Genetically engineered hematopoietic stem cells and uses thereof

Abstract

To provide methods for producing genetically engineered hematopoietic cells, populations of genetically engineered hematopoietic cells, and pharmaceutical compositions comprising the populations of hematopoietic cells for use in combinational therapy to treat hematopoietic malignancies.SOLUTION: The present invention provides genetically engineered hematopoietic cells such as hematopoietic stem cells having one or more genetically edited genes of lineage-specific cell-surface proteins, and uses thereof, either alone or in combination with immune therapy that targets the lineage-specific cell-surface proteins.SELECTED DRAWING: Figure 1A

Description

[Technical Field]

[0001] This application claims priority to U.S. Serial No. 62 / 723993, filed August 28, 2018, U.S. Serial No. 62 / 728061, filed September 6, 2018, U.S. Serial No. 62 / 789440, filed January 7, 2019, and U.S. Serial No. 62 / 809202, filed February 22, 2019, the entire contents of each of which are incorporated herein by reference. [Background technology]

[0002] A major challenge in designing targeted therapies is the successful identification of proteins that are uniquely expressed on cells whose elimination would be therapeutically relevant (e.g., abnormal, malignant, or other target cells), but that are not present on cells that one does not wish to eliminate (e.g., normal, healthy, or other non-target cells). For example, many cancer therapies struggle to effectively target cancer cells while leaving normal cells unharmed.

[0003] Emerging alternative strategies involve targeting entire cell lineages, including targeting normal, cancer, and precancerous cells. For example, CD19-targeted chimeric antigen receptor T cells (CAR T cells) and anti-CD20 monoclonal antibodies (e.g., rituximab) each target B-cell lineage proteins (CD19 and CD20, respectively). While potentially effective in treating B-cell malignancies, the use of such therapies is limited because depletion of B cells is harmful. Similarly, targeting lineage-specific proteins of other cell populations, such as myeloid lineage cells (e.g., cancers arising from myeloid blasts, monocytes, megakaryocytes, etc.), is unlikely because these cell populations are necessary for survival.

[0004] Therefore, there remains an unmet need to effectively target cells of interest, such as cancer cells, without targeting or harming normal cell populations. Summary of the Invention

[0005] Provided herein are compositions, e.g., engineered cells, and methods that provide the ability to target one or more cells or cell populations of interest while allowing non-targeted cell populations to escape such targeting. For example, provided herein are genetically engineered hematopoietic cells, such as hematopoietic stem cells (HSCs), that have genetic modifications or edited genes for one or more lineage-specific cell surface antigens. In some embodiments, the modified, e.g., edited, genes are capable of producing altered forms of the lineage-specific cell surface proteins that at least partially retain the biological activity of the lineage-specific cell surface antigens of the HSCs or their expressing progeny cells, but can escape targeting by cytotoxic agents specific for the wild-type lineage-specific cell surface antigens. In some embodiments, the modified, e.g., edited, gene does not result in the lineage-specific cell surface protein(s), or results in a truncated version of the lineage-specific cell surface protein(s) that may be capable of escaping targeting by cytotoxic agents specific for the wild-type lineage-specific cell surface antigen(s), yet not retain the biological activity of the lineage-specific cell surface antigen(s) of the HSC or of its expressing progeny cells.

[0006] Thus, provided herein are genetically engineered hematopoietic cells, such as hematopoietic stem cells (HSCs), that have one or more altered lineage-specific cell surface antigens. In some embodiments, one or more of the lineage-specific cell surface proteins are altered such that one or more of the lineage-specific cell surface proteins retain at least partial biological activity of the lineage-specific cell surface antigen of the HSC or of its expressing progeny, but are capable of escaping targeting by cytotoxic agents specific for the corresponding wild-type lineage-specific cell surface antigen(s). In some embodiments, one or more of the altered lineage-specific cell surface proteins are altered such that all (e.g., one, two, three, four, etc.) of the altered lineage-specific cell surface proteins retain at least partial biological activity. In some embodiments, one or more of the altered lineage-specific cell surface proteins are altered such that at least one, but not all, of the altered lineage-specific cell surface protein(s) retains at least partial biological activity. In some embodiments, one or more modified lineage-specific cell surface proteins are modified such that one or more of the lineage-specific cell surface proteins do not retain at least partial biological activity of the lineage-specific cell surface antigen of the HSC or of its expressing progeny, but are capable of escaping targeting by cytotoxic agents specific for the corresponding wild-type lineage-specific cell surface antigen(s). In some embodiments, one or more modified lineage-specific cell surface proteins are modified such that none of the modified lineage-specific cell surface protein(s) retains at least partial biological activity. Thus, the genetically engineered hematopoietic cells provided herein with one or more modified lineage-specific cell surface antigens can include modified lineage-specific cell surface antigen(s) that are capable of escaping targeting by cytotoxic agents specific for the corresponding wild-type lineage-specific cell surface antigen(s) and retain at least partial biological activity, and / or can include lineage-specific cell surface antigen(s) that do not retain biological activity (e.g., proteins can be knocked out).

[0007] Due to the fact that genetically engineered hematopoietic cells produce one or more altered lineage-specific cell surface antigen(s), which have the ability to escape such targeting while retaining their biological activity, the genetically engineered hematopoietic cells provided herein with genetically modified or edited genes for one or more lineage-specific cell surface antigens are useful for therapies, such as immunotherapy and other cytotoxic agents, that specifically target cells expressing the lineage-specific cell surface antigen. Thus, such engineered hematopoietic cells can target or direct immunotherapy or other cytotoxic agents to lineage-specific cell surface antigens required for the survival of an organism. Such engineered hematopoietic cells can also target or direct immunotherapy or other cytotoxic agents to cell types required for the survival of an organism that express the targeted lineage-specific cell surface antigen. In other embodiments, the genetically engineered hematopoietic cells provided herein, which have genetically modified or edited genes for one or more lineage-specific cell surface antigens, are useful for therapies, such as immunotherapy and other cytotoxic agents, that specifically target cells expressing the lineage-specific cell surface antigens, without retaining biological activity, due to their ability to escape such targeting. Such engineered hematopoietic cells allow for the targeting or directing of immunotherapeutic or other cytotoxic agents to lineage-specific cell surface antigens that are not required for the survival of the organism. Such engineered hematopoietic cells also allow for the targeting or directing of immunotherapeutic or other cytotoxic agents to cell types that are not required for the survival of the organism that express the targeted lineage-specific cell surface antigen. In some embodiments where the genetically engineered hematopoietic cells have one or more altered lineage-specific cell surface antigens, where one or more lineage-specific cell surface antigens retain biological activity, and where one or more lineage-specific cell surface antigens do not retain biological activity, it is possible to target or direct immunotherapeutic or other cytotoxic agents to the lineage-specific cell surface antigen(s) that may or may not be required for survival of the organism.Such engineered hematopoietic cells also enable the targeting or directing of immunotherapeutic or other cytotoxic agents to cell types that may or may not be required for the survival of the organism that express the targeted lineage-specific cell surface antigen.

[0008] In some aspects, the genetically engineered hematopoietic cells are genetically modified or edited to produce one modified or mutated lineage-specific cell surface antigen that retains biological activity but escapes targeting by cytotoxic agents specific for the wild-type lineage-specific cell surface antigen. In some aspects, the genetically engineered hematopoietic cells are genetically modified or edited to produce two or more (e.g., 2, 3, 4, 5, etc.) modified or mutated lineage-specific cell surface antigens that escape targeting by cytotoxic agents specific for (or targeting) the corresponding wild-type lineage-specific cell surface antigen. In some embodiments of these latter aspects, at least one of the modified or mutated lineage-specific cell surface proteins retains its biological activity. In some embodiments, two or more of the modified or mutated lineage-specific cell surface antigens retain their respective biological activity. In some embodiments, all of the modified or mutated lineage-specific cell surface antigens expressed by the genetically engineered hematopoietic cells retain (at least in part) their respective biological activity.

[0009] Accordingly, one aspect of the present disclosure features genetically engineered hematopoietic cells comprising: (i) a genetically altered or edited first gene encoding a first lineage-specific cell surface antigen; and (ii) a genetically altered or edited second gene encoding a second lineage-specific cell surface antigen. In some embodiments, the first gene is altered or edited such that expression of the first lineage-specific cell surface antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, the first gene is altered or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the first lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen retains its biological activity. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retains its biological activity. In some embodiments, the second gene has been modified or edited such that expression of the second lineage-specific cell surface antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to the expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, the second gene has been modified or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the second lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen retains its biological activity.In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retains its biological activity. In some embodiments, the mutant or modified version of the first and second lineage-specific cell surface antigens retain their respective biological activity. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen retains its biological activity and the mutant or modified version of the second lineage-specific cell surface antigen does not retain its biological activity. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen does not retain its biological activity and the mutant or modified version of the second lineage-specific cell surface antigen does not retain its biological activity.

[0010] Another aspect of the disclosure features genetically engineered hematopoietic cells comprising: (i) a genetically modified or edited first gene encoding a first lineage-specific cell surface antigen; (ii) a genetically modified or edited second gene encoding a second lineage-specific cell surface antigen; and (iii) a genetically modified or edited third gene encoding a third lineage-specific cell surface antigen. In some embodiments, the genetically engineered hematopoietic cells further comprise (iv) a genetically modified or edited fourth gene encoding a fourth lineage-specific cell surface antigen. In some embodiments, the genetically engineered hematopoietic cells further comprise (v) a genetically modified or edited fifth gene encoding a fifth lineage-specific cell surface antigen.

[0011] In some embodiments, any one or more of the gene(s) encoding the lineage-specific cell surface antigen(s) have been modified or edited such that expression of the respective lineage-specific cell surface antigen(s) is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to the expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, any one or more of the gene(s) encoding the lineage-specific cell surface antigen(s) have been modified or edited such that the genetically engineered hematopoietic cells express mutant or modified versions of the respective lineage-specific cell surface antigen(s).

[0012] In some embodiments, any one or more of the mutant lineage-specific cell surface antigen(s) escape targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, any one or more of the mutant lineage-specific cell surface antigen(s) retain their biological activity. In some embodiments, any one or more of the mutant lineage-specific cell surface antigen(s) escape targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retain their biological activity.

[0013] Another aspect of the disclosure features a population of genetically engineered hematopoietic cells, wherein the genetically engineered hematopoietic cells within the population comprise: (i) a genetically altered or edited first gene encoding a first lineage-specific cell surface antigen; and (ii) a genetically altered or edited second gene encoding a second lineage-specific cell surface antigen. In some embodiments, the first gene is altered or edited such that expression of the first lineage-specific cell surface antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, the first gene is altered or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the first lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen escapes targeting by a cytotoxic agent that targets the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen retains its biological activity. In some embodiments, the mutant or modified version of the first lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retains its biological activity. In some embodiments, the second gene has been modified or edited such that expression of the second lineage-specific cell surface antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to the expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, the second gene has been modified or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the second lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen retains its biological activity.In some embodiments, the mutant or modified version of the second lineage-specific cell surface antigen escapes targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retains its biological activity.

[0014] Another aspect of the disclosure features a population of genetically engineered hematopoietic cells, wherein the genetically engineered hematopoietic cells of the population further comprise: (iii) a genetically altered or edited third gene encoding a third lineage-specific cell surface antigen. In some embodiments, the genetically engineered hematopoietic cells of the population further comprise: (iv) a genetically altered or edited fourth gene encoding a fourth lineage-specific cell surface antigen. In some embodiments, the genetically engineered hematopoietic cells of the population further comprise (v) a genetically altered or edited fifth gene encoding a fifth lineage-specific cell surface antigen. In some embodiments, any one or more of the gene(s) encoding the lineage-specific cell surface antigen(s) have been modified or edited such that expression of the respective lineage-specific cell surface antigen(s) is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to expression of the corresponding endogenous or wild-type lineage-specific cell surface antigen). In some embodiments, any one or more of the genes encoding the lineage-specific cell surface antigens have been modified or edited such that the genetically engineered hematopoietic cells express mutant or modified versions of the respective lineage-specific cell surface antigen(s). In some embodiments, any one or more of the mutant lineage-specific cell surface antigen(s) escape targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen. In some embodiments, any one or more of the mutant or modified versions of the lineage-specific cell surface antigen(s) retain their biological activity. In some embodiments, any one or more of the mutant lineage-specific cell surface antigen(s) escape targeting by cytotoxic agents that target the corresponding wild-type lineage-specific cell surface antigen and retain their biological activity.One aspect of the present disclosure features a population of genetically engineered hematopoietic cells, including: (i) a first group of genetically engineered hematopoietic cells that have a genetic modification or edit in a first gene encoding a first lineage-specific cell surface antigen, wherein the first group of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the first lineage-specific cell surface antigen or (b) express a variant of the first lineage-specific cell surface antigen; and (ii) a second group of genetically engineered hematopoietic cells that have a genetic modification or edit in a second gene encoding a second lineage-specific cell surface antigen, wherein the second group of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the second lineage-specific cell surface antigen or (b) express a variant of the second lineage-specific cell surface antigen. In some embodiments, the first group of genetically engineered hematopoietic cells can fully or partially overlap with the second group of genetically engineered hematopoietic cells.

[0015] In some embodiments, the present disclosure provides genetically engineered hematopoietic cells comprising: (i) a genetically modified or edited gene encoding CD19; and (ii) a genetically modified or edited gene encoding CD33. In some embodiments, the CD19 gene is modified or edited such that expression of the CD19 antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to the expression of the corresponding endogenous or wild-type CD19 antigen). In some embodiments, the CD19 gene is modified or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the CD19 antigen. In some embodiments, the mutant or modified version of the CD19 antigen escapes targeting by cytotoxic agents that target the corresponding wild-type CD19 antigen. In some embodiments, the mutant or modified version of the CD19 antigen retains its biological activity. In some embodiments, the mutant or modified version of the CD19 antigen escapes targeting by cytotoxic agents that target the corresponding wild-type CD19 antigen and retains its biological activity. In some embodiments, the CD33 gene is modified or edited such that expression of the CD33 antigen is reduced or eliminated in the genetically engineered hematopoietic cells (e.g., compared to the expression of the corresponding endogenous or wild-type CD33 antigen). In some embodiments, the CD33 gene is modified or edited such that the genetically engineered hematopoietic cells express a mutant or modified version of the CD33 antigen. In some embodiments, the mutant or modified version of the CD33 antigen escapes targeting by cytotoxic agents that target the corresponding wild-type CD33 antigen. In some embodiments, the mutant or modified version of the CD33 antigen retains its biological activity. In some embodiments, the mutant or modified version of the CD33 antigen escapes targeting by cytotoxic agents that target the corresponding wild-type CD33 antigen and retains its biological activity. In some embodiments of the genetically engineered hematopoietic cells comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD19 has been modified or edited such that all of exon 2 has been deleted or a portion of exon 2 has been deleted.In some embodiments of a genetically engineered hematopoietic cell comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD33 has been modified or edited such that all of exon 2 has been deleted or a portion of exon 2 has been deleted. In some embodiments of a genetically engineered hematopoietic cell comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD19 has been modified or edited such that the gene is truncated, has inserted and / or deleted sequences (e.g., resulting in scrambled, frameshifted, or nonsense sequences), or the entire gene has been deleted (e.g., effectively a knockout gene). In some embodiments of genetically engineered hematopoietic cells comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD33 has been modified or edited such that the gene is truncated, has inserted and / or deleted sequences (e.g., resulting in a scrambled, frameshift, or nonsense sequence), or the entire gene is deleted (e.g., effectively a knockout gene). In some embodiments of genetically engineered hematopoietic cells comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD19 has been modified or edited such that the entire exon 2 of CD19 is deleted or a portion of exon 2 of CD19 is deleted, and the gene encoding CD33 has been modified or edited such that the CD33 gene is truncated, has inserted and / or deleted sequences (e.g., resulting in a scrambled, frameshift, or nonsense sequence), or the entire CD33 gene is deleted.In some embodiments of genetically engineered hematopoietic cells comprising (i) a modified or edited gene encoding CD19 and (ii) a modified or edited gene encoding CD33, the gene encoding CD33 has been modified or edited such that all of exon 2 of CD33 is deleted or a portion of exon 2 of CD33 is deleted, and the gene encoding CD19 has been modified or edited such that the CD19 gene is truncated, has inserted and / or deleted sequences (e.g., resulting in a scrambled, frameshifted, or nonsense sequence), or is deleted in its entirety.

[0016] In some embodiments, the present disclosure provides genetically engineered hematopoietic cells comprising: (i) a gene encoding CD19 that has been genetically modified or edited to delete all or part of exon 2; and (ii) a gene encoding CD33 that has been genetically modified or edited to delete all or part of exon 2. In some embodiments, a variant of the CD19 antigen with the deletion of exon 2 or part of exon 2 retains its biological activity. In some embodiments, a variant of the CD19 antigen with the deletion of exon 2 or part of exon 2 escapes targeting by cytotoxic agents that target the corresponding wild-type CD19 antigen and retains its biological activity. In some embodiments, a variant of the CD33 antigen with the deletion of exon 2 or part of exon 2 retains its biological activity. In some embodiments, a variant of the CD33 antigen in which exon 2 has been deleted or a portion of exon 2 has been deleted escapes targeting by cytotoxic agents that target the corresponding wild-type CD33 antigen and retains its biological activity. In some embodiments, the present disclosure provides genetically engineered hematopoietic cells comprising: (i) a gene encoding CD19 that has been genetically modified or edited to delete all of exon 2 or a portion of exon 2, and (ii) a gene encoding CD33 that has been genetically modified or edited to delete all of exon 2 or a portion of exon 2. In some embodiments, the present disclosure provides genetically engineered hematopoietic cells comprising a gene encoding CD19 that has been genetically modified or edited to delete intron 1 and / or intron 2 of CD19. In some embodiments, the genetically engineered hematopoietic cells have a sequence deletion in intron 1 and / or intron 2 of the CD19 gene. For example, either a portion of intron 1 and / or intron 2 of CD19 is deleted, or the entire intron 1 and / or intron 2 of CD19 is deleted.In some embodiments, the disclosure provides genetically engineered hematopoietic cells comprising a gene encoding CD33 that has been genetically modified or edited, such that intron 1 and / or intron 2 of CD33 have been modified or edited. In some embodiments, the genetically engineered hematopoietic cells have a sequence deletion in intron 1 and / or intron 2 of the CD33 gene. For example, either a portion of intron 1 and / or intron 2 of CD33 is deleted, or the entire intron 1 and / or intron 2 of CD33 is deleted. In some embodiments, the disclosure provides genetically engineered hematopoietic cells comprising: (i) a gene encoding CD19 that has been genetically modified or edited, such that intron 1 and / or intron 2 of CD19 have been modified or edited, and (ii) a gene encoding CD33 that has been genetically modified or edited, such that intron 1 and / or intron 2 of CD33 have been modified or edited. In some embodiments, a variant of the CD19 antigen having a deletion of intron 1 and / or intron 2 or a deletion of a portion of intron 1 and / or intron 2 retains its biological activity. In some embodiments, a variant of the CD19 antigen having a deletion of intron 1 and / or intron 2 or a deletion of a portion of intron 1 and / or intron 2 escapes targeting by cytotoxic agents that target the corresponding wild-type CD19 antigen and retains its biological activity. In some embodiments, a variant of the CD33 antigen having a deletion of intron 1 and / or intron 2 or a deletion of a portion of intron 1 and / or intron 2 escapes targeting by cytotoxic agents that target the corresponding wild-type CD33 antigen and retains its biological activity. In some embodiments, a variant of the CD33 antigen having a deletion of intron 1 and / or intron 2 or a deletion of a portion of intron 1 and / or intron 2 escapes targeting by cytotoxic agents that target the corresponding wild-type CD33 antigen and retains its biological activity.

[0017] Any of the genetically engineered hematopoietic cells or populations of genetically engineered hematopoietic cells described herein can be hematopoietic stem cells (HSCs). In some cases, the HSCs are CD34+ / CD33- cells. Any of the hematopoietic cells described herein can be derived from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs). In some embodiments, the genetically engineered hematopoietic cells are human hematopoietic cells. In some embodiments, any of the hematopoietic cells described herein are bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs) derived from a human.

[0018] In some embodiments, the variants of the first lineage-specific cell surface antigen and / or the variants of the second lineage-specific cell surface antigen (and / or the variants of the third, fourth, and / or fifth lineage-specific cell surface antigen) comprise a mutated or deleted non-essential epitope. Such non-essential epitopes on the first lineage-specific cell surface antigen and / or the variants of the second lineage-specific cell surface antigen (and / or the variants of the third, fourth, and / or fifth lineage-specific cell surface antigen) have at least 3 amino acids. In some examples, the non-essential epitopes on the first lineage-specific cell surface antigen and / or the variants of the second lineage-specific cell surface antigen (and / or the variants of the third, fourth, and / or fifth lineage-specific cell surface antigen) are 6-10 amino acids long. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 200 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 175 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 150 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or fourth, and / or fifth lineage-specific cell surface antigen) is between 6 and 125 amino acids.In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 100 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 75 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is between 6 and 50 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is 6 to 25 amino acids. In some examples, the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen (and / or the nonessential epitope on the third, and / or the fourth, and / or the fifth lineage-specific cell surface antigen) is an entire exon or a portion of an exon.

[0019] In some embodiments, at least one of the first and second lineage-specific cell surface antigens is associated with a hematopoietic malignancy. In some embodiments, at least one of the modified or mutant lineage-specific cell surface antigens is associated with a hematopoietic malignancy. Non-limiting examples include CD7, CD13, CD19, CD22, CD25, CD32, CD33, CD38, CD44, CD47, CD56, CD96, CD117, CD123, CD135, CD174, CLL-1, folate receptor b, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3, and WT1. In some examples, the first and second lineage-specific cell surface antigens are selected from (a) CD19+CD33, (b) CD19+CD13, (c) CD19+CD123, (d) CD33+CD13, (e) CD33+CD123, and (f) CD13+CD123.

[0020] In some embodiments, the modified lineage-specific cell surface antigen is a type 1 lineage-specific cell surface antigen. In some embodiments, at least one of the lineage-specific cell surface antigens is a type 1 lineage-specific cell surface antigen. In some embodiments, the lineage-specific cell surface antigen is CD19. In some embodiments, at least one of the lineage-specific cell surface antigens is CD19. In some embodiments, at least one of the first and second lineage-specific cell surface antigens is a type 1 lineage-specific cell surface antigen, e.g., CD19. In some embodiments, at least one of either the modified or mutant lineage-specific cell surface antigens is a type 1 lineage-specific cell surface antigen, e.g., CD19. In some embodiments, both the first and second lineage-specific cell surface antigens are type 1 lineage-specific cell surface antigens. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) occurs in an exon of the CD19 gene. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) occurs in exon 2 of the CD19 gene. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) occurs in one or more introns of the CD19 gene, including, for example, modification or editing of one or more introns resulting in modification(s) of exon 2 of CD19. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) results in a mutation or deletion of exon 2 of the CD19 gene. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) results in the deletion of all of exon 2 of the CD19 gene or the deletion of a portion of exon 2 of the CD19 gene. In some cases, the mutated CD19 comprises the amino acid sequence of SEQ ID NO: 52.

[0021] In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) occurs in one or more introns of the CD19 gene, including, for example, modification or editing of one or more introns resulting in modification(s) of exon 4 of CD19. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) results in a mutation or deletion of exon 4 of the CD19 gene. In some embodiments, the genetic modification or editing of the CD19 gene (e.g., an endogenous CD19 gene) results in a deletion of the entire exon 4 of the CD19 gene or a deletion of a portion of exon 2 of the CD19 gene. In some cases, the mutated CD19 comprises the amino acid sequence of SEQ ID NO: 73.

[0022] In some embodiments, the modified lineage-specific cell surface antigen is a type 2 lineage-specific cell surface antigen. In some embodiments, at least one of the lineage-specific cell surface antigens is a type 2 lineage-specific cell surface antigen. In some embodiments, the lineage-specific cell surface antigen is CD33. In some embodiments, at least one of the lineage-specific cell surface antigens is CD33. In some embodiments, at least one of the first and second lineage-specific cell surface antigens is a type 2 lineage-specific cell surface antigen, e.g., CD33. In some embodiments, at least one of either the modified or mutant lineage-specific cell surface antigens is a type 2 lineage-specific cell surface antigen, e.g., CD33. In some embodiments, both the first and second lineage-specific cell surface antigens are type 2 lineage-specific cell surface antigens. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in an exon of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in exon 2 of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in one or more introns of the CD33 gene, including, for example, modification or editing of one or more introns that results in modification(s) of exon 2 of CD33. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in intron 1 and intron 2 of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) results in a mutation or deletion of exon 2 of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) results in the deletion of all of exon 2 of the CD33 gene or the deletion of a portion of exon 2 of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in exon 3 of the CD33 gene.In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) occurs in one or more introns of the CD33 gene, for example, including modification or editing of one or more introns resulting in modification(s) of exon 3 of CD33. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) results in a mutation or deletion of exon 3 of the CD33 gene. In some embodiments, the genetic modification or editing of the CD33 gene (e.g., an endogenous CD33 gene) results in the deletion of the entire exon 3 of the CD33 gene or the deletion of a portion of exon 3 of the CD33 gene. In some examples, the second group of genetically engineered hematopoietic cells may contain genetic editing in exon 2 or exon 3 of the CD33 gene (e.g., including genetic modification in one or more introns resulting in modification of exon 2 or exon 3). In some examples, the CD33 gene is an endogenous CD33 gene. An example CD33 variant includes SEQ ID NO: 56 or SEQ ID NO: 58.

[0023] In some embodiments, the second lineage-specific cell surface antigen is a type 0 protein. In some embodiments, at least one of the first and second lineage-specific cell surface antigens is a type 0 protein. In some embodiments, at least one of the modified or mutant lineage-specific cell surface antigens is a type 0 lineage-specific cell surface antigen. In some embodiments, both the first and second lineage-specific cell surface antigens are type 0 lineage-specific cell surface antigens. In some embodiments, the genetic modification or editing of the type 0 antigen gene occurs in an exon of the type 0 gene. In some embodiments, the genetic modification or editing of the type 0 antigen gene occurs in exon 2 of the type 0 antigen gene. In some embodiments, the genetic modification or editing of the type 0 antigen gene occurs in one or more introns of the type 0 antigen gene, including, for example, modification or editing of one or more introns resulting in modification(s) of exon 2 of the type 0 antigen gene. In some embodiments, the genetic modification or editing of the type 0 antigen gene occurs in intron 1 and intron 2 of the type 0 antigen gene.

[0024] Any of the genetically engineered hematopoietic cells described herein can be generated by genome editing. In some embodiments, genome editing does not involve an exogenous nuclease. In some embodiments, genome editing involves homologous recombination mediated by an adeno-associated virus vector. In some embodiments, genome editing involves an exogenous nuclease. Exemplary approaches include methods involving the use of zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), or CRISPR-Cas systems. In some embodiments, the CRISPR-Cas system includes a Cas endonuclease. In some embodiments, the Cas endonuclease is Cas9 endonuclease.

[0025] In another aspect, provided herein are methods for generating either genetically engineered hematopoietic cells or a population of genetically engineered hematopoietic cells. In one aspect, provided herein are methods for generating a population of genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells; and (ii) genetically modifying or editing at least one lineage-specific cell surface antigen. In some embodiments, the at least one lineage-specific cell surface antigen is genetically modified by CRISPR to generate the population of genetically engineered hematopoietic cells. In one aspect, provided herein are methods for generating a population of genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells; and (ii) genetically modifying or editing a first lineage-specific cell surface antigen, or a second lineage-specific cell surface antigen, or genetically modifying or editing the first lineage-specific cell surface antigen and the second lineage-specific cell surface antigen in the population of hematopoietic cells by CRISPR to generate the population of genetically engineered hematopoietic cells. In one aspect, provided herein are methods for generating a population of genetically engineered hematopoietic cells, the methods comprising: (i) providing a population of hematopoietic cells; and (ii) genetically modifying or editing a first lineage-specific cell surface antigen and a second lineage-specific cell surface antigen in the population of hematopoietic cells to generate the genetically engineered population of hematopoietic cells. In some embodiments, the methods for generating a population of genetically engineered hematopoietic cells further comprise (iii) genetically modifying or editing one or more other lineage-specific cell surface antigen(s) in the population of hematopoietic cells to generate the genetically engineered population of hematopoietic cells. In any of these methods, the genetically engineered hematopoietic cells are human cells.

[0026] In one aspect, provided herein is a method for generating genetically engineered hematopoietic cells, the method comprising: (i) providing hematopoietic cells, and (ii) genetically modifying or editing a first lineage-specific cell surface antigen, or a second lineage-specific cell surface antigen, or genetically modifying or editing the first lineage-specific cell surface antigen and the second lineage-specific cell surface antigen, in the hematopoietic cells by CRISPR, to generate the genetically engineered hematopoietic cells. In one aspect, provided herein is a method for generating genetically engineered hematopoietic cells, the method comprising: (i) providing hematopoietic cells, and (ii) genetically modifying or editing a first lineage-specific cell surface antigen and a second lineage-specific cell surface antigen to generate the genetically engineered hematopoietic cells. In some embodiments, the method for producing the genetically engineered hematopoietic cells further comprises (iii) genetically modifying or editing one or more other lineage-specific cell surface antigen(s) to produce the genetically engineered hematopoietic cells. In any of these methods, the genetically engineered hematopoietic cells are human cells.

[0027] In one aspect, provided herein is a method for generating a population of genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells, and (ii) genetically modifying or editing the CD19 gene, or the CD33 gene, or genetically modifying or editing the CD19 gene and the CD33 gene, in the population of hematopoietic cells by CRISPR, to generate the genetically engineered hematopoietic cells. In one aspect, provided herein is a method for generating a population of genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells, and (ii) genetically modifying or editing the CD19 gene and the CD33 gene in the population of hematopoietic cells to generate the genetically engineered hematopoietic cells. In one aspect, provided herein is a method for generating genetically engineered hematopoietic cells, the method comprising: (i) providing hematopoietic cells, and (ii) genetically modifying or editing the CD19 gene, or genetically modifying or editing the CD33 gene, or genetically modifying or editing the CD19 gene and the CD33 gene, in the hematopoietic cells by CRISPR, to generate the genetically engineered hematopoietic cells. In one aspect, provided herein is a method for generating genetically engineered hematopoietic cells, the method comprising: (i) providing hematopoietic cells, and (ii) genetically modifying or editing the CD19 gene and genetically modifying or editing the CD33 gene, to generate the genetically engineered hematopoietic cells. In some embodiments, the method for generating genetically engineered hematopoietic cells or a population of genetically engineered hematopoietic cells further comprises (iii) genetically modifying or editing one or more other lineage-specific cell surface antigen(s) to generate the genetically engineered hematopoietic cells. In either of these methods, the genetically engineered hematopoietic cells are human cells.

[0028] In some embodiments, gene editing of the CD19 gene involves one or more guide nucleic acid molecules targeting one or more introns of CD19. In some embodiments, gene editing of the CD33 gene involves one or more guide nucleic acid molecules targeting one or more introns of CD33. In some embodiments, gene editing of the CD33 gene involves one or more guide nucleic acid molecules that do not target a CD33 pseudogene upstream of the CD33 gene. In some embodiments, gene editing of the CD33 gene involves one or more guide nucleic acid molecules that (a) target one or more introns of CD33 and (b) do not target a CD33 pseudogene upstream of the CD33 gene. In some embodiments, the introns of the CD19 gene include intron 1 and intron 2. In some embodiments, the introns of the CD33 gene include intron 1 and intron 2. In some embodiments, gene editing of CD19 results in the elimination of exon 2 of the CD19 gene. In some embodiments, gene editing of CD19 results in the elimination of exon 4 of the CD19 gene. In some embodiments, gene editing of CD33 results in the elimination of exon 2 of the CD33 gene. In some embodiments, gene editing of the CD33 gene involves one or more guide nucleic acid molecules that target exon 3 of CD33. In some embodiments, gene editing of the CD33 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:67.

[0029] Further provided herein are methods for generating genetically engineered hematopoietic cells, the methods comprising: (i) providing a population of hematopoietic cells; and (ii) gene editing, using CRISPR, a CD19 gene, a CD33 gene, or both the CD19 and CD33 genes in the population of hematopoietic cells to generate genetically engineered hematopoietic cells, wherein the gene editing of the CD19 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 14-26, 67, and 69-72, and / or the gene editing of the CD33 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 27-50 and 68. In some embodiments, the methods for generating genetically engineered hematopoietic cells comprise gene editing, using CRISPR, a CD33 gene in the population of hematopoietic cells to generate genetically engineered hematopoietic cells, wherein the gene editing of the CD33 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 67.

[0030] In some embodiments, step (ii) is performed by gene editing of both the CD19 gene and the CD33 gene in the population of hematopoietic cells using CRISPR to generate genetically engineered hematopoietic cells, wherein the gene editing of the CD19 gene involves a guide nucleic acid comprising the nucleotide sequence of SEQ ID NO:67 and / or the gene editing of the CD33 gene involves a guide nucleic acid comprising the nucleotide sequence of SEQ ID NO:68.

[0031] In any of the methods described herein, the hematopoietic cells can be HSCs, e.g., CD34+ / CD33- cells. The hematopoietic cells can be from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs). In some embodiments, the hematopoietic cells are from human bone marrow cells, human cord blood cells, or human peripheral blood mononuclear cells (PBMCs).

[0032] Also provided herein are genetically engineered hematopoietic cells having one of more of the following characteristics: (a) carrying a gene-edited CD19 gene capable of expressing a mutant CD19 comprising the amino acid sequence of SEQ ID NO: 52 or 73 and / or a gene-edited CD33 gene capable of expressing a mutant CD33 comprising the amino acid sequence of SEQ ID NO: 56 or SEQ ID NO: 58; (b) carrying a gene-edited CD19 gene capable of expressing a mutant CD19 comprising the amino acid sequence of SEQ ID NO: 52 or 73 and a gene-edited CD33 gene capable of expressing a mutant CD33 comprising the amino acid sequence of SEQ ID NO: 56; (c) exon 2 of the CD33 gene in hematopoietic cells is modified, and one or more portions of the CD33 pseudogene are not modified; (d) exon 2 of the CD33 gene in hematopoietic cells is deleted and one or more portions of the CD33 pseudogene are left unaltered; (e) Exon 2 of the CD33 gene in hematopoietic cells is altered, and one or more portions of the CD33 pseudogene are not altered by a deletion or mutation that causes a frameshift. (f) exon 2 of the CD33 gene of the hematopoietic cell is modified, and the one or more portions of the CD33 pseudogene that are not modified by a frameshift-causing deletion or mutation are selected from exon 1, intron 1, exon 2, and combinations thereof; (g) Exon 2 of the CD33 gene of hematopoietic cells is modified, and one or more portions of the CD33 pseudogene that are not modified by a deletion or mutation causing a frameshift are selected from exon 1, intron 1, and / or exon 2 sequence(s) that share sequence homology with exon 1, intron 1, and / or exon 2 sequence(s) of CD33, respectively.

[0033] Additionally, genetically engineered hematopoietic cells produced by any of the methods disclosed herein are also within the scope of this disclosure.

[0034] Also provided herein are populations of genetically engineered hematopoietic stem cells, wherein at least 50% (e.g., at least 60%, 70%, 75%, 80%, 85%, 90%, or 95%) of the hematopoietic stem cells therein possess both a gene-edited CD19 gene and a gene-edited CD33 gene. In some cases, the gene-edited CD19 gene can express a CD19 variant comprising the amino acid sequence of SEQ ID NO: 52 or 73. Alternatively, or in addition, the gene-edited CD33 gene can express a CD33 variant comprising the amino acid sequence of SEQ ID NO: 56 or SEQ ID NO: 58.

[0035] Additionally, provided herein are methods for treating hematopoietic malignancies (e.g., AML) comprising administering to a subject in need thereof a population of genetically engineered hematopoietic cells disclosed herein. The method may further comprise administering to the subject an effective amount of a first immunotherapeutic agent. In some cases, the first immunotherapeutic agent is a cytotoxic agent that targets cells expressing either a first lineage-specific cell surface antigen or a second lineage-specific cell surface antigen.

[0036] In some examples, the first immunotherapeutic agent is a cytotoxic agent that targets cells expressing a first lineage-specific cell surface antigen, and the method further includes administering a second immunotherapeutic agent to the subject when the hematopoietic malignancy recurs in the subject. The second immunotherapeutic agent can be a cytotoxic agent that targets cells expressing a second lineage-specific cell surface antigen. In one example, the first immunotherapeutic agent, the second immunotherapeutic agent, or both are CAR-T cells. In one example, the first immunotherapeutic agent, the second immunotherapeutic agent, or both are antibody-drug conjugates.

[0037] The present disclosure also provides methods of protecting hematopoietic stem cells from immunotherapy in a subject in need thereof, where the therapy targets one or more lineage-specific antigen(s). In some embodiments, the method includes administering modified hematopoietic cells to the subject, where the stem cells contain one or more gene(s) encoding the lineage-specific antigen(s) targeted by the immunotherapy, and the gene(s) are modified, mutated, or edited. In some embodiments of the method, the gene(s) are modified such that expression of the gene(s) results in modified, mutated protein(s), or complete knockout(s) of the protein(s), or a combination thereof. In some embodiments of the method, the modified, mutated protein(s) or complete knockout(s) prevents immunotherapy from targeting the hematopoietic stem cells containing the mutated gene(s). In some embodiments of the method, the editing results in expression of one or more lineage-specific antigen(s) containing a partial deletion. In some embodiments of the method, the partial deletion encompasses an entire exon or a portion of an exon. In some embodiments of the method, the administered immunotherapy includes one or more antibody-drug conjugate(s), which may be administered simultaneously or sequentially. In some embodiments of the method, the administered immunotherapy includes cells expressing one or more chimeric antigen receptors, or a pool of two or more cells, each expressing a different chimeric antigen receptor, which may be administered simultaneously or sequentially. In one embodiment, the present disclosure provides a method of protecting hematopoietic stem cells from one or more chimeric antigen receptor T-cell therapies targeting one or more lineage-specific antigen(s) in a subject in need thereof, wherein hematopoietic stem cells are administered and the hematopoietic stem cells are modified such that expression of the gene(s) of the one or more lineage-specific antigen(s) results in an engineered, mutated form or complete knockout(s) of the lineage-specific antigen(s) targeted by the CART(s).In one embodiment of this method, the mutated form(s) of one or more lineage-specific antigen(s) lack an exon, e.g., an exon containing a CART or antibody-drug conjugate epitope. In any of these methods, the modified hematopoietic cells can be any of the modified hematopoietic cells described herein or elsewhere in this application.

[0038] Such modified hematopoietic cells can be produced using gene editing technology, such as CRISPR, as described herein. As described elsewhere, CRISPR methodology can be used to delete the entire or part of a gene of interest. In some embodiments, CRISPR methodology can be used to delete one or more exons containing the targeted epitope. In some cases, it is beneficial to target one or more flanking intron sequences to excise the exon. In some cases, the exon sequence itself can be targeted by CRISPR. However, current conventional CRISPR treatments can lead to small insertions and deletions, which can lead to frameshifts and shortened, non-functional proteins. To avoid unintended knockouts, it can be beneficial to target intron sequences to more precisely edit the exon sequence of interest.

[0039] Accordingly, the present disclosure also provides methods for generating modified hematopoietic cells, comprising introducing one or more guide RNAs capable of editing one or more gene(s) encoding one or more lineage-specific antigen(s) targeted by one or more chimeric antigen receptor(s). In some embodiments of the method, the editing results in expression of the lineage-specific antigen(s) lacking an exon. In some embodiments, the editing results in complete knockout of the lineage-specific antigen(s). In some embodiments of the method, the editing results in a combination of expression of the lineage-specific antigen(s) lacking an exon and complete knockout of the lineage-specific antigen(s) in a cell or cell population. In some embodiments, the one or more guide RNAs are selected to target one or more introns. In some embodiments of the method, targeting adjacent introns results in excision of the genetic sequence encoding the exon between the two introns.

[0040] Targeting one intron can result in the creation of a new splice site, leading to the excision of the gene sequence encoding the adjacent exon. Exon skipping using single-guide RNA has been described (e.g., Mou et al., Genome Biology 2017 18:108). Thus, in some embodiments, one intron can be targeted according to the methods described herein.

[0041] In some embodiments, methods for protecting hematopoietic stem cells from immunotherapy can be used in a subject in need thereof, where the therapy targets one or more lineage-specific antigen(s). In some embodiments, the methods include administering modified hematopoietic cells to the subject, where the stem cells contain one or more gene(s) encoding the lineage-specific antigen(s) CD19 and / or CD33 targeted by the immunotherapy, and the CD19 and / or CD33 gene(s) are modified, mutated, or edited. In some embodiments of the methods, the CD19 and / or CD33 gene(s) are modified such that expression results in modified or mutated CD19 and / or CD33, or complete knockout(s) of CD19 and / or CD33, or a combination thereof. In some embodiments of the methods, the engineered mutated CD19 and / or CD33 protein(s), or complete CD19 and / or CD33 knockout(s), prevents immunotherapy from targeting hematopoietic stem cells containing the mutated gene(s). In some embodiments of the methods, the editing results in expression of CD19 and / or CD33 containing a partial deletion. In some embodiments of the methods, the partial deletion encompasses an entire exon or a portion of an exon, e.g., exon 2 of CD33 and / or CD19. In some embodiments of the methods, the administered immunotherapy includes one or more antibody-drug conjugate(s) directed against CD19 and / or CD33, which may be administered simultaneously or sequentially. In some embodiments of the method, the administered immunotherapy comprises cells expressing one or more chimeric antigen receptors directed against CD19 and / or CD33, or a pool of two cell populations, one expressing a chimeric antigen receptor directed against CD19 and the other expressing a chimeric antigen receptor directed against CD33. The cells expressing a chimeric antigen receptor directed against CD19 can be administered simultaneously or sequentially with the cells expressing a chimeric antigen receptor directed against CD33.In one aspect, the present disclosure provides a method of protecting hematopoietic stem cells from one or more chimeric antigen receptor T cell therapies targeting CD19 and / or CD33 in a subject in need thereof, wherein the hematopoietic stem cells are administered and the hematopoietic stem cells are modified such that expression of the gene(s) encoding CD19 and / or CD33 results in an altered, mutated form(s) or complete knockout(s) of CD19 and / or CD33. In one aspect of this method, the mutated form(s) of CD19 and / or CD33 lack an exon, e.g., an exon containing a CART epitope.

[0042] Thus, the present disclosure also provides methods for generating modified hematopoietic cells, comprising introducing one or more guide RNAs capable of editing one or more gene(s) encoding CD19 and / or CD33, wherein CD19 and / or CD33 are targeted by one or more chimeric antigen receptor(s) or antibody-drug conjugates. In some embodiments of the method, the editing results in expression of CD19 and / or CD33 lacking exons. In some embodiments, the editing results in complete knockout of CD19 and / or CD33. In some embodiments of the method, the editing results in a combination of expression of lineage-specific antigen(s) lacking exons and complete knockout of CD19 and / or CD33 in a cell or cell population. In some embodiments, the one or more guide RNAs are selected to target one or more introns. In some embodiments of the method, targeting adjacent introns results in excision of the gene sequence encoding the exon between the two introns.

[0043] Listed aspects 1. A genetically engineered population of hematopoietic cells comprising: (i) a first population of genetically engineered hematopoietic cells having a gene edit in a first gene encoding a first lineage-specific cell surface antigen, wherein the first population of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the first lineage-specific cell surface antigen, or (b) express a variant of the first lineage-specific cell surface antigen; (ii) a second population of genetically engineered hematopoietic cells that have a gene edit in a second gene encoding a second lineage-specific cell surface antigen, wherein the second population of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the second lineage-specific cell surface antigen, or (b) express a variant of the second lineage-specific cell surface antigen. 2. The population of genetically engineered hematopoietic cells of embodiment 1, wherein the first group of genetically engineered hematopoietic cells overlaps with the second group of genetically engineered hematopoietic cells. 3. A population of genetically engineered hematopoietic cells, wherein one or more cells of the population are: (i) have reduced or ablated expression of a first lineage-specific cell surface antigen relative to a wild-type counterpart cell, or express a variant of the first lineage-specific cell surface antigen; (ii) have reduced or ablated expression of a second lineage-specific cell surface antigen relative to their wild-type counterpart cells, or express a variant of the second lineage-specific cell surface antigen. 4. The population of embodiment 3, wherein the reduction in expression of the first lineage-specific cell surface antigen, the second first lineage-specific cell surface antigen, or both, is no more than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the level in wild-type counterpart cells.

[0044] 5. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, wherein a first lineage-specific cell surface antigen (e.g., CD19) is expressed in the subject's primary cancer and a second lineage-specific cell surface antigen (e.g., CD33) is expressed in the subject's recurrent cancer. 6. The genetically engineered population of hematopoietic cells of embodiment 1 or 2, wherein a first lineage-specific cell surface antigen (e.g., CD33) is expressed on a first subpopulation of cancer cells of the subject, and a second lineage-specific cell surface antigen (e.g., CD123 or CLL-1) is expressed on a second subpopulation of cancer cells of the subject. 7. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population have gene edits (e.g., contain indels or contain deletions) in both alleles encoding the first lineage-specific cell surface antigen. 8. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population have gene edits (e.g., contain indels or contain deletions) in both alleles encoding the second lineage-specific cell surface antigen. 9. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population have gene edits (e.g., contain indels or contain deletions) in both alleles encoding the first lineage-specific cell surface antigen and in both alleles encoding the second lineage-specific cell surface antigen.

[0045] 10. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the copies of the first gene (encoding the lineage-specific cell surface antigen) in the population of cells have gene edited, as measured, e.g., using PCR, e.g., according to the assay of Example 1. 11. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the copies of the second gene (encoding a lineage-specific cell surface antigen) in the population of cells have gene edited, as measured, e.g., using PCR, e.g., according to the assay of Example 1. 12. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the copies of the first and second genes (encoding the first and second lineage-specific cell surface antigens, respectively) in the population of cells have gene edits, as measured, e.g., using PCR, e.g., according to the assay of Example 1. 13. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population (or cells differentiated from the cells in the population) are negative for the first lineage-specific cell surface antigen. 14. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population (or cells differentiated from the cells in the population) are negative for the second lineage-specific cell surface antigen.

[0046] 15. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein at least 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the population (or cells differentiated from the cells in the population) are negative for both the first lineage-specific cell surface antigen and the second lineage-specific cell surface antigen. 16. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein the surface level of a first lineage-specific cell surface antigen in the population (or cells differentiated from cells within the population) is less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the surface level of the first lineage-specific cell surface antigen in wild-type counterpart cells. 17. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein the surface level of the second lineage-specific cell surface antigen in the population (or cells differentiated from cells within the population) is less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the surface level of the second lineage-specific cell surface antigen in wild-type counterpart cells. 18. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein the intracellular level of the first lineage-specific antigen in the population (or cells differentiated from cells within the population) is less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the intracellular level of the first lineage-specific cell surface antigen in wild-type counterpart cells. 19. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein the intracellular level of the second lineage-specific antigen in the population (or cells differentiated from cells within the population) is less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the intracellular level of the second lineage-specific cell surface antigen in wild-type counterpart cells.

[0047] 20. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein the first and second genes are selected from Table 1A. 21. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, wherein the first and second lineage-specific cell surface antigens are selected from Table 1A. 22. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which comprises a plurality of HSCs and / or HPCs. 23. The population of genetically engineered hematopoietic cells of embodiment 22, which retain differentiation potential, for example in an in vitro CFU assay, for example as described in Example 1 of the present application. 24. The population of genetically engineered hematopoietic cells of embodiment 23, wherein the cells form at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 200 total colonies per 250 cells in a CFU assay, such as the assay of Example 1 of the present application.

[0048] 25. The population of genetically engineered hematopoietic cells of embodiment 23 or 24, wherein the cells form at least 1, 2, 3, 4, 5, 10, or 20 CFU-GEMM colonies per 250 cells in a CFU assay, e.g., the assay of Example 1 of the present application. 26. The population of genetically engineered hematopoietic cells of any of embodiments 23-25, wherein the cells form at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 CFU-GM colonies per 250 cells in a CFU assay, e.g., the assay of Example 1 herein. 27. The population of genetically engineered hematopoietic cells of any of embodiments 23-26, wherein the cells form at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 BFU-E colonies per 250 cells in a CFU assay, such as the assay of Example 1 of the present application. 28. The population of genetically engineered hematopoietic cells of any of embodiments 23-27, wherein the number of BFU-E colonies is about 30%-150%, 35-135%, 40-120%, or 50%-100% of the number of CFU-GM colonies when assayed in a CFU assay (e.g., the assay of Example 1 herein). 29. The population of genetically engineered hematopoietic cells of any of embodiments 23-28, wherein the number of CFU-GEMM colonies is about 1-15%, 1-10%, or 1.5-5.0% of the number of CFU-GM colonies when assayed in a CFU assay (e.g., the assay of Example 1 herein).

[0049] 30. The population of genetically engineered hematopoietic cells of any of embodiments 23-29, wherein the number of CFU-GEMM colonies is about 1-30%, 2-20%, or 3-10% of the number of BFU-E colonies when assayed in a CFU assay (e.g., the assay of Example 1 herein). 31. The genetically engineered population of hematopoietic cells of any of embodiments 23-30, comprising: a) the number of BFU-E colonies formed by the cells in a CFU assay is within about 5%, 10%, 20%, or 30% of the number of BFU-E colonies formed by otherwise similar unmodified cells; b) the number of CFU-GM colonies formed by the cells in a CFU assay is within about 5%, 10%, 20%, or 30% of the number of CFU-GM colonies formed by otherwise similar unmodified cells; c) the number of CFU-GEMM colonies formed by the cells in a CFU assay is within about 5%, 10%, 20%, or 30% of the number of CFU-GEMM colonies formed by otherwise similar unmodified cells; and d) the total number of colonies formed by the cells in a CFU assay is within about 5%, 10%, 20%, or 30% of the total number of colonies formed by otherwise similar unmodified cells; One, two, three, or all of the above. 32. The population of genetically engineered hematopoietic cells of any of embodiments 23-31, wherein the cells are capable of giving rise to differentiated myeloid cells. 33. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which are capable of growing in culture, e.g., expanding by at least 2-, 3-, 4-, 5-, or 10-fold (e.g., in 8 days, e.g., in conditions according to Example 1). 34. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which have a viability of at least 50%, 60%, 70%, 75%, 80%, 85%, or 90% under conditions, e.g., according to Example 1 or Example 4 (e.g., after 2, 4, 6, 8, or 10 days).

[0050] 35. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which are capable of engraftment and yield, e.g., at least 0.1%, 0.2%, 0.5%, 1%, 2%, 5%, or 10% CD45+ cells in the subject's peripheral blood, e.g., according to the assay of Example 1. 36. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which are capable of giving rise to at least 0.1%, 0.2%, 0.5%, 1%, 2%, 5%, 10%, 20%, 40%, 60%, or 80% B cells in the peripheral blood of the subject, e.g., according to the assay of Example 1. 37. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, which are resistant to a first immunotherapeutic agent that targets a first lineage-specific cell surface antigen, e.g., IC of the first immunotherapeutic agent on the population of cells. 50 is the IC of the first immunotherapeutic agent for control cells (e.g., the control cells are wild-type counterpart cells). 50 For example, at least 2, 3, 4, 5, 10, 20, 50, or 100 times greater in the assay of Example 2 than in the assay of Example 2. 38. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, which are resistant to a second immunotherapeutic agent that targets a second lineage-specific cell surface antigen, e.g., IC of the second immunotherapeutic agent on the population of cells. 50 is the IC of the second immunotherapeutic agent for control cells (e.g., the control cells are wild-type counterpart cells). 50 For example, at least 2, 3, 4, 5, 10, 20, 50, or 100 times greater in the assay of Example 2 than in the assay of Example 2. 39. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, which are resistant to a first immunotherapeutic agent that targets a first lineage-specific cell surface antigen and a second immunotherapeutic agent that targets a second lineage-specific cell surface antigen, e.g., the cells exhibit less than 50%, 40%, 35%, 30%, 25%, 20%, or 15% specific killing, e.g., in an in vitro cytotoxicity assay, e.g., in the assay of Example 9.

[0051] 40. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% of the cells in the population substantially lack cell surface expression of both the first lineage-specific cell surface antigen and the second lineage-specific cell surface antigen. 41. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein approximately 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% of the cells in the population comprise at least one allelic mutation in a first lineage-specific cell surface antigen and at least one allelic mutation in a second lineage-specific cell surface antigen. 42. The population of genetically engineered hematopoietic cells of any of the preceding embodiments, wherein approximately 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, or 80-90% of the cells in the population comprise a biallelic mutation in a first lineage-specific cell surface antigen and a biallelic mutation in a second lineage-specific cell surface antigen. 43. The genetically engineered population of hematopoietic cells of any of embodiments 1-42, comprising: (a) the first lineage-specific cell surface antigen is CD33 and the second lineage-specific cell surface antigen is CD123; (b) the population of cells comprises HSCs; and (c) at least 20%, 30%, 40%, 50%, or 60% of the cells in the population substantially lack cell surface expression of both CD123 and CD33. 44. The genetically engineered population of hematopoietic cells of any of embodiments 1-42, comprising: (a) the first lineage-specific cell surface antigen is CD33 and the second lineage-specific cell surface antigen is CLL-1; (b) the population of cells comprises HSCs; and (c) at least 20%, 30%, 40%, 50%, or 60% of the cells in the population substantially lack cell surface expression of both CLL1 and CD33.

[0052] 45. The genetically engineered population of hematopoietic cells of any of embodiments 1-42, comprising: (a) the first lineage-specific cell surface antigen is CD123 and the second lineage-specific cell surface antigen is CLL-1; (b) the population of cells comprises HSCs; and (c) at least 20%, 30%, 40%, 50%, or 60% of the cells in the population substantially lack cell surface expression of both CLL1 and CD123. 46. ​​The genetically engineered population of hematopoietic cells of any of embodiments 1-42, comprising: (a) the first lineage-specific cell surface antigen is CD19 and the second lineage-specific cell surface antigen is CD33; (b) the population of cells comprises HSCs; and (c) at least 20%, 30%, 40%, 50%, or 60% of the cells in the population substantially lack cell surface expression of both CD19 and CD33. 47. The population of any of embodiments 43-46, wherein (d) the gene edit of the first gene comprises a frameshift mutation and the gene edit of the second gene comprises a frameshift mutation. 48. The genetically engineered population of hematopoietic cells of any of the preceding embodiments, wherein the hematopoietic cells are hematopoietic stem cells (HSCs). 49. The genetically engineered population of hematopoietic cells of embodiment 48, wherein the HSCs are CD34+ / CD33- cells.

[0053] 50. The genetically engineered population of hematopoietic cells of any one of embodiments 1-49, wherein the hematopoietic cells are from bone marrow cells, umbilical cord blood cells, or peripheral blood mononuclear cells (PBMCs). 51. The genetically engineered population of hematopoietic cells of any one of embodiments 1-40, wherein the first lineage-specific cell surface antigen variant and / or the second lineage-specific cell surface antigen variant comprises a mutated non-essential epitope. 52. The genetically engineered population of hematopoietic cells of any of embodiments 1-51, comprising: the gene editing of the gene encoding the first lineage-specific cell surface antigen comprises a frameshift mutation; and the gene edit of the second gene comprises a frameshift mutation; One or both of the following may be true: 53. The population of genetically engineered hematopoietic cells of embodiment 52, wherein the frameshift mutation comprises an insertion or deletion of less than 20, 15, 10, 5, 4, 3, or 2 nucleotides. 54. The population of genetically engineered hematopoietic cells of any of the preceding aspects, wherein the gene editing comprises genome editing.

[0054] 55. The population of genetically engineered hematopoietic cells of any of aspects 1-54, wherein one or more cells within the population are negative for one or both of the first lineage-specific cell surface antigen and the second first lineage-specific cell surface antigen. 56. The genetically engineered population of hematopoietic cells of any of embodiments 1-55, wherein the CD33 pseudogene is unaltered in one or more (e.g., at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or all) of the cells in the population. 57. The population of genetically engineered hematopoietic cells of any of aspects 1-56, wherein the average number of off-target gene edits in the cell population is less than 3, 2, or 1 per cell. 58. The genetically engineered population of hematopoietic cells of embodiment 57, wherein the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen has at least 3 amino acids. 59. The population of genetically engineered hematopoietic cells of embodiment 58, wherein the nonessential epitope on the first lineage-specific cell surface antigen and / or the nonessential epitope on the second lineage-specific cell surface antigen is 6 to 10 amino acids.

[0055] 60. The genetically engineered population of hematopoietic cells of any one of embodiments 1-59, wherein at least one of the first and second lineage-specific cell surface antigens is a type 1 lineage-specific cell surface antigen. 61. The genetically engineered population of hematopoietic cells of embodiment 60, wherein the type 1 lineage-specific cell surface antigen is CD19. 62. The population of genetically engineered hematopoietic cells of embodiment 61, wherein the first group of genetically engineered hematopoietic cells contains a gene edit in exon 2 or exon 4 of the CD19 gene. 63. The genetically engineered population of hematopoietic cells of embodiment 62, wherein the CD19 gene is an endogenous CD19 gene. 64. The population of genetically engineered hematopoietic cells of embodiment 62 or 63, wherein a first group of genetically engineered hematopoietic cells expresses a mutated CD19 comprising the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 73.

[0056] 65. The genetically engineered population of hematopoietic cells of any one of embodiments 1-64, wherein at least one of the first and second lineage-specific cell surface antigens is a type 2 lineage-specific cell surface antigen. 66. The genetically engineered population of hematopoietic cells of embodiment 65, wherein the type 2 lineage-specific cell surface antigen is CD33. 67. The population of genetically engineered hematopoietic cells of embodiment 66, wherein the second group of genetically engineered hematopoietic cells contains a gene edit in exon 2 or exon 3 of the CD33 gene. 68. The genetically engineered population of hematopoietic cells of embodiment 67, wherein the CD33 gene is an endogenous CD33 gene. 69. The population of genetically engineered hematopoietic cells of embodiment 67 or 68, wherein the second group of genetically engineered hematopoietic cells expresses a mutated CD33 comprising the amino acid sequence of SEQ ID NO:56 or SEQ ID NO:58.

[0057] 70. The population of genetically engineered hematopoietic cells of any one of aspects 1 to 69, which are produced by genome editing. 71. The genetically engineered population of hematopoietic cells of embodiment 70, wherein the genome editing involves zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), or a CRISPR-Cas system. 72. The population of genetically engineered hematopoietic cells of embodiment 71, wherein the CRISPR-Cas system comprises a Cas endonuclease. 73. The population of genetically engineered hematopoietic cells of embodiment 72, wherein the Cas endonuclease is a Cas9 endonuclease. 74. The genetically engineered population of hematopoietic cells of any one of embodiments 1-73, wherein at least one of the first and second lineage-specific cell surface antigens is associated with a hematopoietic malignancy.

[0058] 75. The genetically engineered population of hematopoietic cells of any one of embodiments 1-74, wherein at least one of the first and second lineage-specific cell surface antigens is a type 0 protein. 76. The genetically engineered population of hematopoietic cells of any one of embodiments 1-75, wherein the first and second lineage-specific cell surface antigens are selected from the group consisting of CD7, CD13, CD19, CD20, CD22, CD25, CD32, CD33, CD38, CD44, CD45, CD47, CD56, CD96, CD117, CD123, CD135, CD174, CLL-1, folate receptor b, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3, and WT1. 77. The genetically engineered population of hematopoietic cells of embodiment 76, wherein the first and second lineage-specific cell surface antigens are: (i) CD19 and CD33; (ii) CD19 and CD13; (iii) CD19 and CD123; (iv) CD19 and CLL-1; (v) CD33 and CD13; (vi) CD33 and CD123; (vii) CD33 and CLL-1; (viii) CD13 and CD123; (ix) CD123 and CLL-1; (x) CD19, CD33, and CD13; (xi) CD19, CD33, and CD123; (xii) CD33, CD13, and CD123; (xiii) CD19, CD13, and CD123; (xiv) CLL-1, CD123, and CD33; or (xv) CD19, CD33, CD13, and CD123; is selected from the group consisting of: 78. A method for producing genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells; and (ii) gene editing a first gene encoding a first lineage-specific cell surface antigen and a second gene encoding a second lineage-specific cell surface antigen in a hematopoietic population to produce genetically engineered hematopoietic cells; Includes: 79. The method of embodiment 78, wherein the first gene and the second gene are: (i) CD19 and CD33; (ii) CD19 and CD13; (iii) CD19 and CD123; (iv) CD19 and CLL-1; (v) CD33 and CD13; (vi) CD33 and CD123; (vii) CD33 and CLL-1; (viii) CD13 and CD123; or (ix) CD123 and CLL-1, is.

[0059] 80. A method for producing genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells; (ii) gene editing the CD19 gene, the CD33 gene, or both genes in a population of hematopoietic cells by CRISPR to generate genetically engineered hematopoietic cells; Including, Gene editing of the CD19 gene involves one or more guide nucleic acid molecules that target one or more introns of CD19; Gene editing of the CD33 gene involves one or more guide nucleic acid molecules that (a) target one or more introns of CD33; and / or (b) do not target the CD33 pseudogene upstream of the CD33 gene. 81. The method of embodiment 80, wherein the introns of the CD19 gene include intron 1 and intron 2, and / or the introns of the CD33 gene include intron 1 and intron 2. 82. The method of embodiment 80 or 81, wherein the gene editing of CD19 results in the elimination of exon 2 of the CD19 gene; and / or the gene editing of CD33 results in the elimination of exon 2 of the CD33 gene. 83. A method for producing genetically engineered hematopoietic cells, the method comprising: (i) providing a population of hematopoietic cells; (ii) gene editing the CD19 gene, the CD33 gene, or both in a population of hematopoietic cells by CRISPR to generate genetically engineered hematopoietic cells; Including, and / or wherein the gene editing of the CD19 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 14-26, 67, and 69-72. Gene editing of the CD33 gene involves at least one guide nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 27-50 and 68. 84. The method of embodiment 83, wherein step (ii) is carried out by gene editing both the CD19 gene and the CD33 gene in the population of hematopoietic cells using CRISPR to produce genetically engineered hematopoietic cells; Gene editing of the CD19 gene involves a guide nucleic acid comprising the nucleotide sequence of SEQ ID NO: 67; Gene editing of the CD33 gene involves a guide nucleic acid comprising the nucleotide sequence of SEQ ID NO:68.

[0060] 85. The method of any one of embodiments 80 to 84, wherein the hematopoietic cells are HSCs. 86. The method of embodiment 85, wherein the HSCs are CD34+ / CD33- cells. 87. The method of any one of embodiments 80 to 86, wherein the hematopoietic cells are from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs). 88. A genetically engineered hematopoietic cell produced by any of embodiments 80-87. 89. A genetically engineered hematopoietic cell, which harbors a gene-edited CD19 gene capable of expressing a mutant CD19 comprising the amino acid sequence of SEQ ID NO: 52 or 73, and / or a gene-edited CD33 gene capable of expressing a mutant CD33 comprising the amino acid sequence of SEQ ID NO: 56 or SEQ ID NO: 58.

[0061] 90. The genetically engineered hematopoietic cell of embodiment 89, wherein the cell harbors a gene-edited CD19 gene capable of expressing a mutant CD19 comprising the amino acid sequence of SEQ ID NO: 52 or 73, and a gene-edited CD33 gene capable of expressing a mutant CD33 comprising the amino acid sequence of SEQ ID NO: 56. 91. A genetically engineered population of hematopoietic stem cells, wherein at least 50% of the hematopoietic stem cells carry both a gene-edited CD19 gene and a gene-edited CD33 gene. 92. The genetically engineered population of hematopoietic stem cells of embodiment 91, wherein the gene-edited CD19 gene is capable of expressing a CD19 variant comprising the amino acid sequence of SEQ ID NO: 52 or 73, and / or the gene-edited CD33 gene is capable of expressing a CD33 variant comprising the amino acid sequence of SEQ ID NO: 56 or SEQ ID NO: 58. 93. Genetically engineered hematopoietic cells, wherein exon 2 of the CD33 gene in the hematopoietic cells is modified and the CD33 pseudogene is not modified. 94. The genetically engineered hematopoietic cell of embodiment 93, wherein exon 2 of the CD33 gene in the hematopoietic cell is deleted.

[0062] 95. The genetically engineered hematopoietic cell of embodiment 93 or 94, wherein the CD33 pseudogene is not modified by a deletion or mutation that causes a frameshift. 96. The genetically engineered hematopoietic cell of embodiment 93 or 94, wherein the CD33 pseudogene is not modified by a deletion or mutation that causes a frameshift in exon 1, intron 1, exon 2, or a combination thereof. 97. The genetically engineered hematopoietic cell of embodiment 93, wherein the frameshift is on a sequence(s) of exon 1, intron 1, and / or exon 2 of a CD33 pseudogene that shares sequence homology with a sequence(s) of exon 1, intron 1, and / or exon 2 of CD33, respectively. 98. A method of providing hematopoietic cells to a subject (e.g., a subject with a hematopoietic malignancy), comprising: (a) providing the population of genetically engineered hematopoietic cells of any one of embodiments 1-77 and 88-97, optionally wherein the genetically engineered hematopoietic cells comprise HSCs and / or HPCs; (b) administering the population of genetically engineered hematopoietic cells to a subject, e.g., under conditions that allow engraftment of at least a portion of the population; Including, This provides hematopoietic cells to the subject. 99. A method of treating a hematopoietic malignancy, comprising administering to a subject in need thereof a population of genetically engineered hematopoietic cells of any one of embodiments 1-77 and 88-97.

[0063] 100. The method of embodiment 99, further comprising: (a) administering to a subject an effective amount of a first immunotherapeutic agent that targets a first lineage-specific cell surface antigen; (b) administering to the subject an effective amount of a second immunotherapeutic agent that targets a second lineage-specific cell surface antigen; Includes: 101. The method of embodiment 100, wherein the first immunotherapeutic agent and the second immunotherapeutic agent are administered simultaneously or sequentially (e.g., sequentially, with or without overlap; e.g., the first and second immunotherapeutic agents are not present in the subject at the same time). 102. The method of embodiment 100 or 101, wherein a first immunotherapeutic agent is administered when the subject has a primary cancer, and a second immunotherapeutic agent is administered when the subject has a recurrent cancer or a cancer that is resistant to the first immunotherapeutic agent. 103. The method of embodiment 102, wherein the primary cancer is AML and the recurrent cancer is recurrent AML. 104. The method of embodiment 102, wherein the primary cancer is AML and the recurrent cancer is ALL.

[0064] 105. The method of any of embodiments 102 or 104, wherein the recurrent cancer has undergone lineage switching relative to the primary cancer. 106. The method of any of embodiments 102-105, wherein the first lineage-specific cell surface antigen is absent in the recurrent cancer, or is expressed at a lower level in the recurrent cancer compared to the primary cancer (e.g., at less than 50%, 40%, 30%, 20%, or 10% of the protein level in the primary cancer), or is expressed in fewer cancer cells in the recurrent cancer compared to the primary cancer (e.g., less than 50%, 40%, 30%, 20%, or 10% of the recurrent cancer cells detectably express the protein). 107. The method of any of embodiments 102-106, wherein the primary cancer comprises one or more resistant cells, e.g., cells that lack or express a first lineage-specific cell surface antigen at a lower level than in sensitive cells. 108. The method of any of embodiments 89-107, further comprising: administering to the subject an effective amount of a first immunotherapeutic agent that targets expressing a first lineage-specific cell surface antigen. 109. In the method of embodiment 108, if the subject experiences a recurrence (e.g., a recurrence in which the cancer is negative for the first lineage-specific cell surface antigen), an effective amount of a second immunotherapeutic agent that targets a second lineage-specific cell surface antigen is administered to the subject.

[0065] 110. The method of any of embodiments 100-109, wherein the first lineage-specific cell surface antigen is CD19 and the second lineage-specific cell surface antigen is CD33. 111. The method of any of embodiments 100-110, wherein the subject has a cancer (eg, a primary cancer) comprising a first subpopulation of cancer cells and a second subpopulation of cancer cells. 112. The method of embodiment 111, wherein a first subpopulation of the cancer cells expresses a first lineage-specific cell surface antigen, and a second subpopulation of the cancer cells expresses a second lineage-specific cell surface antigen. 113. The method of embodiment 112, wherein a first subpopulation of cancer cells is targeted by a first immunotherapeutic agent and a second subpopulation of cancer cells is targeted by a second immunotherapeutic agent. 114. The method of embodiment 113, wherein the first subpopulation of cancer cells is resistant to the second immunotherapeutic agent, or the second immunotherapeutic agent is less effective against the first subpopulation of cancer cells than against the second subpopulation of cancer cells, e.g., by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0066] 115. The method of embodiment 113 or 114, wherein the second subpopulation of cancer cells is resistant to the first immunotherapeutic agent, or the first immunotherapeutic agent is less effective against the second subpopulation of cancer cells than against the first subpopulation of cancer cells, e.g., by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. 116. The method of any of embodiments 113-115, wherein the first subpopulation of cancer cells does not express the second lineage-specific cell surface antigen, or the second lineage-specific cell surface antigen is expressed at a lower level (e.g., less than 50%, 40%, 30%, 20%, or 10% of the protein level) in the first subpopulation compared to the second subpopulation. 117. The method of any of embodiments 113-116, wherein the second subpopulation of cancer cells does not express the first lineage-specific cell surface antigen, or the first lineage-specific cell surface antigen is expressed at a lower level (e.g., less than 50%, 40%, 30%, 20%, or 10% of the protein level) in the second subpopulation compared to the first subpopulation. 118. The method of any of embodiments 113-117, wherein the first subpopulation of cancer cells expresses CD33 and the second subpopulation of cancer cells expresses CD123 or CLL-1. 119. The method of any of embodiments 113-118, wherein the first subpopulation of cancer cells is about 50-99%, 60-90%, 70-90%, or about 80% of the subject's cancer cells.

[0067] 120. The method of any of embodiments 113-119, wherein the second subpopulation of cancer cells is about 1-50%, 10-40%, 10-30%, or about 20% of the subject's cancer cells. 121. The method of any of embodiments 113-120, wherein the first subpopulation of cancer cells are bulk cancer cells and / or the second subpopulation of cancer cells are cancer stem cells. 122. The method of any of embodiments 113-121, wherein the first subpopulation of cancer cells has one or more markers of differentiated hematopoietic cells, and / or the second subpopulation of cancer cells has one or more markers of HSCs or HPCs. 123. The method of any of embodiments 113-122, wherein the first immunotherapeutic agent and the second immunotherapeutic agent are administered simultaneously. 124. The method of any of embodiments 113-123, wherein the first immunotherapeutic agent and the second immunotherapeutic agent are administered such that both the first immunotherapeutic agent and the second immunotherapeutic agent are present in the subject simultaneously.

[0068] 125. The method of any of embodiments 113-124, further comprising administering to the subject an effective amount of a first immunotherapeutic agent. 126. The method of embodiment 125, wherein the first immunotherapeutic agent is a cytotoxic agent that targets cells expressing either the first lineage-specific cell surface antigen or the second lineage-specific cell surface antigen. 127. The method of embodiment 126, wherein the first immunotherapeutic agent is a cytotoxic agent that targets cells expressing a first lineage-specific cell surface antigen, and the method further comprises administering to the subject a second immunotherapeutic agent when the hematopoietic malignancy recurs in the subject. 128. The method of embodiment 127, wherein the second immunotherapeutic agent is a cytotoxic agent that targets cells expressing a second lineage-specific cell surface antigen. 129. The method of any one of embodiments 126-128, wherein the first immunotherapeutic agent, the second immunotherapeutic agent, or both are CAR-T cells.

[0069] 130. The method of any one of embodiments 126-128, wherein the first immunotherapeutic agent, the second immunotherapeutic agent, or both, is an antibody. 131. The method of any one of embodiments 126-128, wherein the first immunotherapeutic agent, the second immunotherapeutic agent, or both, is an antibody-drug conjugate. 132. The method of any one of embodiments 113 to 131, wherein the hematopoietic malignancy is AML. 133. The method of embodiment 132, wherein the AML is relapsed AML.

[0070] The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the invention will also be apparent from the following drawings and detailed description of several embodiments, as well as from the appended claims.

[0071] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [Brief explanation of the drawings]

[0072] [Figure 1A] 1A and 1B are schematic diagrams illustrating an example therapeutic process involving the methods described herein. 1A: The process involves obtaining CD34+ cells (obtained from a donor or autologously), genetically engineering the CD34+ cells, engrafting the engineered cells into a patient, and administering CAR T cell therapy to the patient, resulting in complete removal or reduction of cancer burden and preserved hematopoiesis. [Figure 1B-1] 1A and 1B are schematic diagrams showing an example therapeutic process involving the methods described herein. 1B: Engineered donor CD34+ cells in which a nonessential epitope of a lineage-specific cell surface antigen has been modified so that it does not bind to CAR T cells specific for that epitope. [Figure 1B-2] 1A and 1B are schematic diagrams showing an example therapeutic process involving the methods described herein. 1B: Engineered donor CD34+ cells in which a nonessential epitope of a lineage-specific cell surface antigen has been modified so that it does not bind to CAR T cells specific for that epitope. [Figure 1B-3] 1A and 1B are schematic diagrams showing an example therapeutic process involving the methods described herein. 1B: Engineered donor CD34+ cells in which a nonessential epitope of a lineage-specific cell surface antigen has been modified so that it does not bind to CAR T cells specific for that epitope. [Figure 1B-4]1A and 1B are schematic diagrams showing an example therapeutic process involving the methods described herein. 1B: Engineered donor CD34+ cells in which a nonessential epitope of a lineage-specific cell surface antigen has been modified so that it does not bind to CAR T cells specific for that epitope. [Figure 2-1] Figure 2 is a schematic diagram of the extracellular and transmembrane portions of the lineage-specific cell surface protein human CD33. Regions of CD33 that are predicted to be less deleterious when modified are indicated by boxes. The sequence corresponds to SEQ ID NO:51. [Figure 2-2] Figure 2 is a schematic diagram of the extracellular and transmembrane portions of the lineage-specific cell surface protein human CD33. Regions of CD33 that are predicted to be less deleterious when modified are indicated by boxes. The sequence corresponds to SEQ ID NO:51. [Figure 3A-1] Figures 3A and 3B are schematic diagrams showing that CAR T cells bind to cells expressing human CD33, but not to cells expressing human CD33 with altered or deleted CD33 epitopes. 3A: CAR T cells target CD33+ acute myeloid leukemia cells, leading to cell lysis. [Figure 3A-2] Figures 3A and 3B are schematic diagrams showing that CAR T cells bind to cells expressing human CD33, but not to cells expressing human CD33 with altered or deleted CD33 epitopes. 3A: CAR T cells target CD33+ acute myeloid leukemia cells, leading to cell lysis. [Figure 3B-1] Figures 3A and 3B are schematic diagrams showing that CAR T cells bind to cells expressing human CD33, but not to cells expressing human CD33 with altered or deleted epitopes on CD33. 3B: CAR T cells are incapable of binding to genetically engineered donor graft cells with altered or deleted CD33 epitopes. As a result, these cells are not lysed. [Figure 3B-2]Figures 3A and 3B are schematic diagrams showing that CAR T cells bind to cells expressing human CD33, but not to cells expressing human CD33 with altered or deleted epitopes on CD33. 3B: CAR T cells are incapable of binding to genetically engineered donor graft cells with altered or deleted CD33 epitopes. As a result, these cells are not lysed. [Figure 4] FIG. 4 is a schematic diagram of CRISPR / Cas9-mediated genomic deletion of CD19 exon 2, resulting in expression of an exon 2-deleted CD19 variant.

[0073] [Figure 5A] Figures 5A and 5B contain diagrams showing the investigation of various modified single-guide RNAs (ms-sgRNAs) targeting CD19 in a human leukemia cell line (K562 cells). 5A: Photograph showing PCR amplicons derived from a region spanning introns 1 and 2 of the CD19 gene, as determined by T7E1 assay. Samples were either treated with T7E1 (+) or untreated (-). Percentage cleavage efficiency is indicated below each lane. C = New England Biolabs (NEB) sample control; WT = wild-type untransfected cells; Cas9 = Cas9 alone. [Figure 5B] Figures 5A and 5B include diagrams showing the examination of various modified single guide RNAs (ms-sgRNAs) targeting CD19 in a human leukemia cell line (K562 cells). 5B: Chart showing the percent indels determined by T7E1 assay and TIDE analysis. [Figure 6A] 6A-6C include diagrams showing dual ms-sgRNA-mediated deletion of exon 2 of CD19 in K562 cells. 6A: Schematic showing a PCR-based assay for detecting CRISPR / Cas9-mediated genomic deletion of exon 2 of CD19 by dual ms-sgRNA-mediated CRISPR / Cas9. [Figure 6B-C] Figures 6A-6C include diagrams showing dual ms-sgRNA-mediated deletion of exon 2 of CD19 in K562 cells. 6B: Photograph showing deletion of the region between exon 1 and exon 3 after treatment of K562 cells with the indicated pair of ms-sgRNAs by end-point PCR assay of genomic DNA. 6C: Chart showing percentage deletion quantified by end-point PCR. [Figure 7A] Figures 7A and 7B contain diagrams showing the screening of CD19 ms-sgRNAs targeting intron 1 or 2 in CD34+ HSCs by T7E1 assay and TIDE analysis. 7A: Photograph showing PCR amplicons derived from the region spanning intron 1 and 2 of the CD19 gene, as determined by T7E1 assay. Samples were either treated with T7E1 (+) or untreated (-). The percent insertion / deletion (indel) and cleavage efficiency are indicated below each lane. C = NEB sample control; Cas9 = Cas9 only. [Figure 7B] Figures 7A and 7B include diagrams showing screening of CD19 ms-sgRNAs targeting intron 1 or 2 in CD34+ HSCs by T7E1 assay and TIDE analysis. 7B: PCR amplicons derived from the region spanning intron 1 and 2 of the CD19 gene were analyzed by T7E1 assay or TIDE analysis to determine the percent indels. Cas9 = cas9-only control. [Figure 8A-B] Figures 8A and 8B include diagrams showing dual ms-sgRNA-mediated deletion of CD19 exon 2 in CD34+ HSCs. 8A: Photograph showing the smaller deletion PCR product compared to the larger parental band, as determined by PCR of the genomic deletion region. 8B: Chart showing the percent deletion quantified by end-point PCR. [Figure 9A-B]Figures 9A and 9B include diagrams showing the investigation of ms-sgRNAs targeting intron 1 or 2 of CD19 in CD34+ HSCs. 9A: Photograph showing PCR amplicons derived from the region spanning introns 1 and 2 of the CD19 gene as determined by T7E1 assay. Percent cleavage efficiency is indicated below each lane. 9B: Chart showing PCR amplicons and percent indels derived from the region spanning introns 1 and 2 of the CD19 gene as analyzed by T7E1 assay. Cas9 = cas9-only control.

[0074] [Figure 10A] Figures 10A-10D include diagrams showing efficient duplex ms-sgRNA-mediated deletion of exon 2 of CD19 in CD34+ HSCs. 10A: Photograph showing the smaller deletion PCR product compared to the larger parental band, as determined by PCR of the genomic deletion region. The percent deletion is indicated below each lane. [Figure 10B] 10A-10D include diagrams showing efficient double ms-sgRNA-mediated deletion of exon 2 of CD19 in CD34+ HSCs. 10B: Chart showing percent deletion quantified by end-point PCR. [Figure 10C-D] Figures 10A-10D include diagrams showing efficient double ms-sgRNA-mediated deletion of exon 2 of CD19 in CD34+ HSCs. 10C: Photographs showing PCR products of full-length CD19 or CD19 with a deletion of exon 2 when edited with the gRNA6 / gRNA14 pair. 10D: Chart showing the percentage of CFUs of cells edited by the gRNA6 / gRNA14 pair. BFU-E: erythroid burst-forming cells; CFU-GM: granulocyte-macrophage colony-forming cells; CFU-GEMM: multipotent myeloid progenitor colony-forming cells (generate granulocytes, erythrocytes, monocytes, and megakaryocytes). [Figure 11A]11A-11E are diagrams showing the generation and characterization of B cell lymphoma cells carrying an exon 2 deletion in CD19 using a pair of gRNAs, gRNA6 and gRNA14. 11A: Photographs showing the genomic DNA of full-length CD19 and CD19 with the exon 2 deletion (left panel) and PCR products of the cDNA of full-length CD19 and CD19 with the exon 2 deletion. [Figure 11B] 11A-11E are diagrams showing the generation and characterization of B-cell lymphoma cells harboring an exon 2 deletion in CD19 using a pair of gRNAs, gRNA6 and gRNA14. 11B: Chart showing quantification of editing efficiency by end-point PCR. [Figure 11C] 11A-11E are diagrams showing the generation and characterization of B-cell lymphoma cells carrying an exon 2 deletion in CD19 using a pair of gRNAs, gRNA6 and gRNA14. 11C: Photographs showing the expression of full-length CD19 and CD19 mutants carrying a deletion of the fragment encoded by exon 2 using an antibody specific for the C-terminus of CD19. [Figure 11D] Figures 11A-11E are diagrams showing the generation and characterization of B-cell lymphoma cells with an exon 2 deletion in CD19 using a pair of gRNAs, gRNA6 and gRNA14. 11D: Chart showing surface and intracellular staining of CD19 expression in edited cells as measured by flow cytometry. [Figure 11E] Figures 11A-11E are diagrams showing the generation and characterization of B cell lymphoma cells with an exon 2 deletion in CD19 using a pair of gRNAs, gRNA6 and gRNA14. 11E: Chart showing cell number (left panel) and cell viability (right panel) of Raji B cells expressing CD19 exon 2. [Figure 12A]12A-12C include diagrams illustrating the engraftment of CD19ex2 hematopoietic stem cells (HSCs) in a mouse model. 12A: Schematic workflow for assessing the differentiation potential of edited CD34+ HSCs. d = days, w = weeks, w / o = age, RNP = ribonucleoprotein. [Figure 12B] 12A-12C include diagrams illustrating the engraftment of CD19ex2 hematopoietic stem cells (HSCs) in a mouse model. 12B: Chart showing the percentage of CD45+ cells in peripheral blood collected from mice engrafted with HSCs expressing CD19ex2. [Figure 12C] 12A-12C include diagrams illustrating the engraftment of CD19ex2 hematopoietic stem cells (HSCs) in a mouse model. 12C: Chart showing the percentage of CD19 B cells in peripheral blood collected from mice engrafted with HSCs expressing CD19ex2. [Figure 13] Figure 13 is a schematic workflow for assessing the in vivo selectivity and efficacy of CART19 therapy in the Raji Burkitt lymphoma tumor model. d = days, w = weeks, w / o = age. [Figure 14A] Figures 14A-14D include diagrams showing the generation of Raji-fluc-GFP cells with a deletion of CD19 exon 2. 14A: Diagram showing CD19 expression in Raji-fluc-GFP cell lines transfected with the indicated combinations of ms-sgRNAs, as determined by FACS. Parental Raji cells and Raj-fluc-GFP nucleofected with Cas9 alone are included as controls. [Figure 14B-D]Figures 14A-14D include diagrams showing the generation of CD19 exon 2 deleted Raji-fluc-GFP cells. 14B: Chart showing the percentage of live cells in each population of cells (CD19 "high," CD19 "medium," and CD19 "low"). 14C: Photograph showing the smaller PCR product of the exon 2 deletion compared to the larger parental band, as determined by PCR of the genomic deletion region. 14D: Chart showing the percentage of cells with deleted CD19 exon 2 in the bulk population of cells, as determined by end-point PCR.

[0075] [Figure 15A-B] 15A-15B include diagrams showing the level of CART19 cytotoxicity against CD19 exon 2 deleted Raji cells. 15A: Line graph showing that CD19 exon 2 deleted cells are resistant to CART19 cytotoxicity. 15B: Bar graph showing that CD19 exon 2 deleted cells are resistant to CART19 cytotoxicity. [Figure 16] FIG. 16 is a schematic diagram showing an exemplary in vivo model for assessing the efficacy and selectivity of CART therapy paired with edited HSCs involving the methods described herein. [Figure 17] FIG. 17 is a schematic diagram showing CD33 exon 2 editing leading to expression of CD33m variants. [Figure 18A-B] Figures 18A-18B contain charts showing the examination of various ms-sgRNAs targeting intron 1 or 2 of CD33 in CD34+ HSCs by TIDE analysis. PCR amplicons derived from regions spanning introns 1 and 2 of the CD33 gene were analyzed by TIDE analysis to determine the percent indels. 18A: Guide RNAs 1-19. 18B: Guide RNAs 10-24. [Figure 19A-B]Figures 19A-19B include diagrams showing the characterization of CD33-edited primary CD34+ HSCs. 19A: Diagram showing flow cytometry analysis of CD34+ HSCs that were either unedited (left panel, mock ("NT")) or edited to produce a complete CD33 knockout (middle panel, "CD33 gRNA KO"), or edited with the CD33 gRNA-18 / gRNA-24 pair, resulting in expression of a mutated CD33 with a deleted fragment encoded by exon 2 (CD33ex2) or a complete knockout (right panel, "CD33 gRNA18+24"). 19B: Chart showing the percentage of HSCs with knockout CD33 ("KO") and CD33 with an exon 2 deletion ("ex2 Del") obtained in cells edited with the knockout gRNA or the CD33 gRNA18 / gRNA24 pair.

[0076] [Figure 20A-B] Figures 20A-20B include diagrams showing the genotyping and in vitro differentiation of cells edited with dual gRNAs targeting CD33. 20A: Chart showing that CD33ex2 and CD33KO cells retained differentiation potential in vitro, as determined by CFU assay. 20B: Photograph showing that both CD33ex2 and knockout alleles were observed in differentiated myeloid cells treated with the CD33 gRNA18 / gRNA24 pair. [Figure 21A-C]Figures 21A-21C include diagrams showing the generation and characterization of CD33ex2 in AML cell lines. 21A: Photograph showing genomic PCR results of selected HL60 clones resulting from gene editing with the CD33 gRNA18 / gRNA24 pair. 21B: Diagram illustrating Taqman assays for total CD33 (full-length + ex2del, including both full-length and exon 2 deleted) and CD33 (with exon 2 deleted). 21C: Chart showing expression levels of total CD33 (full-length and exon 2 deleted; left panel) and CD33ex2del in Jurkat cells, parental HL60 cells, and several edited HL60 clones. [Figure 22A-B] Figures 22A-22C include diagrams showing the sensitivity of CD33ex2 cells to gemtuzumab ozogamicin (GO). 22A: Chart showing the viability of cancer cell lines (Jurkat, THP-1, and HL-60) treated with GO at the indicated concentrations. 22B: Chart showing the viability of THP-1 cells, CD33ex2 THP-1 cells (generated with the CD33 gRNA18 / gRNA24 pair), HL-60 cells, and CD33ex2 HL-60 cells (generated with the CD33 gRNA18 / gRNA24 pair) treated with GO at the indicated concentrations. [Figure 22C] 22A-22C include diagrams showing the sensitivity of CD33ex2 cells to gemtuzumab ozogamicin (GO). 22C: Chart showing the viability of wild-type HSCs, CD33KO HSCs, and CD33ex2 HSCs (generated with the CD33 gRNA18 / gRNA24 pair) after GO treatment ("GO") compared to the PBS control ("PBS"). [Figure 23A-B]Figures 23A-23D include diagrams showing that CD33ex2 cells are resistant to CART33-mediated cytotoxicity. 23A: Chart showing the level of cell lysis of wild-type HL-60 cells (CD33+) in the presence of CART33 (expressing anti-CD33 CAR1). 23B: Chart showing the level of cell lysis of CD33ex2 HL-60 cells in the presence of CART33. [Figure 23C-D] 23A-23D include diagrams showing that CD33ex2 cells are resistant to CART33-mediated cytotoxicity. 23C: Chart showing the level of cell lysis of CD33KO HL-60 cells in the presence of CART33. 23D: Chart comparing the percentage of cell lysis of CD33+ cells, CD33ex2 cells, and CD33KO cells in the presence of CART33 at the indicated cell ratios. [Figure 24A-B] 24A-24D include diagrams showing the results of a TIDE assay demonstrating efficient multiplex genome editing of both CD19 and CD33. 24A: Chart showing genome editing of CD19, CD33, and CD19+CD33 in NALM-6 cells. 24B: Chart showing genome editing of CD19, CD33, and CD19+CD33 in HSCs. [Figure 24C-D] Figures 24A-24D include diagrams showing the results of a TIDE assay demonstrating efficient multiplex genome editing of both CD19 and CD33. 24C: Chart showing genome editing of CD19, CD33, and CD19+CD33 in HL-60 cells. 24D: Chart showing genome editing of CD19, CD33, and both CD19 and CD33 in NALM-6 cells.

[0077] [Figure 25A]Figures 25A-25C include diagrams showing the results of nucleofection assays demonstrating the effect of multiplex genome editing of both CD19 and CD33 on the viability of HSCs and cell lines compared to single RNA nucleofection. The gRNAs used for nucleofection are indicated on the x-axis. 25A: Chart showing the percent viability of HSC cells after genome editing. [Figure 25B] Figures 25A-25C include diagrams showing the results of nucleofection assays demonstrating the effect of multiplex genome editing of both CD19 and CD33 on the viability of HSCs and cell lines compared to single RNA nucleofection. The gRNAs used for nucleofection are indicated on the x-axis. 25B: Chart showing the percent viability of Nalm-6 cells after genome editing. From left to right, each set of three bars corresponds to zero, 24 h, and 48 h. [Figure 25C] Figures 25A-25C include diagrams showing the results of nucleofection assays demonstrating the effect of multiplex genome editing of both CD19 and CD33 on the viability of HSCs and cell lines compared to single RNA nucleofection. The gRNAs used for nucleofection are indicated on the x-axis. 25C: Chart showing the percent viability of HL-60 cells after genome editing. From left to right, each set of four bars corresponds to zero, 48 h, 96 h, and 7 d. [Figure 26A] Figures 26A-26C include diagrams showing the sequences of NALM-6 cells transfected with CD19-19 gRNA / RNP and CD33-37 gRNA / RNP complexes and bar graphs of TIDE analysis. 26A: Schematic of identified sequences and relative contribution of each sequence for CD19-edited Nalm-6 cells. [Figure 26B]Figures 26A-26C include diagrams showing the sequences of NALM-6 cells transfected with CD19-19 gRNA / RNP and CD33-37 gRNA / RNP complexes and bar graphs of TIDE analysis. 26B: Schematic representation of identified sequences and the relative contribution of each sequence for CD33-edited Nalm-6 cells. [Figure 26C] Figures 26A-26C include diagrams showing the sequences of NALM-6 cells transfected with CD19-19 gRNA / RNP and CD33-37 gRNA / RNP complexes and bar graphs of TIDE analysis. 26C: Charts showing the frequency of indels that are + / - 1 and + / - 2 (left and right columns, respectively, for each gene). TIDE analysis indicates that most indels are small insertions. [Figure 27-28] Figure 27 is a schematic diagram showing the sequence of the CD33 locus, encompassing the cleavage sites of CD33 gRNA-24 and gRNA-18. In this diagram, the sequence gtgagtggctgtggggagag is labeled gRNA-24, and the sequence ttcatgggtactgcagggca is labeled gRNA-18. Figure 28 shows an experimental schematic and results showing the editing efficiency achieved in CD34+ HSCs using a control ("mock," Cas9 only), a CD33 knockout ("CD33KO," CD33 gRNA-37), and a CD33 exon 2 deletion ("CD33ex2del," CD33 gRNA18 and gRNA24). The editing efficiency (percentage of modification) of the CD33 knockout was assessed by TIDE analysis, and % indels were determined. The fractional population with the exon 2 deletion was determined by end-point PCR. In CD33 exon 2 deletion edited cells, the 30% deletion efficiency refers to editing events that resulted in the deletion of exon 2, but does not encompass events that resulted in a complete knockout of CD33. [Figure 29]Figure 29 includes a diagram showing an analysis of editing events in HSCs resulting from the use of CD33 gRNA-37. The TIDE analysis shows the percentage of sequences observed for each indel obtained by editing CD34+ HSCs with gRNA37.

[0078] [Figure 30-31A] Figure 30 includes diagrams showing the results of flow cytometry analysis of unstained cells, unedited ("mock"), and HSCs edited with CD33 gRNA-37. Figures 31A-31E include diagrams and tables showing analysis of populations of CD34+ HSCs edited with either CD33 gRNA-37 or the CD33 gRNA-18 and gRNA-24 pair at various times after treatment with gemtuzumab ozogamicin (GO). 31A: Line graph showing the number of cells in each of the indicated populations after GO treatment over time. [Figure 31B-C] Figures 31A-31E include diagrams and tables showing analysis of populations of CD34+ HSCs edited with either CD33 gRNA-37 or the CD33 gRNA-18 and gRNA-24 pair at various times after treatment with gemtuzumab ozogamicin (GO). 31B: Table showing results corresponding to the graph shown in Figure 31A. 31C: Photographs showing analysis of CD33 editing after treatment with gemtuzumab ozogamicin. The percentage of edited cells in samples edited with CD33 gRNA-37 ("KO") was assessed by TIDE analysis, and the percentage of edited cells in samples edited with CD33 gRNA-18 and gRNA-24 ("CD33ex2del") was assessed by deletion PCR. [Figure 31D-E]31A-31E include diagrams and tables showing analysis of populations of CD34+ HSCs edited with either CD33 gRNA-37 or the CD33 gRNA-18 and gRNA-24 pair at various times after treatment with gemtuzumab ozogamicin (GO). 31D: Chart showing the percent CD14+ cells (myeloid differentiation) in the indicated cell population in the absence of gemtuzumab ozogamicin over time as indicated. 31E: Chart showing the percent CD14+ cells (myeloid differentiation) in the indicated cell population after gemtuzumab ozogamicin treatment over time as indicated. [Figure 32A-B] Figures 32A and 32B include photographs showing genome editing of CD19 in NAM6 cell lines transfected with control ("WT," wild-type / unmodified), CD19 sgRNA6 and sgRNA14 pair ("Ex2del-1"), CD19 sgRNA7 and sgRNA16 pair ("Ex2del-2"), and CD19 sgRNA-23 and sgRNA-24 pair (CD19 knockout; "CD19KO"). 32A: Photograph of a Western blot with an antibody recognizing the Ig-like C2-type domain encoded by CD19 exon 4 in the indicated cell populations. 32B: Photograph of a Western blot with an antibody recognizing the C-terminus of CD19 in the indicated cell populations. [Figure 33] Figure 33 shows target expression on AML cell lines. Expression of CD33, CD123, and CLL1 in MOLM-13 and THP-1 cells and unstained controls was determined by flow cytometry analysis. The X-axis indicates the intensity of antibody staining, and the Y-axis corresponds to cell number. [Figure 34]Figure 34 shows CD33- and CD123-modified MOLM-13 cells. CD33 and CD123 expression in wild-type (WT), CD33- / -, CD123- / -, and CD33- / -CD123- / - MOLM-13 cells was assessed by flow cytometry. To generate CD33- / - or CD123- / - MOLM-13 cells, WT MOLM-13 cells were electroporated with CD33- or CD123-targeted RNPs, followed by flow cytometric sorting of CD33- or CD123-negative cells. CD33- / -CD123- / - MOLM-13 cells were generated by electroporating CD33- / - cells with CD123-targeted RNPs and sorting for the CD123-negative population. The X-axis indicates the intensity of antibody staining, and the Y-axis corresponds to cell number.

[0079] [Figure 35] Figure 35 shows an in vitro cytotoxicity assay of CD33 and CD123 CAR-T. Anti-CD33 CAR-T and anti-CD123 CAR-T were incubated with wild-type (WT), CD33- / -, CD123- / -, and CD33- / -CD123- / - MOLM-13 cells, and cytotoxicity was assessed by flow cytometry. Untransduced T cells were used as mock CAR-T controls. The CAR pool group consisted of a 1:1 pooled combination of anti-CD33 and anti-CD123 CAR-T cells. Student's t-test was used. ns = not significant; *P<0.05; **P<0.01. The Y-axis indicates the percentage of specific killing. [Figure 36]Figure 36 shows CD33- and CLL1-modified HL-60 cells. Expression of CD33 and CLL1 in wild-type (WT), CD33- / -, CLL1- / -, and CD33- / -CLL1- / - HL-60 cells was assessed by flow cytometry. To generate CD33- / - or CLL1- / - HL-60 cells, WT HL-60 cells were electroporated with CD33- or CLL1-targeted RNPs, followed by flow cytometry sorting for CD33- or CLL1-negative cells. CD33- / -CLL1- / - HL-60 cells were generated by electroporating CD33- / - cells with CLL1-targeted RNPs and sorting for the CLL1-negative population. The X-axis indicates the intensity of antibody staining, and the Y-axis corresponds to cell number. [Figure 37] Figure 37 shows in vitro cytotoxicity assays of CD33 and CLL1 CAR-T. Anti-CD33 CAR-T and anti-CLL1 CAR-T were incubated with wild-type (WT), CD33- / -, CLL1- / -, and CD33- / -CLL1- / - HL-60 cells, and cytotoxicity was assessed by flow cytometry. Untransduced T cells were used as mock CAR-T controls. The CAR pool group consisted of a 1:1 pooled combination of anti-CD33 and anti-CLL1 CAR-T cells. Student's t-test was used. ns = not significant; *P<0.05; **P<0.01, ***P<0.001, ****P<0.0001. The Y-axis indicates the percentage of specific killing. [Figure 38] Figure 38 shows the gene editing efficiency of CD34+ cells. Human CD34+ cells were electroporated with Cas9 protein and CD33-, CD123-, or CLL1-targeting gRNA, either alone or in combination. The editing efficiency of the CD33, CD123, or CLL1 locus was determined by Sanger sequencing and TIDE analysis. The Y-axis indicates the editing efficiency (% by TIDE). [Figure 39A-B]Figures 39A-39C show in vitro colony formation of gene-edited CD34+ cells. Control or CD33, CD123, CLL-1 modified CD34+ cells were plated on Methocult 2 days after electroporation and scored for colony formation 14 days later. BFU-E: erythroid burst-forming cells; CFU-GM: granulocyte-macrophage colony-forming cells; CFU-GEMM: multipotent myeloid progenitor colony-forming cells (generates granulocytes, erythrocytes, monocytes, and megakaryocytes). Student's t-test was used. [Figure 39C] Figures 39A-39C show in vitro colony formation of gene-edited CD34+ cells. Control or CD33, CD123, CLL-1 modified CD34+ cells were plated on Methocult 2 days after electroporation and scored for colony formation 14 days later. BFU-E: erythroid burst-forming cells; CFU-GM: granulocyte-macrophage colony-forming cells; CFU-GEMM: multipotent myeloid progenitor colony-forming cells (generates granulocytes, erythrocytes, monocytes, and megakaryocytes). Student's t-test was used. DETAILED DESCRIPTION OF THE INVENTION

[0080] Successfully identifying suitable proteins for targeted cancer therapy presents a significant challenge. Many potential target proteins are present on the cell surface of both cancer cells and normal, non-cancerous cells, which may be required or critically involved in the development and / or survival of a subject. Many of the target proteins contribute to such essential cellular functionality. Therefore, therapy targeting these proteins may lead to adverse effects in subjects, such as significant toxicity and / or other side effects. Furthermore, resistance to CAR-T therapy remains a challenge in the treatment of hematopoietic malignancies, such as acute myeloid leukemia (AML), due to the transformation of cancer antigens on cancer cells, thus escaping CAR-T therapy. For example, patients with B-cell acute lymphoblastic leukemia (B-ALL) show a marked decline in CD19 expression after CAR-T therapy. -It was found that cancer cells develop into acute myeloid leukemia (AML).

[0081] The present disclosure provides methods, cells, compositions, and kits aimed at addressing at least the above-mentioned problems. The methods, cells, compositions, and kits described herein provide safe and effective treatments for hematological malignancies and allow targeting of one or more lineage-specific cell surface proteins (e.g., type 0, type 1, or type 2 proteins) that are present not only on cancer cells but also on cells critical to the development and / or survival of a subject.

[0082] More specifically, the hematopoietic cells described herein can be used to treat a subject undergoing two or more different therapies for (for example) cancer. Many therapies deplete a subject's endogenous, non-cancerous hematopoietic cells. The replacement or rescue hematopoietic cells described herein can replace the subject's depleted immune cells. Two specific examples of this method are described below.

[0083] First, in some cases, a subject receives a first treatment (e.g., against CD19), then the cancer recurs, and then the subject receives a second treatment (e.g., against CD33). The present application provides, for example, rescue cells that are resistant to both treatments. Thus, the rescue cells can be administered to the subject at or near the time of the first treatment, and if a recurrence occurs, the subject can receive the second treatment without exhausting the rescue cells.

[0084] Second, in some cases, for example, if a cancer contains two subpopulations of cells (e.g., one expressing CD33 and the second expressing CD123 and / or CLL-1), and each treatment attacks only one of the subpopulations, the subject may need to undergo two treatments at once. Rescue cells resistant to both treatments described herein can replace the subject's exhausted immune cells even in the presence of both treatments.

[0085] The experimental evidence provided in the examples of this application demonstrates the production, viability, differentiation potential, and therapeutic resistance of various cells edited with two antigens.For example, Examples 3 and 4 show high multi-editing frequency of CD19 and CD33 HSC cells without compromising viability.Example 9 shows high editing frequency of other pairs of cell surface antigens, such as CD33 and CD123, CD33 and CLL1, and CD123 and CLL1.Example 9 also shows that dual-edited cells exhibit resistance to antigen-targeting CART.

[0086] The present disclosure also provides a population of rescue hematopoietic cells, comprising a first subpopulation of cells that are (and / or originate from) cells resistant to a first treatment and a second subpopulation of cells that are (and / or originate from) cells resistant to a second treatment (optionally, the population can include cells that are (and / or originate from) cells resistant to both treatments; however, this is not required in this embodiment). The cell population can be useful, for example, when a subject is treated sequentially with two treatments. For example, in some embodiments, the edited cell surface antigen is one that is not typically expressed in normal HSCs but becomes expressed in later lineages, so that the transplanted HSCs are resistant to both treatments, regardless of whether any HSCs are edited for both antigens. This population of HSCs will continue to give rise to differentiated cells, some of which will lack the first antigen and some of which will lack the second antigen. When the subject is treated with the first treatment, the differentiated cells that lack the first antigen will survive. When the subject is treated with a second therapy, differentiated cells lacking the second antigen will survive, and therefore, such a heterogeneous population of cells may be useful as rescue cells.

[0087] Thus, described herein are genetically engineered hematopoietic cells, such as hematopoietic stem cells (HSCs), that have gene edits in one or more genes encoding lineage-specific cell surface proteins, e.g., CD33 and / or CD19; methods for producing same, e.g., by CRISPR approaches using specific guide RNAs; and methods for treating hematopoietic malignancies using the engineered hematopoietic cells, either alone or in combination with one or more cytotoxic agents (e.g., CAR-T cells) that can target wild-type lineage-specific cell surface antigens, but not those encoded by the edited genes of the engineered hematopoietic cells.

[0088] I. Genetically engineered hematopoietic cells The present disclosure provides genetically engineered hematopoietic cells, e.g., hematopoietic stem cells, harboring gene-edited genes to reduce or eliminate expression of one or more lineage-specific cell surface antigens or to express mutated forms of one or more lineage-specific cell surface antigens. Mutated antigens will retain at least partial biological activity of the antigen but may escape targeting by cytotoxic agents, such as antigen-specific CAR-T cells. In some embodiments, the lineage-specific cell surface antigen of interest may not be naturally expressed on hematopoietic cells, such as HSCs. However, such antigens may be expressed on cells differentiated from HSCs (e.g., their progeny). "Expressing a lineage-specific cell surface protein" or "expressing a lineage-specific cell surface antigen" means that at least a portion of the lineage-specific cell surface protein or its antigen can be detected on the surface of the hematopoietic cell or its progeny. As used herein, the "progeny" of a hematopoietic cell includes any cell type or cell lineage arising from the hematopoietic cell. In some embodiments, the progeny of a hematopoietic cell is a cell type or cell lineage differentiated from the hematopoietic cell.

[0089] Genetically engineered hematopoietic cells can be used to treat hematopoietic malignancies, either alone or in combination with one or more cytotoxic agents that target wild-type, but not mutant, lineage-specific cell surface antigens encoded by the edited genes of the engineered hematopoietic cells. Such hematopoietic cells can compensate, through differentiation, for the loss of function caused by the elimination of functional, noncancerous cells due to immunotherapy targeting lineage-specific cell surface antigen(s) that can also be expressed on normal cells. This approach would also broaden the selection of target proteins for immunotherapy, such as CART therapy. For example, certain lineage-specific cell surface proteins (e.g., type 0 antigens) are essential for the development and / or survival of essential cells / tissues and are therefore poor targets for conventional immunotherapy. When compensated for by the genetically engineered hematopoietic stem cells described herein, such lineage-specific cell surface proteins (e.g., type 0 antigens) may also be suitable targets for immunotherapy when combined with engineered HSCs.

[0090] (A) Genetically engineered hematopoietic cells expressing mutated forms of multiple lineage-specific cell surface antigens. In some embodiments, the present application provides a population of genetically engineered hematopoietic cells, e.g., HSCs, that collectively carry gene-edited genes for at least two lineage-specific cell surface proteins. The gene-edited genes express a mutated form of the antigen, e.g., in which one or more non-essential epitopes have been deleted or mutated so as to avoid recognition by antigen-specific cytotoxic agents (e.g., have reduced binding activity). Deletion or mutation of non-essential epitopes on lineage-specific cell surface proteins is not expected to dramatically affect the biological activity of such antigens.

[0091] In some cases, the hematopoietic cell populations (e.g., HSCs) described herein can be homogenous, each comprising cells bearing multiple gene-edited genes (e.g., 2, 3, or 4) of lineage-specific cell surface antigens. In other cases, the hematopoietic cell populations are heterogeneous, comprising (a) cells bearing a gene-edited gene encoding a first lineage-specific cell surface antigen, (b) cells bearing a gene-edited gene encoding a second lineage-specific cell surface antigen (which is different from the first antigen), and / or (c) cells bearing gene-edited genes for both the first and second lineage-specific cell surface antigens.

[0092] In some embodiments, the population of cells obtained after editing includes cells in which one or more of the target genes have been partially or completely deleted, or both. In some embodiments, the population of cells obtained after editing includes cells with a gene(s) encoding one or more lineage-specific antigen(s) whose expression results in the lineage-specific antigen(s) having a partial sequence deletion, e.g., edited to lack one or more exon(s) of the lineage-specific antigen(s), and cells containing edited gene(s) that result in complete KO of the lineage-specific antigen(s). In some embodiments, the population of cells obtained after editing includes cells with a gene(s) encoding one or more lineage-specific antigen(s) whose expression results in the lineage-specific antigen(s) having a partial sequence deletion, e.g., edited to lack one or more exon(s) of the lineage-specific antigen(s), and also with edited gene(s) that result in complete KO of the lineage-specific antigen(s).

[0093] In some embodiments, the population of cells obtained after editing includes cells with gene(s) encoding CD19 and / or CD33 that have been edited such that expression results in CD19 and / or CD33 with a partial sequence deletion, e.g., lacking one or more exon(s) of CD19 and / or CD33, and cells that contain edited CD19 and / or CD33 gene(s) that result in complete KO of the lineage-specific antigen. In some embodiments, the population of cells obtained after editing includes cells with gene(s) encoding CD19 and / or CD33 that have been edited such that expression results in CD19 and / or CD33 polypeptides with a partial sequence deletion, e.g., lacking one or more exon(s) of CD19 and / or CD33, and also with edited gene(s) that result in complete KO of CD19 and / or CD33.

[0094] Lineage-specific cell surface proteins As used herein, the terms "protein," "peptide," and "polypeptide" may be used interchangeably and refer to a polymer of amino acid residues linked together by peptide bonds. Generally, proteins can be naturally occurring, recombinant, synthetic, or any combination thereof. Variant proteins that contain mutations (e.g., substitutions, insertions, or deletions) of one or more amino acid residues relative to the wild-type counterpart are also within the scope of the term.

[0095] As used herein, the terms "lineage-specific cell surface protein" and "cell surface lineage-specific protein" may be used interchangeably and refer to any protein that is present on the surface of a cell in sufficient quantity and associated with one or more populations of cell lineage(s). For example, a protein may be present on one or more populations of cell lineage(s) and absent (or at reduced levels) on the cell surface of other cell populations. In some embodiments, the terms "lineage-specific cell surface antigen" and "cell surface lineage-specific antigen" may be used interchangeably and refer to any antigen of a lineage-specific cell surface protein.

[0096] In general, lineage-specific cell surface proteins can be classified based on a number of factors, including whether the protein and / or the population of cells displaying the protein is required for the survival and / or development of the host organism. A summary of exemplary types of lineage-specific proteins is provided in Table 1 below.

[0097] [Table 1]

[0098] As shown in Table 1, type 0 lineage-specific cell surface proteins are required for tissue homeostasis and survival, and cell types bearing type 0 lineage-specific cell surface proteins may also be required for subject survival. Therefore, given the importance of type 0 lineage-specific cell surface proteins or cells bearing type 0 lineage-specific cell surface proteins in homeostasis and survival, targeting this category of proteins may be challenging using conventional CAR T cell immunotherapy, as inhibition or removal of such proteins and cells bearing such proteins may be detrimental to subject survival. Consequently, lineage-specific cell surface proteins (e.g., type 0 lineage-specific proteins) and / or cell types bearing such proteins may be required for survival. For example, this type of lineage-specific protein may be a poor target for conventional CAR T cell-based immunotherapy because it serves a core, non-redundant function in the subject.

[0099] However, by combining the genetically engineered hematopoietic stem cells described herein with cytotoxic agents, such as CAR-T cell-based therapies, the choice of target antigens can be expanded to essential antigens, such as type 0 lineage-specific cell surface proteins. In some embodiments, the engineered hematopoietic cells (e.g., HSCs) have one or more genes for type 0 antigens edited for expression of mutated forms of these type 0 antigens, which retain (at least partially) the biological activity of the type 0 antigen, such that they rescue the loss of normal cells that express type 0 antigens due to the therapy, but can escape targeting by type 0 antigen-specific cytotoxic agents, such as CAR-T cells.

[0100] In contrast to type 0 proteins, type 1 cell surface lineage-specific proteins and cells bearing type 1 cell surface lineage-specific proteins are not required for the homeostasis or survival of a subject's tissue. Targeting type 1 cell surface lineage-specific proteins is unlikely to result in acute toxicity and / or death in the subject. For example, as described by Elkins et al. (Mol. Cancer Ther. (2012) 10: 2222-32), CAR T cells engineered to target the type 1 protein CD307, which is uniquely expressed on both normal plasma cells and multiple myeloma (MM) cells, will lead to the elimination of both cell types. However, because plasma cell lineages are essential for the survival of the organism, CD307 and other type 1 lineage-specific proteins are preferred proteins for CAR T cell-based immunotherapy. Type 1 class lineage-specific proteins can be expressed in a wide variety of different tissues, including the ovary, testis, prostate, breast, endometrium, and pancreas.

[0101] In some embodiments, genetically engineered hematopoietic cells (e.g., HSCs) contain one or more genes for type 1 antigens for expression of mutated forms of type 1 proteins that retain (at least partially) the biological activity of the type 1 antigen but may escape targeting by type 1 antigen-specific cytotoxic agents, e.g., CAR-T cells. The use of such engineered HSCs (either alone or in combination with cytotoxic agents such as CAR-T cells targeting type 1 antigens) may improve patient long-term survival and quality of life. For example, targeting all plasma cells is not expected to result in acute toxicity and / or death, but may have longer-term consequences, such as reduced function of the humoral immune system, leading to an increased risk of infection.

[0102] Targeting type 2 proteins presents significant challenges compared to type 1 proteins. Type 2 proteins are characterized by: (1) the protein being dispensable (i.e., not required) for the survival of the organism, and (2) the cell lineage that carries the protein is essential (i.e., the specific cell lineage is required for survival) for the organism. For example, CD33 is a type 2 protein that is expressed in both normal myeloid cells and acute myeloid leukemia (AML) cells (Dohner et al., NEJM 373:1136 (2015)). As a result, CAR T cells engineered to target the CD33 protein can lead to the killing of both normal myeloid cells and AML cells, which may be incompatible with the survival of the subject.

[0103] In some embodiments, genetically engineered hematopoietic cells (e.g., HSCs) contain one or more genes for type 2 antigens for expression of mutated forms of the antigens, which retain (at least partially) the biological activity of the type 2 antigens but may escape targeting by type 1 antigen-specific cytotoxic agents, e.g., CAR-T cells. The use of such engineered HSCs (either alone or in combination with cytotoxic agents, such as CAR-T cells, that target type 2 antigens) may improve patient long-term survival and quality of life. For example, targeting all plasma cells is not expected to result in acute toxicity and / or death, but may have longer-term consequences, such as reduced function of the humoral immune system, leading to an increased risk of infection.

[0104] In some embodiments, the cell surface lineage-specific protein is BCMA, CD19, CD20, CD30, ROR1, B7H6, B7H3, CD23, CD38, C-type lectin-like molecule 1, CS1, IL-5, L1-CAM, PSCA, PSMA, CD138, CD133, CD70, CD7, CD13, NKG2D, NKG2D ligand, CLEC12A, CD11, CD123, CD56, CD34, CD14, CD33, CD66b, CD41, CD61, CD62, CD235a, CD146, CD326, LMP2, CD22, CD52, CD10, CD3 / TCR, CD79 / BCR, and CD26. In some embodiments, the cell surface lineage-specific protein is CD33 or CD19.

[0105] Alternatively or additionally, the cell surface lineage-specific protein can be an oncoprotein, e.g., a cell surface lineage-specific protein that is differentially present on cancer cells. In some embodiments, the oncoprotein is a protein that is tissue or cell lineage specific. Examples of cell surface lineage-specific proteins associated with specific types of cancer include, without limitation, CD20, CD22 (non-Hodgkin's lymphoma, B-cell lymphoma, chronic lymphocytic leukemia (CLL)), CD52 (B-cell CLL), CD33 (acute myeloid leukemia (AML)), CD10 (gp100) (pan-(precursor B) acute lymphocytic leukemia and malignant melanoma), CD3 / T-cell receptor (TCR) (T-cell lymphoma and leukemia), CD79 / B-cell receptor (BCR) (B-cell lymphoma and leukemia), CD26 (epithelial and lymphoid malignancies), human leukocyte antigen (HLA)-DR, HLA-DP, and HLA-DQ (lymphoid malignancies), RCAS1 (gynecologic cancers, biliary adenocarcinoma, and pancreatic ductal adenocarcinoma), and prostate-specific membrane antigen. In some embodiments, the cell surface protein is CD33 and is associated with AML cells.

[0106] In some embodiments, the genetically engineered HSCs may have edited genes encoding at least two (e.g., two, three, or four) lineage-specific cell surface proteins, which may be selected from CD7, CD13, CD19, CD22, CD20, CD25, CD32, CD33, CD38, CD44, CD45, CD47, CD56, 96, CD117, CD123, CD135, CD174, CLL-1, folate receptor beta, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3, and WT1. In specific examples, the genetically engineered HSCs can have the following combinations of edited genes: (a) CD19+CD33, (b) CD19+CD13, (c) CD19+CD123, (d) CD33+CD13, (e) CD33+CD123, (f) CD13+CD123, (g) CD19+CD33+CD13, (h) CD19+CD33+CD123, (i) CD19+CD13+CD123, (j) CD33+CD13+CD123, or (k) CD19+CD33+CD13+CD123. In some embodiments, the genetically engineered HSCs may have edited genes encoding CD33 and one or more lineage-specific cell surface proteins selected from CD7, CD13, CD19, CD22, CD20, CD25, CD32, CD33, CD38, CD44, CD45, CD47, CD56, 96, CD117, CD123, CD135, CD174, CLL-1, folate receptor beta, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3, and WT1.

[0107] In some embodiments, one or both of the lineage-specific cell surface proteins are CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3, CD3d, CD3e, CD3g, CD4, CD5, CD6, CD7, CD8a, CD8b, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD16, CD16b, CD17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD3 2a, CD32b, CD32c, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42a, CD42b, CD42c, CD42d, CD43, CD44, CD45, CD45RA, CD45RB, CD45RC, CD45R O, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD60a, CD61, CD62E, CD62L , CD62P, CD63, CD64a, CD65, CD65s, CD66a, CD66b, CD66c, CD66F, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD75S, CD77, CD79a, CD79b, CD80, CD81 , CD82, CD83, CD84, CD85A, CD85C, CD85D, CD85E, CD85F, CD85G, CD85H, CD85I, CD85J, CD85K, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CD93, CD94, CD95 , CD96, CD97, CD98, CD99, CD99R, CD100, CD101, CD102, CD103, CD104, CD105, CD106, CD107a, CD107b, CD108, CD109, CD110, CD111, CD112, CD113, CD114, CD115, CD116, CD117, CD118, CD119, CD120a, CD120b, CD121a, CD121b, CD121a, CD121b, CD122, CD123, CD124, CD125, CD126, CD127, CD129, CD130, CD131,CD132、CD133、CD134、CD135、CD136、CD137、CD138、CD139、CD140a、CD140b、 CD141、CD142、CD143、CD14、CDw145、CD146、CD147、CD148、CD150、CD152、CD1 52、CD153、CD154、CD155、CD156a、CD156b、CD156c、CD157、CD158b1、CD158b 2、CD158d、CD158e1 / e2、CD158f、CD158g、CD158h、CD158i、CD158j、CD158k、C D159a、CD159c、CD160、CD161、CD163、CD164、CD165、CD166、CD167a、CD168、 CD169、CD170、CD171、CD172a、CD172b、CD172g、CD173、CD174、CD175、CD175s 、CD176、CD177、CD178、CD179a、CD179b、CD180、CD181、CD182、CD183、CD184 、CD185、CD186、CD191、CD192、CD193、CD194、CD195、CD196、CD197、CDw198、C Dw199、CD200、CD201、CD202b、CD203c、CD204、CD205、CD206、CD207、CD208、 CD209、CD210a、CDw210b、CD212、CD213a1、CD213a2、CD215、CD217、CD218a、C D218b、CD220、CD221、CD222、CD223、CD224、CD225、CD226、CD227、CD228、CD 229、CD230、CD231、CD232、CD233、CD234、CD235a、CD235b、CD236、CD236R、CD 238, CD239, CD240, CD241, CD242, CD243, CD244, CD245, CD246, CD247, CD248, CD249, CD252, CD253, CD254, CD256, CD257, CD258, CD261, CD262, CD263, C D264、CD265、CD266、CD267、CD268、CD269、CD270、CD272、CD272、CD273、CD274、CD275、CD276、CD277、CD278、CD279、CD280、CD281、CD282、CD283、CD284、CD286, CD288, CD289, CD290, CD292, CDw293, CD294, CD295, CD296, CD297, CD298, CD299, CD300a, CD300c, CD300e, CD301, CD302, CD303, CD304, CD305, CD306, CD307a, CD307b, CD307c, CD307d, CD307e, CD309, CD312, CD314, CD315, CD316, CD317, CD318, CD319, selected from CD320, CD321, CD322, CD324, CD325, CD326, CD327, CD328, CD329, CD331, CD332, CD333, CD334, CD335, CD336, CD337, CD338, CD339, CD340, CD344, CD349, CD350, CD351, CD352, CD353, CD354, CD355, CD357, CD358, CD359, CD360, CD361, CD362, and CD363.

[0108] In some embodiments, one or both of the lineage-specific cell surface proteins are CD19; CD123; CD22; CD30; CD171; CS-1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule 1 (CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (CD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlep(1-1)Cer); TNF receptor phagocytosis Member of the B-cell maturation (BCMA), Tn antigen ((TnAg) or (GalNAc alpha-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); mesothelial cell adhesion molecule (MEC) Thelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); serine protease 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR beta); stage-specific embryonic antigen 4 (SSEA-4); CD20; folate receptor alpha; receptor tyrosine protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCA M); prostase; prostatic acid phosphatase (PAP); mutated elongation factor 2 (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor I receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (prosome, macropein) subunit beta type 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein (bcr-abl) consisting of breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Ab1);Tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5 member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); globoH group Hexasaccharide moiety of glyceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus receptor 1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex; locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen 1 (MAD-CT-1); melanoma cancer testis antigen 2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen 1 (PCTA-1 or galectin-8), melanoma antigen 1 recognized by T cells (MelanA or MART1); Rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-1AP);ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytic viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P4501B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORI) S or sibling of regulator of imprinted sites), squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma X breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutated heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), lymphocyte antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0109] In some embodiments, one or both of the lineage-specific cell surface proteins are selected from CD11a, CD18, CD19, CD20, CD31, CD34, CD44, CD45, CD47, CD51, CD58, CD59, CD63, CD97, CD99, CD100, CD102, CD123, CD127, CD133, CD135, CD157, CD172b, CD217, CD300a, CD305, CD317, CD321, CD33, and CLL1.

[0110] In some embodiments, one or both of the lineage-specific cell surface proteins are selected from CD33, CD123, CLL1, CD38, CD135 (FLT3), CD56 (NCAM1), CD117 (c-KIT), FRβ (FOLR2), CD47, CD82, TNFRSF1B (CD120B), CD191, CD96, PTPRJ (CD148), CD70, LILRB2 (CD85D), CD25 (IL2R alpha), CD44, CD96, NKG2D ligand, CD45, CD7, CD15, CD19, CD20, CD22, CD37, and CD82.

[0111] In some embodiments, one or both of the lineage-specific cell surface proteins are selected from CD7, CD11a, CD15, CD18, CD19, CD20, CD22, CD25, CD31, CD33, CD34, CD37, CD38, CD44, CD45, CD47, CD51, CD56, CD58, CD59, CD63, CD70, CD82, CD85D, CD96, CD97, CD99, CD100, CD102, CD117, CD120B, CD123, CD127, CD133, CD135, CD148, CD157, CD172b, CD191, CD217, CD300a, CD305, CD317, CD321, CLL1, FRβ (FOLR2), and NKG2D ligand.

[0112] Table 1A lists exemplary pairs of first and second lineage-specific cell surface proteins that can be used in accordance with the compositions and methods described herein.

[0113] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]

[0114] (i) Mutated lineage-specific cell surface antigens In some embodiments, the hematopoietic cells (HSCs) described herein can contain edited genes encoding mutated forms (mutants or variants, these are used interchangeably herein) of one or more lineage-specific cell surface proteins of interest, which have reduced or no binding to the cytotoxic agents described herein. The variants can lack the epitopes to which the cytotoxic agents bind. Alternatively, the variants can possess mutations in one or more epitopes to which the cytotoxic agents bind, such that binding to the cytotoxic agents is reduced or abolished compared to the native or wild-type lineage-specific cell surface protein counterpart. Preferably, such variants maintain substantially similar biological activity to the wild-type counterpart.

[0115] As used herein, the term "reduced binding" refers to binding that is reduced by at least 25%. The level of binding can refer to the amount of binding of a cytotoxic agent to hematopoietic cells or their progeny, or the amount of binding of a cytotoxic agent to a lineage-specific cell surface protein. The level of binding of an engineered hematopoietic cell or its progeny to a cytotoxic agent can be relative to the level of binding of a cytotoxic agent to a non-engineered hematopoietic cell or its progeny, determined by the same assay under the same conditions. Alternatively, the level of binding of a lineage-specific cell surface protein that lacks an epitope for a cytotoxic agent can be relative to the level of binding of a cytotoxic agent to a lineage-specific cell surface protein (e.g., a wild-type protein) that contains the epitope, determined by the same assay under the same conditions. In some embodiments, binding is reduced by at least 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, binding is reduced such that there is substantially no detectable binding in conventional assays.

[0116] As used herein, "no binding" refers to substantially no binding, e.g., no detectable binding or only baseline binding, as determined by conventional binding assays. In some embodiments, there is no binding between the engineered hematopoietic cells or their progeny and the cytotoxic agent. In some embodiments, there is no detectable binding between the engineered hematopoietic cells or their progeny and the cytotoxic agent. In some embodiments, no binding of the hematopoietic cells or their progeny to the cytotoxic agent refers to a baseline level of binding shown using any conventional binding assay known in the art. In some embodiments, the level of binding of the engineered hematopoietic cells or their progeny to the cytotoxic agent is not biologically significant. The term "no binding" is not intended to require an absolute absence of binding.

[0117] Cells that are "negative" for a given lineage-specific cell surface antigen have substantially reduced expression levels of the lineage-specific antigen compared to its naturally occurring counterpart (e.g., an otherwise similar unmodified cell), e.g., undetectable or indistinguishable from background levels, e.g., using a flow cytometry assay, e.g., the assay of Example 1. In some cases, cells negative for a lineage-specific cell surface antigen have levels that are less than 10%, 5%, 2%, or 1% of those compared to its naturally occurring counterpart. Variants may share at least 80% (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or more) sequence homology with the wild-type counterpart, and in some embodiments may contain no other mutations in addition to those to mutate or delete the epitope of interest. The "percent identity" of two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm has been incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3, to obtain amino acid sequences homologous to protein molecules of the invention. Where gaps exist between the two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0118] In some cases, the variant contains one or more amino acid residue substitutions (e.g., 2, 3, 4, 5, or more) within the epitope of interest such that the cytotoxic agent does not bind or has reduced binding to the mutated epitope. Such variants may have substantially reduced binding affinity for the cytotoxic agent (e.g., at least 40%, 50%, 60%, 70%, 80%, or 90% lower binding affinity than its wild-type counterpart). In some examples, such variants may have abolished binding activity for the cytotoxic agent. In other cases, the variant contains a deletion of a region containing the epitope of interest. Such a region may be encoded by an exon. In some embodiments, the region is a domain of the lineage-specific cell surface protein of interest that encodes the epitope. In one example, the variant deletes only the epitope. The length of the deleted region may range from 3 to 60 amino acids, e.g., 5 to 50, 5 to 40, 10 to 30, 10 to 20, etc.

[0119] The mutation(s) or deletion(s) in the lineage-specific cell surface antigen variants can be in or surrounding non-essential epitopes, so long as the mutation(s) or deletion(s) do not substantially affect the biological activity of the protein.

[0120] As used herein, the term "epitope" refers to the amino acid sequence (linear or conformational) of a protein, such as a lineage-specific cell surface antigen, that is bound by a CDR of an antibody. In some embodiments, the cytotoxic agent binds to one or more (e.g., at least 2, 3, 4, 5, or more) epitopes of the lineage-specific cell surface antigen. In some embodiments, the cytotoxic agent binds to more than one epitope of the lineage-specific cell surface antigen, and the hematopoietic cell is engineered such that each of the epitopes is absent and / or unavailable for binding by the cytotoxic agent.

[0121] In some embodiments, the genetically engineered HSCs described herein have one or more edited genes for lineage-specific cell surface antigens such that the edited genes express mutated lineage-specific cell surface antigens with mutations in one or more nonessential epitopes. A nonessential epitope (or a fragment containing it) refers to a domain on a lineage-specific protein whose mutation (e.g., deletion) is less likely to substantially affect the biological activity of the lineage-specific protein and, therefore, the biological activity of the cell expressing it. For example, when hematopoietic cells contain a deletion or mutation of a nonessential epitope of a lineage-specific cell surface antigen, such hematopoietic cells are capable of proliferating and / or undergoing erythropoietic differentiation to levels similar to hematopoietic cells expressing the wild-type lineage-specific cell surface antigen.

[0122] Nonessential epitopes of lineage-specific cell surface antigens can be identified by the methods described herein for protein structure-function prediction or by conventional methods. For example, nonessential epitopes of a protein can be predicted based on comparing the amino acid sequence of a protein from one species with the sequence of the protein from another species. Non-conserved domains are typically not essential for the functionality of the protein. As will be apparent to those skilled in the art, nonessential epitopes of proteins can be predicted using algorithms or software such as PROVEAN software (see, e.g., provean.jcvi.org; Choi et al. PLoS ONE (2012) 7(10): e46688) to predict potential nonessential epitopes ("candidate nonessential epitopes") on a lineage-specific protein of interest. Mutations, including substitutions and / or deletions, can be made to one or more amino acid residues of any of the candidate nonessential epitopes using conventional nucleic acid modification technologies. The protein variants thus prepared can be introduced into cells of a suitable type, e.g., hematopoietic cells, and the functionality of the protein variants can be examined to confirm that the candidate nonessential epitope is indeed a nonessential epitope.

[0123] Alternatively, non-essential epitopes of lineage-specific cell surface antigens can be identified by mutating candidate regions on the lineage-specific protein of interest in a suitable type of host cell (e.g., hematopoietic cells) and testing the functionality of the mutated lineage-specific protein in the host cells. If the mutated lineage-specific protein substantially retains the biological activity of its native counterpart, this indicates that the mutated region is non-essential for the function of the lineage-specific protein.

[0124] Methods for assessing lineage-specific cell surface antigens and functionality of hematopoietic cells or their progeny will be known in the art and include, for example, proliferation assays, differentiation assays, colony formation, expression analysis (e.g., gene and / or protein), protein localization, intracellular signaling, functional assays, and in vivo humanized mouse models.

[0125] Any method for identifying and / or validating non-essential epitopes on lineage-specific cell surface antigens is also within the scope of this disclosure.

[0126] (ii) hematopoietic stem cells In some embodiments, the hematopoietic cells described herein are hematopoietic stem cells. Hematopoietic stem cells (HSCs) can give rise to both myeloid and lymphoid progenitor cells, which in turn give rise to myeloid cells (e.g., monocytes, macrophages, neutrophils, basophils, dendritic cells, erythrocytes, platelets, etc.) and lymphoid cells (e.g., T cells, B cells, NK cells), respectively. HSCs are characterized by the expression of the cell surface marker CD34 (e.g., CD34+), which can be used to identify and / or isolate HSCs, and the absence of cell surface markers associated with lineage commitment.

[0127] In some embodiments, the HSCs are obtained from a subject, such as a mammalian subject. In some embodiments, the mammalian subject is a non-human primate, a rodent (e.g., a mouse or rat), a cow, a pig, a horse, or a livestock animal. In some embodiments, the HSCs are obtained from a human patient, such as a human patient with a hematopoietic malignancy. In some embodiments, the HSCs are obtained from a healthy donor. In some embodiments, the HSCs are obtained from a subject to whom immune cells expressing a chimeric receptor will subsequently be administered. HSCs administered to the same subject from which the cells were obtained are referred to as autologous cells, and HSCs obtained from a subject other than the subject to whom the cells will be administered are referred to as allogeneic cells.

[0128] In some embodiments, the HSCs administered to a subject are allogeneic. In some embodiments, the HSCs are obtained from a donor with an HLA haplotype that matches the subject's HLA haplotype. Human leukocyte antigens (HLA) encode human major histocompatibility complex (MHC) proteins. MHC molecules are present on the surface of antigen-presenting cells and many other cell types and present peptides of self and non-self (e.g., foreign) antigens for immune surveillance. However, HLA is highly polymorphic, resulting in many distinct alleles. Different (foreign, non-self) alleles can be antigenic and can stimulate adverse, potent immune responses, particularly in organ and cell transplants. HLA molecules recognized as foreign (non-self) can lead to transplant rejection. In some embodiments, it is desirable to administer HSCs from a donor with the same HLA type as the patient to reduce the incidence of rejection.

[0129] The HLA locus of donor subject can be typed to identify the individual as the HLA-matched donor for the subject.The method for typing HLA locus will be clear to those skilled in the art.For example, it includes serology (serotyping), cell typing, gene sequencing, phenotyping and PCR.If the HLA loci of donor and subject are identical or sufficiently similar so that no adverse immune response is expected, the HLA from donor is considered to be "matched" with the HLA of subject.

[0130] In some embodiments, the HLA from the donor does not match the HLA of the subject. In some embodiments, the subject is administered HSCs that are HLA-mismatched to the HLA of the subject. In some embodiments, the subject is further administered one or more immunosuppressants to reduce or prevent rejection of the donor HSC cells. In some embodiments, the HSCs do not contain CART.

[0131] HSCs can be obtained from any suitable source using conventional means known in the art. In some embodiments, HSCs are obtained from a sample from a subject (or donor), such as a bone marrow sample, or from a blood sample. Alternatively or additionally, HSCs can be obtained from the umbilical cord. In some embodiments, HSCs are obtained from bone marrow, umbilical cord blood cells, or peripheral blood mononuclear cells (PBMCs). Generally, bone marrow cells can be obtained from the iliac crest, femur, tibia, spine, ribs, or other medullary cavity of a subject (or donor). Bone marrow can be removed from a patient and isolated by various separation and washing procedures known in the art. An exemplary procedure for the isolation of bone marrow cells includes the following steps: a) extraction of a bone marrow sample; b) centrifugation of the bone marrow suspension into three fractions and collection of the intermediate fraction or buffy coat; c) the buffy coat fraction from step (b) is centrifuged once more through a separation fluid, usually Ficoll™, and the intermediate fraction containing the bone marrow cells is collected; and d) washing of the collected fraction from step (c) for recovery of re-infused bone marrow cells.

[0132] HSCs are typically found in the bone marrow but can be mobilized into the circulation by administering a mobilization agent to harvest HSCs from peripheral blood. In some embodiments, the subject (or donor) from whom the HSCs are obtained is administered a mobilization agent, such as granulocyte colony-stimulating factor (G-CSF). The number of HSCs collected after mobilization using a mobilization agent is typically greater than the number of cells obtained without the use of a mobilization agent.

[0133] HSCs for use in the methods described herein can express a lineage-specific cell surface antigen of interest. By any of the modifications described herein (e.g., genetic modification or incubation with a blocking agent), the HSCs will not be targeted by the cytotoxic agents also described herein. Alternatively, HSCs for use in the methods described herein may not express a lineage-specific cell surface protein of interest (e.g., CD19); however, progeny cells differentiated from the HSCs (e.g., B cells) will express the lineage-specific cell surface protein. By genetic modification, the endogenous gene of the HSC encoding the lineage-specific cell surface protein can be disrupted in a region encoding a nonessential epitope of the lineage-specific cell surface protein. Progeny cells differentiated (e.g., in vivo) from such modified HSCs will express a modified lineage-specific cell surface protein with the nonessential epitope mutated, preventing them from being targeted by cytotoxic agents capable of binding to the nonessential epitope.

[0134] In some embodiments, a sample is obtained from a subject (or donor) and then isolated from the subject (or donor) a desired cell type (e.g., CD34 + / CD33 - cells), e.g., PBMCs and / or CD34 + Hematopoietic cells can be isolated from blood as described herein. Cells can also be isolated from other cells, for example, by isolation and / or activation with antibodies that bind to cell surface epitopes of the desired cell type. Another method that can be used involves negative selection using antibodies against cell surface markers to selectively enrich for specific cell types without activating the cells by receptor engagement.

[0135] Prior to or after engineering the HSCs so that they do not bind or have reduced binding to cytotoxic agents, the population of HSCs can be expanded. The cells can be cultured under conditions including an expansion culture medium containing one or more cytokines, such as stem cell factor (SCF), Flt-3 ligand (Flt3L), thrombopoietin (TPO), interleukin 3 (IL-3), or interleukin 6 (IL-6). The cells can be expanded for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 days, or any range required. In some embodiments, HSCs are isolated from a desired cell population (e.g., CD34) from a sample obtained from a subject (or donor). + / CD33 - ) and prior to manipulation (e.g., genetic manipulation, contact with a blocking agent). In some embodiments, HSCs are expanded after genetic manipulation, thereby selectively expanding cells that have undergone genetic modification and lack the lineage-specific cell surface antigen epitope to which the cytotoxic agent binds (e.g., have at least a partial deletion or substitution of the epitope). In some embodiments, a cell ("clone") or several cells having the desired characteristics (e.g., phenotype or genotype) after genetic modification can be selected and independently expanded. In some embodiments, HSCs are expanded prior to contacting the HSCs with a blocking agent that binds the lineage-specific cell surface antigen epitope, thereby providing a population of HSCs that express a lineage-specific cell surface antigen that cannot be bound by the cytotoxic agent due to blocking of the corresponding epitope by the blocking agent.

[0136] (iii) Preparation of genetically engineered hematopoietic cells Genetically engineered hematopoietic cells, such as HSCs, carrying edited genes for one or more lineage-specific cell surface antigens can be prepared by conventional methods or by the methods described herein. In some embodiments, the genetic engineering is performed using genome editing. As used herein, "genome editing" refers to a method of modifying the genome of an organism, including nucleotide sequences that either encode or do not encode proteins, to knock out the expression of a target gene. Genome editing methods generally involve the use of endonucleases that can cleave nucleic acids in the genome, for example, at targeted nucleotide sequences. Repair of double-strand breaks in the genome can be repaired to introduce mutations and / or exogenous nucleic acids can be inserted into targeted sites.

[0137] Genome editing methods are generally classified based on the type of endonuclease involved in creating the double-stranded break in the target nucleic acid. These methods include the use of zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), meganucleases, and CRISPR / Cas systems.

[0138] In some embodiments, the modified cells are engineered as described herein using TALEN technology known in the art. Generally, TALENs are engineered restriction enzymes capable of specifically binding and cleaving a desired target DNA molecule. Typically, TALENs contain a transcription activator-like effector (TALE) DNA-binding domain fused to a DNA cleavage domain. The DNA-binding domain may contain a highly conserved 33-34 amino acid sequence with a divergent two-amino acid RVD (repeat variable dipeptide motif) at positions 12 and 13. The RVD motif determines the binding specificity for a nucleic acid sequence and can be engineered to specifically bind to a desired DNA sequence according to methods known to those skilled in the art. In one example, the DNA cleavage domain may be derived from FokI endonuclease. The FokI domain functions as a dimer, requiring two constructs with unique DNA-binding domains in the appropriate orientation and spacing for a site on the target genome. TALENs specific to a sequence on a desired target gene (e.g., CD19, CD33) may be constructed using any method known in the art.

[0139] TALEN specific to the target gene of interest can be used in cells to generate double-strand breaks (DSBs).If the repair mechanism improperly repairs the break by non-homologous end joining, mutations can be introduced at the break site.For example, improper repair can introduce frameshift mutations.Alternatively, an exogenous DNA molecule with a desired sequence can be introduced into cells together with TALEN.Depending on the sequence of exogenous DNA and chromosomal sequence, this process can be used to correct defects or introduce DNA fragments into the target gene of interest, or introduce such defects into endogenous genes, thereby reducing the expression of the target gene.

[0140] In some embodiments, one or more populations of hematopoietic cells are generated by genetic manipulation of lineage-specific cell surface antigens (e.g., those described herein) using TALENs. The genetically engineered hematopoietic cells may not express the lineage-specific cell surface antigen. Alternatively, the hematopoietic cells may be engineered to express an altered version of the lineage-specific cell surface antigen, e.g., deleted or mutated, relative to the wild-type counterpart. Such mutated lineage-specific cell surface antigens may retain a certain level of biological activity, as the wild-type counterpart. In some embodiments, a population of hematopoietic cells containing mutated CD33 is generated by genetic manipulation using TALENs. In some embodiments, exon 2 or exon 3 of CD33 is mutated using TALENs. In some examples, a population of hematopoietic cells containing mutated CD19 is generated by genetic manipulation using TALENs. In some embodiments, exon 2 or exon 4 of CD19 is mutated using TALENs.

[0141] In some embodiments, cells can be genetically engineered using zinc finger (ZFN) technology known in the art. Generally, genome editing mediated by zinc finger involves the use of zinc finger nucleases, which typically include a DNA binding domain (i.e., zinc finger) and a cleavage domain (i.e., nuclease). Zinc finger binding domains can be engineered to recognize and bind to any target gene of interest (e.g., CD19, CD33) using methods known in the art, and can be specifically designed to recognize DNA sequences ranging from about 3 nucleotides to about 21 nucleotides in length or from about 8 to about 19 nucleotides in length. Zinc finger binding domains typically include at least three zinc finger recognition regions (e.g., zinc fingers).

[0142] Restriction endonucleases (restriction enzymes) that can sequence-specifically bind to DNA (at recognition site) and cut DNA at or near the binding site are known in the art and can be used to form ZFNs for genome editing.For example, type IIS restriction endonucleases cut DNA at sites distant from the recognition site and have separable binding and cutting domains.In one example, the DNA cutting domain can be derived from FokI endonuclease.

[0143] In some embodiments, one or more populations of hematopoietic cells are generated by genetic manipulation of lineage-specific cell surface antigens (e.g., those described herein) using ZFNs. The genetically engineered hematopoietic cells may not express the lineage-specific cell surface antigen. Alternatively, the hematopoietic cells may be engineered to express an altered version of the lineage-specific cell surface antigen, e.g., having deletions or mutations relative to the wild-type counterpart. Such mutated lineage-specific cell surface antigens may retain a certain level of biological activity, as do the wild-type counterparts. In some examples, a population of hematopoietic cells containing mutated CD33 is generated by genetic manipulation using ZFNs. In some embodiments, exon 2 or exon 3 of CD33 is mutated using ZFNs. In some examples, a population of hematopoietic cells containing mutated CD19 is generated by genetic manipulation using ZFNs. In some embodiments, exon 2 or exon 4 of CD19 is mutated using ZFNs.

[0144] In one aspect of the disclosure, replacement of cancer cells with an altered population of normal cells is performed using normal cells engineered to prevent the cells from binding cytotoxic drugs. Such alterations can include deletion or mutation of lineage-specific protein epitopes using a CRISPR-Cas system, where the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is an engineered, non-naturally occurring CRISPR-Cas system.

[0145] The present disclosure utilizes a CRISPR / Cas system that hybridizes to a target sequence on a lineage-specific protein polynucleotide, where the CRISPR / Cas system comprises a Cas endonuclease and an engineered crRNA / tracrRNA (or single guide RNA). In some embodiments, the CRISPR / Cas system comprises a crRNA but does not comprise a tracrRNA sequence. The CRISPR / Cas complex can bind to the lineage-specific protein polynucleotide and allow cleavage of the protein polynucleotide, thereby modifying the polynucleotide.

[0146] The CRISPR / Cas system of the present disclosure can bind to and / or cleave a region of interest within a lineage-specific cell surface protein in coding or non-coding regions within or adjacent to a gene, such as a leader sequence, trailer sequence, or intron, or in non-transcribed regions either upstream or downstream of the coding region. Guide RNAs (gRNAs) used in the present disclosure can be designed such that the gRNA directs binding of the Cas enzyme-gRNA complex to a predetermined cleavage site (target site) in the genome. Cleavage sites can be chosen to release fragments containing regions of unknown sequence or regions containing SNPs, nucleotide insertions, nucleotide deletions, rearrangements, etc.

[0147] Cleavage of the gene region can include cleaving one or both strands at the location of the target sequence with a Cas enzyme. In one embodiment, such cleavage can result in reduced transcription of the target gene. In another embodiment, cleavage can further include repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, where repair results in the insertion, deletion, or substitution of one or more nucleotides in the target polynucleotide.

[0148] The terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably and refer to a nucleic acid containing a sequence that determines the specificity of the Cas DNA-binding protein of a CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence on the genome of a host cell. The gRNA, or the portion thereof, that hybridizes to the target nucleic acid can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides in length. In some embodiments, the gRNA sequence that hybridizes to the target nucleic acid is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 nucleotides or between 15-25 nucleotides in length.

[0149] In addition to the sequence that binds to the target nucleic acid, in some embodiments, the gRNA also comprises a scaffold sequence. The expression of the gRNA that encodes both the sequence that is complementary to the target nucleic acid and the scaffold sequence has the dual function of both binding (hybridizing) to the target nucleic acid and recruiting an endonuclease to the target nucleic acid, which can result in site-specific CRISPR activity. In some embodiments, such a chimeric gRNA can be referred to as a single guide RNA (sgRNA).

[0150] As used herein, a "scaffold sequence," also referred to as tracrRNA, refers to a nucleic acid sequence that recruits a Cas endonuclease to a target nucleic acid that is bound (hybridized) to a complementary gRNA sequence. Any scaffold sequence that includes at least one stem-loop structure and recruits an endonuclease can be used in the genetic elements and vectors described herein. Exemplary scaffold sequences will be apparent to those skilled in the art. For example, they can be found in Jinek, et al. Science (2012) 337(6096):816-821, Ran, et al. Nature Protocols (2013) 8:2281-2308, PCT Application No. WO2014 / 093694, and PCT Application No. WO2013 / 176772. In some embodiments, the CRISPR-Cas system does not include a tracrRNA sequence.

[0151] In some embodiments, the gRNA sequence does not include the scaffold sequence, and the scaffold sequence is expressed as a separate transcript. In such embodiments, the gRNA sequence further comprises an additional sequence that is complementary to a portion of the scaffold sequence and functions to bind (hybridize) to the scaffold sequence and recruit an endonuclease to the target nucleic acid.

[0152] In some embodiments, the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the target nucleic acid (see also U.S. Patent 8,697,359, which is incorporated by reference for its teaching of gRNA sequence complementarity with target polynucleotide sequences). It has been demonstrated that mismatches between CRISPR guide sequences and target nucleic acids near the 3' end of the target nucleic acid can abolish nuclease cleavage activity (Upadhyay, et al. Genes Genome Genetics (2013) 3(12): 2233-2238). In some embodiments, the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3' end of the target nucleic acid (e.g., the last 5, 6, 7, 8, 9, or 10 nucleotides of the 3' end of the target nucleic acid).

[0153] Exemplary sgRNA sequences targeting intron 1, intron 2, or intron 4 of CD19 are provided in Table 3. Exemplary sgRNA sequences targeting introns 1 and 2 of CD33 are provided in Table 4. Additional guide RNAs for editing CD19 and CD33 are provided below. As will be apparent to one of skill in the art, the selection of an sgRNA sequence can depend on factors such as the number of predicted on-target and / or off-target binding sites. In some embodiments, the sgRNA sequence is selected to maximize potential on-targets and minimize potential off-target sites.

[0154] As will be apparent to those skilled in the art, various tools can be used to design and / or optimize the sequence of sgRNAs, for example, to increase the specificity and / or accuracy of genome editing. Generally, candidate sgRNAs can be designed by identifying sequences within the target region with high predicted on-target efficiency and low off-target efficiency based on any available web-based tool. Candidate sgRNAs can be further assessed by manual inspection and / or experimental screening. Examples of web-based tools include, but are not limited to, CRISPRseek, CRISPR Design Tool, Cas-OFFinder, E-CRISP, ChopChop, CasOT, CRISPR direct, CRISPOR, BREAKING-CAS, CrispRGold, and CCTop. See, e.g., Safari, et al. Current Pharma. Biotechol. (2017) 18(13).

[0155] In some embodiments, the Cas endonuclease is a Cas9 nuclease (or a variant thereof) or a Cpf1 nuclease (or a variant thereof). Cas9 endonuclease cleaves the double-stranded DNA of the target nucleic acid, resulting in blunt ends, while cleavage by a Cpf1 nuclease results in overhanging ends of the nucleic acid.

[0156] Typically, a target nucleic acid is flanked on the 3' or 5' side by a protospacer adjacent motif (PAM), which can interact with an endonuclease and may be involved in targeting endonuclease activity to the target nucleic acid. Generally, the PAM sequence flanking the target nucleic acid is believed to depend on the endonuclease and the source from which the endonuclease is derived. For example, in the Cas9 endonuclease derived from Streptococcus pyogenes, the PAM sequence is NGG, although the PAM sequences NAG and NGA can be recognized with lower efficiency. In the Cas9 endonuclease derived from Staphylococcus aureus, the PAM sequence is NNGRRT. In the Cas9 endonuclease derived from Neisseria meningitidis, the PAM sequence is NNNNGATT or the degenerate PAM sequence NNNNGHTT. See, e.g., Adli Nature Communications (2018) 9:1191. For the Cas9 endonucleases from Streptococcus thermophilus, St1Cas9, and St3Cas9, the PAM sequences are NNAGAAW and NGGNG, respectively. For the Cas9 endonuclease from Treponema denticola, the PAM sequence is NAAAAC. For the Cas9 endonuclease from Streptococcus canis, the PAM sequence is NNG. See Chatterjee, et al. Sci. Adv. (2018) 4: eaau0766. For the Cas9 endonuclease from Campylobacter jejuni, the PAM sequence is NNNNACAC. See, e.g., Adli Nature Communications (2018) 9:1191.

[0157] In some embodiments, the Cas endonuclease is a Cpfl nuclease. In contrast to the Cas9 endonuclease, the Cpfl endonuclease generally does not require a tracrRNA sequence and recognizes a PAM sequence located at the 5' end of the target nucleic acid. In the Cpfl nuclease, the PAM sequence is TTTN. In some embodiments, the Cas endonuclease is MAD7 (also referred to as Cpfl nuclease from Eubacterium rectale) and the PAM sequence is YTTTN.

[0158] In some embodiments, genetically engineering the cell also includes introducing a Cas endonuclease into the cell. In some embodiments, the nucleic acid encoding the Cas endonuclease and the gRNA is provided on the same nucleic acid (e.g., a vector). In some embodiments, the nucleic acid encoding the Cas endonuclease and the gRNA is provided on different nucleic acids (e.g., different vectors). Alternatively, or in addition, the Cas endonuclease can be provided or introduced into the cell in protein form.

[0159] In some embodiments, the Cas endonuclease is a Cas9 enzyme or a variant thereof. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (SpCas9), Staphylococcus aureus (SaCas9), Streptococcus canis (ScCas9), Neisseria meningitidis (NmCas9), Streptococcus thermophilus, Campylobacter jujuni (CjCas9), or Treponema denticola. In some embodiments, the nucleotide sequence encoding the Cas endonuclease can be codon-optimized for expression by a host cell. In some embodiments, the endonuclease is a Cas9 homolog or ortholog.

[0160] In some embodiments, the nucleotide sequence encoding the Cas9 endonuclease is further modified to alter the activity of the protein. In some embodiments, the Cas9 endonuclease is modified to inactivate one or more catalytic residues of the endonuclease. In some embodiments, the Cas9 endonuclease is modified to inactivate one of the catalytic residues of the endonuclease and is referred to as a "nickase" or "Cas9n." The Cas9 nickase endonuclease cleaves one DNA strand of the target nucleic acid. See, e.g., Dabrowska et al. Frontiers in Neuroscience (2018) 12(75). It has been shown that mutations in one or more of the enzyme's RuvC and HNH catalytic domains can improve Cas9 efficiency. See, e.g., Sarai et al. Currently Pharma. Biotechnol. (2017) 18(13). In some embodiments, the Cas9 nickase contains mutations at amino acid positions D10 and / or H840. In some instances, the Cas9 nickase comprises substitution mutations D10A and / or H840A.

[0161] In some embodiments, the methods described herein involve two separate cleavage reactions, in which one Cas9 nickase is directed to cleave one DNA strand of the target nucleic acid and one Cas9 nickase is directed to cleave a second DNA strand of the target nucleic acid.

[0162] In some embodiments, the Cas9 endonuclease is a catalytically inactive Cas9. For example, dCas9 contains mutations of catalytically active residues (D10 and H840) and lacks nuclease activity. Alternatively, or in addition, the Cas9 endonuclease can be fused to another protein or portion thereof. In some embodiments, dCas9 is fused to a repression domain, such as a KRAB domain. In some embodiments, such dCas9 fusion proteins are used in constructs described herein for multiplexed gene repression (e.g., CRISPR interference (CRISPRi)). In some embodiments, dCas9 is fused to an activation domain, such as VP64 or VPR. In some embodiments, such dCas9 fusion proteins are used in constructs described herein for gene activation (e.g., CRISPR activation (CRISPRa)). In some embodiments, dCas9 is fused to an epigenetic regulatory domain, such as a histone demethylase domain or a histone acetyltransferase domain. In some embodiments, dCas9 is fused to LSD1 or p300, or portions thereof. In some embodiments, dCas9 fusions are used for CRISPR-based epigenetic modulation. In some embodiments, dCas9 or Cas9 is fused to a Fok1 nuclease domain (referred to as "Fok1-dCas9"). In some embodiments, Cas9 or dCas9 fused to a Fok1 nuclease domain is used for genome editing. See, e.g., Safari et al. Current Pharma. Biotechol. (2017):18. In some embodiments, Cas9 or dCas9 is fused to a fluorescent protein (e.g., GFP, RFP, mCherry, etc.). In some embodiments, Cas9 / dCas9 proteins fused to fluorescent proteins are used to label and / or visualize genomic loci or identify cells expressing the Cas endonuclease.

[0163] In some embodiments, the Cas endonuclease is modified to improve the specificity of the enzyme (e.g., to reduce off-target effects while maintaining robust on-target cleavage). In some embodiments, the Cas endonuclease is an improved specificity Cas9 variant (e.g., eSPCas9). See, e.g., Slaymaker et al. Science (2016) 351 (6268): 84-88. In some embodiments, the Cas endonuclease is a high-fidelity Cas9 variant (e.g., SpCas9-HF1). See, e.g., Kleinstiver et al. Nature (2016) 529: 490-495.

[0164] Cas enzymes, such as Cas endonucleases, are known in the art and can be obtained from a variety of sources and / or engineered / modified to modulate one or more activities or specificities of the enzyme. In some embodiments, the Cas enzyme is engineered / modified to recognize one or more PAM sequences. In some embodiments, the Cas enzyme is engineered / modified to recognize one or more PAM sequences that are different from the PAM sequences that the Cas enzyme recognizes without engineering / modification. In some embodiments, the Cas enzyme is engineered / modified to reduce the off-target activity of the enzyme.

[0165] In some embodiments, the nucleotide sequence encoding the Cas endonuclease is further modified to alter the specificity of the endonuclease activity (e.g., to reduce off-target cleavage, decrease Cas endonuclease activity or intracellular lifespan, increase homologous recombination, and reduce non-homologous end joining). See, e.g., Komor et al. Cell (2017) 168: 20-36. In some embodiments, the nucleotide sequence encoding the Cas endonuclease is modified to alter the PAM recognition of the endonuclease. For example, the Cas endonuclease SpCas9 recognizes the PAM sequence NGG, while relaxed variants of SpCas9 containing one or more endonuclease modifications (e.g., VQR SpCas9, EQR SpCas9, VRER SpCas9) can recognize the PAM sequences NGA, NGAG, and NGCG. The PAM recognition of an engineered Cas endonuclease is considered "relaxed" if the Cas endonuclease recognizes more potential PAM sequences than an unengineered Cas endonuclease. For example, the Cas endonuclease SaCas9 recognizes the PAM sequence NNGRRT, whereas a relaxed variant of SaCas9 containing one or more endonuclease modifications (e.g., KKH SaCas9) can recognize the PAM sequence NNNRRT. In one example, the Cas endonuclease FnCas9 recognizes the PAM sequence NNG, whereas a relaxed variant of FnCas9 containing one or more endonuclease modifications (e.g., RHA FnCas9) can recognize the PAM sequence YG. In one example, the Cas endonuclease is a Cpf1 endonuclease containing substitution mutations S542R and K607R, which recognizes the PAM sequence TYCV. In one example, the Cas endonuclease is a Cpf1 endonuclease containing the substitution mutations S542R, K607R, and N552R, which recognizes the PAM sequence TATV. See, e.g., Gao et al. Nat. Biotechnol. (2017) 35(8): 789-792.

[0166] In some embodiments, the methods described herein involve genetically engineering a population of hematopoietic cells using Cas9 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 1 lineage-specific cell surface antigen in a population of hematopoietic cells using Cas9 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically modifying or editing the CD19 gene, or the CD33 gene, or the CD19 gene and the CD33 gene in a population of hematopoietic cells using Cas9 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD19 gene in a population of hematopoietic cells using Cas9 nuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutation in exon 2 or exon 4 of CD19 in a population of hematopoietic cells using a Cas9 nuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using a Cas9 nuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 14-26, 67, and 69-72. In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using a Cas9 nuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 67.

[0167] In some embodiments, the methods described herein involve using Cas9 nuclease (or a variant thereof) to engineer a gene encoding a type 2 lineage-specific cell surface antigen in a population of hematopoietic cells. In some embodiments, the methods described herein involve using Cas9 nuclease (or a variant thereof) to engineer a mutant CD33 gene in a population of hematopoietic cells. In some embodiments, the methods described herein involve using Cas9 nuclease (or a variant thereof) to engineer a mutation in exon 2 or exon 3 of CD33 in a population of hematopoietic cells. In some embodiments, the methods described herein involve using Cas9 nuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 27-50 and 68 to engineer a mutant CD33 gene in a population of hematopoietic cells. In some embodiments, the methods described herein involve engineering a mutant CD33 gene in a population of hematopoietic cells using a Cas9 nuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 68.

[0168] In some embodiments, the endonuclease is a base editor. Base editor endonucleases generally comprise a catalytically inactive Cas endonuclease fused to a functional domain. See, e.g., Eid et al. Biochem. J. (2018) 475(11): 1955-1964; Rees et al. Nature Reviews Genetics (2018) 19:770-788. In some embodiments, the catalytically inactive Cas endonuclease is dCas9. In some embodiments, the endonuclease comprises dCas9 fused to one or more uracil glycosylase inhibitor (UGI) domains. In some embodiments, the endonuclease comprises dCas9 fused to an adenine base editor (ABE), e.g., an ABE evolved from the RNA adenine deaminase TadA. In some embodiments, the endonuclease comprises dCas9 fused to a cytodine deaminase enzyme (e.g., APOBEC deaminase, pmCDA1, activation-induced cytidine deaminase (AID)). In some embodiments, the catalytically inactive Cas endonuclease has reduced activity and is nCas9. In some embodiments, the endonuclease comprises nCas9 fused to one or more uracil glycosylase inhibitor (UGI) domains. In some embodiments, the endonuclease comprises nCas9 fused to an adenine base editor (ABE), e.g., an ABE evolved from the RNA adenine deaminase TadA. In some embodiments, the endonuclease comprises nCas9 fused to a cytodine deaminase enzyme (e.g., APOBEC deaminase, pmCDA1, activation-induced cytidine deaminase (AID)).

[0169] Examples of base editors include, without limitation, BE1, BE2, BE3, HF-BE3, BE4, BE4max, BE4-Gam, YE1-BE3, EE-BE3, YE2-BE3, YEE-CE3, VQR-BE3, VRER-BE3, SaBE3, SaBE4, SaBE4-Gam, Sa(KKH)-BE3, Target-AID, Target-AID-NG, xBE3, eA3A-BE3, BE-PLUS, TAM, CRISPR-X, ABE7.9, ABE7.10, ABE7.10*, xABE, ABESa, VQR-ABE, VRER-ABE, Sa(KKH)-ABE, and CRISPR-SKIP. Additional examples of base editors can be found, for example, in US Publication No. 2018 / 0312825A1, US Publication No. 2018 / 0312828A1, and PCT Publication No. WO2018 / 165629A1, which are incorporated by reference in their entireties.

[0170] In some embodiments, the base editor is further modified to inhibit base excision repair at the target site and induce cellular mismatch repair. To protect the Cas endonuclease from degradation and exonuclease activity, any of the Cas endonucleases described herein can be fused to a Gam domain (bacteriophage Mu protein). See, e.g., Eid et al. Biochem. J. (2018) 475(11): 1955-1964.

[0171] In some embodiments, the methods described herein involve genetically engineering a population of hematopoietic cells using a base editor (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 1 lineage-specific cell surface antigen in a population of hematopoietic cells using a base editor (or a variant thereof). In some embodiments, the methods described herein involve genetically modifying or editing the CD19 gene, or genetically modifying or editing the CD33 gene, or genetically modifying or editing the CD19 gene and the CD33 gene in a population of hematopoietic cells using a base editor (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD19 gene in a population of hematopoietic cells using a base editor (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutation in exon 2 or exon 4 of CD19 in a population of hematopoietic cells using a base editor (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using a base editor (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 14-26, 67, and 69-72. In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using a base editor (or a variant thereof) and a guide sequence provided by SEQ ID NO: 67.

[0172] In some embodiments, the methods described herein involve using a base editor (or a variant thereof) to engineer a gene encoding a type 2 lineage-specific cell surface antigen in a population of hematopoietic cells. In some embodiments, the methods described herein involve using a base editor (or a variant thereof) to engineer a mutant CD33 gene in a population of hematopoietic cells. In some embodiments, the methods described herein involve using a base editor nuclease (or a variant thereof) to engineer a mutation in exon 2 or exon 3 of CD33 in a population of hematopoietic cells. In some embodiments, the methods described herein involve using a base editor nuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 27-50 and 68 to engineer a mutant CD33 gene in a population of hematopoietic cells. In some embodiments, the methods described herein involve using a base editor (or a variant thereof) and a guide sequence provided by SEQ ID NO: 68 to engineer a mutant CD33 gene in a population of hematopoietic cells.

[0173] In some embodiments, the Cas endonuclease belongs to the Class 2 Type V of Cas endonucleases. Class 2 Type V Cas endonucleases can be further categorized as Type VA, Type VB, Type VC, and Type VU. See, e.g., Stella et al. Nature Structural & Molecular Biology (2017). In some embodiments, the Cas endonuclease is a Type VA Cas endonuclease, e.g., Cpf1 nuclease. In some embodiments, the Cas endonuclease is a Type VB Cas endonuclease, e.g., C2c1 endonuclease. See, e.g., Shmakov et al. Mol Cell (2015) 60: 385-397. In some embodiments, the Cas endonuclease is Mad7.

[0174] In some embodiments, the Cas endonuclease is a Cpf1 nuclease or a variant thereof. As will be understood by those of skill in the art, the Cas endonuclease Cpf1 nuclease may also be referred to as Cas12a. See, e.g., Strohkendl et al. Mol. Cell (2018) 71: 1-9. In some embodiments, the host cell expresses a Cpf1 nuclease from Provetella spp., Francisella spp., Acidaminococcus sp. (AsCpf1), Lachnospiraceae bacterium (LpCpf1), or Eubacterium rectale. In some embodiments, the nucleotide sequence encoding the Cpf1 nuclease can be codon-optimized for expression by the host cell. In some embodiments, the nucleotide sequence encoding the Cpf1 endonuclease is further modified to alter the activity of the protein.

[0175] A catalytically inactive variant of Cpf1 (Cas12a) may be referred to as dCas12a. The catalytically inactive variants of Cpf1 described herein can be fused to functional domains to form base editors. See, e.g., Rees et al. Nature Reviews Genetics (2018) 19: 770-788. In some embodiments, the catalytically inactive Cas endonuclease is dCas9. In some embodiments, the endonuclease comprises dCas12a fused to one or more uracil glycosylase inhibitor (UGI) domains. In some embodiments, the endonuclease comprises dCas12a fused to an adenine base editor (ABE), e.g., an ABE evolved from the RNA adenine deaminase TadA. In some embodiments, the endonuclease comprises dCas12a fused to a cytodine deaminase enzyme (e.g., APOBEC deaminase, pmCDA1, activation-induced cytidine deaminase (AID)).

[0176] In some embodiments, the methods described herein involve genetically engineering a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 1 lineage-specific cell surface antigen in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically modifying or editing the CD19 gene, or genetically modifying or editing the CD33 gene, or genetically modifying or editing the CD19 gene and the CD33 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD19 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutation in exon 2 or exon 4 of CD19 in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 14-26, 67, and 69-72. In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 67.

[0177] In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 2 lineage-specific cell surface antigen in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD33 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutation in exon 2 or exon 3 of CD33 in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD33 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 27-50 and 68. In some embodiments, the methods described herein involve genetically engineering a mutant CD33 gene in a population of hematopoietic cells using Cpf1 nuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 68.

[0178] Alternatively or additionally, the Cas endonuclease can be a Cas14 endonuclease or a variant thereof. In contrast to the Cas9 endonuclease, the Cas14 endonuclease is derived from archaea and tends to be smaller in size (e.g., 400-700 amino acids). Additionally, the Cas14 endonuclease does not require a PAM sequence. See, e.g., Harrington et al. Science (2018).

[0179] In some embodiments, the methods described herein involve genetically engineering a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 1 lineage-specific cell surface antigen in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically modifying or editing the CD19 gene, or the CD33 gene, or the CD19 gene and the CD33 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD19 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutation in exon 2 or exon 4 of CD19 in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 14-26, 67, and 69-72. In some embodiments, the methods described herein involve engineering a mutant CD19 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 67.

[0180] In some embodiments, the methods described herein involve genetically engineering a gene encoding a type 2 lineage-specific cell surface antigen in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD33 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutation in exon 2 or exon 3 of CD33 in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a mutant CD33 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof) and a guide sequence provided by any one of SEQ ID NOs: 27-50 and 68. In some embodiments, the methods described herein involve engineering a mutant CD33 gene in a population of hematopoietic cells using Cas14 endonuclease (or a variant thereof) and a guide sequence provided by SEQ ID NO: 68.

[0181] Any of the Cas endonucleases described herein can be adjusted to control the expression and / or activity levels of the Cas endonuclease at a desired time. For example, it may be advantageous to increase the expression and / or activity levels of the Cas endonuclease in a specific phase(s) of the cell cycle. It has been demonstrated that the level of homology-directed repair is reduced in the G1 phase of the cell cycle. Thus, increasing the expression and / or activity levels of the Cas endonuclease in the S, G2, and / or M phases can increase homology-directed repair after Cas endonuclease editing. In some embodiments, the expression and / or activity levels of the Cas endonuclease are increased in the S, G2, and / or M phases of the cell cycle. In one example, the Cas endonuclease is fused to the N-terminal region of human Geminin. See, e.g., Gutschner et al. Cell Rep. (2016) 14(6): 1555-1566. In some embodiments, the expression and / or activity level of the Cas endonuclease is reduced in the G1 phase. In one example, the Cas endonuclease is modified such that it has reduced activity in the G1 phase. See, e.g., Lomova et al. Stem Cells (2018).

[0182] Alternatively or additionally, any of the Cas endonucleases described herein can be fused to an epigenetic modifier (e.g., a chromatin-modifying enzyme, e.g., a DNA methylase, a histone deacetylase). See, e.g., Kungulovski et al. Trends Genet. (2016) 32(2):101-113. A Cas endonuclease fused to an epigenetic modifier can be referred to as an "epi-effector" and can allow for temporary and / or transient endonuclease activity. In some embodiments, the Cas endonuclease is dCas9 fused to a chromatin-modifying enzyme.

[0183] In some embodiments, the present disclosure provides compositions and methods for modifying or deleting cell surface lineage-specific proteins in hematopoietic cells using the CRISPR / Cas9 system, wherein the guide RNA sequence hybridizes to a nucleotide sequence encoding an epitope of the lineage-specific cell surface antigen. In some embodiments, the present disclosure provides compositions and methods for modifying or deleting two or more cell surface lineage-specific proteins in hematopoietic cells using the CRISPR / Cas9 system, wherein the guide RNA sequence hybridizes to a nucleotide sequence encoding an epitope of the lineage-specific cell surface antigen. In some embodiments, the guide RNA sequence(s) hybridize to a nucleotide sequence encoding an exon of the lineage-specific cell surface antigen. In some embodiments, one or more guide RNA sequences may hybridize to one or more intron sequences, leading to skipping of adjacent exons. For example, two guide RNA sequences can be used to target regions on two nearby introns (e.g., intron 1 and intron 2, or intron 2 and intron 3), resulting in the skipping of an exon between the two introns. In some embodiments, the cell surface lineage-specific protein is CD33 or CD19, and the gRNA hybridizes to a portion of a nucleotide sequence encoding an epitope of CD33 or CD19. In some embodiments, the cell surface lineage-specific protein is CD33, and the gRNA hybridizes to a portion of intron 1 or intron 2 of the nucleotide sequence encoding CD19. In some embodiments, the cell surface lineage-specific protein is CD19, and the gRNA hybridizes to a portion of intron 1 or intron 2 of the nucleotide sequence encoding CD19.

[0184] In some embodiments, the cell surface lineage-specific protein is CD33 and the gRNA hybridizes to a portion of the gene encoding exon 2. In some embodiments, the cell surface lineage-specific protein is CD18 and the gRNA hybridizes to a portion of the gene encoding exon 3. In some embodiments, a first cell surface lineage-specific protein is CD33 and the gRNA hybridizes to a portion of the gene encoding exon 2 and a second cell surface lineage-specific protein is CD19 and the gRNA hybridizes to a portion of exon 3. In some embodiments, the CD33 and / or CD19 genes are knocked out. In some embodiments, portions of the CD33 and / or CD19 genes are knocked out.

[0185] In some embodiments, further genetic manipulation of HSCs, particularly allogeneic HSCs, may be desirable to reduce the graft-versus-host effect. For example, hematopoietic stem cell transplantation (HSCT) is the standard treatment for relapsed AML. However, at least one of the limiting factors for successful HSCT is graft-versus-host disease (GVHD), which is associated with the expression of the cell surface molecule CD45. See, for example, Van Besie, Hematology Am. Soc. Hematol Educ Program (2013) 56; Mawad, Curr. Hematol. Malig. Rep. (2013) 8(2): 132. CD45RA and CD45RO are isoforms of CD45 (found on all hematopoietic cells except for erythrocytes). In T lymphocytes, CD45RA is expressed on naive cells, while CD45RO is expressed on memory cells. CD45RA T cells have a high potential for responding to recipient-specific proteins after HSCT, leading to GVHD. CD45 is a type 1 lineage protein because CD45-bearing cells are required for survival; however, to prevent and / or reduce the incidence or severity of GvHD, the antigen portion of CD45 can be deleted from stem cells using CRISPR.

[0186] Also provided herein are methods for generating genetically engineered hematopoietic cells as described herein, which harbor edited genes for expressing mutated forms of one or more lineage-specific cell surface antigens. Such methods can involve providing cells and introducing into the cells components of a CRISPR-Cas system for genome editing. In some embodiments, a nucleic acid comprising a CRISPR-Cas guide RNA (gRNA) that hybridizes or is predicted to hybridize to a portion of a nucleotide sequence encoding a lineage-specific cell surface antigen is introduced into the cell. In some embodiments, the gRNA is introduced into the cell on a vector. In some embodiments, a Cas endonuclease is introduced into the cell. In some embodiments, the Cas endonuclease is introduced into the cell as a nucleic acid encoding the Cas endonuclease. In some embodiments, the gRNA and the nucleotide sequence encoding the Cas endonuclease are introduced into the cell on the same nucleic acid (e.g., the same vector). In some embodiments, the Cas endonuclease is introduced into the cell in the form of a protein. In some embodiments, the Cas endonuclease and gRNA are preformed in vitro and introduced into the cell as a ribonucleoprotein complex.

[0187] In some embodiments, multiple gRNAs are introduced into cells.In some embodiments, two or more guide RNAs are transfected into cells in equimolar amounts.In some embodiments, two or more guide RNAs are provided in non-equimolar amounts.In some embodiments, two or more guide RNAs are provided in amounts that are optimized to ensure that the editing of each target occurs at equal frequency.In some embodiments, two or more guide RNAs are provided in amounts that are optimized to ensure that the editing of each target occurs at optimal frequency.

[0188] In some embodiments, multiple gRNAs are allowed to form gRNA-RNP complexes in the same reaction.In some embodiments, two or more gRNA-RNP complexes are formed by separate reactions.RNP complexes with two or more guide RNAs can be transfected together or separately.For example, Cas9-CD19_gRNA-19 RNP and Cas9-CD33_gRNA-37 RNP can be formed separately by two separate incubations or together by one incubation, and can be transfected together or separately, for example, simultaneously.

[0189] In some embodiments, two or more guides are transfected simultaneously with each other. In some embodiments, two or more guides are provided sequentially or consecutively, i.e., by two or more separate transfections. For example, Cas9-CD19_gRNA-RNP and Cas9-CD33 gRNA RNP can be transfected together, for example, in equimolar amounts or another optimal ratio. In some examples, an RNP containing Cas9 and any one of the CD19 gRNAs provided by SEQ ID NOs: 14-26, 67, 69-72 is transfected together with an RNP containing Cas9 and any one of the CD33 gRNAs provided by SEQ ID NOs: 22-50 and 68. Alternatively, Cas9-CD19_gRNA-RNP and Cas9-CD33 gRNA RNP can be transfected sequentially. For example, first a Cas9-CD19_gRNA-RNP and then a Cas9-CD33 gRNA RNP, or first a Cas9-CD33_gRNA-RNP and then a Cas9-CD19 gRNA RNP. In some examples, an RNP comprising Cas9 and any one of the CD19 gRNAs provided by SEQ ID NOS: 14-26, 67, 69-72 is transfected sequentially (e.g., before or after) with an RNP comprising Cas9 and any one of the CD33 gRNAs provided by SEQ ID NOS: 22-50 and 68.

[0190] The vectors of the present disclosure can be used to drive expression of one or more sequences in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman, et al., EMBO J. (1987) 6:187). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, see, for example, chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd eds., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0191] The vectors of the present disclosure can direct nucleic acid expression preferentially in specific cell types (e.g., tissue-specific control elements used to express nucleic acids). Such control elements include promoters that can be tissue-specific or cell-specific. The term "tissue-specific" as applied to a promoter refers to a promoter that can direct the selective expression of a nucleotide sequence of interest in a specific type of tissue (e.g., a seed) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue. The term "cell-type specific" as applied to a promoter refers to a promoter that can direct the selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term "cell-type specific" as applied to a promoter also refers to a promoter that can promote the selective expression of a nucleotide sequence of interest in a region within a single tissue. The cell-type specificity of a promoter can be assessed using methods well known in the art, such as immunohistochemical staining.

[0192] Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids encoding CRISPR / Cas9 into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of the CRISPR-Cas system to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle. In some embodiments, the nucleic acid encoding CRISPR / Cas9 is introduced by transfection (e.g., electroporation, microinjection). In some embodiments, the nucleic acid encoding CRISPR / Cas9 is introduced by nanoparticle delivery, e.g., cationic nanocarriers.

[0193] Viral vector delivery systems include DNA and RNA viruses that have either episomal or integrated genomes after delivery to the cell.

[0194] Viral vectors can be directly administered to patients (in vivo), or they can be used to engineer cells in vitro or ex vivo, and the modified cells can then be administered to patients. In one embodiment, the present disclosure utilizes virus-based systems for gene transfer, including but not limited to retrovirus, lentivirus, adenovirus, adeno-associated, and herpes simplex virus vectors. Furthermore, the present disclosure provides vectors that can integrate into the host genome, such as retroviruses or lentiviruses. Preferably, the vectors used to express the CRISPR-Cas system of the present disclosure are lentivirus vectors.

[0195] In one embodiment, the present disclosure allows one or more vectors encoding CRISPR-Cas to be introduced into eukaryotic cells. The cells can be cancer cells. Alternatively, the cells are hematopoietic cells, such as hematopoietic stem cells. Examples of stem cells include pluripotent, multipotent, and unipotent stem cells. Examples of pluripotent stem cells include embryonic stem cells, embryonic germ cells, embryonic carcinoma cells, and induced pluripotent stem cells (iPSCs). In a preferred embodiment, the present disclosure provides for introducing CRISPR-Cas9 into hematopoietic stem cells.

[0196] The vector of the present disclosure is delivered to a eukaryotic cell of a subject. The modification of the eukaryotic cell with the CRISPR / Cas9 system can be carried out by cell culture, and the method includes isolating the eukaryotic cell from the subject prior to modification. In some embodiments, the method further includes returning the eukaryotic cell and / or cells derived therefrom to the subject.

[0197] In some embodiments, the gRNA is introduced into a cell in the form of a vector. In some embodiments, the gRNA and the nucleotide sequence encoding the Cas endonuclease are introduced into a cell on the same nucleic acid (e.g., the same vector). In some embodiments, the gRNA is introduced into a cell in the form of RNA. In some embodiments, the gRNA may include one or more modifications, for example, to improve the stability of the gRNA, reduce off-target activity, or increase editing efficiency. Examples of modifications include, without limitation, base modifications, backbone modifications, and modifications to the length of the gRNA. For example, it has been demonstrated that extending the length of the gRNA at the 5' end and / or introducing one or more chemical modifications can increase editing efficiency. See, for example, Park et al. Nature Communications (2018) 9:3313; Moon et al. Nature Communications (2018) 9:3651. In addition, it has been found that the incorporation of a nucleic acid or a locked nucleic acid increases the specificity of genome editing. See, e.g., Cromwell, et al. Nature Communications (2018) 9: 1448. See, e.g., Safari et al. Current Pharm. Biotechnol. (2017) 18: 13. In some embodiments, the gRNA can include one or more modifications selected from a phosphorothioate backbone modification, a 2'-O-Me modified sugar (e.g., at one or both of the 3' and 5' ends), a 2'F modified sugar, a substitution of the ribose sugar with the bicyclic nucleotide-cEt, 3'thioPACE (MSP), or any combination thereof. Suitable gRNA modifications are described, for example, in Rahdar et al. PNAS December 22, 2015 112 (51) E7110-E7117 and Hendel et al., Nat Biotechnol. 2015 Sep;33(9): 985-989, each of which is incorporated herein by reference in its entirety.In some embodiments, the gRNAs described herein comprise one or more 2'-O-methyl-3'-phosphorothioate nucleotides, e.g., at least 2, 3, 4, 5, or 6 2'-O-methyl-3'-phosphorothioate nucleotides. In some embodiments, the gRNAs described herein comprise modified nucleotides (e.g., 2'-O-methyl-3'-phosphorothioate nucleotides) at the 5'- and three terminal positions and / or the 3'- and three terminal positions.

[0198] In some embodiments, the gRNA comprises one or more modified bases (e.g., 2'O-methyl nucleotides). In some embodiments, the gRNA comprises one or more modified uracil bases. In some embodiments, the gRNA comprises one or more modified adenine bases. In some embodiments, the gRNA comprises one or more modified guanine bases. In some embodiments, the gRNA comprises one or more modified cytosine bases.

[0199] In some embodiments, the gRNA comprises one or more modified internucleotide linkages, such as, for example, phosphorothioates, phosphoramidates, and O'methyl ribose or deoxyribose residues.

[0200] In some embodiments, the gRNA comprises an extension of about 10 to 100 nucleotides at the 3' and / or 5' end of the gRNA, hi some embodiments, the gRNA comprises an extension of about 10 to 100 nucleotides, about 20 to 90 nucleotides, about 30 to 80 nucleotides, about 40 to 70 nucleotides, about 40 to 60 nucleotides, or about 50 to 60 nucleotides.

[0201] In some embodiments, the Cas endonuclease and gRNA are preformed in vitro and introduced into cells as a ribonucleoprotein complex. Exemplary mechanisms for introducing a ribonucleoprotein complex containing a Cas endonuclease and a gRNA include, but are not limited to, electroporation, cationic lipids, DNA nanoclews, and cell-penetrating peptides. See, e.g., Safari et al. Current Pharma. Biotechnol. (2017) 18(13); Yin et al. Nature Review Drug Discovery (2017) 16: 387-399.

[0202] Any of the CRISPR / Cas systems described herein can be further optimized to increase the selectivity of genome editing, for example, by improving homologous recombination. See, e.g., Komor et al. Cell (2017) 168: 20-36. For example, in some embodiments, a CRISPR / Cas system can be optimized to inhibit non-homologous end joining and / or promote homologous recombination.

[0203] Several small molecules have been identified for regulating Cas endonuclease genome editing. In some embodiments, cells are contacted with one or more small molecules to improve Cas endonuclease genome editing. In some embodiments, a subject is administered one or more small molecules to improve Cas endonuclease genome editing. In some embodiments, cells are contacted with one or more small molecules to inhibit non-homologous end joining and / or promote homologous recombination. Examples of small molecules that can regulate Cas endonuclease genome editing include, but are not limited to, L755507, Brefeldin A, ligase IV inhibitor SCR7, VE-822, and AZD-7762. See, for example, Hu et al. Cell Chem. Biol. (2016) 23: 57-73; Yu et al. Cell Stem Cell (2015) 16: 142-147; Chu et al. Nat. Biotechnol. (2015) 33: 543-548; Maruyama et al. Nat. Biotechnol. (2015) 33: 538-542; and Ma et al. Nature Communications (2018) 9:1303.

[0204] In some embodiments, any of the Cas endonucleases can be used with a donor single-stranded DNA designed to anneal with the DNA strand that is first released from the Cas endonuclease.

[0205] In some embodiments, it is desirable to temporally control genome editing. For example, in some embodiments, the expression and / or activity of a Cas endonuclease can be controlled to induce genome editing at a desired time. In some embodiments, cells containing any of the CRISPR / Cas systems described herein can be allowed to engraft into a subject, and then the expression and / or activity of the Cas endonuclease can be induced. Alternatively, or in addition, the Cas endonucleases described herein can be fused to epigenetic modifiers (e.g., chromatin-modifying enzymes, e.g., DNA methylases, histone deacetylases).

[0206] (B) Genetically engineered hematopoietic cells expressing CD19 and / or CD33 variants. In some embodiments, genetically engineered hematopoietic cells can have edited CD19 genes, CD33 genes, or both, which are engineered to express mutated CD19, CD33, or both. In some cases, the mutated CD19 and / or CD33 include mutations or deletions in one or more non-essential epitopes such that the biological activity of CD19 and / or CD33 is retained (at least in part).

[0207] (i) Genetically engineered hematopoietic cells expressing CD19 variants In some examples, CD19 variants are provided herein, which may include deletions or mutations of fragments of the protein encoded by any one of the CD19 exons, or deletions or mutations of non-essential epitopes of CD19. The entire sequence of the CD19 gene, containing 15 exons, is known in the art. See, for example, GenBank accession no. NC_000016. For example, one or more epitopes located in the region encoded by CD19 gene exon 2 may be deleted or mutated. Certain modifications to the region of the CD19 gene encoding exon 2 have been shown to result in successful CD19 protein expression, membrane localization, and partial maintenance of protein function (Sotillo et al. Cancer Discovery. (2015) 5: 1282-1295). For example, missense or frameshift mutations on exon 2 of the CD19 gene, or alternatively, modifications that permanently or transiently reduce the expression of the splicing factor SRSF3, which is involved in the retention of CD19 exon 2, can reduce in vivo CD19 expression. In some embodiments, one or more epitopes located in the region encoded by exon 2 of the CD19 gene are mutated or deleted. For example, the FMC63 epitope of CD19, a known target of CD19-targeted CAR therapy, can be mutated or deleted (Sotillo et al. Cancer Discovery. (2015) 5: 1282-129; Nicholson et al. Mol Immunol. (1997) 34: 1157-1165; Zola et al. Immunol Cell Biol. (1991) 69: 411-422).

[0208] In some examples, one or more epitopes located in the region encoded by exon 4 of the CD19 gene may be deleted or mutated.

[0209] In some embodiments, exon 2 of CD19 may be mutated or deleted. In some embodiments, exon 4 of CD19 is mutated or deleted. An exemplary human CD19 amino acid sequence is provided below, with the fragment encoded by exon 2 underlined and the fragment encoded by exon 4 in italics (SEQ ID NO: 51).

[0210] [ka]

[0211] CD19 full length mRNA (underlined = exon 2; italic = exon 4) [ka]

[0212] In some examples, the engineered hematopoietic cells have an engineered CD19 gene (e.g., an engineered endogenous CD19 gene) that expresses a CD19 variant lacking the fragment encoded by exon 2 (CD19ex2). An exemplary amino acid sequence of such a CD19 variant is provided below (the junction of the fragment encoded by exon 1 and the fragment encoded by exon 3 is shown in bold):

[0213] [ka]

[0214] mRNA ex2 deletion [ka] [ka]

[0215] In some embodiments, exon 4 of CD19 is mutated or deleted. In some examples, the engineered hematopoietic cells have an engineered CD19 gene (e.g., an engineered endogenous CD19 gene) that expresses a CD19 variant (CD19ex4) in which the fragment encoded by exon 4 has been deleted. Exemplary amino acid sequences of such CD19 variants are provided below:

[0216] [ka]

[0217] mRNA ex4 deletion [ka]

[0218] Genetically engineered hematopoietic stem cells harboring an edited CD19 gene that expresses this CD19 variant are also within the scope of this disclosure.

[0219] Genetically engineered hematopoietic stem cells carrying an edited CD19 gene that expresses this CD19 variant are also within the scope of the present disclosure. Such cells may be a homogeneous population containing cells expressing the same CD19 variant (e.g., CD19ex2, CD19ex4). Alternatively, the cells may be a heterogeneous population containing cells expressing different CD19 variants (which may be due to heterogeneous editing / repair events within the cells) or cells that do not express CD19 (CD19KO). In a specific example, the genetically engineered HSCs may be a heterogeneous population containing cells that express CD19ex2 and cells that do not express CD19 (CD19KO). In some specific examples, the genetically engineered HSCs may be a heterogeneous population containing cells that express CD19ex4 and cells that do not express CD19 (CD19KO).

[0220] The genetically engineered hematopoietic stem cells with CD19 gene editing can be prepared by suitable genome editing methods, such as those known in the art or disclosed herein. In some embodiments, the genetically engineered hematopoietic stem cells described herein can be produced using a CRISPR approach. See the discussion of this application. In certain examples, specific guide RNAs targeting fragments (exon sequences or intron sequences) of the CD19 gene can be used in the CRISPR method. Exemplary gRNAs for editing the CD19 gene (e.g., deleting exon 2, exon 4) are provided in Example 1, Table 3, and Example 3 below.

[0221] In some examples, multiple gRNAs can be used to edit CD19 gene by CRISPR.For example, different combinations of gRNAs selected from those listed in Table 3 can be used in multiplex approach.In one example, a pair of gRNA6 (AGCAGAGGACTCCAAAAGCT; SEQ ID NO: 18) and gRNA14 (CCATGGACAGAAGAGGTCCG; SEQ ID NO: 24) is used to edit CD19 gene by CRISPR.Also provided herein is a method for gene editing CD19 of hematopoietic cells (for example, HSCs) by CRISPR using one or more of the gRNAs described herein, for example, a pair of gRNA6 + gRNA14 or a pair of gRNA23 + gRNA24.

[0222] Due to the mechanism of Cas9 cleavage and DNA repair, there will be a wide range of repair events, including small insertions of 1-2 nucleotides and sometimes longer deletions. Representative sequences of repaired CD19 exon 2 deletion products (intron 1 to intron 2 are presented) are shown below (SEQ ID NOS: 53-55):

[0223] [Table 3]

[0224] Despite the heterogeneity at the genomic DNA level, all RNA transcripts produced from the edited CD19 gene encode CD19 variants lacking the fragment encoded by exon 2.

[0225] (ii) Genetically engineered hematopoietic cells expressing CD33 variants In some embodiments, the lineage-specific cell surface protein is CD33. As will be known to those skilled in the art, CD33 is encoded by seven exons, including alternatively spliced ​​exons 7A and 7B (Brinkman-Van der Linden et al. Mol Cell. Biol. (2003) 23: 4199-4206). Furthermore, the CD33 gene encodes two isoforms, one that retains exon 2 and is referred to as CD33M, and one that excludes exon 2 and is referred to as CD33m (Figure 17).

[0226] Exemplary amino acid sequences of the 7A and 7B splicing isoforms are provided below:

[0227] CD33M-7A: amino acids (underlined = exon 2; italicized = exon 7A) [ka]

[0228] CD33-M; transcript variant 1 mRNA. NM_001772 (underlined = exon 2; italicized = exon 7A) [ka] [ka]

[0229] CD33m-7A: amino acids (italicized = exon 7A; SEQ ID NO: 56) [ka]

[0230] CD33-m transcript variant 2; no exon 2, exon 7A mRNA. NM_001082618 (italicized = exon 7A) [ka]

[0231] CD33M-7B: amino acids (underlined = exon 2; italicized = exon 7B; SEQ ID NO: 57) [ka]

[0232] CD33 transcript variant 3; exon 7B mRNA. NM_001177608 (underlined = exon 2; italicized = exon 7B) [ka] [ka]

[0233] CD33m-7B amino acids (italicized = exon 7B; SEQ ID NO: 58) [ka]

[0234] CD33 transcript variant 4; no exon 2, exon 7B mRNA (italicized = exon 7B) [ka]

[0235] Using human CD33 as an exemplary lineage-specific cell surface protein, regions of the protein where amino acid mutations and / or deletions are less likely to result in deleterious effects (e.g., reduced or abolished function) were predicted using PROVEAN software (provean.jcvi.org; see Choi et al. PLoS ONE (2012) 7(10): e46688). Examples of predicted regions are boxed in Figure 2, and exemplary deletions of predicated regions are presented in Table 2. Amino acid residue numbering is based on the amino acid sequence of human CD33 (CD33M-7A) provided by SEQ ID NO: 1.

[0236] [Table 4-1] [Table 4-2]

[0237] The nucleotide sequence encoding CD33 is engineered to delete any epitope of the protein (extracellular portion of CD33) or a fragment containing same using conventional methods of nucleic acid manipulation. The amino acid sequences provided below are exemplary sequences of CD33 variants engineered to lack each of the epitopes in Table 2.

[0238] The amino acid sequence of the extracellular portion of CD33 is provided by SEQ ID NO: 1. The signal peptide is shown in italics, and the sites of manipulation are underlined and bold. The transmembrane domain is shown in italics and underlined.

[0239] [ka]

[0240] The amino acid sequence of the extracellular portion of CD33, including the deletion of residues S248 to E252, is provided by SEQ ID NO: 2. The signal peptide is shown in italics and the transmembrane domain is shown in italics and underlined.

[0241] S248_E252insdelTARND;PROVEAN score=-1.916 [ka]

[0242] The amino acid sequence of the extracellular portion of CD33, including a deletion of residues 147 to D51, is provided by SEQ ID NO: 3. The signal peptide is shown in italics and the transmembrane domain is shown in italics and underlined.

[0243] I47_D51insdelVPFFE;PROVEAN score=-1.672 [ka]

[0244] The amino acid sequence of the extracellular portion of CD33, including the deletion of residues G249 to T253, is provided by SEQ ID NO: 4. The signal peptide is shown in italics and the transmembrane domain is shown in italics and underlined.

[0245] [ka]

[0246] The amino acid sequence of the extracellular portion of CD33 containing a deletion of residues K250 to R254 is provided by SEQ ID NO: 5. The signal peptide is shown in italics and the transmembrane domain is shown in italics and underlined.

[0247] [ka]

[0248] The amino acid sequence of the extracellular portion of CD33, including a deletion of residues P48 to K52, is provided by SEQ ID NO: 6. The signal peptide is shown in italics, and the transmembrane domain is shown in italics and underlined.

[0249] [ka]

[0250] The amino acid sequence of the extracellular portion of CD33 containing a deletion of residues Q251 to A255 is provided by SEQ ID NO: 7. The signal peptide is shown in italics and the transmembrane domain is shown in italics and underlined.

[0251] [ka]

[0252] In some examples, CD33 variants are provided herein, which may include deletions or mutations of a fragment of the protein encoded by any one of the CD33 exons, or deletions or mutations of a non-essential epitope. The predicted structure of CD33 includes two immunoglobulin domains, an IgV domain, and an IgC2 domain. In some embodiments, a portion of the immunoglobulin V domain of CD33 is deleted or mutated. In some embodiments, a portion of the immunoglobulin C domain of CD33 is deleted or mutated. In some embodiments, exon 2 of CD33 is deleted or mutated. In some embodiments, a CD33 variant lacks amino acid residues W11 to T139 of SEQ ID NO: 1. In some embodiments, a CD33 variant lacks amino acid residues G13 to T139 of SEQ ID NO: 1. In some embodiments, the deleted or mutated fragment overlaps with or encompasses an epitope to which a cytotoxic agent binds. As described in Example 1, in some embodiments, the epitope comprises amino acids 47-51 or 248-252 of the extracellular portion of CD33 (SEQ ID NO: 1). In some embodiments, the epitope comprises amino acids 248-252 (SEQ ID NO: 8), 47-51 (SEQ ID NO: 9), 249-253 (SEQ ID NO: 10), 250-254 (SEQ ID NO: 11), 48-52 (SEQ ID NO: 12), or 251-255 (SEQ ID NO: 13) of the extracellular portion of CD33 (SEQ ID NO: 1).

[0253] In some embodiments, the genetically engineered hematopoietic stem cells have a gene edit in the CD33 gene, where exon 2 of CD33 is mutated or deleted. In some embodiments, exon 2 of CD33 is mutated or deleted (see amino acid sequence of the fragment encoded by exon 2 above). In some embodiments, the genetically engineered hematopoietic stem cells have a gene edit in the CD33 gene, whereby expression of CD33 with a deleted or mutated exon 2 of CD33 occurs. In some embodiments, the genetically engineered hematopoietic stem cells express CD33, where exon 2 of CD33 is mutated or deleted. In some examples, the genetically engineered hematopoietic cells have a genetically engineered CD33 gene (e.g., a genetically engineered endogenous CD33 gene), whereby the engineering results in expression of a CD33 variant (CD33ex2) where the fragment encoded by exon 2 is deleted.

[0254] In some embodiments, CD33 gene-edited HSCs that express a CD33 variant lacking a fragment encoded by exon 2 also contain a partial or complete deletion of adjacent introns (intron 1 and intron 2) in addition to the deletion of exon 2.

[0255] An exemplary amino acid sequence of a CD33 mutant in which the fragment G13-T139 has been deleted is provided below (the junction of the fragment encoded by exon 1 and the fragment encoded by exon 3 is shown in bold):

[0256] [ka]

[0257] [ka]

[0258] Although some cells can express a CD33 protein lacking the fragment encoded by exon 2, genetically engineered hematopoietic cells differ from such native cells at least in that these cells have undergone genome editing to modify a CD33 gene, such as an endogenous CD33 gene. In other words, the parental hematopoietic stem cells from which genetically engineered HSCs are derived possess a CD33 gene that produces an exon 2-containing transcript.

[0259] Genetically engineered hematopoietic stem cells carrying an edited CD33 gene that expresses this CD33 variant are also within the scope of the present disclosure. Such cells may be a homogeneous population containing cells expressing the same CD33 variant (e.g., CD33ex2). Alternatively, the cells may be a heterogeneous population containing cells expressing different CD33 variants (which may be due to heterogeneous editing / repair events within the cells) or cells that do not express CD33 (CD33KO). In a specific example, the genetically engineered HSCs may be a heterogeneous population containing cells that express CD33ex2 and cells that do not express CD33 (CD33KO).

[0260] Genetically engineered hematopoietic stem cells with an edited CD33 gene can be prepared by suitable genome editing methods, such as those known in the art or disclosed herein. In some embodiments, the genetically engineered hematopoietic stem cells described herein can be produced using a CRISPR approach. See the discussion of this application. In certain examples, specific guide RNAs targeting fragments (exon sequences or intron sequences) of the CD33 gene can be used in the CRISPR method. Exemplary gRNAs for editing the CD33 gene (e.g., deleting exon 2) are provided in Example 2, Table 4, and Example 3 below.

[0261] In some instances, multiple gRNAs can be used to edit the CD33 gene with CRISPR, e.g., different combinations of gRNAs selected from those listed in Table 4 can be used in a multiplexed approach.

[0262] The CD33 pseudogene known as SIGLEC22P (gene ID 114195) is located upstream of the CD33 gene and shares a certain degree of sequence homology with the CD33 gene. Cross-targeting gRNAs between regions on the pseudogene and the CD33 gene can lead to the production of aberrant gene products. Therefore, in some embodiments, gRNAs used in methods for editing CD33 with CRISPR preferably have low or no cross-reactivity with regions within the pseudogene. In some cases, gRNAs used in methods for editing CD33 with CRISPR preferably have low or no cross-reactivity with regions (single or multiple) on exon 1, intron 1, or exon 2 of CD33 that are homologous to the pseudogene. Such gRNAs can be designed by comparing the sequences of the pseudogene and the CD33 gene to select targeting sites within the CD33 gene that have less or no homology to regions of the pseudogene.

[0263] In one example, a pair of gRNA18 (TTCATGGGTACTGCAGGGCA; SEQ ID NO: 44) and gRNA24 (GTGAGTGGCTGTGGGGAGAG; SEQ ID NO: 50) is used to edit CD33 by CRISPR. Also provided herein is a method for gene editing CD33 in hematopoietic cells (e.g., HSCs) by CRISPR using one or more of the gRNAs described herein, for example, a pair of gRNA18+gRNA24. The length of the gRNA sequences described herein can be modified (increased or decreased), for example, to improve editing specificity and / or efficiency. In some embodiments, the length of gRNA24 is 20 base pairs. In some embodiments, reducing the length of gRNA24 can reduce the editing efficiency of gRNA24 for CD33.

[0264] Due to the mechanism of Cas9 cleavage and DNA repair, there will be a wide range of repair events, including small insertions of 1-2 nucleotides and sometimes longer deletions. Representative sequences of repaired CD33 exon 2 deletion products (intron 1 to intron 2 are presented) are shown below (SEQ ID NOS: 59-65):

[0265] [Table 5]

[0266] Despite heterogeneity at the genomic DNA level, all RNA transcripts produced from the edited CD33 genes encode CD33 variants lacking the fragment encoded by exon 2.

[0267] (iii) Genetically engineered hematopoietic cells expressing both CD19 and CD33 variants Genetically engineered hematopoietic cells, such as HSCs in which both the CD19 and CD33 genes have been edited, are also provided herein. In some embodiments, a population of genetically engineered hematopoietic HSCs is provided herein, wherein at least 50% of the cells carry gene-edited CD19 and CD33 genes on at least one chromosome.

[0268] In some embodiments, the edited CD19 gene can express a CD19 variant in which the fragment encoded by exon 2 has been deleted. Alternatively or additionally, the edited CD33 gene can express a CD33 variant in which the fragment encoded by exon 3 has been deleted.

[0269] Genetically engineered hematopoietic cells with both CD19 and CD33 gene editing can be prepared by conventional methods. In some embodiments, such cells can be prepared by CRISPR using a pair of gRNAs, one of which targets CD19 and the other of which targets CD33. An example is provided in Example 3, Table 8 below. In one example, the pair of gRNAs can be simultaneously introduced into parental HSCs, and cells with gene editing in CD19 and / or CD33 can be harvested for future use.

[0270] Masked lineage-specific cell surface antigens While many of the embodiments described herein involve mutation of endogenous genes encoding lineage-specific cell surface antigens, it is understood that other approaches can be used instead of or in addition to mutation. For example, lineage-specific cell surface antigens can be masked to prevent or reduce their recognition, e.g., by immunotherapeutic agents. In some embodiments, masking is used for lineage-specific cell surface antigens that are difficult to mutate, e.g., because gene mutation is inefficient or deleterious to cells expressing the mutant. In some embodiments, the lineage-specific cell surface protein is CD45. In some embodiments, masking is performed on cell types described herein, e.g., HSCs or HPCs.

[0271] In some embodiments, masking is achieved by expressing a masking protein in the cells of interest (e.g., by stably expressing DNA encoding the masking protein in the cells). In some embodiments, the masking protein comprises a binding domain (e.g., an antibody or antigen-binding fragment, e.g., an scFv) that binds to the lineage-specific cell surface protein in a manner that reduces binding of the immunotherapeutic agent to the lineage-specific cell surface protein, e.g., by competing for binding at the same epitope. In some embodiments, the binding domain binds to CD45. In some embodiments, the masking protein further comprises one or more sequences that direct its localization to the surface of the cell. In some embodiments, the masking protein comprises a transmembrane domain fused to the binding domain. The masking protein may comprise a linker disposed between the transmembrane domain and the binding domain. The masking protein may be expressed at a level that binds to a sufficient amount of the lineage-specific cell surface antigen such that the immunotherapeutic agent exhibits reduced binding and / or reduced killing of cells expressing the masking protein compared to otherwise similar cells that do not express the masking protein.

[0272] In some embodiments, the cells described herein have reduced binding to (and / or reduced killing by) two different immunotherapeutic agents that recognize two different lineage-specific cell surface antigens. For example, the cells can have a mutation in a gene encoding a first lineage-specific cell surface antigen and can contain a masking protein that masks a second lineage-specific cell surface antigen. In some embodiments, the cells can contain a first masking protein that masks the first lineage-specific cell surface antigen and a second masking protein that masks the second lineage-specific cell surface antigen. In some embodiments, the first and second lineage-specific cell surface antigens are antigens listed in Table 1A.

[0273] Cells that have been altered with one or more lineage-specific cell surface antigens While many of the embodiments described herein involve more than one lineage-specific cell surface antigen, the present disclosure also discloses various cells altered for a single lineage-specific cell surface antigen. For example, the present disclosure describes cells altered for any one of the lineage-specific cell surface antigens described herein (e.g., altered for one or both alleles of the lineage-specific cell surface antigen). The present disclosure also describes cells expressing a single masking protein for a single lineage-specific cell surface antigen.

[0274] II. Cytotoxic Agents Specific for Lineage-Specific Cell Surface Antigens Cytotoxic agents that target cells expressing lineage-specific cell surface antigens (e.g., cancer cells) can be used in combination with the genetically engineered hematopoietic cells described herein. As used herein, the term "cytotoxic agent" refers to any agent that can directly or indirectly induce cytotoxicity in target cells expressing lineage-specific cell surface antigens (e.g., target cancer cells). Such cytotoxic agents can include protein-binding fragments that bind and target epitopes of lineage-specific cell surface antigens. In some cases, cytotoxic agents can include antibodies, which can be conjugated to drugs (e.g., anti-cancer drugs) to form antibody-drug conjugates (ADCs).

[0275] Cytotoxic agents for use in the methods described herein can directly cause cell death of a target cell. For example, the cytotoxic agent can be an immune cell (e.g., a cytotoxic T cell) expressing a chimeric receptor. Engagement of the protein-binding domain of the chimeric receptor with a corresponding epitope on a lineage-specific cell surface antigen can transmit a signal (e.g., an activation signal) to the immune cell, resulting in the release of cytotoxic molecules such as perforin and granzymes and the activation of effector functions, leading to the death of the target cell. In another example, the cytotoxic agent can be an ADC molecule. By binding to the target cell, the drug moiety of the ADC will exert cytotoxic activity, leading to the death of the target cell.

[0276] In other embodiments, the cytotoxic agent can indirectly induce cell death of the target cell. For example, the cytotoxic agent can be an antibody that, upon binding to the target cell, will induce effector activity (e.g., ADCC) and / or recruit other factors (e.g., complement), resulting in the death of the target cell.

[0277] Any of the cytotoxic agents described herein target lineage-specific cell surface antigens and include, for example, protein-binding fragments that specifically bind to epitopes on lineage-specific proteins.

[0278] For leukemias that become resistant to CAR-T therapy, an emerging strategy is to target alternative or multiple antigens simultaneously (see, for example, Nature Reviews Immunology (2019), Volume 19, pp. 73-74 and Cancer Discov. (2018) Oct;8(10):1219-1226).

[0279] In some embodiments, more than one (e.g., 2, 3, 4, 5, or more) cytotoxic agents are used to target more than one (e.g., 1, 2, 3, 4, 5, or more) epitope(s) of a lineage-specific cell surface antigen. In some embodiments, more than one (e.g., 1, 2, 3, 4, 5, or more) cytotoxic agents are used to target epitope(s) of one or more lineage-specific cell surface antigen(s) (e.g., additional / alternative antigens). In some embodiments, targeting more than one lineage-specific cell surface antigen reduces recurrence of hematopoietic malignancies. In one embodiment, two or more cytotoxic agents are used in the methods described herein. In some embodiments, two or more cytotoxic agents are administered simultaneously. In some embodiments, two or more cytotoxic agents are administered sequentially.

[0280] Examples of additional cell surface proteins that can be targeted are known in the art (see, e.g., Tasian, Ther. Adv. Hematol. (2018) 9(6): 135-148; Hoseini and Cheung, Blood Cancer Journal (2017) 7, e522; doi:10.1038 / bcj.2017.2; Taraseviciute et al. Hematology and Oncology (2019) 31(1)). In some embodiments, the methods described herein involve targeting a lineage-specific cell surface antigen and one or more additional cell surface proteins. In some embodiments, the methods described herein involve administering a cytotoxic agent that targets CD33 and at least one additional cytotoxic agent that targets an additional cell surface protein, e.g., CD7, CD13, CD15, CD25 (IL-2Rα), CD30, CD32 (FcγRIII), CD38, CD44v6, CD45, CD47, CD56, CD90 (Thy1), CD96, CD117 (c-KIT), CD123 (IL3Rα), CD135 (FLT3R), CD174 (Lewis Y), CLL-1 (CLEC12A), folate receptor b, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3 (HAVCR2), CD19, and WT1. In some embodiments, the methods described herein involve administering a cytotoxic agent that targets CD19 and at least one additional cytotoxic agent that targets an additional cell surface protein, e.g., CD7, CD13, CD15, CD25 (IL-2Rα), CD30, CD32 (FcγRIII), CD38, CD44v6, CD45, CD47, CD56, CD90 (Thy1), CD96, CD117 (c-KIT), CD123 (IL3Rα), CD135 (FLT3R), CD174 (Lewis Y), CLL-1 (CLEC12A), folate receptor b, IL1RAP, MUC1, NKG2D / NKG2DL, TIM-3 (HAVCR2), CD19, and WT1.

[0281] In some examples, a cytotoxic agent is used to target CD33 and a second cytotoxic agent is used to target CD19. In some examples, a cytotoxic agent is used to target CD33 and a second cytotoxic agent is used to target an additional cell surface protein. In some examples, a cytotoxic agent is used to target CD19 and a second cytotoxic agent is used to target an additional cell surface protein. In some examples, a cytotoxic agent is used to target CD33 and a second cytotoxic agent is used to target CD13. In some examples, a cytotoxic agent is used to target CD33 and a second cytotoxic agent is used to target CD13. In some examples, a cytotoxic agent is used to target CD33 and a second cytotoxic agent is used to target CD123. In some examples, a cytotoxic agent is used to target CD19 and a second cytotoxic agent is used to target CD13. In some examples, a cytotoxic agent is used to target CD19 and a second cytotoxic agent is used to target CD123. In some examples, a cytotoxic agent is used to target CD13 and a second cytotoxic agent is used to target CD123.

[0282] In some examples, a cytotoxic agent for targeting CD33 is used, a second cytotoxic agent for targeting CD19 is used, and a third cytotoxic agent for targeting CD13 is used. In some examples, a cytotoxic agent for targeting CD33 is used, a second cytotoxic agent for targeting CD19 is used, and a third cytotoxic agent for targeting CD123 is used. In some examples, a cytotoxic agent for targeting CD33 is used, a second cytotoxic agent for targeting CD13 is used, and a third cytotoxic agent for targeting CD123 is used. In some examples, a cytotoxic agent for targeting CD19 is used, a second cytotoxic agent for targeting CD19 is used, and a third cytotoxic agent for targeting CD13 is used. In some examples, a cytotoxic agent is used to target CD33, a second cytotoxic agent is used to target CD19, a third cytotoxic agent is used to target CD13, and a fourth cytotoxic agent is used to target CD123.

[0283] (i) Therapeutic antibodies Any of the antibodies or antigen-binding fragments thereof can be used as cytotoxic agents or to construct cytotoxic agents that target epitopes of the lineage-specific cell surface antigens described herein. Such antibodies or antigen-binding fragments can be prepared by conventional methods, such as hybridoma technology or recombinant technology.

[0284] As used herein, the term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, i.e., a covalently linked heterotetramer consisting of two identical Ig H chains and two identical L chains encoded by different genes. Each heavy chain consists of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region consists of three domains, CH1, CH2, and CH3. Each light chain consists of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region consists of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs arranged in the following order from amino-terminus to carboxy-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant regions of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (Clq). When the two proteins are expressed in stoichiometric amounts and self-assemble in the appropriate configuration, the formation of a mature, functional antibody molecule can be achieved.

[0285] In some embodiments, the antigen-binding fragment is a single-chain antibody fragment (scFv) that specifically binds to an epitope of a lineage-specific cell surface antigen, hi other embodiments, the antigen-binding fragment is a full-length antibody that specifically binds to an epitope of a lineage-specific cell surface antigen.

[0286] As described herein and as will be apparent to one of skill in the art, the CDRs of an antibody specifically bind to an epitope of a target protein / antigen (a lineage-specific cell surface protein / antigen).

[0287] In some embodiments, the antibodies are full-length antibodies, meaning that the antibodies comprise a crystallizable (Fc) partial fragment and an antigen-binding (Fab) partial fragment. In some embodiments, the antibodies are of the isotype IgG, IgA, IgM, IgA, or IgD. In some embodiments, the population of antibodies comprises one isotype of antibody. In some embodiments, the antibodies are IgG antibodies. In some embodiments, the antibodies are IgM antibodies. In some embodiments, the population of antibodies comprises more than one isotype of antibody. In some embodiments, the population of antibodies consists of a majority of antibodies of one isotype, but also contains antibodies of one or more other isotypes. In some embodiments, the antibodies are selected from the group consisting of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgAsec, IgD, and IgE.

[0288] The antibodies described herein can specifically bind to a target protein. As used herein, "specific binding" refers to antibody binding to a predetermined protein, such as a cancer antigen. "Specific binding" can involve more frequent, more rapid, or more durable interactions, and / or greater affinity for the target protein relative to alternative proteins. In some embodiments, a population of antibodies specifically binds to a particular epitope of a target protein, meaning that the antibody binds to the particular protein more frequently, more rapidly, or more durable interactions, and / or with greater affinity for the epitope relative to alternative epitopes of the same target protein or epitopes of other proteins. In some embodiments, an antibody that specifically binds to a particular epitope of a target protein may not bind to other epitopes of the same protein.

[0289] Antibodies can be selected based on the binding affinity of the antibody to the target protein or epitope. Alternatively, or in addition, the antibody can be mutated to introduce one or more mutations to alter (e.g., improve or decrease) the binding affinity of the antibody to the target protein or epitope.

[0290] The antibody or antigen-binding portion thereof is about 10 -7 Less than M, about 10 -8 Less than M, about 10 -9 Less than M, about 10 -10 Less than M, about 10 -11 Less than M or about 10 -12 It can specifically bind with a dissociation constant (KD) of less than M. The affinity of antibodies according to the present disclosure can be readily determined using conventional techniques (see, e.g., Scatchard et al., Ann. NY Acad. Sci. (1949) 51:660; and U.S. Patent Nos. 5,283,173, 5,468,614, or equivalents).

[0291] The binding affinity or binding specificity for an epitope or protein can be determined by a variety of methods, including equilibrium dialysis, equilibrium binding, gel filtration, ELISA, surface plasmon resonance, or spectroscopy.

[0292] For example, antibodies (or antigen-binding fragments thereof) specific for an epitope of a lineage-specific protein of interest can be produced by conventional hybridoma technology. Lineage-specific proteins, which may be coupled to a carrier protein such as KLH, can be used to immunize a host animal to generate antibodies that bind to the complex. The route and schedule of immunization of the host animal will generally follow established conventional techniques for antibody stimulation and production, as described further herein. General techniques for the production of murine, humanized, and human antibodies are known in the art and are described herein. It is contemplated that any mammalian subject, including humans, or antibody-producing cells therefrom can be engineered to serve as the basis for the production of mammalian cell lines, including human hybridomas. Typically, a host animal is inoculated intraperitoneally, intramuscularly, orally, subcutaneously, plantarly, and / or intradermally with an amount of immunogen, including as described herein.

[0293] Hybridomas can be prepared from lymphocytes and immortalized myeloma cells using the general somatic cell hybridization technique of Kohler, B. and Milstein, C. (1975) Nature 256:495-497, or as modified by Buck, DW, et al., In Vitro, 18:377-381 (1982). Available myeloma lines, including but not limited to X63-Ag8.653 and those from the Salk Institute Cell Distribution Center, San Diego, Calif., USA, can be used for hybridization. Generally, the technique involves fusing myeloma and lymphoid cells using a fusing agent such as polyethylene glycol or by electrical means well known to those skilled in the art. After fusion, the cells are separated from the fusion medium and grown in a selective growth medium, such as hypoxanthine-aminopterin-thymidine (HAT) medium, to remove unhybridized parent cells. Any of the media described herein, supplemented with or without serum, can be used to culture hybridomas secreting monoclonal antibodies. As another alternative to cell fusion techniques, EBV-immortalized B cells can be used to produce the TCR-like monoclonal antibodies described herein. The hybridomas are expanded and subcloned, if desired, and the supernatants are assayed for anti-immunogen activity by conventional immunoassay procedures (e.g., radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay).

[0294] Hybridomas that can be used as a source of antibodies include all derivatives, progeny, of the parent hybridoma that produce monoclonal antibodies capable of binding to lineage-specific proteins. Hybridomas producing such antibodies can be grown in vitro or in vivo using known procedures. If desired, monoclonal antibodies can be isolated from the culture medium or body fluids by conventional immunoglobulin purification procedures, such as ammonium sulfate precipitation, gel electrophoresis, dialysis, chromatography, and ultrafiltration. Undesired activity, if present, can be removed, for example, by passing the preparation over an adsorbent made from the immunogen attached to a solid phase and eluting or liberating the desired antibody from the immunogen.

[0295] Immunization of a host animal with a target protein or fragment containing the target amino acid sequence conjugated to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor, using a bifunctional or derivatized agent, e.g., maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine ​​residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCl, or RN=C=NR, where R and R are different alkyl groups, can generate a population of antibodies (e.g., monoclonal antibodies).

[0296] If desired, the antibody of interest (e.g., produced by a hybridoma) can be sequenced, and the polynucleotide sequence can then be cloned into a vector for expression or propagation. The sequence encoding the antibody of interest can be maintained on the vector within host cells, which can then be expanded and frozen for future use. Alternatively, the polynucleotide sequence can be used for genetic engineering to "humanize" the antibody or to improve affinity (affinity maturation) or other characteristics of the antibody. For example, if the antibody is to be used in human clinical trials and treatments, the constant region can be engineered to more closely resemble human constant regions to avoid an immune response. It may be desirable to genetically engineer the antibody sequence to obtain greater affinity for lineage-specific proteins. In some instances, the antibody sequence is engineered to increase the antibody's binding affinity for lineage-specific proteins, such that lower levels of lineage-specific proteins are detected by the antibody. In some embodiments, antibodies with increased binding to lineage-specific proteins can be used to reduce or prevent the recurrence of hematopoietic malignancies. It will be apparent to one skilled in the art that one or more polynucleotide changes can be made to an antibody and still maintain its binding specificity for the target protein.

[0297] In other embodiments, fully human antibodies can be obtained by using commercially available mice engineered to express specific human immunoglobulin proteins. Transgenic animals designed to generate a more desirable (e.g., fully human antibodies) or stronger immune response can also be used to generate humanized or human antibodies. Examples of such technologies are Xenomouse® from Amgen, Inc. (Fremont, Calif.) and HuMAb-Mouse® and TCMouse™ from Medarex, Inc. (Princeton, NJ). In another alternative, antibodies can be produced recombinantly by phage display or yeast technology. See, e.g., U.S. Pat. Nos. 5,565,332; 5,580,717; 5,733,743; and 6,265,150; and Winter et al., (1994) Annu. Rev. Immunol. 12:433-455. Alternatively, phage display technology (McCafferty et al., (1990) Nature 348:552-553) can be used to generate human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors.

[0298] Antigen-binding fragments of intact antibodies (full-length antibodies) can be prepared by conventional methods, for example, F(ab')2 fragments can be generated by pepsin digestion of the antibody molecule, and Fab fragments can be generated by reducing the disulfide bridges of the F(ab')2 fragment.

[0299] Genetically engineered antibodies, such as humanized antibodies, chimeric antibodies, single-chain antibodies, and bispecific antibodies, can be produced, for example, by conventional recombinant technology. In one example, DNA encoding a monoclonal antibody specific for a target protein can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed on one or more expression vectors. These can then be transfected into host cells, such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells, that do not otherwise produce immunoglobulin proteins, to obtain the synthesis of the monoclonal antibody by the recombinant host cells. See, e.g., PCT Publication No. WO 87 / 04462. The DNA can then be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains for the homologous murine sequences of Morrison et al., (1984) Proc. Nat. Acad. Sci. 81:6851, or by covalently joining all or part of the coding sequence for a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. In that manner, genetically engineered antibodies, such as "chimeric" or "hybrid" antibodies, with the binding specificity of a target protein can be prepared.

[0300] Techniques developed for the production of "chimeric antibodies" are well known in the art. See, e.g., Morrison et al. (1984) Proc. Natl. Acad. Sci. USA 81, 6851; Neuberger et al. (1984) Nature 312, 604; and Takeda et al. (1984) Nature 314:452.

[0301] Methods for constructing humanized antibodies are also well known in the art. See, for example, Queen et al., Proc. Natl. Acad. Sci. USA, 86:10029-10033 (1989). In one example, the VH and VL variable regions of a parent non-human antibody are subjected to three-dimensional molecular modeling analysis according to methods known in the art. Then, framework amino acid residues predicted to be important for the formation of correct CDR structures are identified using the same molecular modeling analysis. In parallel, human VH and VL chains with amino acid sequences homologous to those of the parent non-human antibody are identified from any antibody gene database using the parent VH and VL sequences as search queries. Then, human VH and VL acceptor genes are selected.

[0302] The CDR regions in the selected human acceptor gene can be replaced by CDR regions from the parent non-human antibody or a functional variant thereof. When necessary, residues in the framework regions of the parent chain predicted to be important for interacting with the CDR regions (see above) can be used to replace the corresponding residues on the human acceptor gene.

[0303] Single-chain antibodies can be prepared by recombinant technology by linking a nucleotide sequence encoding a heavy-chain variable region and a nucleotide sequence encoding a light-chain variable region. Preferably, a flexible linker is incorporated between the two variable regions. Alternatively, techniques described for the production of single-chain antibodies (U.S. Patent Nos. 4,946,778 and 4,704,692) can be adapted to generate phage or yeast scFv libraries, and scFv clones specific for lineage-specific proteins can be identified from the libraries using routine procedures. Positive clones can be subjected to further screening to identify those that bind to the lineage-specific protein.

[0304] In some instances, a cytotoxic agent for use in the methods described herein comprises an antigen-binding fragment targeting the lineage-specific protein CD33. In other instances, a cytotoxic agent for use in the methods described herein comprises an antigen-binding fragment targeting the lineage-specific protein CD19. In other instances, two or more cytotoxic agents are used in the methods described herein. In some embodiments, two or more cytotoxic agents are administered simultaneously. In some embodiments, two or more cytotoxic agents are administered sequentially. In one non-limiting example, antibodies and antigen-binding fragments that target CD33 and CD19 in combination are used in the methods described herein. In one non-limiting example, antibodies and antigen-binding fragments that target CD33 are used in combination with a cytotoxic agent (e.g., an antibody, an immune cell expressing a chimeric antigen receptor, or an antibody-drug conjugate) that targets a second lineage-specific cell surface antigen or an additional cell surface protein. In one non-limiting example, antibodies and antigen-binding fragments that target CD19 are used in combination with cytotoxic agents (e.g., antibodies, immune cells expressing chimeric antigen receptors, antibody-drug conjugates) that target a second lineage-specific cell surface antigen or additional cell surface proteins.

[0305] In some embodiments, bispecific or multispecific antibodies can be used to target more than one epitope (e.g., more than one epitope of a lineage-specific cell surface antigen, more than one epitope of a lineage-specific cell surface antigen, an epitope of a lineage-specific cell surface antigen, and an epitope of an additional cell surface antigen). See, e.g., Hoseini et al. Blood Cancer Journal (2017) 7, e552. Non-limiting examples of bispecific antibodies include tandem bi-scFv (e.g., single-chain bispecific tandem fragment variable (scBsTaFv)), bispecific T cell engager (BiTE), bispecific single-chain Fv (bsscFv), bispecific killer cell engager (BiKE), dual affinity retargeting (DART), diabody, tandem diabody (TandAb), single-chain Fv triple body (sctb), bispecific scFv immunofusion (Blf), Fabsc, dual variable domain immunoglobulin (DVD-Ig), CrossMab (CH1-CL), modular bispecific antibody (IgG-scFv). See, e.g., Marin-Acevedo et al. J. Hematol. Oncol. (2018) 11: 8; Slaney et al. Cancer Discovery (2018) 8(8): 924-934, and Elgundi et al. Advanced Drug Discovery Reviews (2017) 122: 2-19.

[0306] In some embodiments, the antibody is a bispecific T cell engager (BiTE) comprising two linked scFv molecules. In some embodiments, at least one of the linked scFvs of the BiTE binds to an epitope of a lineage-specific cell surface protein (e.g., CD33 or CD19). In one example, the BiTE is blinatumomab. See, e.g., Slaney et al. Cancer Discovery (2018) 8(8): 924-934.

[0307] For example, antibodies that target both CD33 and CD19 can be used in the methods described herein. Antibodies and antigen-binding fragments that target CD33 or CD19, or a combination thereof, can be prepared by routine practice. Non-limiting examples of antigen-binding fragments that target CD19 can be found in Porter DL et al. NEJM (2011) 365:725-33 and Kalos M et al. Sci Transl Med. (2011) 3:95ra73. See also the description herein. Such antigen-binding fragments that target CD19 can be used to create the CAR constructs described herein.

[0308] In some embodiments, bispecific antibodies can be used in which one molecule targets an epitope of a lineage-specific cell surface protein on a target cell and the other molecule targets a surface antigen on an effector cell (e.g., T cell, NK cell), allowing the target cell to be brought into proximity with the effector cell. See, e.g., Hoseini et al. Blood Cancer Journal (2017) 7, e552.

[0309] In some embodiments, two or more (e.g., 2, 3, 4, 5, or more) epitopes of a lineage-specific cell surface protein are engineered, allowing two or more (e.g., 2, 3, 4, 5, or more) different cytotoxic agents (e.g., two antibodies) to be targeted to the two or more epitopes. In some embodiments, antibodies may act synergistically to improve efficacy. In some embodiments, two or more (e.g., 2, 3, 4, 5, or more) epitopes of a lineage-specific cell surface protein are engineered, allowing two or more (e.g., 2, 3, 4, 5, or more) different cytotoxic agents (e.g., two antibodies) to be targeted to the two or more epitopes of a lineage-specific cell surface protein. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or more) epitopes of the lineage-specific cell surface protein are altered, and one or more (e.g., 1, 2, 3, 4, 5, or more) epitopes of the additional cell surface protein are altered, allowing two or more (e.g., 2, 3, 4, 5, or more) different cytotoxic agents (e.g., two antibodies) to be targeted to the lineage-specific cell surface protein epitope and the additional cell surface protein epitope. In some embodiments, targeting two or more lineage-specific cell surface proteins can reduce recurrence of hematopoietic malignancies.

[0310] In some embodiments, the methods described herein involve administering a cytotoxic agent that targets an epitope of a lineage-specific cell surface antigen that is mutated in the genetically engineered population of hematopoietic cells. In some embodiments, the methods described herein involve administering a cytotoxic agent that targets an epitope of a lineage-specific cell surface antigen that is mutated in the genetically engineered population of hematopoietic cells and one or more additional cytotoxic agents that target one or more additional cell surface proteins. In some embodiments, antibodies act synergistically to improve efficacy by targeting more than one cell surface protein.

[0311] In some embodiments, the methods described herein involve administering to a subject a population of genetically engineered cells lacking nonessential epitopes on lineage-specific cell surface antigens and one or more immunotherapeutic agents (e.g., antibodies) that target cells expressing the lineage-specific cell surface antigen. In some embodiments, the methods described herein involve administering to a subject a population of genetically engineered cells lacking nonessential epitopes on type 1 lineage-specific cell surface antigens and one or more immunotherapeutic agents (e.g., antibodies) that target cells expressing the lineage-specific cell surface antigen. In some embodiments, the methods described herein involve administering to a subject a population of genetically engineered cells lacking nonessential epitopes on type 2 lineage-specific cell surface antigens and one or more immunotherapeutic agents (e.g., antibodies) that target cells expressing the lineage-specific cell surface antigen. In any one of the embodiments described herein, for example, if the hematopoietic malignancy recurs, one or more additional immunotherapeutic agents may be further administered to the subject (e.g., targeting one or more additional epitopes and / or antigens).

[0312] In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells lacking a non-essential epitope of CD33 and one or more antibodies that target cells expressing CD33. In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells lacking an epitope on exon 2 or exon 3 of CD33 and one or more antibodies that target cells expressing CD33. In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells expressing a mutated CD33 comprising the amino acid sequence of SEQ ID NO: 56 or SEQ ID NO: 58 and one or more antibodies that target cells expressing CD33.

[0313] In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells lacking a non-essential epitope of CD19 and one or more antibodies that target cells expressing CD19. In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells lacking an epitope on exon 2 or exon 4 of CD19 and one or more antibodies that target cells expressing CD19. In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells expressing a mutated CD19 comprising the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:73 and one or more antibodies that target cells expressing CD19.

[0314] (ii) Immune cells expressing chimeric antigen receptors In some embodiments, the cytotoxic agent targeting an epitope of a lineage-specific cell surface antigen as described herein is an immune cell expressing a chimeric receptor, which comprises an antigen-binding fragment (e.g., a single-chain antibody) capable of binding to an epitope of a lineage-specific protein (e.g., CD33 or CD19). Recognition of a target cell (e.g., a cancer cell) bearing an epitope of the lineage-specific protein on its cell surface by the antigen-binding fragment of the chimeric receptor transmits an activation signal to the signaling domain(s) (e.g., costimulatory signaling domain and / or cytoplasmic signaling domain) of the chimeric receptor. This can activate the effector function of the immune cell expressing the chimeric receptor. In some embodiments, the immune cell expresses more than one chimeric receptor (e.g., 2, 3, 4, 5, or more) and is referred to as a bispecific or multispecific immune cell. In some embodiments, the immune cell expresses more than one chimeric receptor, at least one of which targets an epitope of a lineage-specific cell surface antigen. In some embodiments, immune cells express more than one chimeric receptor, each of which targets an epitope on a lineage-specific cell surface antigen. In some embodiments, immune cells express more than one chimeric receptor, at least one of which targets an epitope on a lineage-specific cell surface antigen and at least one of which targets an epitope on an additional cell surface antigen. In some embodiments, targeting more than one lineage-specific cell surface protein or one lineage-specific cell surface protein and one or more additional cell surface proteins can reduce the recurrence of hematopoietic malignancies. In some embodiments, immune cells express chimeric receptors that target more than one epitope (e.g., more than one epitope on a single antigen, or epitopes on more than one antigen), referred to as bispecific chimeric receptors.

[0315] In some embodiments, epitopes of two or more lineage-specific cell surface proteins are targeted by a cytotoxic agent. In some embodiments, two or more chimeric receptors, e.g., bispecific chimeric receptors, are expressed by the same immune cell. Such cells can be used in any of the methods described herein. In some embodiments, cells expressing chimeric receptors are "pooled," i.e., two or more groups of cells express two or more different chimeric receptors. In some embodiments, two or more cells expressing different chimeric antigen receptors are administered simultaneously. In some embodiments, two or more cells expressing different chimeric antigen receptors are administered sequentially. In some embodiments, epitopes of CD33 and CD19 are targeted by a cytotoxic agent. In some embodiments, chimeric receptors expressing CD33 and CD19 are expressed by the same immune cell (i.e., bispecific immune cells). Such cells can be used in any of the methods described herein. In some embodiments, the "pooled" cells expressing chimeric receptors targeting CD33 and CD19, i.e., the two or more groups of cells, express two or more different chimeric receptors. In some embodiments, the two or more groups of cells expressing chimeric receptors targeting CD33 and CD19 are administered simultaneously. In some embodiments, the two or more groups of cells expressing chimeric receptors targeting CD33 and CD19 are administered sequentially.

[0316] As used herein, a chimeric receptor refers to a non-naturally occurring molecule that can be expressed on the surface of a host cell and contains a binding domain (e.g., an antigen-binding fragment that binds to an epitope of a lineage-specific cell surface protein) that provides the specificity of the chimeric receptor. Generally, a chimeric receptor contains at least two domains derived from different molecules. In addition to the epitope-binding fragment described herein, a chimeric receptor can further contain one or more of the following: a hinge domain, a transmembrane domain, a costimulatory domain, a cytoplasmic signaling domain, and combinations thereof. In some embodiments, a chimeric receptor contains, from N-terminus to C-terminus, an antigen-binding fragment that binds to a lineage-specific cell surface protein, a hinge domain, a transmembrane domain, and a cytoplasmic signaling domain. In some embodiments, a chimeric receptor further contains at least one costimulatory domain. See, e.g., Marin-Acevedo et al. J. Hematol. Oncol. (2018) 11: 8.

[0317] Alternatively or additionally, the chimeric receptor can be a switchable chimeric receptor. See, e.g., Rodger et al. PNAS (2016) 113: 459-468; Cao et al. Angew. Chem. Int. Ed. (2016) 55: 7520-7524. Generally, the switchable chimeric receptor comprises a binding domain that binds to a soluble antigen-binding fragment, which has antigen-binding specificity and can be administered in association with immune cells.

[0318] In some embodiments, the chimeric receptor can be a masked chimeric receptor, which is maintained in an "off" state until immune cells expressing the chimeric receptor are localized to a desired location within a subject. For example, the binding domain (e.g., antigen-binding fragment) of the chimeric receptor can be blocked by an inhibitory peptide that is cleaved by a protease present at the desired location within a subject.

[0319] In some embodiments, it may be advantageous to adjust the binding affinity of a binding domain (e.g., an antigen-binding fragment). For example, in some cases, relapse of hematopoietic malignancies may result from reduced expression of the target antigen on the surface of target cells (e.g., antigen escape), and lower levels of antigen may be ineffective or less effective at stimulating cytotoxicity of target cells. See, e.g., Majzner et al. Cancer Discovery (2018) 8(10). In some embodiments, the binding affinity of a binding domain (e.g., an antigen-binding fragment) may be improved, for example, by mutating one or more amino acid residues in the binding domain. A binding domain with improved binding affinity for an antigen may result in immune cells responding to lower levels of antigen (lower antigen density), reducing or preventing relapse.

[0320] In some embodiments, the chimeric receptors described herein comprise one or more hinge domain(s). In some embodiments, the hinge domain can be located between the antigen-binding fragment and the transmembrane domain. A hinge domain is an amino acid segment typically found between two domains of a protein, which can allow flexibility of the protein and movement of one or both domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the antigen-binding fragment relative to another domain of the chimeric receptor can be used. The hinge domain can contain approximately 10 to 200 amino acids, e.g., 15 to 150 amino acids, 20 to 100 amino acids, or 30 to 60 amino acids. In some embodiments, the hinge domain can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acids in length.

[0321] In some embodiments, the hinge domain is the hinge domain of a naturally occurring protein. Any protein hinge domain known in the art containing a hinge domain is suitable for use in the chimeric receptors described herein. In some embodiments, the hinge domain is at least a portion of the hinge domain of a naturally occurring protein, conferring flexibility to the chimeric receptor. In some embodiments, the hinge domain is CD8α or CD28. In some embodiments, the hinge domain is a portion of the hinge domain of CD8α, e.g., a fragment containing at least 15 (e.g., 20, 25, 30, 35, or 40) consecutive amino acids of the hinge domain of CD8α or CD28.

[0322] Hinge domains of antibodies, such as IgG, IgA, IgM, IgE, or IgD antibodies, are also suitable for use in the chimeric receptors described herein. In some embodiments, the hinge domain is a hinge domain connecting the antibody constant domains CH1 and CH2. In some embodiments, the hinge domain is from an antibody and comprises the antibody hinge domain and one or more antibody constant regions. In some embodiments, the hinge domain comprises the antibody hinge domain and the antibody CH3 constant region. In some embodiments, the hinge domain comprises the antibody hinge domain and the antibody CH2 and CH3 constant regions. In some embodiments, the antibody is an IgG, IgA, IgM, IgE, or IgD antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. In some embodiments, the hinge region comprises the hinge region and the CH2 and CH3 constant regions of an IgG1 antibody. In some embodiments, the hinge region comprises the hinge region and CH3 constant region of an IgG1 antibody.

[0323] Chimeric receptors comprising hinge domains that are non-naturally occurring peptides are also within the scope of the present disclosure. In some embodiments, the hinge domain between the C-terminus of the extracellular ligand binding domain and the N-terminus of the transmembrane domain of an Fc receptor is linked by a peptide linker, e.g., (Gly x Ser)n linker, wherein x and n can independently be integers between 3 and 12, including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more.

[0324] Additional peptide linkers that can be used in the hinge domains of the chimeric receptors described herein are known in the art (see, e.g., Wriggers et al. Current Trends in Peptide Science (2005) 80(6): 736-746 and PCT Publication WO2012 / 088461).

[0325] In some embodiments, the chimeric receptors described herein can contain one or more transmembrane domain(s). Transmembrane domains for use in chimeric receptors can be in any form known in the art. As used herein, "transmembrane domain" refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane. Transmembrane domains suitable for use in the chimeric receptors used herein can be obtained from naturally occurring proteins. Alternatively, the transmembrane domain can be a synthetic, non-naturally occurring protein segment, e.g., a hydrophobic protein segment that is thermodynamically stable in a cell membrane.

[0326] Transmembrane domains are classified based on their transmembrane domain topology, which includes the number of times the transmembrane domain spans the membrane and the orientation of the protein. For example, a single-pass membrane protein traverses the cell membrane once, while a multi-pass membrane protein traverses the cell membrane at least twice (e.g., 2, 3, 4, 5, 6, 7, or more times). In some embodiments, the transmembrane domain is a single-pass transmembrane domain. In some embodiments, the transmembrane domain is a single-pass transmembrane domain that positions the N-terminus of the chimeric receptor on the extracellular side of the cell and the C-terminus of the chimeric receptor on the intracellular side of the cell. In some embodiments, the transmembrane domain is obtained from a single-pass transmembrane protein. In some embodiments, the transmembrane domain is from CD8α. In some embodiments, the transmembrane domain is from CD28. In some embodiments, the transmembrane domain is from ICOS.

[0327] In some embodiments, the chimeric receptors described herein comprise one or more costimulatory signaling domains. As used herein, the term "costimulatory signaling domain" refers to at least a portion of a protein that mediates intracellular signaling to induce an immune response, such as an effector function. The costimulatory signaling domain of the chimeric receptors described herein can be a cytoplasmic signaling domain from a costimulatory protein that transmits a signal to modulate responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils.

[0328] In some embodiments, a chimeric receptor comprises more than one (at least 2, 3, 4, or more) costimulatory signaling domain. In some embodiments, a chimeric receptor comprises more than one costimulatory signaling domain obtained from different costimulatory proteins. In some embodiments, a chimeric receptor does not comprise a costimulatory signaling domain.

[0329] Generally, many immune cells require costimulatory signals in addition to antigen-specific stimulation to promote cell proliferation, differentiation, and survival, as well as to activate cellular effector functions. Activation of a costimulatory signaling domain in a host cell (e.g., an immune cell) can induce the cell to increase or decrease cytokine production and secretion, phagocytic properties, proliferation, differentiation, survival, and / or cytotoxicity. The costimulatory signaling domain of any costimulatory protein may be suitable for use in the chimeric receptors described herein. The type(s) of costimulatory signaling domain(s) may be selected based on factors such as the type of immune cell in which the chimeric receptor will be expressed (e.g., primary T cells, T cell lines, NK cell lines) and the desired immune effector function (e.g., cytotoxicity). Examples of costimulatory signaling domains for use in chimeric receptors may be the cytoplasmic signaling domains of costimulatory proteins, including, without limitation, CD27, CD28, 4-1BB, OX40, CD30, ICOS, CD2, CD7, LIGHT, NKG2C, and B7-H3. In some embodiments, the costimulatory domain is derived from 4-1BB, CD28, or ICOS. In some embodiments, the costimulatory domain is derived from CD28 and the chimeric receptor comprises a second costimulatory domain from 4-1BB or ICOS.

[0330] In some embodiments, the costimulatory domain is a fusion domain comprising more than one costimulatory domain or portions of more than one costimulatory domain, hi some embodiments, the costimulatory domain is a fusion of the costimulatory domains from CD28 and ICOS.

[0331] In some embodiments, the chimeric receptors described herein comprise one or more cytoplasmic signaling domain(s). Any cytoplasmic signaling domain can be used in the chimeric receptors described herein. Generally, the cytoplasmic signaling ...

Claims

1. (i) a first population of genetically engineered hematopoietic cells that have a gene edit in a first gene encoding a first lineage-specific cell surface antigen, wherein the first population of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the first lineage-specific cell surface antigen, or (b) express a variant of the first lineage-specific cell surface antigen; (ii) a second population of genetically engineered hematopoietic cells that have a gene edit in a second gene encoding a second lineage-specific cell surface antigen, wherein the second population of genetically engineered hematopoietic cells (a) have reduced or eliminated expression of the second lineage-specific cell surface antigen, or (b) express a variant of the second lineage-specific cell surface antigen. Including, the first population of genetically engineered hematopoietic cells overlaps with the second population of genetically engineered hematopoietic cells; The first and second lineage-specific cell surface antigens are: (i) CD19 and CD33; (ii) CD33 and CD123; and (iii) selected from the group consisting of CD33 and CLL-1; A genetically engineered population of hematopoietic cells.

2. One or more cells of the population: (i) have reduced or ablated expression of a first lineage-specific cell surface antigen relative to a wild-type counterpart cell, or express a variant of the first lineage-specific cell surface antigen, the first lineage-specific cell surface antigen being expressed in the subject's primary cancer; and (ii) have reduced or ablated expression of a second lineage-specific cell surface antigen relative to a wild-type counterpart cell, or express a mutant version of the second lineage-specific cell surface antigen, wherein the second lineage-specific cell surface antigen is expressed in the subject's recurrent cancer; A genetically engineered population of hematopoietic cells.

3. 3. The population of genetically engineered hematopoietic cells of claim 2, wherein the first lineage-specific cell surface antigen is CD19 and the second lineage-specific cell surface antigen is CD33.

4. One or more cells of the population: (i) have reduced or ablated expression of a first lineage-specific cell surface antigen relative to a wild-type counterpart cell, or express a mutant version of the first lineage-specific cell surface antigen, the first lineage-specific cell surface antigen being expressed in a first subpopulation of cancer cells of the subject; and (ii) have reduced or ablated expression of a second lineage-specific cell surface antigen relative to a wild-type counterpart cell, or express a mutant version of the second lineage-specific cell surface antigen, wherein the second lineage-specific cell surface antigen is expressed in a second subpopulation of the subject's cancer cells; A genetically engineered population of hematopoietic cells.

5. 5. The genetically engineered population of hematopoietic cells of claim 4, wherein the first lineage-specific cell surface antigen is CD33 and the second lineage-specific cell surface antigen is CD123 or CLL-1.

6. 6. The population of genetically engineered hematopoietic cells of any one of claims 1-5, wherein at least 40% of the copies of the gene encoding a first lineage-specific cell surface antigen have a gene edit and at least 40% of the copies of the gene encoding a second lineage-specific cell surface antigen have a gene edit.

7. 7. The population of genetically engineered hematopoietic cells of any one of claims 1 to 6, wherein the surface level of the first lineage-specific cell surface antigen in the population is less than 40% of the surface level of the first lineage-specific cell surface antigen in a wild-type counterpart cell.

8. 8. The population of genetically engineered hematopoietic cells of any one of claims 1 to 7, wherein the surface level of the second lineage-specific cell surface antigen in the population is less than 40% of the surface level of the second lineage-specific cell surface antigen in a wild-type counterpart cell.

9. 9. The population of genetically engineered hematopoietic cells of any one of claims 1 to 8, wherein the gene edit of the gene encoding the first lineage-specific cell surface antigen comprises a frameshift mutation, and the gene edit of the second gene comprises a frameshift mutation.

10. 10. The population of genetically engineered hematopoietic cells of any one of claims 1 to 9, which is capable of growing at least two-fold in culture over a period of 8 days.

11. 11. The population of genetically engineered hematopoietic cells of any one of claims 1 to 10, wherein the surface level of the second lineage-specific cell surface antigen in the population is less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1% of the surface level of the second lineage-specific cell surface antigen in a wild-type counterpart cell.

12. A population of genetically engineered hematopoietic cells according to any one of claims 1 to 11, which is capable of engraftment.

13. 13. The genetically engineered population of hematopoietic cells of any one of claims 1 to 12, wherein the hematopoietic cells are hematopoietic stem cells (HSCs).

14. 14. The genetically engineered population of hematopoietic cells of any one of claims 1 to 13, wherein the CD33 pseudogene is unaltered in one or more (e.g., at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% or all) of the cells of the population.

15. (a) providing a population of genetically engineered hematopoietic cells according to any one of claims 1 to 14; and (b) administering to a subject the population of genetically engineered hematopoietic cells; Including, thereby providing hematopoietic cells to the subject, A method of providing hematopoietic cells to a subject (eg, a subject having a hematopoietic malignancy).

16. Administering a population of genetically engineered hematopoietic cells according to any one of claims 1 to 14 to a subject in need thereof; administering to the subject an effective amount of a first immunotherapeutic agent that targets a first lineage-specific cell surface antigen; and administering to the subject an effective amount of a second immunotherapeutic agent that targets a second lineage-specific cell surface antigen.

23. A method for treating a hematopoietic malignancy comprising:

17. 17. The method of claim 16, wherein a first immunotherapeutic agent is administered when the subject has a primary cancer and a second immunotherapeutic agent is administered when the subject has a recurrent cancer or a cancer that is resistant to the first immunotherapeutic agent.

18. 17. The method of claim 16, wherein the subject has a cancer comprising a first subpopulation of cancer cells that express a first lineage-specific cell surface antigen and a second subpopulation of cancer cells that express a second lineage-specific cell surface antigen.

19. The method of claim 18, wherein the first lineage-specific cell surface antigen is CD33 and the second lineage-specific cell surface antigen is CD123 or CLL-1.

Images