of item 8, wherein the viral protein gene encodes an AAV protein, an adenovirus protein, a retrovirus protein, an SV40 protein, or a herpes simplex virus protein. (Item 10) 10. The rBV genome of item 9, wherein the foreign protein expression cassette comprises a sequence encoding at least one AAV capsid protein or at least one SV40VP1 major capsid protein. (Item 11) 8. The rBV genome of item 7, wherein the two DNA sequences that enable the foreign protein expression cassette to be integrated into the DNA backbone are homologous to DNA sequences within the rBV DNA backbone or are transposable elements. (Item 12) Item 6, a rBV DNA backbone; A foreign protein expression cassette, comprising: At least one foreign protein gene, an insect cell promoter operably linked to the at least one foreign gene; and a foreign protein expression cassette comprising two DNA sequences that enable the foreign protein expression cassette to be integrated into the rBV DNA backbone; and (Item 13) Item 7, the rBV genome; and at least one baculovirus capsid protein. (Item 14) 14. The recombinant baculovirus vector or particle of item 13, wherein the rBV genome comprises DNA encoding at least one AAV capsid protein. (Item 15) Item 13. The rBV genome according to item 12, A recombinant baculovirus vector or particle comprising at least one baculovirus capsid protein. (Item 16) 14. An insect cell comprising the recombinant baculovirus vector or particle according to item 13. (Item 17) 17. The insect cell of item 16, further comprising at least one foreign protein expressed from the foreign protein expression cassette in the rBV backbone of the rBV genome. (Item 18) 16. An insect cell comprising the recombinant baculovirus vector or particle according to item 15. (Item 19) Item 14. A rBV vector or particle according to item 13, and an insect cell susceptible to infection and capable of expressing said at least one foreign protein encoded by said rBV backbone in said rBV vector or particle. (Item 20) 20. The heterologous expression system of item 19, wherein the rBV vector or particle comprises an rBV backbone comprising a foreign protein expression cassette, the foreign protein expression cassette comprising a sequence encoding at least one AAV capsid protein. (Item 21) Item 16. A rBV vector or particle according to item 15, and an insect cell susceptible to infection and capable of expressing said at least one foreign protein encoded by said rBV backbone in said rBV vector or particle. (Item 22) 1. A non-adherent insect cell lysate comprising: A recombinant baculovirus (rBV) genome according to item 7; and at least one foreign protein encoded by the rBV genome and expressed in the lysate. (Item 23) 23. The non-adhesive insect cell lysate of item 22, wherein the at least one foreign protein encoded by the rBV genome is at least one AAV capsid protein. (Item 24) 1. A non-adherent insect cell lysate comprising: A recombinant baculovirus (rBV) genome according to item 12; and at least one foreign protein encoded by the rBV genome and expressed in the lysate. (Item 25) 1. A method for producing a foreign protein in an insect cell, comprising: Infecting said insect cells with the recombinant baculovirus vector or particle according to item 13; culturing the infected cells under conditions conducive to expression of the foreign protein gene; and isolating the foreign protein from the insect cells. (Item 26) 26. The method of claim 25, wherein the at least one foreign protein is at least one recombinant AAV capsid protein. (Item 27) A recombinant AAV capsid protein produced by the method described in item 26. (Item 28) 1. A method for producing a foreign protein in an insect cell, comprising: Infecting said insect cells with the recombinant baculovirus vector or particle according to item 15; culturing the infected cells under conditions conducive to expression of the foreign protein gene; and isolating the foreign protein from the insect cells.

Claims

[Claim 1] The invention described in the specification.

Images