Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Abstract

To provide: an siRNA which inhibits proprotein convertase subtilisin / kexin type 9 (PCSK9) gene expression; a pharmaceutical composition containing the siRNA; and a conjugate.SOLUTION: Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The siRNA contains a sense strand and an antisense strand. The sense strand contains a nucleotide sequence I, the nucleotide sequence I having the same length as a specific nucleotide sequence 1, with three or less nucleotide differences. The antisense strand contains a nucleotide sequence II, the nucleotide sequence II having the same length as another specific nucleotide sequence 2, with three or less nucleotide differences. The siRNA, pharmaceutical composition thereof and the conjugate can effectively treat and / or prevent hypercholesterolemia.SELECTED DRAWING: Figure 3

Description

[Technical field]

[0001] The present disclosure relates to the proprotein convertase subtilisin / kexin type 9 (PCSK9) gene. The present disclosure further relates to nucleic acids, pharmaceutical compositions and siRNA complexes capable of suppressing expression. The present invention relates to methods for preparing and using said nucleic acids, pharmaceutical compositions and siRNA complexes. [Background technology]

[0002] Lipid abnormalities, especially high levels of low-density lipoprotein cholesterol (LDL-c), persist is an important risk factor that induces and promotes the development and progression of atherosclerosis, It is closely related to ischemic cardiovascular and cerebrovascular diseases and poses a serious threat to human health. The main therapeutic drugs are statins, cholesterol absorption inhibitors, resins, probucol, and fulveolar. These include the dibrates and nicotinic acid and its derivatives. By lowering the serum levels, the risk of developing cardiovascular and cerebrovascular diseases can be reduced. A significant proportion of patients do not achieve ideal lipid levels.

[0003] Research has shown that the proprotein convertase subtilisin / kexin type 9 (PCSK9) gene It has been revealed that the gene plays an important role in lipid metabolism, especially cholesterol metabolism. By suppressing PCSK9 gene expression, plasma cholesterol levels can be reduced. Small interfering RNA (SMAR) can effectively reduce ng RNA, siRNA) is RNA interference (RNA interference, RN Based on the mechanism of action of ribosomal expression (RI), the expression of any gene of interest can be suppressed in a sequence-specific manner. The purpose of treating the disease can be achieved by inhibiting or blocking PCSK at the mRNA level. Suppressing gene expression is undoubtedly the most ideal therapeutic approach.

[0004] Development of siRNA drugs that suppress PCSK9 gene expression and treat hypercholesterolemia In the development of these drugs, appropriate siRNA and its modifications, as well as effective delivery systems, are key technologies. Summary of the Invention [Problem to be solved by the invention]

[0005] The inventors of the present disclosure have discovered that the following siRNA complexes are provided by the present disclosure: By using this compound, PCSK9 gene expression is specifically suppressed, and the liver is specifically targeted, resulting in liver It is possible to suppress the expression of the PCSK9 gene and realize the treatment or prevention of hypercholesterolemia. The inventors have also unexpectedly found that highly active siRNA and drug compositions Invented the [Means for solving the problem]

[0006] In some embodiments, the present disclosure provides an siR having a structure shown in formula (308): Provide the NA complex.

[0007] [ka] In the formula, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. m1, m2, or m3 is independently an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H or C1 -C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10 Alkoxy group is selected from the group consisting of R3 is a group having the structure shown in formula A59.

[0008] [ka] In the formula, E1 is OH, SH or BH2; Nu is an siRNA, the siRNA comprising a sense strand and an antisense strand, Each nucleotide of an iRNA is independently a modified or unmodified nucleotide. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially reversed. The nucleotide sequence I and the nucleotide sequence II are complementary to each other to form a double-stranded region. One selected from the following i) to vi): i) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length. and the nucleotide difference is three or less, and is shown in nucleotide sequence II and SEQ ID NO:2. The nucleotide sequences to be compared are of equal length and have no more than three nucleotide differences; 5'-AAGCAAGCAGACAUUUAUZ1-3' (SEQ ID NO: 1), 5'-Z2AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2) wherein Z1 is C and Z2 is G, and in said nucleotide sequence I, position Z1 is The corresponding nucleotide Z3 is included in the nucleotide sequence II, and the position of Z2 is included in the nucleotide sequence II. and Z4 is the first nucleotide at the 5' end of the antisense strand. It is a nucleotide, ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:6 is 3 or less. The nucleotide sequence shown in 2 is the same length and has no more than three nucleotide differences. , 5'-UUUGUAGCAUUUUUAUUAZ5-3' (SEQ ID NO:61), 5'-Z6UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:62) wherein Z5 is A and Z6 is U; and in said nucleotide sequence I, position Z5 is The corresponding nucleotide Z7 is included in the nucleotide sequence II, which corresponds to Z6 in position II. the antisense strand includes a nucleotide Z8 which is the first nucleotide at the 5' end of the antisense strand; It is a nucleotide, iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 122 is the same in length and differs by no more than three nucleotides. and 5'-GCCUGGAGUUUAUUCGGAZ9-3' (SEQ ID NO: 121), 5'-Z 10 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122) However, Z9 is A and Z 10 is U, and in said nucleotide sequence I, position Z9 Nucleotide Z corresponding to 11 and in said nucleotide sequence II, position Z 10 To The corresponding nucleotide Z 12 wherein Z 12 is the 5' end of the antisense strand It is the first nucleotide, iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 have a length and the nucleotide sequence II and the sequence of SEQ ID NO: The nucleotide sequence shown in 182 is the same length and has no more than three nucleotide differences. can be, 5'-CUGUUUUGCUUUUGUAACZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z 13 is U and Z 14 is A, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 4 16 wherein Z 16 is the 5' end of the antisense strand It is the first nucleotide at the end v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:2 is 3 or less. The nucleotide sequence shown in 42 is the same length and has no more than three nucleotide differences. the law of nature, 5'-GGUUUUGUAGCAUUUUUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 8 20 wherein Z 20 is the 5' end of the antisense strand It is the first nucleotide at the end vi) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have the same length and the nucleotide sequence II and the sequence of SEQ ID NO: The nucleotide sequence shown in 302 is the same length and has no more than three nucleotide differences. can be, 5'-GUGACUUUUUAAAAUAAAZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z 21 is A and Z 22 is U, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 and in said nucleotide sequence II, position Z2 Nucleotide Z corresponding to 2 24 wherein Z 24 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0009] R2 is a linear alkylene group having a length of 1 to 20 carbon atoms, Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenile group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterosi Crylene group and C5-C 10 one or more selected from the group consisting of heteroarylene groups; Optionally substituted, R2 is C1-C 10 Alkyl groups, C6-C 10Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1- C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen Substituents: -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1 -C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1 -C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 Alkyl group ), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C (O)(C1-C 10 alkyl group), -N(C1-C 10 Alkyl group)C(O)(phenyl ), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl Group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, - SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH(phenyl group), -NHSO2(C1-C 10 Alkyl group), -NHSO2 (phenyl group) and -NHSO2(C1-C 10 (halogenated alkyl group) may optionally have one or more substituents, Each L1 is independently a straight chain alkylene group of 1 to 70 carbon atoms in length, or multiple carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C1 8 Heterocyclylene groups and C5-C 10 Heteroarylene groups are each selected from the group consisting of or more optionally substituted, L1 being C1-C 10 Alkyl groups, C6-C 10 Aryl Group , C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C1 0 alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C1 0 alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10Halogenated A alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH 2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C1 0 alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -COH, -C(O )O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O) (C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Al Kill group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 Alkyl group)C(O ) (phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alki phenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Al Kill group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C 1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 Al -NHSO2(C1-C6) 10 alkyl group), - NHSO2(phenyl group) and -NHSO2(C1-C 10 (halogenated alkyl group) and optionally having one or more substituents selected from the group consisting of JPEG2025038090000004.jpg6170 represents the site to which the group is covalently attached and M1 represents the targeting group.

[0010] In some embodiments, the present disclosure provides siRNA capable of suppressing PCSK9 gene expression. The siRNA comprises a sense strand and an antisense strand, Each nucleotide in the antisense strand can be independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide. the sense strand comprises nucleotide sequence I; the anti- The sense strand comprises nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence Array II refers to a double-stranded region formed in at least a portion in a reverse-complementary manner, and the fluoro-modified nucleotides The nucleotides are located at nucleotide sequence I and nucleotide sequence II, and are located from the 5' end to the 3' end. In the sense strand, nucleotides at positions 7, 8, and 9 of nucleotide sequence I are the nucleotides at the remaining positions in the sense strand are fluoro-modified nucleotides, the nucleotides are non-fluoro-modified nucleotides, and the nucleotides are In the sense strand, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are the nucleotides at the remaining positions in the antisense strand are fluoro-modified nucleotides; nucleotide sequence I and nucleotide sequence II are non-fluoro modified nucleotides, The sequence II is one selected from the above i) to vi).

[0011] In some embodiments, the present disclosure provides a method for the preparation of a siRNA of the present disclosure and a pharma- ceutically acceptable A pharmaceutical composition is provided that includes a carrier.

[0012] In some embodiments, the present disclosure relates to siRNAs and the siRNAs provided by the present disclosure. A siRNA complex is provided that includes a conjugated group that is conjugated and bound to the siRNA.

[0013] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or the siRNA complex for treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene. The present invention provides a method for the preparation of a medicament for treatment and / or prophylaxis.

[0014] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or administering to a subject in need thereof an effective amount of the siRNA complex. The present invention provides a method for treating and / or preventing a disease or physiological condition caused by abnormal expression of the PCSK9 gene. do.

[0015] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or contacting an effective amount of the siRNA complex with the hepatocyte. The present invention provides a method for inhibiting the expression of the PCSK9 gene in a patient suffering from osteoporosis.

[0016] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or a kit comprising the siRNA complex. Effect of the Invention

[0017] The siRNA, drug composition and siRNA complex provided by the present disclosure have excellent stability. It has high PCSK9 mRNA suppression activity and reduced off-target effects and toxicity. and / or diseases or physiological conditions caused by abnormal expression of the PCSK9 gene, such as hypercholesterolemia, Teratemia can be significantly treated or prevented.

[0018] In some embodiments, the siRNA, drug composition or s The iRNA complexes show excellent target mRNA suppression activity in in vitro cell experiments. In the form, the siRNA, drug composition, or siRNA complex provided by the present disclosure , at least 20%, 30%, 40%, 50%, 60%, 70%, 80% in hepatocytes , 90% or 95% target mRNA inhibition rates are shown.

[0019] In some embodiments, the siRNA, drug composition or s The iRNA complex may have greater stability and / or greater activity in the body. In some embodiments, the siRNA, drug composition or The siRNA complexes were found to be at least 20%, 30%, 40%, 50%, 60%, or 70% responsive to the In some embodiments, the target gene expression suppression rate is 0%, 80%, 90% or 95%. In the present disclosure, the siRNA, drug composition, or siRNA complex is At least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 9 In some embodiments, the present disclosure provides a method for inhibiting PCSK9 gene expression by administering a therapeutically effective amount of the ... The provided siRNA, drug composition or siRNA complex is capable of infecting at least 20% of the body, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% intrahepatic PCSK9 In some embodiments, the siR provided by the present disclosure The NA, drug composition or siRNA complex is administered to the body at least 20%, 30%, 40%, Intrahepatic PCSK in 50%, 60%, 70%, 80%, 90% or 95% of animal models In some embodiments, the si provided by the present disclosure The RNA, drug composition or siRNA complex is capable of absorbing at least 20%, 30%, 40% , 50%, 60%, 70%, 80%, 90% or 95% of human subjects with intrahepatic PCS In some embodiments, the s The iRNA, drug composition or siRNA complex does not show significant off-target effects An off-target effect may be, for example, the suppression of normal expression of a non-target gene. Binding / inhibition of off-target gene expression is 50% greater than on-target gene effects. At 40%, 30%, 20% or 10% lower, the off-target effects are not significant. It is considered that.

[0020] In some embodiments, the siRNA provided by the present disclosure is It showed high inhibitory activity in the K system and IC 50 But 0.0194~ In some embodiments, the siR provided by the present disclosure is 0.0561 nM. The NA complex was administered to cynomolgus monkeys by subcutaneous injection once at a dose of 9 mg / kg. , and NHP liver tissue PCSK9 mRNA on the 15th day after administration compared to the 7th day before administration. In some embodiments, the inhibition rate is as high as 56 to 81%. The iRNA complex showed a more pronounced inhibition of serum PCSK9 protein expression. On the 14th day after administration, the suppression rate of PCSK9 protein expression in serum was high at over 90%. In some embodiments, the siRNA complexes provided by the present disclosure are capable of inhibiting serum LDL-c and The levels of LDL- and CHO were significantly suppressed, especially from the 14th to 29th days after administration. The inhibition rate against c was high at over 30%, and even reached 64%. In some embodiments, the present disclosure provides The siRNA complex inhibited LDL-K+ expression in a single dose of 9 mg / kg for a long period of time (11 weeks). -c The suppression rate can be maintained at 50% or more, and the siRNA complex provided by the present disclosure The body showed no significant toxicity in either rats or mice. The siRNA complexes provided by the present invention have rapid onset, long duration, and target mRNA expression. A expression was significantly suppressed, effectively increasing the content of PCSK9 protein in serum. It has a strong inhibitory effect on serum LDL-c and CHO. , and has excellent biological safety.

[0021] Thus, the siRNAs, drug compositions and siRNA complexes provided by the present disclosure and inhibiting the expression of the PCSK9 gene, thereby preventing or treating diseases or physiological conditions caused by abnormal expression of the PCSK9 gene. The present invention has a bright prospect for application and can effectively treat and / or prevent various conditions. do. Other features and advantages of the present disclosure are described in the Detailed Description section below. Let me explain in detail. [Brief description of the drawings]

[0022] [Fig. 1A-1F] In order, dose-effect curves were fitted according to the relative residual activity of the reporter gene Renilla in the psiCHECK system after transfection with different siRNAs (siRNA 1-6). [Diagram 2]FIG. 1 shows normalized PCSK9 protein levels in serum at different time points after a single dose of 9 mg / kg of conjugates 1, 4 or 7 administered subcutaneously to cynomolgus monkeys. [Diagram 3] FIG. 1 shows normalized LDL-c levels in serum at different time points after a single dose of 9 mg / kg of conjugates 4 or 7, respectively, administered subcutaneously to cynomolgus monkeys. [Figure 4] FIG. 13. Normalized CHO levels in serum at different time points after a single dose of 9 mg / kg of conjugates 4 or 7, respectively, administered subcutaneously to cynomolgus monkeys. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] Hereinafter, the embodiments of the present disclosure will be described in detail. The detailed description is merely for the purpose of explaining or interpreting the present disclosure, and It should be understood that this is not intended to be limiting.

[0024] In this disclosure, PCSK9 mRNA is Genbank accession number NM_1749 36.3. Furthermore, unless otherwise indicated, the present disclosure The term "target gene" as used herein refers to a gene capable of transcribing the PCSK9 mRNA. The term "target mRNA" refers to the PCSK9 mRNA.

[0025] definition Unless otherwise stated in the context, the capital letters C, G, U, A, and T represent nucleotide salts. The base sequence is represented by a lowercase letter m, and the nucleotide immediately to the left of the letter m is methoxy. A lowercase letter f indicates a modified nucleotide, and the letter f indicates one nucleotide adjacent to the left of the letter f. The nucleotide is a fluoro-modified nucleotide, and the lowercase letter s indicates that the nucleotide is a fluoro-modified nucleotide. The two adjacent nucleotides on the right are linked by a thiophosphate group. P1 represents a nucleotide having a 5'-phosphate nucleotide adjacent to the right side of P1. The combination letter VP represents a 5'-phosphate analog modified nucleotide. The nucleotide adjacent to the right of the combination letter VP is a vinyl phosphate modified nucleotide. The combination letter Ps represents a leution, and the combination letter Ps represents one adjacent 1 to the right of the combination letter Ps. One nucleotide is a phosphorothioate modified nucleotide, and the capital P is The nucleotide immediately to the right of the letter P is a 5'-phosphate nucleotide. It represents:

[0026] In this context, the term "fluoro-modified nucleotide" refers to a nucleotide having a ribose group of This refers to a nucleotide in which the 2'-hydroxy group is replaced with fluorine. "Leuotide" is a nucleotide in which the 2' hydroxyl group of the ribose group is replaced with a non-fluorine group. "Nucleotide analog" refers to a nucleotide or nucleotide analog that is It can substitute for nucleotides in nucleic acids, but adenine ribonucleotides, Guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or It refers to a group whose structure is different from thymine deoxyribonucleotide, for example, isonucleotide, Bridged nucleic acid (BNA) or acyclic nucleic acid The "methoxy-modified nucleotide" is a nucleotide that has a 2'-hydroxyl group at the ribose group. It refers to a nucleotide in which the oxy group is replaced with methoxy.

[0027] In the context of this specification, the terms "complement" and "reverse complement" are used interchangeably. It may have the meaning well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, each of the bases of one strand is It means that the bases on one strand complement each other. The pyrimidine base adenine (A) always mates with the pyrimidine base thymine (T) (or In the nucleosome, uracil (U) pairs with the purine base guanine (C), which is always paired with the purine base guanine (C). It pairs with the lysine base cytosine (G). Each base pair consists of one purine and one It contains two pyrimidines: an adenine on one strand is always replaced by a thymine (or uracil) on the other strand. ) and guanine always pairs with cytosine, then both strands are complementary. It is also believed that the sequence of the strand can be deduced from the sequence of its complementary strand. In the art, the term "mismatch" refers to a situation in which bases at corresponding positions in a double-stranded nucleic acid are complementary. This means that there is no pairing of the two nuclei.

[0028] Unless otherwise specified in the context, "essentially reverse complementary" refers to the complementary structure of two related nucleotides. "Substantially reverse complementary" refers to the presence of three or fewer base mismatches between the nucleotide sequences. " refers to the presence of no more than one base mismatch between two nucleotide sequences; "Perfectly reverse complementary" means that there are no base mismatches between the two nucleotide sequences. Refers to...

[0029] In this context, one nucleotide sequence has a "nucleotide difference" with another nucleotide sequence. The presence of a "difference" means that the type of base at the same position in the former is different from that in the latter. For example, when one nucleotide base in the latter is A, the same If the corresponding nucleotide base at the same position is U, C, G, or T, Nucleotide differences between the two nucleotide sequences have been observed. In an embodiment, an abasic nucleotide or its equivalent is substituted for the nucleotide at the original position. When using the nucleotide sequence, it is considered that a nucleotide difference has occurred at that position.

[0030] In particular, in the context of the present disclosure, the method for preparing the siRNA, drug composition or siRNA complex In describing the above, unless otherwise specified, the nucleoside monomer e monomer) refers to the nucleoside in the siRNA or siRNA complex to be prepared. Depending on the type and order of phosphoramidites, modified or unmodified phosphoramidites are used in solid-phase phosphoramidite synthesis. Creoside phosphoramidite monomers (unmodified or modified d RNA phosphoramidites. RNA phosphoramid tes is sometimes called Nucleoside phosphoramidites) Phosphoramidite solid-phase synthesis is a method used for RNA synthesis known to those skilled in the art. All of the nucleoside monomers used in the present disclosure are commercially available. do.

[0031] In the context of this disclosure, unless otherwise specified, "composite" means that each has a specific function. refers to a covalent bond between two or more chemical moieties that are bonded to one another, and accordingly, A "complex" is a compound formed by covalently bonding each of the chemical moieties. Furthermore, a "siRNA complex" refers to a complex that contains one or more chemical moieties with a specific function. In the following text, the term "s" refers to a compound formed by covalently binding to an iRNA. The iRNA complex may also be referred to simply as a "complex." The siRNA complex may be A siRNA complex is a general term for multiple siRNA complexes, or a siRNA complex represented by a certain chemical formula. In the context of the present disclosure, a "composite molecule" refers to a molecule that is capable of reacting with an siRNA. and ultimately form the siRNA complex of the present disclosure. It should be understood that there is.

[0032] As used herein, "any" or "optionally" refers to the event or events described thereafter. that circumstances may or may not occur and that such statements are based on the assumption that an event or circumstance will occur. For example, "optionally substituted" "alkyl" refers to a group that may or may not occur. " includes "alkyl" and "substituted alkyl" as defined in the following sentence. With respect to any groups that contain substituents, it is important to note that these groups may be sterically impractical, synthetically impractical, or otherwise unfeasible. It is not intended to introduce any substitutions or substitution patterns that are unnecessary and / or inherently unstable. It will be understood by those skilled in the art that there is no.

[0033] As used herein, "alkyl" refers to both straight and branched chains having the specified number of carbon atoms. The specific number refers to a branched chain, and the specific number is usually 1 to 20 carbon atoms, for example, 1 to 10 carbon atoms. For example, C1-C6 alkyl is 1 to 6 Includes straight-chain and branched-chain alkyls of up to 100 carbon atoms. Refers to alkyl residues having a specific number of carbons. When used herein, it is intended to include all branched and straight chain forms having that number of carbons. Thus, for example, "butyl" includes n-butyl, sec-butyl, isobutyl and tert-butyl. -butyl, and "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl, just like alkyl, but with two points of attachment. It refers to a residue that

[0034] As used herein, "alkenyl" means an alkyl group having at least one carbon-carbon double bond. refers to an unsaturated branched or straight chain alkyl having a carbon-carbon double bond, The group is obtained by removing one hydrogen molecule from the adjacent carbon atom of the The double bonds may be in the cis or trans configuration. Exemplary alkenyls include vinyl and , prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1- propenyl, such as prop-2-en-2-yl, and but-1-en-1-yl. yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2- buta-1,3-dien-1-yl, buta-2-en-2-yl, buta-1,3-dien-1-yl, buta and butenyl, such as 1,3-dien-2-yl. In certain embodiments, alkenyl has 2 to 20 carbon atoms, while in other embodiments, Alkenylene has 2 to 10, 2 to 8, or 2 to 6 carbon atoms. A subset of alkenyl, it refers to residues similar to alkenyl, but which have two points of attachment.

[0035] As used herein, "alkynyl" means an alkynyl group having at least one carbon-carbon triple bond. The term refers to an unsaturated branched or straight chain alkyl group having a carbon-carbon triple bond, It is obtained by removing two hydrogen molecules from adjacent carbon atoms of alkyl. The alkyl groups include ethynyl, prop-1-yn-1-yl, prop-2-yn-1-yl, and prop-1-yn-1-yl. Propynyl, but-1-yn-1-yl, but-1-yn-3-yl, but- butynyl, such as 3-yn-1-yl. In certain embodiments, alkynyl has 2 to 20 carbon atoms, but in other embodiments, 2 to 1 Alkynylene is a subset of alkynyl having 0, 2 to 8, or 2 to 6 carbon atoms. and refers to a residue similar to alkynyl, but having two points of attachment.

[0036] As used herein, "alkoxy" refers to an alkyl group having a specified number of carbon atoms attached through oxygen bridges. alkyl of a carbon atom, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyl Oxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy Alkoxy is usually 1- having 10, 1-8, 1-6, or 1-4 carbon atoms bonded by oxygen bridges .

[0037] As used herein, "aryl" refers to an aromatic monocyclic or polycyclic hydrocarbon ring system. The aromatic monocyclic group is a group formed by removing a hydrogen atom from a ring carbon atom. The cyclic or polycyclic hydrocarbon ring system contains only hydrogen atoms and 6 to 18 carbon atoms. At least one of the rings in the ring system is fully unsaturated, i.e., it follows the Hückel theory Contains a cyclic, delocalized (4n+2) π-electron system. Aryl includes phenyl, fluorene, etc. Arylene is a substituted or unsubstituted aryl group. A aryl group is a subset of aryl and refers to a residue that is the same as aryl but has two points of attachment.

[0038] As used herein, a "halogen substituent" or "halo" refers to any group including fluoro, chloro, , bromo or iodo, and the term "halogen" includes fluorine, chlorine, bromine or iodine. .

[0039] As used herein, "halogenated alkyl" refers to an alkyl group having a specified number of carbon atoms. is an alkyl group as defined above, substituted with up to the maximum permitted number of halogen atoms. Examples of halogenated alkyl groups include trifluoromethyl, difluoromethyl, and , 2-fluoroethyl, or pentafluoroethyl.

[0040] The term "heterocyclic group" refers to a group having 2 to 12 carbon atoms and 1 to 2 carbon atoms selected from nitrogen, oxygen, or sulfur. It refers to a stable 3- to 18-membered non-aromatic cyclic group containing 6 heteroatoms. Unless otherwise specified, heterocyclic groups may be monocyclic, bicyclic, tricyclic or tetracyclic ring systems, fused or bridged. The heteroatoms in the heterocyclic groups may be optionally oxidized. Nitrogen atoms, if present, are optionally quaternized. Heterocyclic groups may be partially saturated or completely Heterocyclic groups can be attached to the rest of the molecule through any atom of the ring. Examples of such heterocyclic groups include dioxanyl, thiophenyl[1,3]diphenyl. Sulfonyl (thienyl[1,3]dithianyl), decahydroisoquinolinyl Imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, Morpholinyl, Octahydroindole, Octahydroisoindole, 2-Oxapipe Razinyl, 2-oxapiperidyl, 2-oxapyrrolidinyl, oxazolidinyl, piperidinyl Dysyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidyl, quinuclidinyl , thiazolidinyl, tetrahydrofuryl, trisulfonyl, tetra thihydropyranyl, thiomorpholinyl, thiamol thiamorpholinyl, 1-oxothiomorpholinyl o-thiomorpholinyl) and 1,1-dioxothiomorpholinyl (1,1 -dioxo-thiomorpholinyl).

[0041] "Heteroaryl" means an alkyl group having 2 to 17 carbon atoms and a group selected from nitrogen, oxygen, and sulfur. refers to a group derived from a 3- to 18-membered aromatic ring radical containing 1 to 6 heteroatoms. As used herein, heteroaryl refers to a monocyclic, bicyclic, tricyclic, or tetracyclic ring system. and at least one of the rings in the ring system is fully unsaturated, i.e., it is Heteroaryls include cyclic delocalized (4n+2) π-electron systems that conform to the Heteroaryl theory. includes bridged ring systems. The heteroatoms in heteroaryl are optionally oxidized. One or more The nitrogen atom (if present) is optionally quaternized. Heteroaryl is any of the heteroaryls in the ring. The atom that is attached to the rest of the molecule is azepinyl. acridinyl, benzimidazolyl, benzoindole, 1,3-benzodioxazoline aryl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl Benzo[b][1,4]dioxepinyl pinyl), benzo[b][1,4]oxazinyl azinyl), 1,4-benzodioxanyl, Benzonaphthofuranyl, benzoxazolyl, benzodioxolyl olyl), benzodioxinyl, benzopyranyl, Benzopyronyl, benzofuryl, benzofuranonyl, benzothiophenyl, benzothieno[ 3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2- a]pyridyl, carbazolyl, cinnolinyl, cyclopenta[d ]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d ]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl (5,6-dihydro benzo[h]quinazolinyl), 5,6-dihydrobenzo[h]quinazolinyl 5,6 dihydrobenzo[h]cinnolinyl, 6,7-dihydrobenzo[h]cinnolinyl Doro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuryl dibenzothiophenyl, furyl, furanonyl, furo[3,2-c]pyridyl, 5,6 ,7,8,9,10-Hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8, 9,10-Hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10- Hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazolyl Indazolyl, indole, isoindole, indolinyl, isoindolinyl nyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-Methano-5,6,7,8-tetrahydroquinazolinyl -5,6,7,8-tetrahydroquinazolinyl), naphthyridinyl (naphthyridinyl), 1,6-naphthyridinonyl (1,6-naphth yridinonyl, oxadiazolyl, 2-oxoazepinyl pinyl), oxazolyl, oxiranyl, 5,6,6a,7, 8,9,10,10a-Octahydrobenzo[H]quinazolinyl, 1-phenyl-1H- Pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl (pht halazinyl, pteridinyl, purinyl, pyrrolyl, Pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyridinyl Rimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl nyl, quinazolinyl, quinoxalinyl, quinolyl, tetra Hydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydroquinazolinyl Hydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl 5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7, 8-Tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, thiazolyl Triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno [3,2-d]pyrimidinyl, thieno[2,3-c]pyridinyl -c]pridinyl) and thiophenyl / thienyl Including, but not limited to:

[0042] A variety of hydroxy protecting groups may be used in the present disclosure. Generally, the protecting groups are , to render chemical functionalities inert to certain reaction conditions and can modify that functional group in the molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups can be added and removed by the methods described by Beaucage et al. Tetrahedron 1992,48,2223-2311, and Greene a nd Wuts,Protective Groups in Organic Syn thesis,Chapter 2,2d ed.John Wiley & Sons , New York, 1991, each of which is incorporated herein by reference in its entirety. In some embodiments, the protecting group is capable of reacting with basic conditions. In some embodiments, the present invention is stable at room temperature but can be removed under acidic conditions. Non-exclusive examples of hydroxy protecting groups that may be used herein include dimethoxytrityl (D MT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl) or 9-(p-Methoxyphenyl)xanthen-9-yl (Mox). Non-exclusive illustrative examples of hydroxy protecting groups that can be used herein include Tr( trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl) trityl) or TMTr (4,4',4''-trimethoxytrityl).

[0043] The term "subject," as used herein, refers to any animal, e.g., a mammal. Subjects of the present disclosure include humans, non-human primates (e.g., monkeys or other species of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats or any type of poultry, but is not limited to such.

[0044] As used herein, "treatment" refers to a method for obtaining beneficial or desired results; "Therapeutic benefit" includes, but is not limited to, the eradication of the underlying disorder being treated. A therapeutic effect also means that the subject is still suffering from or is ameliorating the symptoms of the underlying disorder. Despite the possibility of suffering from one or more physiological symptoms associated with a potential disorder, Eradication or amelioration results in an observed improvement in the subject.

[0045] As used herein, "prophylaxis" refers to a method of obtaining a beneficial or desired result, and includes prevention. In order to obtain a "preventive effect," the diagnosis of the disease in question is made. Although the gene expression may not have been determined, the siRNA complex or drug composition may be administered to a subject suffering from a particular disease. The drug is administered to a subject at risk of developing a disease or to a subject who has reported one or more pathological symptoms of the disease. It can be administered to a subject.

[0046] In one aspect, the present disclosure provides six siRNAs capable of suppressing PCSK9 gene expression. do.

[0047] The siRNA of the present disclosure comprises a nucleotide group as a basic structural unit. It is known to those skilled in the art that a phosphate group includes a ribose group and a base. The explanation will be omitted.

[0048] The siRNA of the present disclosure comprises a sense strand and an antisense strand, The lengths of the sense strands are the same or different, the length of the sense strand is 19 to 23 nucleotides, The length of the antisense strand is 19 to 26 nucleotides. The length ratio of the sense strand to the antisense strand of the siRNA to be used was 19 / 19, 19 / 20, or 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 2 0 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20 , 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 2 3 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 2 In some embodiments, the sense strand and antisense strand of the siRNA may be The length ratio of the sense chains is 19 / 21, 21 / 23 or 23 / 25.

[0049] <First siRNA> According to the present disclosure, the siRNA may be a first siRNA.

[0050] The first siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 form a region, The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 2 is the same length and has no more than three nucleotide differences. do. 5'-AAGCAAGCAGACAUUUAUZ1-3' (SEQ ID NO: 1), 5'-Z2AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2) wherein Z1 is C and Z2 is G, and in said nucleotide sequence I, position Z1 is The corresponding nucleotide Z3 is included in the nucleotide sequence II, and the position of Z2 is included in the nucleotide sequence II. and Z4 is the first nucleotide at the 5' end of the antisense strand. It is a nucleotide.

[0051] In this context, "corresponding positions" refers to positions from the same end of a nucleotide sequence to the same For example, nucleotide sequence I at position 1 at the 3' end of nucleotide sequence I The second nucleotide corresponds to the first nucleotide at the 3' end of SEQ ID NO:1. It is leotide.

[0052] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0053] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 and / or the nucleotide sequence has no more than one nucleotide difference There is not more than one nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:2. be.

[0054] In some embodiments, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 Nucleotide differences between the nucleotide sequences include differences at position Z4, where Z4 is A, U or is selected from C. In some embodiments, the nucleotide difference is at position Z4 and Z4 is selected from A, U or C. Z3 is a nucleotide complementary to Z4. siRNAs having the above nucleotide differences These nucleotide differences have been shown to have high siRNA-mediated target mRNA silencing potential. siRNAs, including siRNAs, are also within the scope of protection of the present disclosure.

[0055] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary, "targeted" refers to the presence of three or fewer base mismatches between two nucleotide sequences; The term "substantially reverse complementary" means that there is not more than one base mismatch between the two nucleotide sequences. Perfectly reverse-complementary means that there are no base mismatches between the two nucleotide sequences. It refers to something that does not exist.

[0056] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4. do. 5'-AAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO: 3), 5'-Z4AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 4) wherein Z4 is the first nucleotide at the 5' end of the antisense strand, and Z3 is is selected from A, U, G or C; Z4 is a nucleotide complementary to Z3; In some embodiments, Z3 is C and Z4 is G.

[0057] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. In some embodiments, the nucleotide sequence IV and the second nucleotide sequence The sequence is substantially reverse-complementary or completely reverse-complementary to the second nucleotide sequence. is adjacent to the 5' end of the nucleotide sequence set forth in SEQ ID NO:1 in the target mRNA, It refers to a nucleotide sequence equal in length to nucleotide sequence IV above.

[0058] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is C, The base of nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is CC, and the base sequence of nucleotide sequence IV is GG, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is CCC and the base sequence of nucleotide sequence IV is GGG; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is ACCC, and the base sequence of nucleotide sequence IV is The base sequence is GGGU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is CC, the base sequence of nucleotide sequence IV is GG, In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0059] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, The bases of sequence IV are also determined.

[0060] <Second siRNA> According to the present disclosure, the siRNA may be a second siRNA.

[0061] The second siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 form a region. , which are equal in length and have no more than three nucleotide differences, and which are identical to nucleotide sequence II and sequence The nucleotide sequence shown in reference number 62 is the same length and has no more than three nucleotide differences. It is. 5'-UUUGUAGCAUUUUUAUUAZ5-3' (SEQ ID NO:61), 5'-Z6UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:62) wherein Z5 is A and Z6 is U; and in said nucleotide sequence I, position Z5 is The corresponding nucleotide Z7 is included in the nucleotide sequence II, which corresponds to Z6 in position II. the antisense strand includes a nucleotide Z8 which is the first nucleotide at the 5' end of the antisense strand; It is a nucleotide.

[0062] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0063] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 and / or There is one or more nucleotide differences between Sequence II and the nucleotide sequence shown in SEQ ID NO:62. Below.

[0064] In some embodiments, the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:62 Nucleotide differences between the nucleotide sequences include a difference at position Z8, where Z8 is A, C or G. In some embodiments, the nucleotide difference is selected from Z In some embodiments, the difference is at position Z8, where Z8 is selected from A, C, or G. , Z7 is the nucleotide complementary to Z8. A has high siRNA-mediated target mRNA silencing ability and mitochondrial function, and these nucleotide differences siRNAs comprising the same are also within the scope of protection of the present disclosure.

[0065] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0066] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:63. Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:64. It is. 5'-UUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:63), 5'-Z8UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:64) wherein Z8 is the first nucleotide at the 5' end of the antisense strand, and Z7 is is selected from A, U, G or C; Z8 is a nucleotide complementary to Z7; In some embodiments, Z7 is A and Z8 is U.

[0067] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 61, the length of which is adjacent to the 5' end of the nucleotide sequence shown in V.

[0068] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is U, The base of nucleotide sequence IV is A, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is GU, and the base sequence of nucleotide sequence IV is AC. In this case, the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of string III is GGU and the base sequence of nucleotide sequence IV is ACC; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is GGGU, and the base sequence of nucleotide sequence IV is The base sequence is ACCC, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length, from the 5' end to the 3' end, the base sequence of nucleotide sequence III is GU, the base sequence of nucleotide sequence IV is AC, In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0069] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, The bases of sequence IV are also determined.

[0070] <Third siRNA> According to the present disclosure, the siRNA may be a third siRNA.

[0071] The third siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 form a region. are equal in length, have no more than three nucleotide differences, and are identical to nucleotide sequence II. The nucleotide sequence shown in column 122 is the same length and has three nucleotide differences. The following is the result. 5'-GCCUGGAGUUUAUUCGGAZ9-3' (SEQ ID NO: 121), 5'-Z 10 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122) However, Z9 is A and Z 10 is U, and in said nucleotide sequence I, position Z9 Nucleotide Z corresponding to 11 and in said nucleotide sequence II, position Z 10 To The corresponding nucleotide Z 12 wherein Z 12 is the 5' end of the antisense strand This is the first nucleotide.

[0072] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0073] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:121 and / or There is one nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:122. There are less than one.

[0074] In some embodiments, the nucleotide sequence II is set forth in SEQ ID NO:122. The nucleotide difference between the nucleotide sequence is Z 12 including the difference at the position of Z 12 but In some embodiments, the nucleotide difference is selected from: A, C, or G. Z 12 is the difference in position, Z 12 is selected from A, C, or G. In this state, Z 11 is Z 12 The nucleotide difference is the complementary nucleotide to the nucleotide The siRNAs with these nucleic acids have high siRNA-mediated target mRNA suppression ability, and these nucleic acids siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0075] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary. In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:123. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:124. It is an array. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 123), 5'-Z 12 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 124) However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 11 is selected from A, U, G or C; Z 12 is Z 11 is a nucleotide complementary to In some embodiments, Z 11 is A and Z 12 is U.

[0076] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 121, the length of which is adjacent to the 5' end of the nucleotide sequence shown in It refers to the nucleotide sequence equivalent to IV.

[0077] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is G, The base of nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is AG, and the base sequence of nucleotide sequence IV is CU, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is UAG and the base sequence of nucleotide sequence IV is CUA; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is AUAG, and the base sequence of nucleotide sequence IV is The base sequence is CUAU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length, from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AG and the base sequence of nucleotide sequence IV is CU; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0078] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, The bases of sequence IV are also determined.

[0079] <The fourth siRNA> According to the present disclosure, the siRNA may be a fourth siRNA.

[0080] The fourth siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 form a region. are equal in length, have no more than three nucleotide differences, and are identical to nucleotide sequence II. The nucleotide sequence shown in column 182 is the same length and has three nucleotide differences. The following is the result. 5'-CUGUUUUGCUUUUGUAACZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z 13 is U and Z 14 is A, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 4 16 wherein Z 16 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0081] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0082] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:181 and / or There is a 1 nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:182. There are less than one.

[0083] In some embodiments, the nucleotide sequence II is set forth in SEQ ID NO:182. The nucleotide difference between the nucleotide sequence is Z 16 including the difference at the position of Z 16 but In some embodiments, the nucleotide difference is selected from: U, C, or G. Z 16 is the difference in position, Z 16 is selected from U, C, or G. In this state, Z 15 is Z 16 The nucleotide difference is the complementary nucleotide to the nucleotide The siRNAs with these nucleic acids have high siRNA-mediated target mRNA suppression ability, and these nucleic acids siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0084] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0085] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:183. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:184. It is an array. 5'-CUGUUUUGCUUUUGUAACZ 15 -3' (SEQ ID NO: 183), 5'-Z 16GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 184) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 15 is selected from A, U, G or C; Z 16 is Z 15 is a nucleotide complementary to In some embodiments, Z 15 is U and Z 16 is A.

[0086] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 181, the length of which is adjacent to the 5' end of said nucleotide sequence It refers to the nucleotide sequence equivalent to IV.

[0087] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is C, The base of nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is AC, and the base sequence of nucleotide sequence IV is GU. In this case, the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of string III is GAC and the base sequence of nucleotide sequence IV is GUC; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is AGAC, and the base sequence of nucleotide sequence IV is The base sequence is GUCU, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length and is the base sequence of nucleotide sequence III is AC, and the base sequence of nucleotide sequence IV is GU; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0088] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, The bases of sequence IV are also determined.

[0089] <The fifth siRNA> According to the present disclosure, the siRNA may be a fifth siRNA.

[0090] The fifth siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:241 form a region. are equal in length, have no more than three nucleotide differences, and are identical to nucleotide sequence II. The nucleotide sequence shown in column 242 is the same length and has three nucleotide differences. The following is the result. 5'-GGUUUUGUAGCAUUUUUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z1 Nucleotide Z corresponding to 8 20 wherein Z 20 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0091] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0092] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:241 and / or There is 1 nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:242. There are less than one.

[0093] In some embodiments, the nucleotide sequence II is set forth in SEQ ID NO:242. The nucleotide difference between the nucleotide sequence is Z 20 including the difference at the position of Z 20 but In some embodiments, the nucleotide difference is selected from: U, C, or G. Z 20 is the difference in position, Z 20 is selected from U, C, or G. In this state, Z 19 is Z 20 The nucleotide difference is the complementary nucleotide to the nucleotide The siRNAs with these nucleic acids have high siRNA-mediated target mRNA suppression ability, and these nucleic acids siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0094] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0095] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:243. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:244. It is an array. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 243), 5'-Z 20 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 244) However, the above Z 20is the first nucleotide at the 5' end of the antisense strand, and Z 19 is selected from A, U, G or C; Z 20 is Z 19 is a nucleotide complementary to In some embodiments, Z 19 is U and Z 20 is A.

[0096] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 241, the length of which is adjacent to the 5' end of the nucleotide sequence shown in It refers to the nucleotide sequence equivalent to IV.

[0097] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is G, The base of nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is UG, and the base sequence of nucleotide sequence IV is CA, in which case the sense strand and the antisense strand are The length ratio of the sense strand is 21 / 21, or the nucleotide sequences III and IV are The length of each is 3 nucleotides, and the nucleotide sequence is the base sequence of nucleotide sequence III is CUG and the base sequence of nucleotide sequence IV is CAG; In this case, the length ratio of the sense strand to the antisense strand is 22 / 22, or Sequences III and IV are both 4 nucleotides in length and extend from the 5' to the 3' end. The base sequence of nucleotide sequence III is UCUG, and the base sequence of nucleotide sequence IV is The base sequence is CAGA, and the length ratio of the sense strand to the antisense strand is 23 / 2 In some embodiments, the nucleotide sequence III is Column IV is 2 nucleotides in length, from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA; In this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0098] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Since it is fully reverse complementary, given the base of nucleotide sequence III, The bases of sequence IV are also determined.

[0099] <6th siRNA> According to the present disclosure, the siRNA may be a sixth siRNA.

[0100] The sixth siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 form a region. are equal in length, have no more than three nucleotide differences, and are identical to nucleotide sequence II. The nucleotide sequence shown in column 302 is the same length and has three nucleotide differences. The following is the result. 5'-GUGACUUUUUAAAAUAAAZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z 21 is A and Z 22 is U, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 and in said nucleotide sequence II, position Z2 Nucleotide Z corresponding to 2 24 wherein Z 24 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0101] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0102] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are and / or There is 1 nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:302. There are less than one.

[0103] In some embodiments, the nucleotide sequence II is set forth in SEQ ID NO:302. The nucleotide difference between the nucleotide sequence is Z 24 including the difference at the position of Z 24 but In some embodiments, the nucleotide difference is selected from: A, C, or G. Z 24 is the difference in position, Z 24 is selected from A, C, or G. In this state, Z 23 is Z 24 The nucleotide difference is the complementary nucleotide to the nucleotide The siRNAs with these nucleic acids have high siRNA-mediated target mRNA suppression ability, and these nucleic acids siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0104] In some embodiments, the nucleotide sequence I and the nucleotide sequence II , essentially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0105] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:303. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:304. It is an array. 5'-GUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 303), 5'-Z 24 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 304) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 23is selected from A, U, G or C; Z 24 is Z 23 is a nucleotide complementary to In some embodiments, Z 23 is A and Z 24 is U.

[0106] In some embodiments, the sense strand further comprises nucleotide sequence III. the antisense strand further comprises nucleotide sequence IV; and and nucleotide sequence IV are each 1 to 4 nucleotides in length, The nucleotide sequence III and the nucleotide sequence IV are equal in length and substantially reverse-complementary or completely complementary. and said nucleotide sequence III is a reverse complement to said nucleotide sequence I at the 5' end thereof. and said nucleotide sequence IV is linked to the 3' end of said nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially reverse complementary or completely complementary to each other. The second nucleotide sequence is a sequence number 1 in the target mRNA. 301, the length of which is adjacent to the 5' end of the nucleotide sequence shown in It refers to the nucleotide sequence equivalent to IV.

[0107] In some embodiments, nucleotide sequence III and nucleotide sequence IV , each of which is 1 nucleotide in length, the base of nucleotide sequence III is G, The base of nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. The nucleotide sequence of nucleotide sequence III from the 5' end to the 3' end is It is UG, the base sequence of nucleotide sequence IV is CA, and at this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21, or nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21. In some embodiments, nucleotide sequences III and IV are both 3 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is AUG, and the base sequence of nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the anti-sense strand is 22 / 22, or nucleotide sequences III and IV are both 4 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UAUG, and the base sequence of nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the anti-sense strand is 23 / 23. In some embodiments, nucleotide sequences III and IV are 2 nucleotides in length, and from the 5' end to the 3' end, the base sequence of nucleotide sequence III is UG, and the base sequence of nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the anti-sense strand is 21 / 21.

[0108] In some embodiments, nucleotide sequences III and IV are completely reverse complementary, so when the bases of nucleotide sequence III are given, the bases of nucleotide sequence IV are also determined. In some embodiments, nucleotide sequences III and IV are completely reverse complementary, so when the bases of nucleotide sequence III are given, the bases of nucleotide sequence IV are also determined. In some embodiments, nucleotide sequences III and IV are completely reverse complementary, so when the bases of nucleotide sequence III are given, the bases of nucleotide sequence IV are also determined.

[0109] <siRNA Overhang Ends and Modifications> The following descriptions of nucleotide sequence V, nucleic acid sequence, nucleotide modifications in siRNA, and modification sequences are applicable to any one of the above siRNAs 1 to 6. That is, unless otherwise specified, the following descriptions of siRNA apply to siRNA 1, siRNA 2 The following descriptions of nucleotide sequence V, nucleic acid sequence, nucleotide modifications in siRNA, and modification sequences are applicable to any one of the above siRNAs 1 to 6. That is, unless otherwise specified, the following descriptions of siRNA apply to siRNA 1, siRNA 2 The following descriptions of nucleotide sequence V, nucleic acid sequence, nucleotide modifications in siRNA, and modification sequences are applicable to any one of the above siRNAs 1 to 6. That is, unless otherwise specified, the following descriptions of siRNA apply to siRNA 1, siRNA 2 siRNA, third siRNA, fourth siRNA, fifth siRNA and sixth siRNA For example, a particular siRNA should be considered a description of the NA. If not, "the siRNA further comprises a nucleotide sequence V" means "the 1 siRNA, 2 siRNA, 3 siRNA, 4 siRNA, 5 siRNA the RNA or the sixth siRNA further comprises the nucleotide sequence V."

[0110] In some embodiments, the sense and antisense strands are different lengths, The antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length of 1 3 nucleotides, and attached to the 3' end of the antisense strand; This constitutes the 3' overhanging end (overhanging end). The length ratio of the sense strand to the antisense strand of iRNA was 19 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 2 3, 22 / 24, 22 / 25, 23 / 24, 23 / 25 or 23 / 26. In some embodiments, the nucleotide sequence V is 2 nucleotides in length , whereby the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 21, 21 / 23 or 23 / 25.

[0111] Each nucleotide in the nucleotide sequence V may be any nucleotide. In order to reduce the cost of synthesis, the nucleotide sequence V is preferably composed of two consecutive thymine deoxyribonucleotides (dTdT) or two consecutive uracil ribonucleotides Alternatively, the affinity of the antisense strand of the siRNA to the target mRNA is To improve potency, the nucleotide sequence V is a nucleotide sequence corresponding to the nucleotide sequence of the target mRNA. Thus, in some embodiments, the siRNA of the present disclosure The ratio of the length of the sense strand to the antisense strand is 19 / 21 or 21 / 23. The disclosed siRNAs have higher mRNA silencing activity.

[0112] The nucleotide at the corresponding position in the target mRNA is the nucleotide at the 5' end of the third The nucleotide or nucleotide sequence adjacent to the nucleotide sequence, The nucleotide sequence is substantially or completely reverse complementary to nucleotide sequence II. nucleotide sequence II and nucleotide sequence IV. A nucleotide sequence that is substantially or completely reverse complementary to the nucleotide sequence to be It is a column.

[0113] In some embodiments, the siRNA is The sense strand comprises the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: It comprises the nucleotide sequence shown in SEQ ID NO:6. 5'-AAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO:5), 5'-Z4AUAAAUGUCUGCUUGCUUGG-3' (SEQ ID NO: 6)

[0114] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:7. The antisense strand comprises the nucleotide sequence shown in SEQ ID NO:8. 5'-CCAAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO: 7), 5'-Z4AUAAAUGUCUGCUUGCUUGGGU-3' (SEQ ID NO: 8) wherein Z4 is the first nucleotide at the 5' end of the antisense strand, and Z3 is is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3.

[0115] In some embodiments, the siRNA is fused to the second siRNA. The sense strand comprises the nucleotide sequence shown in SEQ ID NO:65, and the antisense strand comprises the sequence It comprises the nucleotide sequence shown in number 66. 5'-UUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:65), 5'-Z8UAAUAAAAAUGCUACAAAAC-3' (SEQ ID NO:66)

[0116] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:67. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:68. nothing. 5'-GUUUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:67), 5'-Z8UAAUAAAAAUGCUACAAAACCC-3' (SEQ ID NO: 68) wherein Z8 is the first nucleotide at the 5' end of the antisense strand, and Z7 is is selected from A, U, G or C, and Z8 is the nucleotide complementary to Z7.

[0117] In some embodiments, the siRNA is a nucleotide sequence of the siRNA relative to the third siRNA. The siRNA strand comprises the nucleotide sequence shown in SEQ ID NO: 125. The sense strand comprises the nucleotide sequence shown in SEQ ID NO:126. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 125), 5'-Z 12 UCCGAAUAAACUCCAGGCCU-3' (SEQ ID NO: 126)

[0118] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 127. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:128. Includes. 5'-AGGCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 127), 5'-Z 12 UCCGAAUAAACUCCAGGCCUAU-3' (SEQ ID NO: 128 ) However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 11 is selected from A, U, G or C; Z 12 is Z 11 is a nucleotide complementary to do.

[0119] In some embodiments, the siRNA is The siRNA strand comprises the nucleotide sequence shown in SEQ ID NO: 185. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:186. 5'-CUGUUUUGCUUUUGUAACZ 15 -3' (SEQ ID NO: 185), 5'-Z 16 GUUACAAAAGCAAAACAGGU-3' (SEQ ID NO: 186)

[0120] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 187. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:188. Includes. 5'-ACCUGUUUUGCUUUUGUAACZ 15-3' (SEQ ID NO: 187), 5'-Z 16 GUUACAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 188 ) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 15 is selected from A, U, G or C; Z 16 is Z 15 is a nucleotide complementary to do.

[0121] In some embodiments, the siRNA is The siRNA strand comprises the nucleotide sequence shown in SEQ ID NO: 245. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:246. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 245), 5'-Z 20 UAAAAAAUGCUACAAAACCCA-3' (SEQ ID NO: 246)

[0122] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 247. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 248. Includes. 5'-UGGGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 247), 5'-Z 20 UAAAAAAUGCUACAAAACCCAGA-3' (SEQ ID NO: 248 ) However, the above Z 20 is the first nucleotide at the 5' end of the antisense strand, and Z 19 is selected from A, U, G or C; Z 20 is Z 19 is a nucleotide complementary to do.

[0123] In some embodiments, the siRNA is The nucleotide strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 305. The sense strand comprises the nucleotide sequence set forth in SEQ ID NO:306. 5'-GUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 305), 5'-Z 24 UUUAUUUUAAAAGUCACCA-3' (SEQ ID NO: 306)

[0124] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 307. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 308. Includes. 5'-UGGUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 307), 5'-Z 24 UUUAUUUUAAAAGUCACCAUA-3' (SEQ ID NO: 308 ) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 23 is selected from A, U, G or C; Z 24 is Z 23 is a nucleotide complementary to do.

[0125] In some embodiments, the siRNA described in this disclosure is selected from the group consisting of siRNAs described in Tables 1a-1f. siPCSKa1, siPCSKa2, siPCSKb1, and siPCSKb2 , siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siP CSKe1, siPCSKe2, siPCSKf1 or siPCSKf2.

[0126] As discussed above, each nucleotide in the siRNA of the present disclosure may be independently modified or is an unmodified nucleotide. In some embodiments, in the siRNA of the present disclosure, In some embodiments, the nucleotides in the present disclosure are unmodified nucleotides. Some or all of the nucleotides in the siRNA are modified nucleotides. These modifications on the oxido group enable the siRNA of the present disclosure to suppress PCSK9 gene expression. This does not appreciably impair or destroy the function of the device.

[0127] In some embodiments, the siRNA of the present disclosure comprises at least one modified nucleotide. In the context of this disclosure, the term "modified nucleotide" refers to a nucleotide A nucleotide or nucleotide in which the 2' hydroxyl group of the ribose group of the nucleotide has been replaced with another group. The term "modified nucleotide" refers to a nucleotide analogue or a nucleotide having a modified base. The siRNA clearly weakened or abolished the gene expression suppression function of siRNA. For example, JK Watts, GF Deleavey, and MJ Damha,Chemically modified siRNA: to ols and applications. Drug Discov Today, 2008,13(19-20): 842-55. This is also fine.

[0128] In some embodiments, the sense strand or the siRNA provided by the present disclosure The antisense strand has at least one modified nucleotide, and / or At least one of the phosphate ester groups is a phosphate ester group having a modifying group. In other words, at least one single stranded phosphate in the sense strand and the antisense strand At least some of the phosphate groups and / or ribose groups in the sugar backbone have a modified group. The ribose group may be a phosphate group and / or a modified group.

[0129] In some embodiments, the nucleic acid in the sense strand and / or the antisense strand In some embodiments, the nucleotides are all modified nucleotides. Each nucleotide in the sense strand and the antisense strand of the siRNA provided herein is unique. They are either fluoro-modified or non-fluoro-modified nucleotides.

[0130] The inventors of the present disclosure have surprisingly found that the siRNAs described in the present disclosure can be used in animal studies. Achieve a high balance between plasma stability and gene silencing efficiency in found.

[0131] In some embodiments, the fluoro-modified nucleotide is and located in nucleotide sequence II, from the 5' end to the 3' end, At least the nucleotides at positions 7, 8, and 9 of sequence I are fluoro-modified nucleotides; From the 5' end to the 3' end, at least the second, sixth, first and The nucleotides at positions 4 and 16 are fluoro-modified nucleotides.

[0132] In some embodiments, the fluoro-modified nucleotide is and a fluoro-modified nucleotide in nucleotide sequence I located at nucleotide sequence II; nucleotide sequence I, The nucleotides at positions 7, 8, and 9 are fluoro-modified nucleotides, 7 or less fluoro-modified nucleotides in string II; The nucleotides at positions 2, 6, 14, and 16 of the amino acid sequence are fluoro-modified nucleotides.

[0133] In some embodiments, from the 5' end to the 3' end, in the sense strand, and the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the nucleotide sequence I are and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides. the antisense strand is a fluoro-modified nucleotide from the 5' end to the 3' end In the nucleotide sequence II, The nucleotides at positions 4 and 16 are fluoro-modified nucleotides in the antisense strand. The nucleotides at the remaining positions are non-fluoro modified nucleotides.

[0134] In the context of this disclosure, a "fluoro-modified nucleotide" refers to a nucleotide that has a ribose residue that is The hydroxy group at the 2'-position of the group is substituted with fluorine, and the structure is represented by the following formula (7): A "non-fluoro modified nucleotide" refers to a nucleotide in which the ribose moiety of the nucleotide A nucleotide in which the 2'-hydroxy group of the nucleotide is replaced with a non-fluorine group, or a nucleotide In some embodiments, each non-fluoro modified nucleotide is a nucleoside. A nucleotide in which the 2'-hydroxyl group of the ribose group of the nucleotide is replaced with a non-fluorine group It is one independently selected from a nucleotide analog.

[0135] Nucleotides in which the 2' hydroxyl group of the ribose group is replaced with a non-fluorine group are , known to those skilled in the art, and these nucleotides include 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted Alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides The nucleic acid may be one selected from the group consisting of nucleotides, nucleotides, and 2'-deoxynucleotides.

[0136] In some embodiments, the 2'-alkoxy modified nucleotide is shown in formula (8): In some embodiments, the nucleotide sequence is a 2'-methoxy (2'-OMe) modified nucleotide. In the present invention, the 2'-substituted alkoxy modified nucleotide is, for example, a 2'-O In some embodiments, the nucleotide may be a 2'-methoxyethyl (2'-MOE) modified nucleotide. In this embodiment, the 2'-amino (2'-NH2) modified nucleotide is as shown in formula (10): In some embodiments, the 2'-deoxynucleotide (DNA) has the formula: As shown in 1).

[0137] [ka]

[0138] Nucleotide analogs are compounds that can replace nucleotides in nucleic acids. , adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, Refers to a group whose structure is different from that of uracil ribonucleotide or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog is an isonucleotide, a bridged nucleotide, The nucleotide may be a nucleotide or an acyclic nucleotide.

[0139] Bridged nucleic acid (BNA) is a binding BNA refers to a nucleotide that is restricted or inaccessible to the nucleotide sequence. It may also contain a bridged structure with a "fixed" C3'-endo sugar puckering. The bridge is introduced at the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, the BNA is an LNA as shown in formula (12), 3), cET BNA shown in formula (14), or the like.

[0140] [ka]

[0141] Acyclic nucleotides are nucleotides in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide is an unlocked nucleic acid represented by formula (15): (UNA), or glycerol nucleic acid (GNA) as shown in formula (16).

[0142] [ka]

[0143] In the above formula (15) and formula (16), R is H, OH or alkoxy (O-alkyl). The signal is selected from the following:

[0144] Isonucleotides are nucleotides in which the position of the base in the ribose ring changes. In some embodiments, the isonucleotide is represented by the formula (17) or ( 18), in which the base is transferred from the 1'-position to the 2'- or 3'-position of the ribose ring. It may also be a mixture.

[0145] [ka]

[0146] In the compounds of the above formulas (17) and (18), Base is A, U, G, C, T, etc. wherein R is selected from H, OH, F or a non-fluorine group as described above.

[0147] In some embodiments, the nucleotide analog is an isonucleotide, an LNA, The present invention is directed to a method for treating a pulmonary circulation disorder (PCH) comprising the steps of: ENA, cET, UNA, and GNA. In the form, each non-fluoro modified nucleotide is a methoxy modified nucleotide. In this context, the methoxy-modified nucleotide is a nucleotide having a 2'-hydroxyl group of the ribose group. It refers to a nucleotide in which the silyl group is replaced with methoxy.

[0148] In the context, "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide" "Nucleotides in which the 2'-hydroxy group of the ribose group is replaced with fluorine" and "2'- "Nucleotide having a fluororibose group" and "Nucleotide having a fluororibose group" have the same meaning. A compound having the structure shown in formula (7) in which the 2'-hydroxy group of Refers to "methoxy-modified nucleotide," "2'-methoxy-modified nucleotide," and "ribo "Nucleotides in which the 2'-hydroxy group of the 2'-hydroxyl group is substituted with methoxy" and "2'-Methoxy "Nucleotide having a silibose group" and "nucleotide having a silibose group" have the same meaning. The 2'-hydroxy group of the bosyl group is replaced with methoxy, and the structure is shown in formula (8). This refers to a compound that

[0149] In some embodiments, the siRNA of the present disclosure has the following modifications: That is, from the 5' end to the 3' end, in the sense strand, Nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified. nucleotides at the remaining positions in the sense strand, and nucleotides of the second and sixth sequences of nucleotide sequence II in the antisense strand; , 14, and 16 or 2, 6, 8, 9, 14, and 16 are fluoro-modified nucleotides. nucleotide, and the remaining nucleotides in the antisense strand are methoxy-modified It is a nucleotide.

[0150] In some embodiments, the siRNA of the present disclosure has the following modifications: That is, from the 5' end to the 3' end, The nucleotides at positions 5, 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the remaining nucleotides in the sense strand of the siRNA are methoxy-modified nucleotides. from the 5' end to the 3' end in the antisense strand of the siRNA Nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence II are fluoro-modified. The remaining nucleotides in the antisense strand of the siRNA are is an oxy-modified nucleotide, Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end to the 3' end, The nucleotides at positions 2, 6, 14, and 16 of peptide sequence II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is Chid. Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides; The remaining nucleotides in the sense strand of the iRNA are methoxy-modified nucleotides, nucleotides in the antisense strand of the siRNA from the 3' end to the 3' end The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoro-modified nucleotides. , the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is.

[0151] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of siRNAs listed in Tables 1a-1f. siPCSKa1-M1, siPCSKa1-M2, and siPCSKa1- M3, siPCSKa2-M1, siPCSKa2-M2, siPCSKa2-M3, s iPCSKb1-M1, siPCSKb1-M2, siPCSKb1-M3, siPCS Kb2-M1, siPCSKb2-M2, siPCSKb2-M3, siPCSKc1- M1, siPCSKc1-M2, siPCSKc1-M3, siPCSKc2-M1, s iPCSKc2-M2, siPCSKc2-M3, siPCSKd1-M1, siPCS Kd1-M2, siPCSKd1-M3, siPCSKd2-M1, siPCSKd2- M2, siPCSKd2-M3, siPCSKe1-M1, siPCSKe1-M2, s iPCSKe1-M3, siPCSKe2-M1, siPCSKe2-M2, siPCS Ke2-M3, siPCSKf1-M1, siPCSKf1-M2, siPCSKf1- M3, siPCSKf2-M1, siPCSKf2-M2 or siPCSKf2-M3 It is one of the following:

[0152] The siRNAs with the above modifications are not only inexpensive but also resistant to ribonucleases in the blood. It is possible to make nucleic acids less susceptible to cleavage, which improves the stability of the nucleic acid and makes the nucleic acid more The modified siR has a strong resistance to nuclease hydrolysis. NA also has high target mRNA suppression activity.

[0153] In some embodiments, the sense and anti-strands of the siRNA provided by the present disclosure In the sense strand, at least one single strand has a small number of phosphate ester groups in its phosphate-sugar backbone. At least some of the phosphate groups have a modifying group. The phosphate ester group having a modifying group is a phosphodiester bond in the phosphate ester group. At least one oxygen atom of the thiophosphate group is replaced with a sulfur atom. In some embodiments, the phosphate ester group having the modifying group is represented by formula (1): It is a thiophosphate group having the structure.

[0154] [ka]

[0155] These modifications stabilize the double-stranded structure of siRNA and enhance the specificity of base pairing. and maintain a high affinity.

[0156] In some embodiments, in the siRNA provided by the present disclosure, thiophosphoryl The acid ester group is 2′-nucleotide with the first nucleotide at either end of the sense or antisense strand. between the 1st nucleotide and the 2nd nucleotide at either end of the sense or antisense strand, between the nucleotide and the third nucleotide, or any combination thereof In some embodiments, the thiophosphate is present in a carboxylic acid moiety. Terminator groups are present attached at all of the above positions except the 5' end of the sense strand. In embodiments, the thiophosphate group is at all of the above positions except the 3' end of the sense strand. In some embodiments, the thiophosphate group is bonded to is present bound at at least one of the positions. Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second nucleotide and the third nucleotide from the 3' end of the sense strand, The first and second nucleotides from the 5' end of the antisense strand Between, The second and third nucleotides from the 5' end of the antisense strand Between, The first and second nucleotides from the 3' end of the antisense strand Between, and The second and third nucleotides from the 3' end of the antisense strand Between.

[0157] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of siRNAs listed in Tables 1a-1f. siPCSKa1-M1S, siPCSKa1-M2S, and siPCSKa 1-M3S, siPCSKa2-M1S, siPCSKa2-M2S, siPCSKa2 -M3S, siPCSKb1-M1S, siPCSKb1-M2S, siPCSKb1- M3S, siPCSKb2-M1S, siPCSKb2-M2S, siPCSKb2-M 3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3 S, siPCSKc2-M1S, siPCSKc2-M2S, siPCSKc2-M3S , siPCSKd1-M1S, siPCSKd1-M2S, siPCSKd1-M3S, siPCSKd2-M1S, siPCSKd2-M2S, siPCSKd2-M3S, s iPCSKe1-M1S, siPCSKe1-M2S, siPCSKe1-M3S, si PCSKe2-M1S, siPCSKe2-M2S, siPCSKe2-M3S, siP CSKf1-M1S, siPCSKf1-M2S, siPCSKf1-M3S, siPC Either SKf2-M1S, siPCSKf2-M2S or siPCSKf2-M3S There is one.

[0158] In some embodiments, the 5'-terminal nucleotide of the antisense strand of the siRNA The nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

[0159] The conventional 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is As known to those of skill in the art, for example, a 5'-phosphate nucleotide may have the following structure: .

[0160] [ka]

[0161] See, for example, Anastasia Khvorova and Jonathan K. Watts,The chemical evolution of oligo nucleotide therapies of clinical utility . Nature Biotechnology,2017,35(3): 238~4 8 discloses the following four types of 5'-phosphate analog modified nucleotides:

[0162] [ka] In the formula, R is selected from H, OH, methoxy, and fluorine; Base represents a base; A, U , C, G or T.

[0163] In some embodiments, the 5'-phosphate nucleotide is a 5'-phosphate nucleotide as shown in formula (2): A 5'-phosphate analog modified nucleotide is a nucleotide having the formula ( 3) Vinyl phosphate ester (5'-(E)-vinylphosphona te, E-VP) modification, or a thiophosphoric acid as shown in formula (5). It is an acid ester modified nucleotide.

[0164] In some embodiments, the siRNA provided by the present disclosure comprises a siRNA selected from the group consisting of siRNAs listed in Tables 1a-1f. siPCSKa1-M1P1, siPCSKa1-M2P1, and siPCS Ka1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siP CSKa2-M3P1、siPCSKb1-M1P1、siPCSKb1-M2P1、s iPCSKb1-M3P1、siPCSKb2-M1P1、siPCSKb2-M2P1 、siPCSKb2-M3P1、siPCSKc1-M1P1、siPCSKc1-M2 P1、siPCSKc1-M3P1、siPCSKc2-M1P1、siPCSKc2- M2P1、siPCSKc2-M3P1、siPCSKd1-M1P1、siPCSKd 1-M2P1、siPCSKd1-M3P1、siPCSKd2-M1P1、siPCS Kd2-M2P1、siPCSKd2-M3P1、siPCSKe1-M1P1、siP CSKe1-M2P1、siPCSKe1-M3P1、siPCSKe2-M1P1、s iPCSKe2-M2P1、siPCSKe2-M3P1、siPCSKf1-M1P1 、siPCSKf1-M2P1、siPCSKf1-M3P1、siPCSKf2-M1 P1、siPCSKf2-M2P1、siPCSKf2-M3P1、siPCSKa1- M1SP1、siPCSKa1-M2SP1、siPCSKa1-M3SP1、siPC SKa2-M1SP1、siPCSKa2-M2SP1、siPCSKa2-M3SP1 、siPCSKb1-M1SP1、siPCSKb1-M2SP1、siPCSKb1- M3SP1、siPCSKb2-M1SP1、siPCSKb2-M2SP1、siPC SKb2-M3SP1、siPCSKc1-M1SP1、siPCSKc1-M2SP1 、siPCSKc1-M3SP1、siPCSKc2-M1SP1、siPCSKc2- M2SP1、siPCSKc2-M3SP1、siPCSKd1-M1SP1、siPC SKd1-M2SP1、siPCSKd1-M3SP1、siPCSKd2-M1SP1 , siPCSKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1- M1SP1, siPCSKe1-M2SP1, siPCSKe1-M3SP1, siPC SKe2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1 , siPCSKf1-M1SP1, siPCSKf1-M2SP1, siPCSKf1- M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1, siPC It can be one of SKf2-M3SP1.

[0165] <7th siRNA> According to the present disclosure, the siRNA may be a seventh siRNA.

[0166] The seventh siRNA comprises a sense strand and an antisense strand, wherein each nucleotide is independently a modified or unmodified nucleotide, and the sense strand comprises the antisense strand comprises nucleotide sequence I, the antisense strand comprises nucleotide sequence II, The nucleotide sequence I and the nucleotide sequence II are double-stranded in a reverse complementary manner at least in part. The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 form a region. are equal in length, have no more than three nucleotide differences, and are identical to nucleotide sequence II. The nucleotide sequence shown in column 400 is the same length and has three nucleotide differences. The following is the result. 5'-AGACCUGUUUUGCUUUUGZ 25 -3' (SEQ ID NO: 399), 5'-Z 26 CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 400) However, Z 25 is U and Z 26is A, and in said nucleotide sequence I, position Z 25 Nucleotide Z corresponding to 27 and in said nucleotide sequence II, position Z2 Nucleotide Z corresponding to 6 28 wherein Z 28 is the 5' end of the antisense strand It is the first nucleotide at the end.

[0167] In some embodiments, the sense strand comprises only nucleotide sequence I, The antisense strand contains only nucleotide sequence II.

[0168] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:399 and / or There is 1 nucleotide difference between sequence II and the nucleotide sequence shown in SEQ ID NO:400. There are less than one.

[0169] In some embodiments, the nucleotide sequence II is set forth in SEQ ID NO:400. The nucleotide difference between the nucleotide sequence is Z 28 including the difference at the position of Z 28 but In some embodiments, the nucleotide difference is selected from: Z 28 is the difference in position, Z 28 is selected from G, U, or C. In this state, Z 27 is Z 28 is a nucleotide complementary to

[0170] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:399 The nucleotide difference between the nucleotide sequence is the 9th nucleotide from the 5' end of nucleotide sequence I. and Z is dT.

[0171] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:399 The nucleotide difference between the nucleotide sequence is Z 27 including the difference at the position of Z 27 A , G or C.

[0172] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:399 The nucleotide sequence has two nucleotide differences, and the nucleotide sequence I and the nucleotide sequence The nucleotide sequence II is completely reverse complementary, and the two nucleotide differences are Z and Z2. The difference at position 7 is Z dT, and Z 27 is selected from A, G or C.

[0173] siRNAs with the above nucleotide differences exhibited high levels of target mRNA suppression by siRNAs. siRNAs having these nucleotide differences are also within the scope of protection of this disclosure. .

[0174] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:401. nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:402. It is an array. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 401), 5'-Z 28 CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 402) where dT is thymine deoxyribonucleotide, and 28 Is anti-sense It is the first nucleotide at the 5' end of the Z strand. 27is selected from A, U, G or C Re, Z 28 is Z 27 and in some embodiments, Z 27 is U and Z 28 is A.

[0175] In some embodiments, the seventh siRNA is The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 403, and the antisense strand comprises the sequence It comprises the nucleotide sequence shown in sequence number 404. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 403), 5'-Z 28 CAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 404)

[0176] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 405. wherein the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:406. 5'-CUAGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 405) , 5'-Z 28 CAAAAGCAAAACAGGUCUAGAA-3' (SEQ ID NO: 406 )

[0177] In some embodiments, the siRNA described in this disclosure is selected from the group consisting of siRNAs described in Table 1g. The two most commonly used antibodies are siPCSKg3 and siPCSKg4.

[0178] In some embodiments, the Z and / or Z 27 There is a nucleotide difference at position In the siRNA, at least some of the nucleotides are modified nucleotides, and the modified nucleotides are the modified nucleotide is a fluoro-modified nucleotide or a non-fluoro-modified nucleotide; The fluoro-modified nucleotides are located at nucleotide sequence I and nucleotide sequence II. , from the 5' end to the 3' end, at least the second, sixth, The nucleotides at positions 14 and 16 are fluoro-modified nucleotides.

[0179] In some embodiments, the siRNA provided by the present disclosure is selected from the group consisting of siRNAs described in Table 1g. siPCSKg3-M4, siPCSKg4-M5, and siPCSKg3-M4S , siPCSKg4-M5S, siPCSKg3-M4P1, siPCSKg4-M5P 1. Either siPCSKg3-M4SP1 or siPCSKg4-M5SP1 be.

[0180] The inventors of the present disclosure have demonstrated the plasma and lysosomal stability of the siRNAs provided by the present disclosure. We unexpectedly found that not only was the activity significantly improved, but that the activity of suppressing the target mRNA was also high.

[0181] The siRNA provided by the present disclosure can be prepared by a conventional siRNA preparation method in the art (e.g. For example, solid-phase synthesis and liquid-phase synthesis. Commercial customization services are already available. The use of mers to introduce modified nucleotide groups into the siRNAs described in this disclosure and methods for preparing nucleoside monomers having corresponding modifications, and modified nucleoside monomers. Methods for introducing leutide groups into siRNA are also well known to those skilled in the art.

[0182] <Drug Composition> The present disclosure relates to a drug comprising the above-mentioned siRNA as an active ingredient and a pharma- ceutically acceptable carrier. A composition is provided.

[0183] The pharma- ceutical acceptable carrier may be a carrier commonly used in the field of siRNA administration. Often, for example, magnetic nanoparticles (e.g. , nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes (carbon nanotubes, mesoporous silicon n), calcium phosphate nanoparticles rticles), polyethyleneimine (PEI) , polyamidoamine dendrimer (polyamidoamine (PAMAM) d endrimer), poly(L-lysine, PLL), chitosan (chitosan), 1,2-dioleoyl-3-trimethylammonium propane ( 1,2-dioleoyl-3-trimethylammonium-propane , DOTAP), poly(D- or L-lactic acid / glycolic acid copolymer (poly(D&L-lactide / glycolide copolymer) (actic / glycolic acid) copolymer, PLGA), poly(acetylacetonate) Poly(2-aminoethyl ethylene phosphate) Poly(N,N-dimethylaminoethylene phosphate), PPEEA) and poly(N,N-dimethylaminoethylene Poly(2-dimethylaminoethyl methacrylate) acrylate), PDMAEMA) and one or more of their derivatives. The present invention is not limited to these.

[0184] The content of siRNA and a pharma- ceutical acceptable carrier in the pharmaceutical composition is particularly However, there is no requirement that the amount of each component be in the range of 100-150% by weight, and the amount of each component may be in the range of 100-150% by weight. The weight ratio of the siRNA to the pharma- ceutically acceptable carrier may be 1:(1 to 500). In some embodiments, the weight ratio is 1:(1 to 50).

[0185] In some embodiments, the drug composition may contain other pharma- ceutically acceptable excipients. The additive may be one or more of various agents or compounds commonly used in the art. For example, the pharma- ceutically acceptable other additives may be a pH buffer, At least one of a protective agent and an osmolality regulator may be included.

[0186] The pH buffer solution is tris(hydroxymethylaminomethane hydrochloride) having a pH of 7.5 to 8.5. Buffer solution (tris(hydroxymethyl) aminomethane hyd rochloride buffer) and / or phosphate buffer of pH 5.5 to 8.5 For example, it may be a phosphate buffer solution having a pH of 5.5 to 8.5.

[0187] The protective agent is inositol, sorbitol, sucrose, trehalose, mannose. The drug composition may be at least one of maltose, lactose and glucose. The content of the protective agent may be 0.01 to 30% by weight based on the total weight of the composition.

[0188] The osmolality adjusting agent may be sodium chloride and / or potassium chloride. The content of the osmolality adjusting agent is such that the osmolality of the drug composition is 200 to 700 mOsm / kg. Depending on the desired osmolality, one skilled in the art can determine the osmolality of the The content of the osmotic regulator can be easily determined.

[0189] In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injectable solution. Alternatively, the lyophilized powder may be mixed with a liquid additive at the time of administration to form a liquid preparation. The liquid formulation may be administered by subcutaneous, intramuscular or intravenous injection, but is not limited thereto. First, administer the drug to the lungs by aerosol, or deliver the drug to other organ tissues (e.g., the liver) through the lungs by aerosol. In some embodiments, the administration may be to, but is not limited to, The pharmaceutical composition is adapted for intravenous administration.

[0190] In some embodiments, the drug composition may be in the form of a liposomal formulation. In some embodiments, the pharma- ceutically acceptable carrier for use in the liposomal formulation is The carrier is an amine-containing transfection compound (hereinafter also referred to as an organic amine), a co-lipid, wherein the organic amine, auxiliary lipid and / or PEGylated lipid are The PEGylated lipid was prepared as described in CN103380113A (herein incorporated by reference in its entirety). ) or a pharma- ceutically acceptable salt thereof, may be one or more selected from the group consisting of derivatives, auxiliary lipids, and PEGylated lipids. good.

[0191] In some embodiments, the organic amine is a compound described in CN103380113A. The compound may be a compound represented by formula (201) or a pharma- ceutically acceptable salt thereof.

[0192] [ka] During the ceremony, each X 101 Or X 102 are each independently O, S, NA or CA, and A is water. or C1-C 20 is a hydrocarbon chain, Each Y 101 or Z 101 are each independently C=O, C=S, S=O, CH-OH or SO2, Each R 101 , R 102 , R 103 , R 104 , R 105 , R 106 or R 107 That each independently represents hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain aliphatic group, a ring or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic groups of the formula , branched or straight chain acyl groups, substituted or unsubstituted branched or straight chain aryl groups, substituted or unsubstituted a substituted, branched or straight chain heteroaryl group; x is an integer from 1 to 10; n is an integer of 1 to 3, m is an integer of 0 to 20, and p is 0 or 1, If m=p=0, R 102 is hydrogen, When at least one of n or m is 2, R 103 and nitrogen in formula (201) , forming a structure shown in formula (202) or formula (203).

[0193] [ka] In the formula, g, e, and f each independently represent an integer from 1 to 6, and "HCC" represents a hydrocarbon chain. represents each * N represents a nitrogen atom in formula (201).

[0194] In some embodiments, R 103 is a polyamine. In another embodiment, R 103 is a ketal. In some embodiments, R in formula (201) 10 1 and R 102 Each of may independently be an optionally substituted or unsubstituted branched or linear alkyl group. alkyl or alkenyl, said alkyl or alkenyl having from 3 to about 20 carbon atoms; For example, 8 to about 18 carbon atoms and 0 to 4 double bonds, for example, 0 to 2 double bonds. It has a combination.

[0195] In some embodiments, when n and m are each independently a value of 1 or 3, R 103 may be any one of the following formulas (204) to (213).

[0196] [ka]

[0197] In formulae (204) to (213), g, e, and f each independently represent an integer of 1 to 6. where each "HCC" represents a hydrocarbon chain and each * is R 103 and nitrogen in formula (201) Indicates possible bond points with the atom, and any * Each H on the position corresponds to a nitrogen atom in formula (201). It may be substituted for binding.

[0198] The compound of formula (201) was prepared according to the method described in CN103380113A. Good too.

[0199] In some embodiments, the organic amine is an organic amine represented by formula (214): and / or an organic amine represented by formula (215).

[0200] [ka]

[0201] The co-lipid may be cholesterol, a cholesterol analogue, and / or a cholesterol analogue. It is a derivative of The PEGylated lipid is 1,2-dipalmitamido-sn-glycero-3-phosphatidylcholine. Triethanolamine-N-[methoxy(polyethylene glycol)]-2000(1,2 -dipalmitoyl-sn-glycero-3-phosphatidylet hanolamine-N-[methoxy(polyethylene glyco l)]-2000).

[0202] In some embodiments, the pharmaceutical composition further comprises the organic amine, the auxiliary lipid, The molar ratio of the PEGylated lipids was (19.7-80):(19.7-80):(0.3- 50), and may be, for example, (50-70):(20-40):(3-20). .

[0203] In some embodiments, the siRNA of the present disclosure and the amine-containing transfection The drug composition particles formed by the injection reagent have an average diameter of about 30 nm to about 200 nm. Generally, the average diameter of the liposome particles is about 40 nm to about 135 nm, and more generally, The diameter is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or The average diameter of the liposome particles is about 70 nm to about 90 nm. For example, the average diameter of the liposome particles is about 30, 40 0, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 1 40, 150 or 160 nm.

[0204] In some embodiments, the siRNA of the present disclosure and the amine-containing transfection In the drug composition formed by the coupling reagent, siRNA and total lipid (e.g., organic amine , auxiliary lipid and / or PEGylated lipid) weight ratio (weight / weight ratio) is about 1:1 to about 1:5 0, approx. 1:1~approx. 1:30, approx. 1:3~approx. 1:20, approx. 1:4~approx. 1:18, approx. 1:5~ About 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12, or For example, the weight ratio of siRNA to total lipids of the present disclosure is in the range of about 1:6 to about 1:10. Approximately 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13 , 1:14, 1:15, 1:16, 1:17 or 1:18.

[0205] In some embodiments, the pharmaceutical composition is marketed with each component present independently. In some embodiments, the present disclosure provides a liquid formulation. and a pharma- ceutical composition comprising the siRNA provided by may be prepared according to various known methods, and may be used according to the present disclosure instead of conventional siRNA. In some embodiments, the siRNA provided by the following method may be used. It may also be prepared as follows.

[0206] The organic amine, auxiliary lipid, and PEGylated lipid were suspended in alcohol at the above molar ratio and mixed uniformly. The amount of alcohol is adjusted so that the total mass concentration of the resulting lipid solution is 2 to 25%. The alcohol is determined to be, for example, 8 to 18 mg / mL. Pharmaceutically acceptable alcohols, such as ethanol, propylene glycol, benzyl Alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 30 0, polyethylene glycol 400, etc., are selected from alcohols that are liquid at around room temperature. The alcohol may be one or more of the above alcohols, and may be, for example, ethanol.

[0207] The siRNA provided by the present disclosure is dissolved in a buffered salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, and may be, for example, 0.1 to 0.2 M. The pH of the buffer salt solution is adjusted to 4.0 to 5.5, and may be, for example, 5.0 to 5.2. The amount of the buffer solution is preferably such that the siRNA concentration is 0.6 mg / mL or less, e.g., 0.2 to 100 mg / mL. The buffer salts are soluble acetate, soluble citrate, and soluble sucrose. One or more selected from the group consisting of sodium acetate and / or potassium acetate. It may be Umu.

[0208] After mixing the lipid solution and the siRNA aqueous solution, the resulting product was incubated at 40-60°C for at least The mixture is then incubated for another 2 minutes, e.g., 5 to 30 minutes, to obtain an incubated liposome preparation. The volume ratio of the iRNA aqueous solution is 1:(2–5).

[0209] The cultured liposome preparation is concentrated or diluted, impurities are removed, sterilized, and the liposome preparation is prepared according to the present disclosure. The pharmaceutical composition is obtained. Its physicochemical parameters are pH 6.5-8. The entrapment efficiency is 80% or more, the particle size is 40 to 200 nm, and the polydispersity index is 0. .30 or less, and the osmolality is 250-400 mOsm / kg, e.g., The parameters may include a pH of 7.2 to 7.6, an encapsulation efficiency of 90% or more, a particle size of 60 to 100 nm, a polydispersity index of 0.20 or less, and an osmotic pressure of 300 to 400 mOsm / kg.

[0210] Here, concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously. As a method for removing impurities, various conventional methods may be adopted. For example, using a tangential flow system and a hollow fiber column, ultrafiltration may be performed under the condition of 100 KDa, and the ultrafiltration exchange solution may be a phosphate buffer solution (PBS) with a pH of 7.4. As a sterilization method, various conventional methods may be adopted. For example, it may be sterilized by filtration with a 0.22 μm filter.

[0211] <siRNA complex> The present disclosure provides an siRNA complex including the above siRNA and a complex group that is complexed and bound to the siRNA.

[0212] Generally, the complex group includes at least one target group that is pharmaceutically acceptable and an optional linker, and the siRNA, the linker, and the target group are sequentially bound. In some embodiments, the number of the target groups is 1 to 6. In some embodiments, the number of the target groups is 2 to 4. The siRNA molecule may be complexed with the complex group non-covalently or covalently. For example, it may be covalently complexed with the complex group. The complex site between the siRNA and the complex group may be at the 3' end or 5' end of the sense strand of the siRNA, may be at the 5' end of the antisense strand, or may be in the internal sequence of the siRNA. In some embodiments, the complex site between the siRNA and the complex group ​​​​​​ is at the 3' end of the sense strand of the siRNA.

[0213] In some embodiments, the conjugated group is a phosphate group of a nucleotide, a 2'-hydroxyl group In some embodiments, the conjugated group may be linked to a hydroxyl group or a base. It may be linked to the 3'-hydroxy group, in which case the internucleotide is a 2'-5' linker. The conjugated groups are attached to the ends of the siRNA strands via phosphate diester bonds. When the nucleotide is linked to the phosphate group of a nucleotide, it is usually linked to the internal sequence of the siRNA. The various methods of attachment are described in Muthia et al. h Manoharan et.al. siRNA conjugates carr ying sequentially assembled trivalent N- acetylgalactosamine linked through nucleus osides elicit robust gene silencing in v ivo in hepatocytes. ACS Chemical biology ,2015,10 (5): 1181~7.

[0214] In some embodiments, the bond between the siRNA and the conjugated group is acid labile or reducible. These chemical bonds can be linked to the endosomal acidic environment of the cell. The siRNA can be released by decomposition. The conjugated group was bound to the sense strand of siRNA, and the effect of conjugation on siRNA activity was examined. can be reduced as much as possible.

[0215] In some embodiments, the pharma- ceutically acceptable targeting group is a pharma- ceutically acceptable targeting group that is suitable for use in the field of siRNA administration. Ligands commonly used in the art, such as the various ligands described in WO2009082607A2 The disclosure of which is incorporated herein by reference in its entirety. .

[0216] In some embodiments, the pharma- ceutically acceptable targeting group is cholesterol, bile lipophilic molecules such as juices, vitamins (e.g., tocopherols), and lipid molecules of different chain lengths; Polymers such as polyethylene glycol, polypeptides such as membrane-permeable peptides, and aptamers mers, antibodies, quantum dots, lactose, polylactose, mannose, galactose It contains sugars such as galactosamine (GalNAc) and folic acid (folate). , asialoglycoprotein, asialoglycoprotein residue, lipoprotein (e.g., high density lipoprotein , low density lipoproteins, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth Target molecules such as receptor ligands expressed in hepatic parenchymal cells, such as transferrin, or The ligand may be one or more selected from the ligands formed by derivatives.

[0217] In some embodiments, each of the ligands is a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is independently selected from the group consisting of is a ligand capable of binding to a receptor on the surface of liver cells. At least one of the ligands is capable of binding to a receptor on the surface of mammalian hepatocytes. In some embodiments, the at least one ligand is a receptor on the surface of human hepatocytes. In some embodiments, at least one ligand is capable of binding to is a ligand that can bind to the asialoglycoprotein receptor (ASGPR) on the liver surface. These types of ligands are known to those skilled in the art and generally act to bind to target cell surfaces. It binds to specific receptors on the surface and mediates the delivery of siRNA bound to the ligand to target cells. do.

[0218] In some embodiments, the pharma- ceutically acceptable targeting group is a target of a mammalian hepatocyte surface. Any one of the ligands that bind to the asialoglycoprotein receptor (ASGPR) on the surface In some embodiments, each ligand may be independently an asialoglycoprotein. Proteins, e.g. asialoorosomucoid (A SOR or asialofetuin (ASF). In some embodiments, the ligand is a sugar or a sugar derivative.

[0219] In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. Another ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide or sugar derivative. In an embodiment, at least one of the ligands may be a monosaccharide, a disaccharide, or a trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is a modified sugar. Each ligand may be independently a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative, or In some embodiments, each or at least one of the ligands is selected from the group consisting of monosaccharide derivatives. At least one of glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives conductors, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives The glycerol derivative is selected from the group consisting of glycerol, glycerol, fructose and its derivatives, and sialic acid.

[0220] In some embodiments, each of the ligands is D-mannopyranose, L-mannopyranose, Pyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose Glucose, L-glucose, D-galactose, L-galactose, α-D-mannose D-mannose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranolate α-D-glucopyranose, β-D-glucopyranose, α-D-glucofurano β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranolate α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose Ranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N -Acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionyl Galactosamine, Nn-Butyrylgalactosamine, N-Isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucose Glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-di Deoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy Oxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid , 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1 -Thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranoside Ranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio O-α-D-glucoheptopyranoside, 2,5-anhydro-D-allonitrile, riboflavin from D-ribose, D-4-thioribose, L-ribose or L-4-thioribose Other options for the ligand include, for example, CN1053780. 82A, the disclosure of which is incorporated herein by reference in its entirety. Can be enjoyed.

[0221] In some embodiments, the siRNA complex includes a pharma- ceutically acceptable target. The target group may be galactose or N-acetylgalactosamine, and may be galactose or The N-acetylgalactosamine molecule may be monovalent, divalent, trivalent or tetravalent. The monovalent, divalent, trivalent, and tetravalent groups are composed of siRNA molecules and galactose as a targeting group, respectively. The siRNA complex formed from the conjugate group containing galactosamine or N-acetylgalactosamine molecules The molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules in It should be understood to mean 1:1, 1:2, 1:3 or 1:4. In an embodiment, the pharma- ceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, the siRNA described herein is N-acetylglucosamine. When conjugated to a conjugated group containing an amine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, the siRNA described in the present disclosure is N-acetylglucosamine. When conjugated to a galactosamine-containing conjugating group, the N-acetylgalactosamine molecule is trivalent.

[0222] The targeting group may be attached to the siRNA molecule via a suitable linker, and those skilled in the art will appreciate that the targeting group may be linked to the siRNA molecule via a suitable linker. An appropriate linker can be selected depending on the specific type of the target group. For the types of targeting groups and methods of binding to siRNA, see WO2015006740A2. Reference may be made to the disclosure of which, the contents of which are incorporated herein by reference in their entirety.

[0223] In some embodiments, when the targeting group is N-acetylgalactosamine, A suitable linker may be the structure shown in formula (301).

[0224] [ka] During the ceremony, k is an integer from 1 to 3; L A is a chain portion containing an amide bond having a structure represented by formula (302), L A has one of the target groups and one of the L C Bonded to the part by ether bond will be done.

[0225] [ka]

[0226] L B is a chain portion containing N-acylpyrrolidine having the structure shown in formula (303). The chain portion has a carbonyl group at one end thereof, and the L C Bonded to the part by an amide bond and has an oxygen group at the other end, and is bound to the siRNA via a phosphate ester bond.

[0227] [ka]

[0228] L C is hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane. is a divalent to tetravalent linker group based on hydroxymethylaminomethane, C is an oxygen source Each of the L's is bonded to an ether bond via a A is bonded to the a moiety through a nitrogen atom The L B The part is connected to the

[0229] In some embodiments, n=3 and L C Trihydroxymethylaminomethyl In the case of a tetravalent linker group based on a phenyl group, -(L A ) 3 Trihydroxy Methylaminomethane-L B - N-acetylgalactosamine and siRNA molecules The structure of the siRNA complex formed by binding is shown in the following formula (304).

[0230] [ka] In the formula, the double helix structure represents the siRNA.

[0231] Similarly, the conjugation site between the siRNA and the conjugation group is at the 3' end or 5' end of the sense strand of the siRNA. It may be located at the 5' end of the antisense strand, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. It is also possible.

[0232] In some embodiments, the 3' end of the sense strand of the siRNA described herein is , linker-(L A) 3 Trihydroxymethylaminomethane-L B -Three N-A Covalently conjugated to a cetylgalactosamine (GalNAc) molecule, The molar ratio of GalNAc molecules is 1:3, and the structure is shown in the following formula (305): An RNA complex (hereinafter also referred to as (GalNAc)3-siRNA) is obtained.

[0233] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense domain of the siRNA. It is attached to the 3' end of the strand.

[0234] In some embodiments, when the targeting group is N-acetylgalactosamine, A suitable linker may be the structure shown in formula (306).

[0235] [ka] During the ceremony, l is an integer from 0 to 3; * represents the site on the linker that is attached to the targeting group via an ether bond, # represents the site in the linker that is bound to the siRNA via a phosphate bond. .

[0236] In some embodiments, when l=2, the siRNA complex has the formula (30 7) has the structure shown in

[0237] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense domain of the siRNA. It is attached to the 3' end of the strand.

[0238] The conjugates may be synthesised by methods already well described in the prior art. For example, WO2015006740A2 describes in detail a method for preparing multiple types of complexes. The siRNA complexes of the present disclosure are obtained by methods well known to those skilled in the art. For example, WO2014025805A1 describes a method for preparing the structure shown in formula (305): Rajeev et al., ChemBioChem 2015,16,903- A method for preparing the structure shown in formula (307) is described in 908.

[0239] In some embodiments, the siRNA complex has the structure shown in formula (308): has.

[0240] [ka] During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. , Each m1, m2, or m3 is independently an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H , or C1-C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10 a alkoxy groups; R3 is a group having the structure shown in formula A59.

[0241] [ka] wherein E1 is OH, SH, or BH2, and Nu is an siRNA of the disclosure.

[0242] R2 is a linear alkylene group having a length of 1 to 20 carbon atoms, Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenile group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterosi Crylene group and C5-C 10 one or more selected from the group consisting of heteroarylene groups; Optionally substituted, R2 is C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1- C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen Substituents: -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1 -C 10alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1 -C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 Alkyl group ), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C (O)(C1-C 10 alkyl group), -N(C1-C 10 Alkyl group)C(O)(phenyl ), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl Group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, - SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH(phenyl group), -NHSO2(C1-C 10 Alkyl group), -NHSO2 (phenyl group) and -NHSO2(C1-C 10 (halogenated alkyl group) may optionally have one or more substituents, Each L1 is independently a straight chain alkylene group of 1 to 70 carbon atoms in length, or multiple carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C1 8 Heterocyclylene groups and C5-C 10 Heteroarylene groups are each selected from the group consisting of or more optionally substituted, L1 being C1-C 10 Alkyl groups, C6-C 10 Aryl Group , C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C1 0 alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C1 0 alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated A alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH 2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C1 0 alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -COH, -C(O )O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O) (C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Al Kill group)C(O)(C1-C 10 alkyl group), -N(C1-C 10Alkyl group)C(O ) (phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alki phenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Al Kill group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C 1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 Al -NHSO2(C1-C6) 10 alkyl group), - NHSO2(phenyl group) and -NHSO2(C1-C 10 (halogenated alkyl group) may optionally have one or more substituents selected from the group consisting of:

[0243] In some embodiments, L1 is selected from the group A1 through A26, or any combination thereof. The structures and definitions of A1 to A26 are as follows:

[0244] [ka] In the formula, each j1 is independently an integer from 1 to 20, and each j2 is independently an integer from 1 to 20. the law of nature, Each R' is independently C1-C 10 is an alkyl group, Each Ra is independently selected from groups represented by formulae (A27) to (A45) or any combination thereof. is selected from the group consisting of:

[0245] [ka] Each Rb is independently C1-C 10 is an alkyl group, JPEG2025038090000027.jpg6170 represents the site to which the group is covalently attached.

[0246] For convenience, L1 is defined as a linear alkylene group, but may also include, for example, the above-mentioned substitutions and / or Amines and alkenyl groups resulting from substitution that may not be linear or may have different names For purposes of this disclosure, the length of L1 is determined by dividing the length of the is the number of atoms in the chain that connects the bond points. A ring obtained by replacing a nitrogen atom (e.g., heterocyclylene or heteroarylene) is formed by atoms.

[0247] M1 represents a targeting group, and its definition and selectable range are the same as those of the targeting group described above. In some embodiments, each M1 is an asialoglycoprotein on the surface of a mammalian hepatocyte. It is one independently selected from ligands that have affinity for the receptor.

[0248] M1 has affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes. In some embodiments, n1 is an integer from 1 to 3. n3 may be an integer from 0 to 4, and the number of M1 targeting groups in the complex may be Ensure that n1+n3 is at least 2. In some embodiments, n1+n3≧2. This indicates that the number of M1 targeting groups is at least 3, and that the M1 targeting groups and the hepatic surface ascia are This complex is more easily able to bind glycoprotein receptors and is then transported through endocytosis ( The intracellular uptake mechanism can promote uptake of the compound into cells. Thus, when the number of M1 targeting groups is three or more, the M1 targeting groups and the asialoglycosaccharides on the liver surface are closely related. The ease of binding to protein receptors is unclear, so the ease of synthesis, structure / Considering various aspects such as process cost and delivery efficiency, in some embodiments, where n1 is an integer between 1 and 2, n3 is an integer between 0 and 1, and n1+n3=2 or less. The answer is 3.

[0249] In some embodiments, each m1, m2, or m3 is independently 2 to 10 When selected from the integers, the spatial location between the M1 targeting groups is determined by the asiatic relationship between the M1 targeting groups and the liver surface. The sRNAs provided by the present disclosure can be adapted to bind to glycoprotein receptors. To make RNA complexes simpler, easier to synthesize, and / or less costly In some embodiments, each m1, m2, or m3 is independently an integer of 2 to 5. are numbers, and in some embodiments, m1=m2=m3.

[0250] R 10 , R 11 , R 12 , R 13 , R 14 or R 15 But, H, C1-C 10 Alkyl group , C1-C 10 Halogenated alkyl groups and C1-C 10 Independently from each alkoxy group When one of the above is selected, any of them can change the properties of the siRNA complex of the present disclosure. It will be understood by those skilled in the art that the objectives of the present disclosure can be achieved without the need for some In the embodiment, R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are respectively In some embodiments, R1 is independently selected from H, a methyl group, or an ethyl group. 0, R 11 , R 12 , R 13 , R 14 and R 15 are both H.

[0251] R3 is a group having the structure shown in formula A59, where E1 is OH, SH, or BH2. In view of the availability of preparation raw materials, in some embodiments, E1 is OH or It's SH.

[0252] R2 is selected to achieve a bond between the N atom on the nitrogen-containing backbone and A59. In the present context, a "nitrogen-containing backbone" is R 10 , R 11 , R 12 , R 13 , R 14 Reach BiR 15 It refers to a chain structure in which carbon atoms with carbon atoms bonded to them and N atoms are bonded to each other. and R2 is any group capable of binding the A59 group to the N atom on the nitrogen-containing backbone in a suitable manner. In some embodiments, the linker group may be any linker group selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, When preparing the siRNA complex of formula (308), the R2 group is preferably a nitrogen-containing backbone. The site bonded to the N atom above and the site bonded to the P atom in R3 are both included. In some embodiments, the N atom on the nitrogen-containing backbone in R2 may be The bonded site forms an amide bond with the N atom and is bonded to the P atom on R3. forms a phosphate bond with the P atom, and in some embodiments, R2 is B5 , B6, B5' or B6'.

[0253] [ka] During the ceremony, JPEG2025038090000029.jpg6170 represents the site to which the group is covalently attached.

[0254] The value of q2 may range from 1 to 10, and in some embodiments, q 2 is an integer from 1 to 5.

[0255] L1 binds the M1 targeting group to the N on the nitrogen-containing backbone, forming a siRNP shown in formula (308). In some embodiments, the L 1 is a combination of one or more bonds selected from the groups of formulae A1 to A26. In an embodiment, L1 is selected from A1, A4, A5, A6, A8, A10, A11 and A13. In some embodiments, L is a combination of one or more bonds selected from the following: A combination of at least two bonds selected from A1, A4, A8, A10 and A11. In some embodiments, L1 is at least one selected from A1, A8, and A10. Both are combinations of two bonds.

[0256] In some embodiments, the length of L1 is 3 to 25 atoms, 3 to 20 atoms, It may be 4 to 15 atoms or 5 to 12 atoms. The length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces, 22 pieces, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 It is an atom.

[0257] In some embodiments, j1 is an integer from 2 to 10. In some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10. In some embodiments, j2 is an integer from 3 to 5. R' is a C1-C4 alkyl group. In some embodiments, R' is an alkyl group, and in some embodiments, R' is a methyl group, an ethyl group, and an isopropyl group. Ra is one of A27, A28, A29, A30 and A31. In some embodiments, Ra is A27 or A28. Rb is C1-C 5 alkyl group, and in some embodiments, Rb is a methyl group, an ethyl group, an isopropyl group, In some embodiments, the aryl group is one of a propyl group and a butyl group. By selecting j1, j2, R', Ra, and Rb, respectively, the M1 target group and the nitrogen The binding to the N atom on the containing skeleton is realized, and the spatial position between the M1 targeting group and the liver surface is adjusted. It is further adapted for binding to the asialoglycoprotein receptor.

[0258] In some embodiments, the complex has the formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412) ), (413), (414), (415), (416), (417), (418), (4 19), (420), (421) or (422).

[0259] [ka] JPEG2025038090000031.jpg218170JPEG2025038090000032.jpg214170JPEG2025038090000033.jpg209170 JPEG2025038090000034.jpg228170JPEG2025038090000035.jpg216170JPEG2025038090000036.jpg155170

[0260] In some embodiments, the P atom in formula A59 is any atom in the siRNA sequence. For example, the P atom in formula A59 may be bonded to any available position of the siRNA. It may be bound to one nucleotide of either the sense strand or the antisense strand, and any number of In some embodiments, the P atom in formula A59 is any one of the P atoms in the sense strand of the siRNA. In some embodiments, the P atom in formula A59 is linked to one nucleotide. is attached to the end of the sense strand or antisense strand of the siRNA, and in some embodiments In the formula A59, the P atom is bound to the end of the sense strand of the siRNA. The portion is the first four nucleotides from one end of the sense strand or the antisense strand. In some embodiments, the P atom in formula A59 is a nucleotide of the siRNA. and attached to the end of the sense strand or the antisense strand, in some embodiments, The P atom in is attached to the 3' end of the sense strand of the siRNA. When the siRNA complex represented by formula (308) is bound to the above position, the siRNA complex represented by formula (308) enters the cell. When the siRNA is unwound after being loaded, it releases the single antisense strand of the siRNA and binds to the PCS. Blocks the process of K9 mRNA translation into protein, suppressing PCSK9 gene expression It is possible.

[0261] In some embodiments, P in formula A59 represents a nucleotide in the siRNA. Any possible position on the nucleotide, for example, the 5' position of a nucleotide, the 2' position of a nucleotide, In some embodiments, the nucleotide may be attached to the 3' position of the nucleotide or to the base of the nucleotide. In the formula A59, the P atom is linked to the si by forming a phosphodiester bond. It may be attached to the 2', 3' or 5' position of the nucleotide in the RNA. In one embodiment, the P atom in formula A59 is the 3'-terminal nucleotide of the sense strand of the siRNA. The 3' hydroxyl group of the thiol is dehydrogenated to the oxygen atom (at this time, The P atom can be regarded as the P atom of a phosphate group contained in the siRNA), or The P atom in formula A59 is the 2'- of one nucleotide in the sense strand of the siRNA. or is attached to the nucleotide by replacing the hydrogen in the hydroxy group, or is represented by the formula A59 The P atom in the 5' hydroxyl group of the 5' terminal nucleotide of the sense strand of the siRNA is attached to the nucleotide by replacing a hydrogen atom of

[0262] The inventors of the present disclosure have found that the siRNA complex of the present disclosure has significantly improved stability in plasma and The target effect was reduced and the compound further showed high PCSK9 mRNA silencing activity. It has been unexpectedly found that the lipid-lowering effect of the present invention is further enhanced. Thus, the siRNA of the present disclosure may be one of the siRNAs shown in Tables 1a to 1g. These siRNA-containing complexes showed higher PCSK9 mRNA silencing activity. Shows.

[0263] [Table 1a] JPEG2025038090000038.jpg255163JPEG2025038090000039.jpg47170 [Table 1b] JPEG2025038090000041.jpg255164JPEG2025038090000042.jpg41170 [Table 1c] JPEG2025038090000044.jpg255166JPEG2025038090000045.jpg41170 [Table 1d] JPEG2025038090000047.jpg255167JPEG2025038090000048.jpg42170 [Table 1e] JPEG2025038090000050.jpg255166JPEG2025038090000051.jpg42170 [Table 1f] JPEG2025038090000053.jpg255168JPEG2025038090000054.jpg42170 [Table 1g]

[0264] In the siRNA or siRNA complex described in this disclosure, each adjacent nucleotide The bonds between the diesters are phosphate diester bonds or thiophosphate diester bonds. The non-bridging oxygen or sulfur atoms in the ester or thiophosphate bond are negatively charged. It is charged with a hydroxyl or sulfhydryl group. The hydrogen ions at the hydroxyl or sulfhydryl groups may be partially or completely substituted. may be entirely substituted with a cation. The cation may be any cation, for example a metal Cation, ammonium ion NH4 + may be one of the organic ammonium cations. In one embodiment, the cation is an alkali metal ion, in consideration of improving solubility. ions, ammonium cations formed by tertiary amines and quaternary ammonium cations The alkali metal ion is one or more selected from the group consisting of K + And / or Na + and the cation formed by the tertiary amine may be formed by triethylamine. Ammonium ions formed by ammonium ions and / or N,N-diisopropylethylamine The ammonium ion may be formed by the siRNP described in this disclosure. A or the siRNA complex may be present at least partially as a salt. In the case of The sulfur atoms are at least partially bound to sodium ions, and the siR The NA or siRNA complexes are present as sodium salts or partial sodium salts.

[0265] As will be apparent to those skilled in the art, nucleoside monomers having corresponding modifications can be used. The modified nucleotide groups can be introduced into the siRNAs described in this disclosure by using Methods for preparing nucleoside monomers having corresponding modifications and methods for preparing modified nucleoside monomers are provided. Methods for introducing nucleotide groups into siRNA are also well known to those skilled in the art. The leioside monomers may be purchased commercially or may be prepared by known methods. stomach.

[0266] <Preparation of siRNA complex represented by formula (308)> The siRNA complex represented by formula (308) may be prepared by any reasonable synthetic route. good.

[0267] In some embodiments, the siRNA complex of formula (308) can be prepared in the following manner: The method can be carried out under the conditions of phosphoramidite solid phase synthesis. Depending on the nucleotide types and order of the sense and antisense strands of the siRNA, the 3' Nucleoside monomers are sequentially linked from the 5' to the 5', and the linkage of each nucleoside monomer is The process involves four reactions: deprotection, coupling, capping, and oxidation or sulfurization. and isolating and annealing the sense and antisense strands of the siRNA. , the siRNA of the present disclosure.

[0268] The method also includes reacting a compound of formula (32) under coupling reaction conditions and in the presence of a coupling reagent. 1) The compound shown in 1) is mixed with a nucleoside monomer or a nucleotide bound to a solid support. and contacting the compound of formula (321) with the sequence to form a nucleotide sequence. The compound represented by formula (321) below is a conjugated molecule. It is also called.

[0269] [ka] During the ceremony, R4 is capable of binding to siRNA represented by Nu in the compound represented by formula (308). In some embodiments, R4 is a si which is represented by a covalent bond to Nu. In some embodiments, R4 is a group capable of binding to RNA. A group capable of being conjugated to any functional group of the siRNA represented by Nu via a diester bond, Each S1 was independently prepared by substituting all active hydroxy groups in M1 with YCOO- groups. each Y is a methyl group, a trifluoromethyl group, a difluoromethyl group, a fluoromethyl group, ethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-propyl group Independent of propyl, isopropyl, phenyl, halophenyl and alkylphenyl groups In some embodiments, Y is a methyl group.

[0270] n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , The definitions and selectable ranges of L1 and M1 are as described above.

[0271] R4 provides a bond with the N atom on the nitrogen-containing backbone and is represented by the formula (308). In some embodiments, the aryl group is selected to provide a suitable reactive site for the synthesis of the A-complex. In this case, R4 is an R2 linker group or a protected R2 linker group, and It contains a functional group that can form the structure shown in A59 with siRNA.

[0272] In some embodiments, R4 is an siRNA or nucleoside molecule designated Nu. a first functional group capable of forming a phosphite ester with a group on the monomer; and a hydroxy group. or a second functional group capable of reacting with an amino group to form a covalent bond, and a solid support bound by a bond. In some embodiments, the first functional group is a phosphoramidite, a hydroxy group or a protected hydroxy group. In an embodiment, the second functional group is a phosphoramidite, a carboxy group or a carbo In some embodiments, the second functional group is a phosphate. a solid support that is bound to another moiety of the molecule, said covalent bond being a hydroxy or amino group; In some embodiments, the solid support is formed of a phosphate ester In some embodiments, the bond is a carboxylic acid ester bond or an amide bond. In one embodiment, the solid support is a resin.

[0273] In some embodiments, the first functional group is a hydroxy group, -OR k or the formula ( C3), and the second functional group is represented by the formula (C1), (C2), (C3), ( It includes the structure shown in (C1') or (C3').

[0274] [ka] In the formula, q1 is an integer of 1 to 4, X is O or NH, and M + is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG2025038090000058.jpg6170 represents the site to which the group is covalently attached.

[0275] In some embodiments, the first functional group is a phosphine oxide, as shown in formula (C3): The phosphoramidite group may be at any position on the nucleotide. Coupling with a hydroxy group, for example, a hydroxy group at the 2' position or a hydroxy group at the 3' position This is reacted to form a phosphite, which is then oxidized or sulfurized to form the diphosphate shown in formula A59. The conjugated molecule is conjugated to the siRNA by forming an ester or thiophosphate bond. In this case, even if the second functional group is not present, the compound of formula (321) can be The nucleotide can be conjugated to obtain the siRNA complex shown in formula (308). In this case, siRNP is synthesized by a method such as phosphoramidite solid phase synthesis. After obtaining the sense or antisense strand of A, a compound of formula (321) and a nucleotide sequence In the latter step, the hydroxyl group on the terminal nucleotide is reacted with By forming a phosphodiester bond or a thiophosphate bond, The compound is conjugated to the siRNA.

[0276] In some embodiments, the first functional group comprises a protected hydroxy group. In some embodiments, the second functional group comprises a group capable of reacting with a solid support. The reaction provides a composite molecule comprising a solid support. The functional group of 2 is a carboxy group, a carboxyl group, or a carboxyl group as shown in formula (C1), (C2) or (C3). The second functional group includes a carboxylate or a phosphoramidite. In the case of a compound of formula (321) containing a hydroxyl group on a solid support, e.g., a resin, The group or amino group is esterified or amidated to form a carboxylic acid ester bond. The second functional group is a phosphoramidite, forming a conjugated molecule including the solid support. When the compound of formula (321) contains a hydroxyl group, it is possible to combine the compound of formula (321) with a conventional solid support, e.g., a hydroxyl group in a resin. The hydroxyl group was then reacted with the hydroxyl group, which was then oxidized and bonded via a phosphodiester bond. Then, the solid-phase carrier-bound product is reacted with the solid-phase carrier to form a complex molecule. The nucleoside monomers are sequentially linked together according to the phosphoramidite solid phase synthesis method to form a complex. The sense or antisense strand of the siRNA is obtained with the group attached. During the phase synthesis, the first functional group is deprotected and then subjected to coupling reaction conditions. The nucleoside is coupled to a phosphoramidite group on a nucleoside monomer below.

[0277] In some embodiments, the first functional group is a hydroxy group or a protected hydroxy group. The second functional group includes an oxy group, as shown in formula (C1') or (C3'): Carboxylic acid ester bonded solid phase support or amide bonded solid phase support The solid phase carrier may be a solid support or a solid support bound by a phosphate ester bond. The compound of formula (321) was used in place of the solid support and the phosphoramidite solid phase synthesis method was followed. The nucleoside monomers are sequentially linked to form the sense or axon strand of the siRNA to which the complex group is attached. Obtain the antisense strand.

[0278] In some embodiments, the carboxylate is -COO - M + This may be expressed as So, M + is a cation, e.g., a metal cation, the ammonium cation NH + , In one embodiment, the gold cation is one selected from the group consisting of organic ammonium cations. The group ion is one selected from alkali metal ions, for example, K + Or Na + in In order to improve the solubility and facilitate the reaction, some embodiments are In this case, the organic ammonium ion is the ammonium cation formed by a tertiary amine. or quaternary ammonium cations, e.g., ammonia formed by triethylamine. Ammonium ion or ammonium ion formed by N,N-diisopropylethylamine In some embodiments, the carboxylate is triethylamine carboxylate. salt or N,N-diisopropylethylamine carboxylate.

[0279] In some embodiments, R4 is selected from the group consisting of formula (B9), (B10), (B9′), (B1 0'), (B11), (B12), (B11') or (B12') .

[0280] [ka] In the formula, q1 is an integer of 1 to 4, q2 is an integer of 1 to 10, and X is O or NH. Ri, M + is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG2025038090000060.jpg6170 represents the site to which the group is covalently attached. In some embodiments, q1 is 1 or In some embodiments, q2 is an integer from 1 to 5. In some embodiments, R4 comprises a structure shown in formula (B9) or (B10). In some embodiments, R4 comprises a structure shown in formula (B11) or (B12).

[0281] In some embodiments, R k Tr (trityl group), MMTr (4-methoxy trityl group), DMTr (4,4'-bismethoxytrityl group), TMTr (4,4', 4″-trimethoxytrityl group). In some embodiments, R k DMTr, i.e., 4,4'-bismethoxytrityl (4,4'-dimetho xytrityl).

[0282] The definition of L1 is as described above.

[0283] In some embodiments, L1 binds the M1 targeting group to an N atom on the nitrogen-containing backbone. , is used to provide liver targeting functionality to the siRNA complex shown in formula (308). In some embodiments, L1 includes any one or combination of A1 to A26. nothing.

[0284] From the above description, it will be readily understood by those skilled in the art that the phosphorylation Compared with the midite solid phase synthesis method, the above first functional group and the optional second functional group allow for complex The nucleotide sequence may be inserted at any possible position in the nucleotide sequence, for example at the end of the nucleotide sequence, and obtaining an siRNA complex represented by formula (308) linked to the end of the nucleotide sequence. Accordingly, unless otherwise specified, the preparation of the complex and / or the complex molecule is described below. In the description of the above, the terms "deprotection", "coupling", "capping", "oxidation", When referring to reactions such as "sulfurization," reference is made to solid-phase synthesis methods for phosphoramidite nucleic acids known in the art. It should be understood that the reaction conditions and reagents described in the methods also apply to these reactions as well. Exemplary reaction conditions and reagents are described in detail below.

[0285] In some embodiments, each S1 is independently M1. In the formula, each S1 independently represents a hydroxy group in M1, and In some embodiments, each S1 is independently a group protected by a protecting group. All of the active hydroxy groups present in are protected with hydroxy protecting groups. In embodiments, any hydroxy protecting group known to one of skill in the art can be used to protect the active hydroxyl group in M1. In some embodiments, the protected hydroxyl group can be used to protect the hydroxyl group. The hydroxy group may be represented by the formula YCOO-, where each Y is independently C1-C 10 Al Alkyl groups and C6-C 10 aryl groups, wherein the C1-C 10 Alkyl Groups and C6-C 10 The aryl group is optionally substituted with one or more substituents, said substituents being , halogen, and a C1-C6 alkyl group. In the formula, each Y is independently a methyl group, a trifluoromethyl group, a difluoromethyl group, a monomethyl group, Monofluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and C1-C6 arsenic group alkylphenyl groups.

[0286] In some embodiments, each S1 is independently selected from the group consisting of formulae A46-A54. is selected from the group.

[0287] [ka]

[0288] In some embodiments, S1 is of formula A49 or A50.

[0289] In some embodiments, each Y is a methyl group, a trifluoromethyl group, a difluoro Methyl group, fluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group , ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and alkyl group. In some embodiments, Y is independently selected from the group consisting of phenyl and phenyl. It is a ethyl group.

[0290] As described above, the method for preparing the siRNA complex represented by formula (308) is The other strand of the siRNA is synthesized (for example, the sense strand of the siRNA to which the conjugated molecule is bound in the above step). When the siRNA is synthesized, the antisense strand of the siRNA is further synthesized according to a solid phase synthesis method. and vice versa), isolating and annealing the sense and antisense strands. Specifically, in the isolating step, the nucleotide sequence and / or The solid support bound to the conjugate molecule is cleaved and the necessary protecting groups are removed (in this case In the case of the compound of formula (321), each S1 group in the compound of formula (321) is converted to the corresponding M1 target group), The sense strand (or antisense strand) of the siRNA bound to the synthetic molecule and the corresponding antisense strand The sense strand (or antisense strand) is obtained, and the sense strand and the antisense strand are annealed to form a double-stranded RNA. A structure is formed to obtain the siRNA complex shown in formula (308).

[0291] In some embodiments, the method for preparing the siRNA complex represented by formula (308) is Under coupling reaction conditions and in the presence of a coupling reagent, a compound of formula (321) can be obtained. contacting the first nucleoside monomer at the 3' end of the sense strand or the antisense strand; The compound represented by formula (321) is attached to the first nucleotide in the sequence, and phospho The desired sense or antisense nucleotide species are synthesized under the conditions of fluoroamidite solid phase synthesis. Depending on the type and order, nucleoside monomers are linked in the 3' to 5' direction to form siRNP. A step of synthesizing a sense strand or an antisense strand of A, the compound of formula (321) being R 4, a first functional group including a protected hydroxy group, and a compound represented by formula (C1') or (C3') A compound comprising a second functional group having the structure shown in Prior to coupling with the mer, the compound of formula (321) is deprotected and each nucleoside monomer is coupled. The reaction involves four steps: deprotection, coupling, capping, and oxidation or sulfurization. Obtaining the sense or antisense strand of the combined nucleic acid; phosphoramidite solid phase synthesis Under the conditions, the 3' to 5' sequence is determined by the type and order of nucleotides in the antisense or sense strand. Nucleoside monomers are sequentially linked toward the antisense or sense strand of the nucleic acid. Each nucleoside monomer bond is deprotected, coupled, capped, oxidized or The reaction involves four reactions: sulfurization, removal of protecting groups, cleavage from the solid support, and isolation and purification to obtain the sense strand. and obtaining and annealing an antisense strand.

[0292] In some embodiments, the method for preparing the siRNA complex represented by formula (308) is The types and order of nucleotides in the sense strand or antisense strand of the double-stranded siRNA The nucleoside monomers are linked in sequence from 3' to 5' to form the sense strand and the α strand. The antisense strand is synthesized, and the bonds of each nucleoside monomer are deprotected, coupled, and capped. The reaction involves four steps: ping, oxidation or sulfurization, and the sense strand bound to a solid support, and Obtaining the antisense strand bound to the substrate; coupling reaction conditions and coupling reagents In the presence of The antisense strand is contacted with a carrier and a first phosphoramidite group is attached to R4. A compound of formula (321) containing a functional group is attached to the sense strand or antisense strand, and a protecting group is formed. The siRNA with the complex group bound thereto is then cleaved from the solid support by removing the group, and then isolated and purified. and annealing the sense or antisense strand of the nucleic acid.

[0293] In some embodiments, the P atom in formula A59 is a sense atom in the siRNA. The method for preparing the siRNA complex shown in formula (308) is as follows: (1) A compound of formula (321) (the compound of formula (321) is a compound having a protected hydroxyl group at R4) Si-OR k and a first functional group having a structure represented by formula (C1') or (C3'): The hydroxy-protecting group R k Remove the The deprotected product is converted to a nucleoside under coupling reaction conditions and in the presence of a coupling reagent. and contacting the monomer to obtain a nucleoside monomer that is bound to the solid support by a conjugate molecule. thing, (2) Starting with the nucleoside monomer that is bound to the solid support by the conjugated molecule, The sense strand of siRNA was synthesized by phosphoramidite solid-phase synthesis in the '-5' direction. To do, (3) Synthesize the antisense strand of siRNA by phosphoramidite solid-phase synthesis. To do so, (4) The sense and antisense strands of the siRNA are isolated and annealed to give the following formula (308): The method includes obtaining a siRNA complex as shown in

[0294] In step (1), the protecting group R in the compound of the above formula (321) k How to remove The method includes contacting a compound of formula (321) with a deprotecting reagent under deprotecting conditions. The conditions are that the temperature is 0 to 50° C., in some embodiments 15 to 35° C., and the reaction time is 30 In some embodiments, the deprotection reagent is trifluoromethylphenyl. One or more selected from the group consisting of dichloroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. In some embodiments, dichloroacetic acid is used. The molar ratio of the compound is 10:1 to 1000:1, and in some embodiments, 50:1 to The ratio is 500:1.

[0295] The coupling reaction conditions and coupling reagents are suitable for the above coupling reaction. In some embodiments, solid phase synthesis is employed. The same conditions and reagents may be used as in the coupling reaction in the method.

[0296] In some embodiments, the coupling reaction conditions include a reaction temperature of 0 to 50° C. In some embodiments, the reaction temperature is 15 to 35° C. The molar ratio of the monomer is 1:1 to 1:50, and in some embodiments, 1:2 to 1:5. The molar ratio of the compound of formula (321) to the coupling reagent is 1:1 to 1:50. In some embodiments, the ratio is 1:3 to 1:10, and the reaction time is 200 to 3000 seconds, and in some embodiments, 500 to 1500 seconds. 5-Ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole In some embodiments, one or more of the following are selected from the group consisting of 5-ethylthio 1H-tetrahydrofuran, The coupling reaction may be carried out in an organic solvent, is one or more selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane In some embodiments, anhydrous acetonitrile is used. In contrast, the dosage of the organic solvent is 3 to 50 L / mol, and in some embodiments, 5 to 20 L. / mol.

[0297] In step (2), the nucleic acid prepared in the above step is synthesized by a phosphoramidite nucleic acid solid phase synthesis method. Starting with a nucleoside monomer that is bound to a solid support by a conjugated molecule, 3'-5' The sense strand SS of the siRNA complex is synthesized in the direction of It is attached to the 3' end of the sense strand.

[0298] Other conditions for the solid phase synthesis in steps (2) and (3) include deprotection of nucleoside monomers. Protection conditions, type and amount of deprotection reagent, coupling reaction conditions, type and amount of coupling reagent Dosage, conditions for capping reaction, type and dosage of capping reagent, conditions for oxidation reaction, oxidation The types and amounts of reagents, sulfurization reaction conditions, and the types and amounts of sulfurization reagents are included. Various reagents, dosages and conditions are used.

[0299] For example, in some embodiments, in steps (2) and (3), the solid phase synthesis Then, the following conditions may be used:

[0300] The deprotection conditions for the nucleoside monomers are a temperature of 0 to 50° C., and in some embodiments, 1 The temperature is 5 to 35° C., and the reaction time is 30 to 300 seconds, and in some embodiments, 50 to 150 seconds. and the deprotection reagent is trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, chloroacetic acid and in some embodiments, dichloroacetic acid. The molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group on the solid support is It may be from 2:1 to 100:1, and in some embodiments is from 3:1 to 50:1.

[0301] The coupling reaction conditions are at a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The molar ratio of the nucleic acid sequence bound to the solid support to the nucleoside monomer is 1:1 to 1: 50, and in some embodiments 1:5 to 1:15, bound to a solid support. The molar ratio of the nucleic acid sequence to be coupled is 1:1 to 1:100. The reaction time and the selection of coupling reagents are the same as above. be.

[0302] The capping reaction conditions include a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The reaction time is 5 to 500 seconds, and in some embodiments, 10 to 100 seconds. The selection of capping reagent is the same as above. The total amount of capping reagent and the amount of the solid support bound to the capping reagent are the same as above. The molar ratio of the nucleic acid sequence to the nucleic acid sequence is 1:100 to 100:1, and in some embodiments, 1:10 to 1 0:1. Equimolar amounts of acetic anhydride and N-methylimidazole are used as capping reagents. When using the method described above, acetic anhydride, N-methylimidazole, and the nucleic acid sequence to be bound to the solid support are used. The molar ratio may be from 1:1:10 to 10:10:1, and in some embodiments is 1:1 :2~2:2:1.

[0303] The oxidation reaction conditions are a temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The reaction time is from 1 to 100 seconds, in some embodiments from 5 to 50 seconds, and the oxidation reagent is In some embodiments, it is iodine (provided in some embodiments as iodine water). The molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid support in the coupling step is 1. The ratio may be from 5:1 to 100:1, and in some embodiments, from 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a 3:1 mixture of tetrahydrofuran:water:pyridine. The sulfurization reaction is carried out in a mixed solvent of 1 to 1:1:3. The sulfurization reaction conditions are temperature of 0 to 50°C, several In some embodiments, the temperature is 15 to 35° C., and the reaction time is 50 to 2000 seconds. is 100 to 1000 seconds, and the sulfurizing reagent is, in some embodiments, xanthan hydride. The molar ratio of the sulfurization reagent to the nucleic acid sequence that is bound to the solid support in the coupling step is The ratio is from 10:1 to 1000:1, and in some embodiments, from 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a solvent mixture of acetonitrile:pyridine=1:3 to 3: It is carried out in a mixed solvent of 1:1.

[0304] After all nucleoside monomers have been coupled and before annealing, the method further comprises: The method further comprises isolating the sense and antisense strands of A. Methods for isolating are known to those skilled in the art. Generally, the synthesized nucleotide sequence is cleaved from the solid support and the base is phosphorylated. This includes removing the protecting groups on the acid groups and on the ligands, purifying and desalting.

[0305] The synthesized nucleotide sequence is cleaved from the solid support and the bases, phosphate groups and ligands are removed. The above protecting groups can be removed by standard cleavage and deprotection methods used in siRNA synthesis. For example, the resulting solid support-bound nucleotide sequence may be dissolved in concentrated aqueous ammonia. In the deprotection process, the protecting group YCOO- of A46 to A54 is converted to a hydroxy group. and converting the S1 group to the corresponding M1 group to obtain the siRNA complex shown in formula (308). Here, the concentrated ammonia water is 25 to 30% by weight of ammonia water. The amount of concentrated ammonia water is 0.2 ml / mL for the siRNA sequence of interest. It may be from μmol to 0.8 ml / μmol.

[0306] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, The method comprises the steps of: cleaving the nucleotide sequence from the solid support by cleaving the nucleotide sequence with triethylamine trihydrofluoride; This further comprises removing the 2'-TBDMS protection by contacting the In this case, the corresponding nucleotide in the obtained siRNA sequence of interest contains two free The dose of pure triethylamine trihydrofluoride is The concentration may be 0.4 ml / μmol to 1.0 ml / μmol for the corresponding siRNA sequence. In this manner, the siRNA complex shown in formula (308) can be obtained.

[0307] Methods of purification and desalting are well known to those skilled in the art. For example, preparative ion chromatography. Purification of nucleic acids using a chromatographic purification column and gradient elution with NaBr or NaCl The product was collected, combined, and desalted using a reversed-phase chromatography purification column. It is possible.

[0308] In the thus obtained siRNA complex represented by formula (308), the nucleotide A non-bridging oxygen atom or sulfur atom in the phosphodiester or thiophosphodiester bond between The yellow atom is essentially bound to a sodium ion, and is represented by the formula (308): The NA complex exists primarily as a sodium salt. and replacing the sodium ions with hydrogen ions and / or other cations to form other types of formulas. The cation can be used in the same manner as described above. That is correct.

[0309] During the synthesis process, the purity and molecular weight of the nucleic acid sequence can be constantly detected to better control the synthesis quality. Such detection methods are known to those skilled in the art. For example, ion exchange chromatography Nucleic acid purity was detected by liquid chromatography tandem mass spectrometry (LCMS). The molecular weight can be measured by C-MS.

[0310] Annealing methods are also well known to those skilled in the art. The sense strand (SS strand) and the antisense strand (AS strand) were mixed in an equal molar ratio with water for injection and incubated for 70-90 min. 5°C and then cooled to room temperature, allowing the formation of a double-stranded structure through hydrogen bonds. In this manner, the siRNA complex shown in formula (308) can be obtained.

[0311] After obtaining the complex, in some embodiments, the complex may be purified by, for example, liquid chromatography. Using methods such as tandem mass spectrometry, the synthesized compound shown in formula (308) was analyzed by molecular weight detection, etc. We clarified the characteristics of the siRNA complexes that were synthesized, and confirmed that the siRNA complexes The siRNA complex shown in formula (308) and the sequence of the synthesized siRNA is the desired siRNA sequence, e.g., one of the sequences shown in Tables 1a-1g. It is also possible.

[0312] The compound of formula (321) can be prepared by the reaction of the esterification reaction with a base in an organic solvent. and contacting the compound represented by formula (313) with a cyclic acid anhydride in the presence of an esterification catalyst. followed by ion exchange and isolation to obtain the compound of formula (321). can be obtained by:

[0313] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L 1、 The definition and selectable range of each S1 are as described above. R6 is a group that provides R4 in formula (321). In some embodiments, , R6 has the structure shown in formula (A61).

[0314] [ka] In the formula, R i can achieve bonding with the N atom on the nitrogen-containing backbone, R k Combined with O to form one is any group to which a free hydroxy group of k is a hydroxy protecting group. In this case, R4 includes a first functional group as a hydroxy protecting group and a second functional group, A compound of formula (321) in which the second functional group contains a structure represented by formula (C1) or (C2) is obtained. can be done.

[0315] The esterification reaction conditions are a reaction temperature of 0 to 100° C. and a reaction time of 8 to 48 hours. In some embodiments, the esterification reaction conditions include a reaction temperature of 10 to 4 The temperature is 0°C and the reaction time is 20 to 30 hours.

[0316] In some embodiments, the organic solvent is an epoxy solvent, an ether solvent, a haloperidol solvent, or a cyclohexane solvent. Alkyl halogenated solvents, dimethyl sulfoxide, N,N-dimethylformamide and N , N-diisopropylethylamine. In some embodiments, The epoxy solvent is dioxane and / or tetrahydrofuran, and the acetone is The tert-butyl ether solvent is ethyl ether and / or methyl tert-butyl ether, The halogenated alkyl solvents are dichloromethane, trichloromethane and 1,2-dichloromethane. In some embodiments, the organic solvent is one or more of dichloromethane. The amount of the organic solvent is 3 to 3% by weight based on the compound represented by the formula (313). ~50 L / mol, and in some embodiments, 5-20 L / mol.

[0317] In some embodiments, the cyclic acid anhydride is succinic anhydride, glutaric anhydride. anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments , succinic anhydride. The compound represented by the formula (313) and the cyclic acid anhydride The ratio of the fluorine atom to the fluorine atom is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.

[0318] The esterification catalyst may be any catalyst that catalyzes the esterification reaction, e.g. For example, the catalyst may be 4-dimethylaminopyridine. ) is 1:1 to 10:1 in some embodiments. , 2:1~5:1.

[0319] In some embodiments, the base is any inorganic base, organic base, or combination thereof. Considering the solubility and stability of the product, the base may be, for example, In some embodiments, the tertiary amine is a triethylamine. The tertiary amine and the formula (3 13) is 1:1 to 20:1 in molar ratio, and in some embodiments, The ratio is between 3:1 and 10:1.

[0320] The ion exchange reaction is carried out by reacting the compound of formula (321) with the desired carboxylic acid or carboxylate. The ion exchange method is known to those skilled in the art, and a suitable ion exchange Using the solution and exchange conditions, M + It is possible to obtain a complex molecule having a cation, which is described in detail here. In some embodiments, the ion exchange reaction is carried out using triethylamine. The concentration of the triethylamine phosphate solution is 0.2 to 100%. 0.8M, and in some embodiments, the triethylamine phosphate solution The concentration is 0.4 to 0.6 M, and the triethylamine is The dosage of the phosphate solution is 3-6 L / mol, and in a further embodiment 4-5 L / mol. She is an office lady.

[0321] Isolating the compound of formula (321) from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the mixture is subjected to a chromatographic method. The compound of formula (321) can be isolated by, for example, (1) normal phase purification silica gel 200-300 mesh silica gel packing material, 1 wt% triethylamine Gradient elution with chloromethane:methanol = 100:18 to 100:20, or 2) Reverse phase purification: C18, C8 reverse phase packing was used in methanol:acetonitrile = 0.1:1 ~ The compounds were isolated using two chromatographic conditions: 1:0.1 gradient elution and 2:1 gradient elution. In some embodiments, the solvent can be directly removed to provide a crude product of compound of Formula (321). The crude product can be used as is in the subsequent reaction.

[0322] In some embodiments, the method for preparing a compound of Formula (321) comprises the steps of: In an organic solvent, the above ion exchange reaction is carried out in the presence of a condensation agent, a condensation catalyst and a tertiary amine. The product obtained by the reaction is then contacted with a solid phase carrier containing an amino group or a hydroxy group. In this case, R4 includes a first functional group and a second functional group, and the first The functional group comprises a hydroxy protecting group and the second functional group comprises the structure shown in formula (C1'): Compound (321) is obtained.

[0323] The solid phase support is one of the supports used in solid phase synthesis of siRNA. Some are known to those of skill in the art. For example, the solid phase support may have an active hydroxy or amino group. In some embodiments, the solid support may be selected from a solid support that includes a functional group. In some embodiments, the amino resin is a hydroxy resin. The resin or hydroxy resin has a particle size of 100 to 400 mesh, and the surface The amino or hydroxyl group loading parameter is 0.2 to 0.5 mmol / g. The dosage ratio of the compound represented by the formula (321) to the solid phase carrier is 10 to 400 μmol. Compound / gram of solid support (μmol / g). The dosage ratio of the compound represented by formula (321) to the solid support is 50 to 200 μmol / g. .

[0324] The organic solvent may be any suitable solvent or mixture of solvents known to those skilled in the art. In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ether, Solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethylformamide In some embodiments, the amine is one or more of N,N-diisopropylethylamine and N,N-diisopropylethylamine. In the embodiment, the epoxy solvent is dioxane and / or tetrahydrofuran. The ether solvent is ethyl ether and / or methyl tert-butyl ether. The halogenated alkyl solvent is dichloromethane, trichloromethane, and 1,2 In some embodiments, the organic solvent is one or more of: is acetonitrile. The amount of the organic solvent is 20 for the compound of formula (321). In some embodiments, the concentration is 50 to 100 L / mol. do.

[0325] In some embodiments, the condensing agent is benzotriazol-1-yl-oxy Tripyrrolidino-phosphonium hexafluorophosphate / ester (benzotri iazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate, PyBop), 3-diethoxyphosphoryl -1,2,3-Benzoxazol-4(3H)-one (3-(Diethoxyphos phoryloxy)-1,2,3-benzotriazin-4(3H)-one, DEPBT) and / or O-benzotriazole-tetramethyluronium hexafluoro O-benzotriazol-1-yl-tetramethylbenzoate / ester thyluronium hexafluorophosphate), In some embodiments, the condensing agent is O-benzotriazole-tetramethyl ether. The condensation agent is tetrafluoromethane hexafluorophosphate / ester. The molar ratio of the compound to be treated is 1:1 to 20:1, and in another embodiment, 1:1 to 5: The answer is 1.

[0326] In some embodiments, the tertiary amine is triethylamine and / or N, N-diisopropylethylamine, and in some embodiments, N,N-diisopropyl propylethylamine, and the molar ratio of the tertiary amine to the compound represented by formula (321) The ratio of the fluorine-containing polymer to the fluorine-containing polymer is from 1:1 to 20:1, and in some embodiments, from 1:1 to 5:1.

[0327] In some embodiments, the method for preparing a compound of Formula (321) comprises a capping reaction The resulting condensation product is reacted with a capping reagent and an acylation catalyst in an organic solvent under the conditions described above. and isolating to obtain a compound of formula (321). The function of the capping reaction is to avoid the generation of unwanted by-products in subsequent reactions. The first step is to remove any active reactive functional groups that have not yet fully reacted in order to obtain a The conditions for the capping reaction are a reaction temperature of 0 to 50° C., and in some embodiments, 15 to 3 5° C., and the reaction time is 1 to 10 hours, and in some embodiments, 3 to 6 hours. The capping reagent may be a capping reagent known to those skilled in the art for use in solid-phase synthesis of siRNA. may also be used.

[0328] In some embodiments, the capping reagent is capping reagent 1 (cap 1) and capping reagent 2 (cap2), where capping reagent 1 is N-methyl imidazole, and in some embodiments, pyridine of N-methylimidazole. It is supplied as a pyridine / acetonitrile mixture with a volume ratio of 1:1. 10 to 1:1, and in some embodiments, 1:3 to 1:1, and pyridine and The volume ratio of the total volume of acetonitrile to N-methylimidazole is 1:1 to 10:1. In some embodiments, the ratio is 3:1 to 7:1. In some embodiments, the capping reagent 2 is acetic anhydride. It is supplied as a solution in acetonitrile with a volume ratio of acetic anhydride to acetonitrile of 1:1. to 1:10, and in a further embodiment from 1:2 to 1:6.

[0329] In some embodiments, the N-methylimidazole is The ratio of the volume of the mixed solution to the mass of the compound of formula (321) is 5 ml / g to 50 ml / g. In some embodiments, the acetic anhydride acetone concentration is 15 ml / g to 30 ml / g. The ratio of the volume of the trinitrile solution to the mass of the compound of formula (321) is 0.5 ml / g to 10 ml. / g, and in some embodiments, 1 ml / g to 5 ml / g.

[0330] In some embodiments, the capping reagent comprises equimolar amounts of acetic anhydride and N In some embodiments, the organic solvent is acetonitrile. Nitriles, epoxy solvents, ether solvents, halogenated alkyl solvents, dimethyl sulfur 1) 1-Hexoxide, N,N-dimethylformamide and N,N-diisopropylethylamine In some embodiments, the organic solvent is acetonitrile. The amount of the organic solvent is 10 to 50 L / mol, or In some embodiments, it is 5 to 30 L / mol.

[0331] In some embodiments, the acylation catalyst is an esterification condensation or an amidation condensation catalyst. The catalyst may be selected from any catalyst that can be used in the reaction of the present invention, for example, an alkali heterocyclic compound. In one embodiment, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the solvent to the compound represented by formula (321) is 0.001:1 to 1:1. In some embodiments, the ratio is 0.01:1 to 0.1:1.

[0332] In some embodiments, the compound of formula (321) is isolated from the reaction mixture by any suitable isolation method. In some embodiments, the compound can be isolated by thorough washing with an organic solvent. purify and filter to remove unreacted reactants, excess capping reagent, and other impurities. The compound of formula (321) can be obtained by the above. The organic solvent is acetonitrile, dichloromethane, methanol, and in some embodiments, acetonitrile It is.

[0333] In some embodiments, the method for preparing the conjugated molecule of formula (321) comprises the steps of: In the present invention, under coupling reaction conditions and in the presence of a coupling reagent, The compound shown is contacted with a phosphorodiamidite and isolated to give the compound shown in formula (321). In this case, R4 includes a first functional group and a second functional group, and the first functional group is wherein the functional group comprises a hydroxy protecting group and the second functional group comprises a structure shown in formula (C3): Compound (321) is obtained.

[0334] In some embodiments, the coupling reaction conditions may be at a temperature of 0 to 50° C. The reaction temperature is usually, for example, 15 to 35° C. The reaction temperature is preferably 15 to 35° C. The ratio of the amines may be 1:1 to 1:50, for example, 1:5 to 1:15, and is represented by the formula (313): The molar ratio of the compound to the coupling reagent may be 1:1 to 1:100, for example 1 The reaction time may be 200 to 3000 seconds, for example, 500 The phosphorodiamidite is, for example, bis(diisopropylamino )(2-cyanoethoxy)phosphine may be used, which may be purchased commercially, or It may be synthesized by methods known in the art. The coupling reagent is 1H-tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole The coupling agent is one or more of the above-mentioned compounds, for example, 5-ethylthio-1H-tetrazole. The pulling reaction may be carried out in an organic solvent, and the organic solvent may be anhydrous acetonitrile, anhydrous One or more selected from water, DMF, and anhydrous dichloromethane, for example, anhydrous acetonitrile. In some embodiments, the compound of formula (313) is The amount of the organic solvent is 3 to 50 L / mol, and may be, for example, 5 to 20 L / mol. By carrying out the coupling reaction, the hydroxy group in the compound of formula (313) is With a phosphoramidite to form a phosphoramidite group. In this embodiment, the solvent can be directly removed to obtain the crude compound of formula (321), The crude product can be used as is in the subsequent reaction.

[0335] In some embodiments, the method for preparing a compound of Formula (321) comprises a coupling reaction The product obtained by isolating the product obtained by reacting the product with the product obtained by reacting ... and then contacting the solid phase carrier with a hydroxy group-containing solid phase carrier. The compound of formula (321) is obtained by carrying out a cycloaddition reaction, an oxidation reaction, and isolating the compound. and a second functional group, the first functional group comprising a hydroxy protecting group and the second functional group comprising a A compound of formula (321) in which the functional group has the structure shown in formula (C3') is obtained.

[0336] In some embodiments, the solid support is a suitable substrate for solid phase synthesis of nucleic acids as known in the art. For example, a commercially available general-purpose solid phase support (NittoPhase) that has been deprotected is ase(R)HL UnyLinker TM 300 Oligonucleotides ide Synthesis Support, Kinovate Life Science Nces Corporation, the structure of which is shown in formula B80.

[0337] [ka]

[0338] Deprotection reactions are known to those skilled in the art. In some embodiments, the deprotection conditions are The temperature is 0 to 50°C, for example 15 to 35°C, and the reaction time is 30 to 300 seconds, for example 50 to The deprotection reagents were trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. and in some embodiments, one or more selected from: The deprotection reagent is dichloroacetic acid. -dimethoxytrityl) protecting group is 2:1 to 100:1 in molar ratio, for example, 3:1 to The ratio of the deprotection ratio to the ratio of the reaction mixture to the reaction mixture is 50:1. By carrying out the deprotection, reactive A free hydroxy group is obtained, making it accessible for the next coupling reaction.

[0339] The coupling reaction conditions and the selection of coupling reagents are as described above. By carrying out a coupling reaction, the free hydroxyl group formed in the deprotection reaction and the phosphoryl group The midite groups are reacted to form phosphite linkages.

[0340] In some embodiments, the capping reaction conditions include a temperature of 0 to 50° C., e.g., 1 The temperature is 5 to 35° C., the reaction time is 5 to 500 seconds, for example, 10 to 100 seconds, The capping reaction is carried out in the presence of a capping reagent. The choice and dosage of the capping reagent are as described above. As follows.

[0341] The conditions for the oxidation reaction are a temperature of 0 to 50° C., for example, 15 to 35° C., and a reaction time of The time may be 1 to 100 seconds, for example 5 to 50 seconds, and the oxidation reagent may be, for example, iodine. In some embodiments, the iodine may be provided as iodine water. The molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid support is 1:1 to 100:1, e.g. For example, the ratio may be 5:1 to 50:1. The reaction is carried out in a mixed solvent of dihydrofuran:water:pyridine=3:1:1 to 1:1:3.

[0342] In some embodiments, R6 is one of the groups of formula B7 or B8.

[0343] [ka] In the formula, q2, R k The definition is as described above.

[0344] In this case, the compound represented by formula (313) can be reacted in an organic solvent under amidation reaction conditions: and amidation reaction: In the presence of a condensing agent and a tertiary amine, a compound represented by formula (314) is converted into contacting the compound represented by formula (A-1) or the compound represented by formula (A-2) with the compound represented by formula (A-3) and then isolating the compound represented by formula (A-4); It can be obtained by the preparation method described above.

[0345] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R14 , R 15 , L1, S1, q2 and R k The definitions and available ranges of each are as described above. be.

[0346] The amidation reaction conditions are a reaction temperature of 0 to 100° C. and a reaction time of 1 to 48 hours. In some embodiments, the amidation reaction conditions include a reaction temperature of 10 to 4 The temperature is 0°C and the reaction time is 2 to 16 hours.

[0347] In some embodiments, the organic solvent is an alcohol solvent, an epoxy solvent, Ether solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethyl formamide and N,N-diisopropylethylamine. In some embodiments, the alcohol solvent is methanol, ethanol, propanol, or the like. In some embodiments, the epoxy is one or more of ethanol. The alkoxy solvent, in some embodiments, is dioxane and / or tetrahydrofuran. In some embodiments, the ether solvent is ethyl ether and / or is methyl tert-butyl ether. The halogenated alkyl solvents include In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane In some embodiments, the organic solvent is dichloromethane. The amount of the organic solvent is 3 to 50 L / mol relative to the compound of formula (314); In a further embodiment, it is from 3 to 20 L / mol.

[0348] In some embodiments, the amidation reaction condensing agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one, 4-(4 ,6-Dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (4-(4,6 -dimethoxytriazin-2-yl)-4-methylmorpholi ne hydrochloride), 2-ethoxy-1-ethoxycarbonyl-1,2 -Dihydroquinoline (EEDQ) or O-benzotriazole-tetramethyluronium In a further embodiment, 3-diethoxy hexafluorophosphate / ester. The amidation is diphosphoryl-1,2,3-benzoxazol-4(3H)-one. The molar ratio of the reaction condensation agent to the compound represented by formula (314) may be 1:1 to 10:1. In some embodiments, the ratio is from 2.5:1 to 5:1.

[0349] In some embodiments, the tertiary amine is triethylamine or N,N-diethylamine. In a further embodiment, N,N-diisopropyl ethyl amine. The molar ratio of the tertiary amine to the compound represented by formula (314) is 3: It is 1 to 20:1, and in some embodiments, it is 5:1 to 10:1.

[0350] In some embodiments, the compounds of formula (A-1) and formula (A-2) may be any suitable For example, R k When is a DMTr group, glyceric acid The compound of formula (A-1) can be prepared by reacting calcium with DMTrCl. Similarly, 3-amino-1,2-propanediol was contacted with a cyclic acid anhydride, and then DMTr was added. Cl to prepare a compound of formula (A-2), The acid anhydride may be a cyclic acid anhydride having 4 to 13 carbon atoms, and in some embodiments, 4 to 8 carbon atoms. As can be easily understood by those skilled in the art, the selection of the cyclic acid anhydride is based on the compound (A-2). For example, the cyclic anhydride may be succinic anhydride. When the cyclic acid anhydride is glutaric anhydride, q2=1. 2, which may be inferred.

[0351] In some variations, the compound of formula (314) can be prepared by reacting the cyclic anhydride, 3- By reacting sequentially with amino-1,2-propanediol and DMTrCl, 313) can also be prepared. These modifications do not affect the structure and function of the compound of formula (313) and are within the scope of the present invention. This can be easily achieved by the vendor using the above method.

[0352] As above, the compound of formula (313) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the chromatograph may be The compound of formula (313) can be isolated by a chromatography method, for example, (1) normal phase purification. Silica gel: 200-300 mesh silica gel packing material, petroleum ether: ethyl acetate Alcohol:dichloromethane:N,N-dimethylformamide=1:1:1:0.5~1:1:1 (2) Reverse-phase purification: C18 and C8 reverse-phase packings were used with a gradient elution of 0.6. The two chromatographs were eluted with a gradient of ethanol:acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the solvent can be directly isolated using chromatographic conditions. The crude product of the compound of formula (313) can be obtained by removing the crude product, which can be directly used for the subsequent It can be used in the reaction.

[0353] In some embodiments, the compound represented by Formula (314) is reacted in an organic solvent with Amidation reaction In the presence of a condensing agent and a tertiary amine, under condensation reaction conditions, a compound represented by formula (320) is obtained. contacting a compound represented by formula (316) with a compound represented by formula (316), followed by isolation. It can be obtained by law.

[0354] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 The definitions and selectable ranges of each are as described above.

[0355] As the compound of formula (316), for example, the compound described in J. Am. Chem. Soc. 201 Compounds disclosed in US Pat. No. 4,136,16958-16961 may be used, or compounds of the formula ( 316) The compounds can be prepared by those skilled in the art by various methods, for example, those described in U.S. Pat. With reference to the method disclosed in Example 1 of US Pat. No. 8,106,022 B2, several formulas (3 16), the entire contents of which are incorporated herein by reference in their entirety. INCORPORATED INTO THE SPECIFICATION.

[0356] In some embodiments, the condensation reaction conditions include a reaction temperature of 0 to 100° C. The reaction time is 0.1 to 24 hours, and in some embodiments, the reaction temperature is 10 to 40° C. and the reaction time is 0.5 to 16 hours.

[0357] Considering the structure of the desired product, compound of formula (314), the compound shown in formula (316) above The molar ratio of the compound to be reacted with the compound represented by the formula (320) is It should be determined based on the sum of n1 and n3. In some embodiments, for example, , when n1 + n3 = 3, to ensure that the reaction is complete and not excessive, 316) and the compound represented by the formula (320) in a molar ratio of 3:1 to 3 0.5:1, and in some embodiments, 3.01:1 to 3.15:1. be.

[0358] In some embodiments, the organic solvent is acetonitrile, an epoxy solvent, an ethylene oxide solvent, Ether solvents, halogenated alkyl solvents, dimethyl sulfoxide, N,N-dimethyl ether and N,N-diisopropylethylamine, The alkoxy solvent, in some embodiments, is dioxane and / or tetrahydrofuran. In some embodiments, the ether solvent is ethyl ether and / or is methyl tert-butyl ether, and the halogenated alkyl solvent is In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane In some embodiments, the organic solvent is dichloromethane. For the compound of formula (320), the amount of the organic solvent is 3 to 50 L / mol. In some embodiments, the concentration is 5 to 20 L / mol.

[0359] In some embodiments, the amidation reaction condensing agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPB T), O-benzotriazole-tetramethyluronium hexafluorophosphate / Ester, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine salt or 1-hydroxybenzotriazole, in further embodiments. In the present invention, benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluoride It is a mixture of fluorophosphates / esters and 1-hydroxybenzotriazole. Triazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphonium The phosphate / ester and 1-hydroxybenzotriazole are used in equimolar amounts. The molar ratio of the total amidation reaction condensing agent to the compound represented by formula (316) is 1:1 to 3:1. In some embodiments, the ratio is 1.05:1 to 1.5:1.

[0360] The tertiary amine is N-methylmorpholine, triethylamine or N,N-diisopropylamine. In some embodiments, N-methylmorpholino The molar ratio of the tertiary amine to the compound represented by formula (316) is 2:1 to 10. :1, and in some embodiments, is from 2:1 to 5:1.

[0361] Similarly as above, the compound of formula (314) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the chromatograph may be The compound of formula (314) can be isolated by a chromatography method, for example: (1) normal phase purification Silica gel: 200-300 mesh silica gel packing material, dichloromethane:methanol (2) Reverse phase purification: C18, C 8. Elute the reversed-phase packing with a gradient of methanol:acetonitrile = 0.1:1 to 1:0.1. In some embodiments, the chromatographic conditions are: In the above, the solvent can be directly removed to obtain the crude product of the compound of formula (314), The product can be used as is in subsequent reactions.

[0362] Compounds of formula (320) can be obtained commercially or by methods known to those skilled in the art. For example, m1 = m2 = m3 = 3, n1 = 1, and n3 = 2, and each R 10 , R 11 , R 12 , R 13 , R 14 , R 15 When both are H, equation (320) The compound can be purchased commercially from Alfa Aesar.

[0363] The siRNA complexes of the present disclosure may be used in combination with other pharma- ceutically acceptable additives. The additive may be one or more of a variety of agents or compounds commonly used in the art. For details, see the description of the pharmaceutical composition of the present disclosure above.

[0364] Uses of the siRNA, drug composition, and complex of the present disclosure In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or the siRNA complex for treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene. The present invention provides a method for the preparation of a medicament for treatment and / or prophylaxis.

[0365] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or administering to a subject in need thereof an effective amount of the siRNA complex. The present invention provides a method for preventing and / or treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene. do.

[0366] siRNA active components of the present disclosure can be administered to a subject in need thereof to induce RNase activity. Preventing and / or preventing diseases or physiological conditions caused by abnormal expression of the PCSK9 gene by the A interference mechanism Therefore, the siRNA and / or the drug of the present disclosure can achieve the therapeutic purpose. The compound composition and / or the siRNA complex is intended to treat a disease or condition caused by abnormal expression of the PCSK9 gene. It is used for the prevention and / or treatment of chronic conditions, or for the treatment of diseases or conditions caused by abnormal expression of the PCSK9 gene. can be used in the preparation of a medicament for the prevention and / or treatment of a physiological condition.

[0367] In some embodiments, the disease or physiological condition is caused by abnormal expression of the PCSK9 gene. is hypercholesterolemia and the associated atherosclerosis, coronary heart disease, This refers to cardiovascular diseases such as high blood pressure.

[0368] As used herein, the term "pharmaceutical administration / administration" refers to the administration of siRNA, drug compositions of the present disclosure. and / or localizing at least a portion of the siRNA complex to a desired site to produce a desired effect. The siRNA, drug composition and / or siRNA complex of the present disclosure can be administered by any method or route that allows the siRNA to be administered. Suitable routes of administration for the methods of the present disclosure include topical administration and Local administration generally results in more siRNA being delivered to the subject than to the systemic circulation of the subject. The complex is delivered to a specific site, but systemic administration of the siRNA, drug composition of the present disclosure and / or the siRNA complex is delivered to the basal systemic circulation of the subject. Considering the possibility of providing a means for preventing and / or treating teratemia, several In some embodiments, an administration method is employed that can deliver the drug to the liver.

[0369] Administration to a subject can be by any suitable route known in the art, including, but not limited to, Oral or non-gastrointestinal routes, e.g., intravenous, intramuscular, subcutaneous, transdermal, intratracheal Intravenous (aerosol), pulmonary, nasal, rectal and local (buccal and sublingual) The frequency of administration may be daily, weekly, or biweekly. , once or more than once every three weeks, once a month, twice a month, three months, six months or once a year.

[0370] The dosage of the siRNA, drug composition or siRNA complex described in this disclosure may be determined by methods known in the art. The dose may be a usual dose for the patient, said dose being determined according to various parameters, in particular the age of the subject. Toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals. Measure sex and treatment effects, e.g., LD 50 (the dose that kills 50% of the colony), ED 50 (In a quantitative response, this refers to the dose that can induce 50% of the maximum response intensity. IC refers to the dose at which a positive sexual response occurs in 50% of experimental subjects 50 The concentration of inhibitor / drug at which the quantitative response is half-inhibited may be measured. A range of human dosages can be derived based on data obtained from nutritional analyses and animal studies. do.

[0371] When administering the siRNA, drug composition and / or siRNA complex described in this disclosure, For example, male or female cynomolgus monkeys aged 3 to 5 years and weighing 2 to 6 kg were Regarding the amount of RNA, (i) for the siRNA complex, the siRNA dose was 0.001 up to 100 mg / kg body weight, and in some embodiments, 0.01 to 50 mg / kg kg body weight, and in some embodiments, 0.05 to 20 mg / kg body weight, In some embodiments, the amount is 0.1 to 15 mg / kg body weight, and in some embodiments, the amount is 0.1 to 15 mg / kg body weight. In one embodiment, the amount is 0.1 to 10 mg / kg body weight, and (ii) siRNA and pharmacologic For the pharmaceutical composition formed with an acceptable carrier, the siRNA dosage is 0.001 up to 50 mg / kg body weight, and in some embodiments 0.01 to 10 mg / kg g body weight, in some embodiments 0.05 to 5 mg / kg body weight, in some embodiments 0.05 to 5 mg / kg body weight, In an embodiment, the dose is 0.1 to 3 mg / kg body weight.

[0372] In some embodiments, the present disclosure provides siRNA and / or drug compositions of the present disclosure. and / or contacting a liver cell with an effective amount of the siRNA complex of the present disclosure. Alternatively, a drug composition and / or a siRNA complex is introduced into the hepatocytes, and the hepatocytes are stimulated by the RNA interference mechanism. The present invention relates to a method for suppressing the expression of PCSK9 gene in liver cells. The present invention provides a method for suppressing the expression of the PCSK9 gene in SMMC- 7721, HepG2, Huh7, or other hepatoma cell lines or isolated primary hepatocytes. In some embodiments, the cells are HepG2 liver cancer cells.

[0373] The methods provided by the present disclosure inhibit expression of the PCSK9 gene in a cell. siRNA in the provided modified siRNA, drug composition and / or siRNA complex The dose is generally between 1 pM and 1 μM on the target cell surface, which can reduce the expression of the target gene. is 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM The amount required to achieve that local concentration will depend on the delivery method, Delivery site, number of cell layers between the delivery site and the target cell or tissue, delivery route (local or systemic), etc. The concentration at the delivery site varies depending on a variety of factors, including the surface of the target cell or tissue. The concentration may be significantly higher than that in

[0374] <Kit> The present disclosure relates to at least one of the modified siRNAs, drug compositions, and siRNA complexes of the present disclosure. A kit is provided that contains an effective amount of the species.

[0375] In some embodiments, the kits described herein include a container containing the modified siRNA. In some embodiments, the kits described herein can include In some embodiments, the container may include a container providing a pharma- ceutically acceptable excipient. Thus, the kit may contain other ingredients, such as stabilizers or preservatives. In some embodiments, the kits described herein include the modified s At least one other therapeutic agent may be included in a container separate from the container providing the iRNA. In some embodiments, the kit comprises a modified siRNA and a pharma- ceutically acceptable carrier and and / or instructions for mixing the composition and / or additives or other ingredients, if present.

[0376] In the kit of the present disclosure, the modified siRNA and a pharma- ceutically acceptable carrier and / or Additives and the modified siRNA, drug composition and / or siRNA complex and / or The complex, and / or the pharma- ceutically acceptable excipient may be in any form, e.g., liquid form, dry form, or mixtures thereof. In some embodiments, the modified form may be provided in a dry or lyophilized form. A modified siRNA and a pharma- ceutically acceptable carrier and / or excipient, and the pharmaceutical composition. and / or the complex and any pharma- ceutically acceptable additives are essentially clean and / or In some embodiments, sterile water can be provided in the kits of the present disclosure. Cut.

[0377] The present disclosure will be further described below with reference to examples, but the present disclosure is not limited thereto. do not have. EXAMPLES

[0378] Unless otherwise specified, all reagents and media used in the following examples are commercially available products. The nucleic acid electrophoresis and real-time PCR procedures used are all performed by Molecular cular Cloning(Cold Spring Harbor Laborat This is carried out with reference to the method described in (Ory Press, 1989).

[0379] siRNA, siRNA complex or the like against the PCSK9 gene synthesized according to the present disclosure When cells were transfected with siRNA or siRNA complex as a negative control, Lipofectamine as a transfection reagent TM2000 (Invitation For specific operations, refer to the instructions provided by the manufacturer. This is what I mean.

[0380] Unless otherwise stated, all reagent proportions provided below are by volume (v / v). It is calculated.

[0381] All experimental data

number

[0382] (Preparation Example 1) Preparation of Complex 1 In this preparation example, complex 1, numbered L10-siPCSKa1M1S, shown in Table 3, was synthesized. The siRNA complexed to the complex was the sense strand corresponding to complex 1 in Table 3. and the antisense strand sequence.

[0383] (1-1) Synthesis of Compound L-10 Compound L-10 was synthesized according to the following method.

[0384] [ka]

[0385] (1-1-1) Synthesis of Complex Terminal Segment GAL-5 [ka]

[0386] (1-1-1a) Synthesis of GAL-2 100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: 1772-03-8, purchased from Ningbo Hongxiang Biochemical Co., Ltd., 463.8 mmol) 1000 ml 100 ml of anhydrous pyridine, and 540 ml of acetic anhydride (purchased from Enox, The reaction mixture was stirred at room temperature for 1.5 hours. The reaction mixture was poured into 10 L of ice water. The cake was washed with 2 L of ice water and then cooled to room temperature until completely dissolved. Add acetonitrile / toluene mixed solvent (acetonitrile:toluene volume ratio = 1:1) The solvent was evaporated to dryness to obtain 130.0 g of a white solid product, GAL-2.

[0387] (1-1-1b) Synthesis of GAL-3 The GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was The mixture was dissolved in 3 ml of anhydrous 1,2-dichloroethane and heated in an ice-water bath under nitrogen protection to obtain a 24.0 mL sample. g of trimethylsilyl trifluoromethanesulfonate (TMSOTf, CAS number: 27 607-77-8, purchased from Macklin, 108.0 mmol) was added and reacted at room temperature overnight. He responded.

[0388] The reaction mixture was diluted with 400 ml of dichloromethane, filtered through diatomaceous earth, and then added to 1 L of saturated charcoal. Add an aqueous solution of sodium hydrogen carbonate, stir evenly, separate the organic phase, and dichloroethane into the aqueous phase. Extract twice with 300 ml each time, combine the organic phases, and add 300 ml of saturated The mixture was washed with an aqueous solution of sodium bicarbonate and 300 ml of saturated saline, and the organic phase was separated and dried. The mixture was dried over sodium sulfate, and the solvent was evaporated to dryness under reduced pressure to give 26.9 g of a pale yellow, viscous starch syrup-like product. The product GAL-3 was obtained.

[0389] (1-1-1c) Synthesis of GAL-4 The GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was Dissolve in 6 ml of anhydrous 1,2-dichloroethane and add 30 g of dried 4 Å molecular sieve powder. 9.0 g of 5-hexen-1-ol (CAS number: 821-41-0, Adamas- Beta Co., Ltd., 89.9 mmol) was added, stirred at room temperature for 30 minutes, and then cooled in an ice bath and nitrogen. Under the protection of the base, 9.08 g of TMSOTf (40.9 mmol) was added and the reaction was stirred at room temperature overnight. The 4Å molecular sieve powder was removed by filtration, and the filtrate was diluted with 300 ml of dichloromethane. The mixture was filtered through diatomaceous earth, 500 ml of saturated aqueous sodium bicarbonate was added, and the mixture was stirred for 10 minutes. The organic phase was separated and the aqueous phase was extracted once with 300 ml of dichloroethane. Combined, 300 ml of saturated sodium bicarbonate solution and 300 ml of saturated saline solution were used. The organic phase was separated, dried over anhydrous sodium sulfate, and the solvent was evaporated to dryness under reduced pressure. 1.3 g of yellow syrup-like product GAL-4 was obtained, which was used in the next oxidation reaction without purification. went.

[0390] (1-1-1d) Synthesis of GAL-5 GAL-4 (14.9 g, 34 0.7 mmol) was dissolved in a mixture of 77 ml of dichloromethane and 77 ml of acetonitrile. The mixture was dissolved in 103 ml of deionized water and 29.7 g of sodium periodate (CA S number: 7790-28-5, purchased from Aladdin, 138.8 mmol) was added. The mixture was stirred in an ice-water bath for 10 minutes, and ruthenium(III) chloride (CAS number: 14898-6 7-0, purchased from Energy Co., 238 mg, 1.145 mmol) was added and the mixture was stirred at room temperature for 1 h. The reaction mixture was diluted with 300 ml of water and stirred, and saturated sodium bicarbonate was added. The pH was then adjusted to about 7.5, the organic phase was separated and discarded, and the aqueous phase was washed once with dichloromethane. The mixture was extracted three times with 200 ml of water per 100 ml of water, and the organic phase was discarded. The pH of the aqueous phase was adjusted to about 3 with solid citric acid. The extract was then extracted three times with dichloromethane, each time at 200 ml. The organic phases were combined and washed with anhydrous sulfuric acid. The solvent was evaporated to dryness under reduced pressure to give 6.85 g of a white foamy solid product, GAL I got -5. 1 H NMR (400 MHz,DMSO) δ 12.01 (br, 1H),7.83 (d,J = 9.2 Hz,1H),5.21 (d,J = 3 .2 Hz,1H),4.96 (dd,J = 11.2,3.2 Hz,1H),4 .49 (d,J = 8.4 Hz,1H),4.07-3.95 (m,3H),3 .92-3.85 (m,1H),3.74-3.67 (m,1H),3.48-3. 39 (m,1H),2.20 (t,J = 6.8 Hz,2H),2.11 (s ,3H),2.00 (s,3H),1.90 (s,3H),1.77 (s,3H) ,1.55-1.45 (m,4H).

[0391] (1-1-2) Synthesis of L-8 [ka]

[0392] J-0 (9.886 g, 52.5 mmol, purchased from Alfa Acer Inc.) and process ( GAL-5 (72.819 g, 162.75 mmol, multiple loci) obtained in 1-1-1 Dissolve the above mixture (a combination of the products from the previous batch) in 525 ml of dichloromethane and add diisopropyl Ethylamine (DIEA, 44.782g, 346.50mmol), Benzotriazol 1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ess PyBOP (90.158 g, 173.25 mmol) and hydroxybenzotriester Add azole (HOBt, 23.410 g, 173.25 mmol) and react at room temperature for 4 hours. Then, 20 ml of saturated sodium bicarbonate and 200 ml of saturated saline were added to wash the mixture. The aqueous phase was extracted twice with dichloromethane, 100 ml each time, and the organic phases were combined and washed with anhydrous sulfuric acid. The crude product was obtained by drying over sodium hydroxide, filtering, and then evaporating the solvent under reduced pressure to dryness. 200-300 mesh normal phase silica gel was used, and silica was purified with 10 wt% triethylamine. Neutralize the acidity of the gel, equilibrate the column with 1 wt‰ triethylamine, and then add dichloromethane. Elute with a gradient of 100:25 to 100:40 methanol, and collect the product eluate. The extract was evaporated to dryness under reduced pressure to give 38.8 g of pure L-8. 1 H NMR (400 MHz ,DMSO) δ 7.84 (d,J = 9.0 Hz,3H),7.27-7.2 3 (m,1H),7.13-7.18 (m,1H),5.22 (d,J = 3. 1 Hz,3H),4.97 (dd,J = 11.3,3.1 Hz,3H),4. 48 (d,J = 8.4 Hz,3H),4.09-3.98 (m,9H),3. 88 (dd,J = 19.3,9.3 Hz,3H),3.75-3.66 (m, 3H),3.44-3.38 (m,3H),3.17-3.30 (m,4H),3. 10-2.97 (m,4H),2.35-2.20 (m,6H),2.15-2.0 8 (m,9H),2.07-1.98 (m,13H),1.94-1.87 (m, 9H),1.81-1.74 (m,9H),1.65-1.42 (m,18H). MS m / z:C 85 H 119 N7O 30 , [M+H] + ,Theoretical value: 1477.59,Actual value: Measured value: 1477.23.

[0393] (1-1-3a) Synthesis of A-1 [ka]

[0394] DMTrCl (4,4'-bismethoxytrityl chloride, 101.65 g, 300 m mol) was dissolved in 1000 ml of anhydrous pyridine and DL-calcium glycerate hydrate was obtained. The reaction mixture was added to the flask (28.63 g, 100 mmol) and reacted at 45° C. for 20 hours. The reaction mixture was then filtered. The cake was rinsed with 200 ml of DCM, the filtrate was concentrated under reduced pressure to dryness, and the remainder was 1 of dichloromethane, and 0.5 M triethylamine phosphate (pH = 7.5-1.0). 8), wash twice with 200 ml each time, and then wash the aqueous phase with dichloromethane, 20 The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed. The mixture was evaporated to dryness under reduced pressure, and purified using a 200-300 mesh normal phase silica gel column. Alcohol:ethyl acetate:dichloromethane:methanol=1:1:1:0.35 to 1:1:1:0 The product eluate was collected and the solvent was evaporated to dryness under reduced pressure. Redissolve in dichloromethane and wash once with 200 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted once with 200 ml of dichloromethane, and the organic phases were combined and washed with anhydrous sodium sulfate. The mixture was dried over sodium, filtered, and the solvent was evaporated to dryness under reduced pressure, then the mixture was cooled to 50°C overnight using a vacuum oil pump. 7 g of a white solid product A-1 was obtained. 1 H NMR (400 MHz, DMSO-d6) δ 7.46 (ddd,J = 6.5,2.3,1.1 Hz,1H),7.40 -7.28 (m,7H),6.89-6.81 (m,4H),4.84 (d,J = 5.0 Hz,1H),4.36-4.24 (m,1H),4.29 (s,6H ),3.92 (dd,J = 12.4,7.0 Hz,1H),3.67 (dd, J = 12.3,7.0 Hz,1H),2.52 (q,J = 6.3 Hz,6 H),1.03 (t,J = 6.3 Hz,9H). MS m / z:C 24 H 23 O6, [MH] - , theoretical value: 407.15, measured value: 406.92.

[0395] (1-1-3b) Synthesis of L-7 [ka]

[0396] L-8 (40 g, 27.09 mmol, multiple lots) obtained in step (1-1-2) The products were combined and A-1 (41.418 g, 81 0.27mmol) and dissolved in 271ml of dichloromethane, and Phosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPBT) (24. Add 318 g, 81.37 mmol of diisopropylethylamine (21.0 07g, 162.54mmol) was added, and the mixture was stirred at 25°C for 1.5 hours. Wash the organic phase with saturated sodium bicarbonate and the aqueous phase with dichloromethane, 50 ml at a time. The organic phase was washed with 150 ml of saturated saline, and the aqueous phase was extracted with 50 ml of dichloromethane. Extract once with methane, combine the organic phases, dry over anhydrous sodium sulfate, filter, and dissolve. The agent was evaporated to dryness under reduced pressure, and then foam-dried overnight using a vacuum oil pump to obtain a crude product. 2 kg of 200-300 mesh normal phase silica gel was used, and 200 ml of triethylamine was added. The acidity of the silica gel was neutralized with amine, and the silica gel was then colored with petroleum ether containing 1 wt% triethylamine. The mixture was equilibrated with petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide. Gradient elution with mido = 1:1:1:0.5 to 1:1:1:0.6 was performed, and the product eluate was collected. The solvent was evaporated to dryness under reduced pressure to give 40.4 g of pure L-7. 1 H NMR (400 M Hz,DMSO) δ7.90-7.78 (m,4H),7.75-7.64 (m, 1H),7.38-7.18 (m,9H),6.91-6.83 (m,4H),5. 25-5.10 (m,4H),4.97 (dd,J = 11.2,3.2 Hz, 3H),4.48-4.30 (m,4H),4.02 (s,9H),3.93-3. 84 (m,3H),3.76-3.66 (m,9H),3.45-3.35 (m, 3H),3.24-2.98 (m,10H),2.30-2.20 (m,2H),2 .11-1.88 (m,31H),1.80-1.40 (m,28H). MS m / z:C 90 H 128 N7O35 , [M-DMTr] + ,Theoretical value: 1564.65,Actual value Value: 1564.88.

[0397] Synthesis of (1-1-4)L-9 [ka]

[0398] L-7 (40 g, 21.4247 mmol) obtained in step (1-1-3b), amber Acid anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine ( DMAP, 5.235 g, 42.8494 mmol) was mixed in 215 mL of dichloromethane. Dissolve diisopropylethylamine (DIEA, 13.845 g, 10 Add 7.1235 mmol) and stir at 25°C for 24 hours. Add 800 ml of 0.5 M triethyl ether. Wash the reaction mixture with diethylamine phosphate, and then wash the aqueous phase with dichloromethane, 3 times with 5 ml each. The organic phases were combined and evaporated to dryness under reduced pressure to obtain the crude product. Normal phase silica gel of 00 to 300 mesh was used, and silica gel was purified with 1 wt% triethylamine. The acidity of the column was neutralized, and the column was equilibrated with dichloromethane and diluted with 1 wt‰ triethylamine. Gradient elution with dichloromethane:methanol = 100:18 to 100:20, product eluate The extract was collected and the solvent was evaporated to dryness under reduced pressure to obtain 31.0 g of pure L-9 complex molecule. 1 HN MR (400 MHz,DMSO) δ 8.58 (d,J = 4.2 Hz,1 H),7.94-7.82 (m,3H),7.41-7.29 (m,5H),7.2 2 (d,J = 8.1 Hz,5H),6.89 (d,J = 8.3 Hz,4 H),5.49-5.37 (m,1H),5.21 (d,J = 3.0 Hz,3 H),4.97 (d,J = 11.1 Hz,3H),4.49 (d,J = 8 .2 Hz,3H),4.02 (s,9H),3.88 (dd,J = 19.4, 9.4 Hz,3H),3.77-3.65 (m,9H),3.50-3.39 (m ,6H),3.11-2.90 (m,5H),2.61-2.54 (m,4H),2 .47-2.41 (m,2H),2.26-2.17 (m,2H),2.15-1. 95 (m,22H),1.92-1.84 (m,9H),1.80-1.70 (m ,10H),1.65-1.35 (m,17H),1.31-1.19 (m,4H) ,0.96 (t,J = 7.1 Hz,9H). MS m / z:C 94 H 132 N 7O 38 , [M-DMTr] + , theoretical value: 1664.72, actual value: 1665.03.

[0399] (1-1-5) Synthesis of Compound L-10 [ka]

[0400] In this step, the L-9 conjugate molecule is bound to a solid support to form the L-10 compound. was prepared.

[0401] The L-9 complex molecule (22.751 g, 11 mmol) obtained in step (1-1-4), O -Benzotriazole-tetramethyluronium hexafluorophosphate / ester (HBTU, 6.257 g, 16.5 mmol) and diisopropylethylamine (DI EA, 2.843 g, 22 mmol) was mixed and dissolved in 900 ml of acetonitrile. The reaction mixture was stirred at room temperature for 5 minutes, and aminomethyl resin (88 g, 100-200 mesh, Amino group loading amount 400 μmol / g, purchased from Nankai Waseisha Co., Ltd.) was added and incubated on a shaker at 25°C. The reaction was carried out at 150 rpm for 18 hours, after which the cake was filtered and separated into 100 ml of DC Rinse twice with 300 ml of M, then rinse twice with 300 ml of acetonitrile. The mixture was then rinsed three times with water and dried for 18 hours using a vacuum oil pump. (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) The capping reaction was carried out by adding The reaction was carried out for 5 hours at 100°C for 5 minutes, the reaction liquid was filtered, and the cake was washed with acetonitrile in 300 ml portions at a time. Rinse three times with 1L, evaporate the solvent under reduced pressure until dry, and dry overnight under reduced pressure with a vacuum oil pump. 02g, and a loading of 90.8 μmol / g of L-10 compound (i.e., L bound to a solid support). -9 complex molecule).

[0402] [Table 2]

[0403] where CapA and CapB are capping reagent solutions, CapA is 20 volumes % N-methylimidazole in a pyridine / acetonitrile mixture. The volume ratio of acetonitrile to acetic anhydride is 3:5, and CapB is 20% by volume of acetonitrile. It is a tolyl solution.

[0404] (1-2) Synthesis of the sense strand of complex 1 Starting from the L-10 compound prepared in the above step, the solid-phase phosphoramidite method was used to The nucleotides are rotated one by one in the 3'-5' direction according to the nucleotide sequence of the sense strand. The nucleoside monomers were then linked to synthesize the sense strand of siRNA complex 1 in Table 3. Each time a side monomer is bonded, the following steps are performed: deprotection, coupling, capping, oxidation, or sulfurization. Four reactions were performed. When two nucleotides are linked by a phosphate ester, When combining nucleoside monomers, deprotection, coupling, capping, and oxidation are performed. Four reactions were performed. When the two nucleotides were linked by a phosphorothioate, When attaching the next nucleoside monomer, protection, coupling, capping, sulfurization The four reactions were carried out under the following conditions:

[0405] Nucleoside monomers were provided in acetonitrile at 0.1 M concentration for each deprotection reaction. The conditions were the same, that is, the temperature was 25° C., the reaction time was 70 seconds, and the deprotection reagent was , a solution of dichloroacetic acid in dichloromethane (3% v / v), The molar ratio of the 4,4'-dimethoxytrityl protecting group in the dimethylformamide was 5:1.

[0406] The coupling reaction conditions were the same for all reactions, with the temperature at 25°C and the solid support The molar ratio of the nucleic acid sequence to be bound to the nucleoside monomer is 1:10, and the nucleic acid sequence is bound to a solid support. The molar ratio of the nucleic acid sequence to the coupling reagent was 1:65, and the reaction time was 600 seconds. and the coupling reagent is 5-ethylthio-1H-tetrazole (5-(Ethyl 0.5M solution of 1H-thiotetrazole (ETT) in acetonitrile. Ta.

[0407] The capping conditions were the same for all of them, with the temperature being 25°C and the reaction time being 15 min. The capping reagent solution was a mixture of CapA and CapB in a molar ratio of 1:1. A solution in which the molar ratio of the capping reagent to the nucleic acid sequence to be bound to the solid support is acetic anhydride The ratio of the substance:N-methylimidazole:nucleic acid sequence bound to the solid support was 1:1:1.

[0408] The conditions for each oxidation reaction were the same: temperature 25°C, reaction time 15 seconds, and acid The iodine-based reagent was 0.05M iodine water. The molar ratio of the nucleic acid sequence bound to the carrier was 30:1. The reaction was carried out in tetrahydrofuran: The reaction was carried out using a mixed solvent of water:pyridine = 3:1:1.

[0409] The conditions for each sulfurization reaction were the same: temperature 25°C, reaction time 300 seconds; The sulfurization reagent was xanthan hydride. The sulfurization reagent and the solid-supported The molar ratio of the nucleic acid sequence to be bound to the antibody was 120:1. The experiment was carried out using a 1:1 mixed solvent of ethylene glycol and ethylenediaminetetraacetate.

[0410] After the coupling of the last nucleoside monomer is completed, the nucleic acid sequence bound to the solid support is The resulting mixture was then cleaved, deprotected, purified, and desalted in that order, and then lyophilized to obtain the sense strand.

[0411] The cleavage and deprotection conditions are as follows: The column was added to ammonia water with a concentration of 25 wt%, and the dosage of ammonia water was 0.5 ml / μmo. The mixture was reacted at 55°C for 16 h, the remaining carrier was removed by filtration, and the supernatant was concentrated under vacuum to dryness. did.

[0412] The purification and desalting conditions were as follows: Preparative ion chromatography purification column Purification of the nucleic acids was accomplished by gradient elution with NaCl (Source 15Q). Specifically, eluent A was 20 mM sodium phosphate (pH 8.1), and the solvent was water / acetonitrile. Nitrile = 9:1 (volume ratio), eluent B: 1.5M sodium chloride, 20mM phosphorus The solvent was water / acetonitrile = 9:1 (volume ratio), Elution gradient: Eluent A:Eluent B = 100:0 to 50:50. After collecting, they are combined and desalted using a reverse phase chromatography purification column. The mixture was desalted using a dextran gel column, and the packing material was dextran gel G25 (Sep hadex G25) and was eluted with deionized water.

[0413] The detection method is as follows: Ion exchange chromatography (IEX-HPLC) The purity of the sense strand was detected using liquid chromatography-mass spectrometry (LC-MS). The molecular weight was analyzed by the method described above. The measured value was consistent with the theoretical value, and the L-9 complex molecule was present at the 3' end. It was shown that the conjugated sense strand SS was synthesized.

[0414] (1-3) Synthesis of antisense strand of complex 1 The solid-phase phosphoramidite method was used to prepare a standard solid-phase support (UnyLinker TM loa Deded NittoPhase® HL Solid Supports, Novate Life Sciences) was used as the starting material, and the multiple The antisense strand of the compound 1 was synthesized. The conditions for the cleavage and deprotection, oxidation or sulfurization reaction, purification and desalting of the sense strand are The same procedure was followed by freeze-drying to obtain the antisense strand. The purity of the antisense strand was detected by IEX-HPLC and The molecular weight was analyzed by liquid crystal mass spectrometry (LC-MS). The measured value was consistent with the theoretical value. This indicates that the antisense strand AS having the desired sequence was synthesized.

[0415] (1-4) Synthesis of Complex 1 For complex 1, the sense strand and the antisense strand were dissolved in water for injection, and each was diluted to 40 μl. The mixture was mixed in an equimolar ratio, heated at 50°C for 15 min, and cooled at room temperature. The annealed product was obtained and freeze-dried to obtain a freeze-dried powder. Dilute the complex using a Li-Q ultrapure water system (resistivity 18.2 MΩ*cm (25 °C)). The concentration was adjusted to 0.2 mg / mL, and then the solution was analyzed by liquid chromatography-mass spectrometry (LC-MS, L iquid Chromatography-Mass Spectrometry, W The molecular weight was detected using a fluoropolymer (purchased from Aters, model number: LCT Premier). The values ​​were consistent with the theoretical values, and the synthesized siRNA complex 1 was confirmed to contain the L-9 complex molecule. It has been shown that the double-stranded nucleic acid sequence is a complex of the structure shown in formula (403). The siRNA sequences used were those shown in Table 3, Complex 1 (L10-siPCSKa1M1S The sequence corresponded to the sequence (also called the sequence of the nucleotide sequence).

[0416] (Preparation Example 2) Preparation of Complexes 2 to 7 The sense and antisense strand sequences are shown in Table 3. The sense and antisense strands of siRNA conjugated to Complex 4, Complex 5, Complex 6, or Complex 7 The sequences shown in Table 3 were synthesized in the same manner as in Preparation Example 1, except that the sequences were the same as those in Preparation Example 1. Complexes 2 to 7 were synthesized and molecular weight detection was performed. Ta.

[0417] Table 3 shows the complex numbers and siRNA sequence compositions.

[0418] [Table 3]

[0419] (Preparation Example 3) Synthesis of siRNA sequence 1) For the sense strand, a general-purpose solid support (UnyLinker TM loaded NittoPhase(R) HL Solid Supports, Kinova The company started the cycle with the launch of TE Life Sciences. 2) For the antisense strand, the sequence of siRNA 1 is complexed with complex 1. The antisense strand of siRNA 1 has a 1′-terminal sequence at the 5′-end compared to the antisense strand sequence of NA. The 5'-phosphate is located at the 5th nucleotide. In the process of preparing the antisense strand, the last nucleoside monomer of the antisense strand is After the coupling of the carboxyl group, four reactions, namely deprotection, coupling, capping, and oxidation, were carried out to obtain the CP. RI monomer (Suzhou Jiji, Cat#13-2601-XX) was added to the 5 The procedure was the same as in Preparation Example 1, except that the 5'-phosphate ester modification was formed by binding to the ' end of the siRNA 1 shown in Table 4 was synthesized by the method described above.

[0420] [ka]

[0421] the conditions of the deprotection, coupling, capping and oxidation reactions used in said conjugation; The conditions for cleavage, deprotection, purification and desalting were the same as those for the synthesis of the sense strand.

[0422] The nucleic acid sequences of the sense and antisense strands of siRNA are shown in Table 4. The sequences were synthesized to be the sense and antisense strands of NA2, but siRNA 2 was prepared in the same manner as in the preparation of RNA 1, and siRNA 2 was obtained.

[0423] The nucleic acid sequences of the sense and antisense strands of siRNA are shown in Table 4. The sense strand and the nucleotide sequence corresponding to siRNA 3, siRNA 4, siRNA 5, or siRNA 6 are shown in Table 1. The 5'-end of the antisense strand of these siRNAs was synthesized to be the antisense strand sequence. The first nucleotide of the CPR-I monoclonal antibody has a 5'-thiophosphate modification. When a 5'-thiomer is bonded, the sulfurization reaction conditions are used instead of the oxidation reaction conditions described above. The preparation of siRNA 1 was similar to that of siRNA 1 except that an antisense strand with phosphate ester modification was obtained. siRNAs 3 to 6 were prepared by the same method as that used in the manufacture of siRNAs 3 to 6. 3, siRNA 4, siRNA 5 or siRNA 6 were obtained.

[0424] Table 4 shows the siRNA numbers and siRNA sequence compositions.

[0425] [Table 4]

[0426] (Experimental Example 1) Inhibitory activity and off-task of siRNA in the in vitro psiCHECK system Detecting target effects

[0427] In this experimental example, each of siRNAs 1 to 6 was detected in the in vitro psiCHECK system. Inhibition of expression of target plasmid by sense strand, sense strand and antisense strand of each siRNA Detect off-target plasmid expression suppression by the seed region or the seed region of the sense strand By doing so, the on-target activity and off-target effects of the siRNAs of the present disclosure can be evaluated. It was worth it.

[0428] Kumico Ui-Tei et.al.,Functional dissect ion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalia n gene silencing with significantly redu ced off-target effect. Nucleic Acids Res According to the method described in Journal of the American College of Medicine, 2008.36(7), 2136-2151, the test plates were The test plasmid and test siRNA were cotransfected into HEK293A cells. The expression level of the dual luciferase reporter gene was then used to determine the SI The on-target activity and off-target effects of RNA were reflected. The specific steps are as follows: As shown below.

[0429] [1] Construction of test plasmids

[0430] psiCHECK TM-2(Promega TM ) plasmids were used to test four types of The plasmids were constructed, in which GSCM represents the on-target plasmid, PSCM, G SSM and PSSM indicated off-target plasmids.

[0431] (1) GSCM detects the on-target activity of the antisense strand of siRNA. A target sequence containing a region completely complementary to the antisense strand sequence of the test siRNA. and the target sequences in the GSCM corresponding to siRNA 1, 2, 4, 5 and 6 are SEQ ID NO: As shown in Figure 373. 5'-GGCGTGCCTGCCAAGCTCACACAGCAGGAACTGAGC CAGAAACGGAGATTGGGCTGGCTCTGAAGCCAAGCCTCTT CTTACTTCACCCGGCTGGGCTCCTCATTTTTACGGGTAAC AGTGAGGCTGGGAAGGGGAACACAGACCAGGAAGCTCGGT GAGTGATGGCAGAACGATGCCTGCAGGCATGGAACTTTTT CCGTTATCACCCAGGCCTGATTCACTGGCCTGGCGGAGAT GCTTCTAAGGCATGGTCGGGGGAGAGGGCCAACAACTGTC CCTCCTTGAGCACCAGCCCCACCCAAGCAAGCAGACATTT ATCTTTTGGGTCTGTCCTCTCTGTTGCCTTTTTACAGCCA ACTTTTCTAGACCTGTTTTGCTTTTGTAACTTGAAGATAT TTATTCTGGGTTTTGTAGCATTTTTATTAATATGGTGACT TTTTAAAATAAAAACAAACAAACGTTGTCCTAACAAAAAA AAAAAAAAAAAAAAA-3' (SEQ ID NO:373)

[0432] The target sequence in GSCM corresponding to siRNA 3 is shown in SEQ ID NO:374. 5'-GCGTGGCCAAGGGTGCCAGCATGCGCAGCCTGCGCG TGCTCAACTGCCAAGGGAAGGGCACGGTTAGCGGCACCCT CATAGGCCTGGAGTTTATTCGGAAAAGCCAGCTGGTCCAG CCTGTGGGGCCACTGGTGGTGCTGCTGCCCCTGGCGGGTG GGTACAGCCGCGTCCTCAACGCCGCCTGCCAGCGCTGGC GAGGGCTGGGGTCGTGCTGGTCACCGCTGCCGGCAACTTC CGGGACGATGCCTGCCTCTACTCCCCAGCCTCAGCTCCCG AGGTCATCACAGTTGGGGCCACCAATGCCCAAGACCAGCC GGTGACCCTGGGGACTTTGGGGACCAACTTTGGCCGCTGT GTGGACCTCTTTGCCCCAGGGAGGACATCATTGGTGCCT CCAGCGACTGCAGCACCTGCTTTGTGTCACAGAGTGGGAC ATCACAGGCTGCTGCCCACGTGGCTGGCATTGCAGCCATG ATGCTGTCTGCCGAGCCGGAGCTCACCCTGGCCGAGTTGA GGCAGAGACTGATCCACTTCTCTGCCAAAGATGTCATCAA TGAGGCCTGGTTCCCTGAGGACCACGGGGTACTG-3' (sequence Number 374)

[0433] (2) PSCM was used to detect off-target effects of the sense strand, and the test s The target sequence is completely identical to the antisense strand sequence of the iRNA, and each siRNA corresponds to The sequences of interest in the PSCM are shown in Table 5a.

[0434] [Table 5a]

[0435] (3) GSSM detects off-target effects in the seed region of the antisense strand. The target sequences in GSSM corresponding to each siRNA are shown in Table 5b.

[0436] [Table 5b]

[0437] (4) PSSM is used to detect off-target effects in the seed region of the sense strand. The target sequences in the PSSMs corresponding to each siRNA are shown in Table 5c.

[0438] [Table 5c]

[0439] psiCHECK each single copy of the above target sequence TM Xho -2 plasmid It was cloned into the I / Not I site.

[0440] [2] Cell culture and transfection (1) Cotransfection of GSCM and siRNA 1 10% fetal bovine serum (FBS, HyClone) and 0.2% penicillin (v / v) Streptomycin (Penicillin-Streptomycin, HyClon HEK293A cells (Nanjing Science) were cultured in H-DMEM complete medium (HyClone) containing (purchased from Bai Biotechnology Co., Ltd.) in a 5% CO2 / 95% air incubator. The cells were cultured at 37°C.

[0441] 8 × 10 HEK293A cells 3 Cells / well were seeded into 96-well plates and incubated for 16 h. When the cell growth density reached 70-80%, the complete H-DMEM medium in the culture well was Remove all the plates by suction and add 80 μl of Opti-MEM medium (GIBCO) to each well. The incubation was continued for 1.5 h.

[0442] Dilute the GSCM test plasmid with DEPC-treated water to 200 ng / μl of test plasmid. The dilution standard solution (Working Solution) was prepared using DEPC-treated water. From siRNA 1, the concentrations were 1000 nM, 333 nM, 111 nM, and 37.0 nM. M, 12.3nM, 4.12nM, 1.37nM, 0.46nM, 0.15nM, 0.0 A total of 11 siRNA dilution standard solutions were prepared, each of which was 5 nM and 0.017 nM. .

[0443] Solutions A1 to A11 were prepared, and each solution A1 to A11 had the above 11 concentrations in order. 1 μl of siRNA diluted standard solution, 0.05 μl of test plasmid diluted standard solution (test plasmid The plate contained 10 μl of Opti-MEM medium (containing 10 ng of mide).

[0444] Prepare solution B. Add 0.2 μl of Lipofectamine to each solution B. TM 200 0 and 10 μl of Opti-MEM medium.

[0445] Prepare C solution, and each C solution contains 0.05 μl of the test plasmid diluted standard solution (test The plate contained 10 μl of Opti-MEM medium (containing 10 ng of mide).

[0446] One B solution was mixed with one each of the A1 to A11 solutions and one each of the C solutions in sequence, and the mixture was cooled to room temperature. The cells were cultured at RT for 20 min to obtain 12 transfection complexes X1 to X12. Transfection complexes were prepared in triplicate.

[0447] Add 20 μl of transfection complexes X1 to X11 to the culture wells. Add 100 mL of siRNA to each well and mix evenly. The siRNA complexes were added to three different culture wells, resulting in a final siRNA concentration of 10nM, 3.33nM, 1.11nM, 0.37nM, 0.123nM, 0.0412 nM, 0.0137nM, 0.0046nM, 0.0015nM, 0.0005nM and The resulting co-transfection mixture was 0.00017 nM and designated test groups 1 to 11.

[0448] Add 20 μl / well of transfection complex X to three additional culture wells. 12 was added to obtain a transfection mixture without siRNA, which served as a control group. did.

[0449] Cotransfection mixtures containing siRNA and transfection mixtures without siRNA were The reaction mixture was incubated in culture wells for 4 h, then 20% 100 μl of FBS-containing H-DMEM complete medium was added. The 96-well plate was then incubate in a CO2 incubator. The cells were then placed in an incubator and cultured for 24 hours.

[0450] (2) Cotransfection of other siRNAs and plasmids The same procedure was repeated with GSCM and si GSCM and siRNAs 2–6 were cotransfected in the same manner as for RNA 1. Cotransfection was performed.

[0451] Except for using PSCM instead of GSCM, the comparison of GSCM and siRNA 1–6 Cotransfection of PSCM and siRNA 1 to 6 was performed using the same method as for transfection. I made a complaint.

[0452] Except for using GSSM instead of GSCM, the comparison of GSCM and siRNA 1-6 was performed. GSSM and siRNA 1 to 6 were cotransfected using the same method as transfection. I made a complaint.

[0453] Except for using PSSM instead of GSCM, the comparison of GSCM and siRNA 1–6 PSSM and siRNA 1 to 6 were cotransfected using the same method as transfection. I made a complaint.

[0454] [3] Detection The medium in the culture wells was removed by suction, and 150 μl of Dual-Glo ( Add a mixture of Luciferase reagent and H-DMEM (volume ratio 1:1) After incubation at room temperature for 10 minutes, 120 μl of the mixture was added to 9 Transfer to a 6-well ELISA plate and place on the Synergy II Multifunctional Microplate Reader. A Firefly reader (BioTek) was used to measure the amount of each well in the ELISA plate. The chemiluminescence value (Fir) was read, and 60 μl of the solution was added to each well of the ELISA plate. l's Dual-Glo® Add Stop & Glo® reagent and mix evenly. Mix thoroughly until uniform, incubate at room temperature for 10 minutes, and then read the Fir sequence. Therefore, the Re in each well of the ELISA plate was measured using a microplate reader. The chemiluminescence value (Ren) of nilla was read.

[0455] The emission ratio (Ratio = Ren / Fir) of each well of the ELISA plate was calculated, and each test The experimental group or control group has three culture wells with the emission ratio Ratio(test) or Ratio(control). The emission ratio of each test group is normalized based on the emission ratio of the control group. The ratio Ratio(Test) / Ratio(Control) was obtained, which resulted in the Renilla report. The expression level of the target gene, i.e., the relative residual activity, is shown. The inhibition rate of siRNA is (1-R) ×100%.

[0456] Different siRNAs (siRNA 1, siRNA 2, siRNA 3, siRNA After transfection with 4, 5 or 6), psiCHE Graph showing the relative residual activity of the reporter gene Renilla in the CK system. The nonlinear regression analysis function of pad 5.0 software was used to determine log(inhibitor) vs. response-Variable slope (four param eters) dose-effect curves were fitted, and Figures 1A to 1F show the dose-effect curves of siRNA 1 to 6 shows the dose-effect curve of siRNA concentration (lg nM) on the abscissa. The ordinate is the relative remaining activity (%) of Renilla, and each black circle represents the test group compared to the control group. The average relative residual activity of Renilla in triplicate culture wells of a group is represented.

[0457] From the fitted dose-effect curve, the following function was obtained: IC A targets GSCM 50 The value was calculated.

[0458]

number

[0459] From the dose-effect curve and the corresponding function, the corresponding X when Y=50% is 50 value Determine the IC of each siRNA 50 Value=10^X 50 (nM) was calculated and IC 50 Value and R 2 The values ​​are summarized in Table 6.

[0460] [Table 6]

[0461] As can be seen from Table 6 and Figures 1A to 1F, the siRNA provided by the present disclosure can be expressed in vitro. High inhibitory activity in HEK293A cells, IC 50 is 0.0194 to 0.0561 The concentration was nM.

[0462] The same procedure as above was repeated except that PSCM, GSSM, and PSSM were used instead of GSCM, respectively. The PSCM, GSSM and Dose-effect curves for PSSM were then obtained. As can be seen from the results, each siRNA At each concentration, the corresponding off-target plasmids PSCM, GSSM, and PSSM were It also had no inhibitory effect on these.

[0463] From the above results, the siRNA of the present disclosure has high target specificity and Neither the seed region of the base strand nor the seed region of the sense strand had any significant off-target effects. It was shown that this was the case.

[0464] (Experimental Example 2) Efficacy evaluation of siRNA complex in non-human primates (NHP) Three to four year old normal cynomolgus monkeys (body weight 2.4-3.1 kg) were divided into two groups of four monkeys per group. In each group, half were female and the other half were male. The subjects received a single dose of 5 by subcutaneous injection.

[0465] Normal cynomolgus monkeys aged 4-5 years (body weight 4.0-5.5 kg) were divided into three groups, 3 animals per group, according to body weight. Each group consisted of male cynomolgus monkeys, and each group was administered Complex 1, 2, or 7. was administered as a single dose by subcutaneous injection.

[0466] Each complex was diluted with sterile sodium chloride injection at 9 mg / ml (as siRNA, The solution was administered to each animal at a volume of 1 ml / kg and a dose of 9 mg / kg. The n days before administration were defined as Dn, the day of administration was defined as D1, and the nth day after administration was defined as D n was defined.

[0467] (2-1) Detection of PCSK9 mRNA in liver tissue On D-7 and D15, each group was administered Complex 1, Complex 2, Complex 4, Complex 5 or Complex 7. The administered cynomolgus monkeys underwent liver puncture, and liver tissue was removed in a volume of approximately 2 × 2 × 8 mm each time. 3 Collect and transfer to 1 ml of RNAlater storage medium (Sigma Aldrich) Store in a 5 mL sterile EP tube, place in a 4°C refrigerator for 24 h, and then transfer to -80°C. and stored it.

[0468] The liver tissue was then homogenized using a tissue homogenizer and further treated with Trizol (The The total RNA was extracted using the RNA extraction kit (Fisher Co., Ltd.) according to the procedure for total RNA extraction described in the instruction manual. The total RNA of the liver tissue was obtained by extraction.

[0469] For each animal, 1 μg of total RNA was reverse transcribed from the liver tissue. The template was the reverse transcription kit Goldenstar TM RT6 cDNA Sy nthesis Kit (purchased from Beijing▲Qin▼Kexinye Biotechnology Co., Ltd., number TSK3 Reagents provided by Goldenstar TM Oligo (dT)1 7 was selected as a primer, and reverse transcription was performed according to the reverse transcription procedure in the kit manual. 20 μl of the reaction mixture was placed and reverse transcription was performed on the total RNA of each liver. Each reverse transcription reaction was incubated at 50°C for 50 min, then at 85°C for 5 min, and finally at 4°C for 30 min. After incubation, 80 μl of DEPC-treated water was added to each reverse transcription reaction system to produce cDNA. A solution containing A was obtained.

[0470] For each reverse transcription reaction system, 5 μl of the solution containing the above cDNA was used as a template for qPCR. Rate and NovoStart® SYBR qPCR SuperMix Provided by Plus Kit (purchased from Kinki Protein Technology Co., Ltd., No. E096-01B) A 20 μl qPCR reaction system was prepared using the reagents listed in Table 1. The target gene PCSK9 and PCR primer sequences for amplifying the endogenous reference gene GAPDH are shown in Table 7. The final concentration of each primer was 0.25 μM. Each qPCR reaction was performed using ABI Step Place the PCR product in the OnePlus Real-Time PCR machine and amplify it in a three-step process. The procedure consisted of 10 min pre-denaturation at 95°C, 30 s denaturation at 95°C, and 30 s annealing at 60°C. The denaturation, annealing, and extension were repeated a total of 40 times. Then, the product W containing the amplified target gene PCSK9 and the endogenous reference gene GAPDH is Immediately after that, product W was heated at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s in this order. The target gene in the product W was detected by real-time fluorescent quantitative PCR. The melting curves of the gene PCSK9 and the endogenous reference gene GAPDH were obtained, and the target genes PCSK9 and The Ct values ​​of the endogenous reference gene GAPDH were obtained.

[0471] [Table 7]

[0472] Using the comparative Ct (ΔΔCt) method, the expression levels of the target gene PCSK9 in D15 and D-7 were Relative quantitative calculations were performed using the following method: ΔCt(D15)=Ct(D15 gene of interest)-Ct(D15 endogenous reference gene) ΔCt(D-7)=Ct(D-7 gene of interest)-Ct(D-7 endogenous reference gene) ΔΔCt(D15)=ΔCt(D15)-ΔCt(D-7 average) ΔΔCt(D-7)=ΔCt(D-7)-ΔCt(D-7 average)

[0473] Here, ΔCt(D-7 mean) is the arithmetic mean of ΔCt(D-7) for each animal before administration. Therefore, each animal has one ΔΔCt(D15) and one ΔΔCt(D-7). It is supported.

[0474] The expression level of PCSK9 mRNA in one animal was compared with that in the other animal on D15. The expression levels of PCSK9 mRNA in D-7 were defined as 100%. .

[0475] Relative expression level of PCSK9 mRNA = 2^(-ΔΔCt(D15)) × 100% Inhibition rate of PCSK9 mRNA by the complex = (1-2^(-ΔΔCt(D15 )))×100%

[0476] For groups administered the same complex, the inhibition of PCSK9 mRNA by the complex was The inhibition rate is the arithmetic mean of the corresponding inhibition rates for each animal in the group.

[0477] The inhibition rate of hepatic PCSK9 mRNA by each complex is shown in Table 8.

[0478] [Table 8]

[0479] As can be seen from Table 8, a single dose of 9 mg / kg resulted in a 7-day increase in the number of patients after administration compared to those before administration. On day 15, the inhibition rates of PCSK9 mRNA by the siRNA complexes were 5. 6%, especially complex 1 and complex 4, in NHP liver tissue. The inhibition rates for RNA reached 79% and 81%, respectively.

[0480] (2-2) Detection of PCSK9 protein content in serum For NHPs administered Complex 4, the doses were taken on D-15, D-9, and D1 before administration, respectively. Venous blood was collected once, and then on D3, D8, D14, D22, and D29 after administration. Blood samples were collected once a week for 18 weeks until D127.

[0481] For NHPs administered Complex 1 or 7, the Venous blood was collected once for each group, and then intravenous blood was collected once on D4, D8, D15, D22, and D29 after administration. Pulse blood was collected once and then weekly for 12 consecutive weeks up to D85.

[0482] For each sample obtained, serum was isolated at room temperature.

[0483] (2-2-1) PCSK9 protein content in serum of cynomolgus monkeys administered Complex 4 Quantity detection D-9, D8, D14, D85, D92, D99, D106 and D 120 sera were selected and Human Proprotein Convertase 9 / PCSK9 Quantikine ELISA Kit (USA R&D System Calibrator Diluent RD5P ( Dilute the serum obtained at each time point above by 25 times using the reagent (1:5 dilution) and follow the instructions in the kit. Following the steps in the manual, a fully automated microplate reader (SYNERGY TM MX The absorbance value of each diluted serum was detected at 450 nm using a 50-μL antibody (Biotek). From each dilution concentration of the standard and their corresponding absorbance values, Graphpad 5. 0 Construct the standard curve by the linear regression function of the software and calculate the corresponding linear equation: Y = aX +b, where a is the slope of the fitted line and b is the slope when X=0. The corresponding Y value (intercept) is calculated by substituting the absorbance value of each diluted serum into the above equation. By this method, the PCSK9 protein content in the diluted serum can be calculated, and the dilution factor can be used to calculate the PCSK9 protein content at each time point. Serum PCSK9 protein content was obtained. Normalized PCSK9 protein level = (Post-treatment PCSK9 protein content / Pre-treatment PCSK9 protein content) Inhibition rate of PCSK9 protein expression = (1-PCSK9 protein content after administration / P before administration CSK9 protein content) x 100%

[0484] Here, the PCSK9 protein content before administration is the PCSK9 protein content of D-9. .

[0485] The PCSK9 protein content at each time point after administration was normalized to the pre-administration level. PCSK9 protein level was defined as 100%, which is represented as D0 in Figure 2. After a single subcutaneous injection of 100 mg / kg of conjugate 4, the serum levels of Normalized PCSK9 protein levels are shown in FIG.

[0486] (2-2-2) PCSK9 protein in serum of cynomolgus monkeys administered complex 1 or 7 Content detection (1)D-14, D-7, D8, D15, D22, D29, D36, D43, D50, Serum samples were selected from D57, D64, and D85. (2) The PCSK9 protein content before administration was Except for the arithmetic mean of the PCSK9 protein contents of D-14 and D-7, PC in serum from cynomolgus monkeys administered with complex 1 or 7 was measured by the same method as in 2-2-1). The SK9 protein content was detected. Cynomolgus monkeys were injected subcutaneously with 9 mg / kg of conjugate 1 or 7. Normalized PCSK9 protein levels in serum at different time points after a single injection The levels are shown in Figure 2.

[0487] As can be seen in Figure 2, the P in NHP serum by complex 4 was significantly increased on day 14 after a single dose. The inhibition rate of CSK9 protein expression was more than 90%, and the complex 4 expression was suppressed up to 12 weeks after administration. The inhibition rate of PCSK9 protein expression by rituximab was always maintained at 50% or higher.

[0488] For conjugate 7, PCSK9 protein expression in NHP serum was significantly increased 22 days after a single dose. The current inhibition rate was 82%, and the expression of PCSK9 protein by complex 7 was suppressed for up to 9 weeks after administration. The inhibition rate was always maintained at 66% or higher.

[0489] For complex 1, PCSK9 protein expression in NHP serum was significantly increased 15 days after a single dose. The current inhibition rate was 83%, and the expression of PCSK9 protein by complex 7 was suppressed for up to 7 weeks after administration. The inhibition rate was always maintained at 65% or higher.

[0490] (2-3) Detection of serum lipid (LDL-c and CHO) content (2-3-1) Serum lipids (LDL-c and CHO) of cynomolgus monkeys administered Complex 4 ) Content detection In (2-2), serum obtained at each time point after administration of complex 4 was selected, and L DL-C measurement kit (DENUO CH7538, Shanghai Dingcheng Biological Technology Co., Ltd.) or CH Using an OL measurement kit (DENUO CH7532, Shanghai Zhicheng Biotechnology Co., Ltd.), According to the operating instructions, the samples were analyzed at each time point using a fully automated biochemical analyzer (Hitachi 7060). The content of serum lipids (LDL-c or CHO) was detected. Standardized lipid level = (post-treatment lipid content / pre-treatment lipid content) x 100% Lipid suppression rate = (1-lipid content after administration / lipid content before administration) x 100%

[0491] Here, the lipid content before administration is the arithmetic mean of the three lipids before administration on D-15, D-9, and D1. where lipid refers to LDL-c or CHO.

[0492] The lipid content at each time point after administration was normalized based on the pre-administration level, and the lipid level before administration was This is defined as 100% and is represented as D0 in FIGS.

[0493] Cynomolgus monkeys were given a single subcutaneous injection of 9 mg / kg of complex 4, and the results were analyzed at different time points. The normalized LDL-c and CHO levels in serum at This is shown in Figures 3 and 4.

[0494] (2-3-2) Serum lipids (LDL-c and CHO) of cynomolgus monkeys administered Complex 7 ) Content detection (1)(2-2) After administration of Complex 7, serum samples were collected at each time point and analyzed for lipids. (2) The lipid content before administration was determined to be the same as that before administration on D-14, D-7, and D-1. The same method as (2-3-1) was used to measure the mean of the arithmetic mean. The lipid (LDL-c and CHO) content in serum of cynomolgus monkeys was detected. The standard deviations in serum at different time points after a single subcutaneous injection of 100 mg / kg of complex 7 were The normalized LDL-c levels and normalized CHO levels are shown in Figures 3 and 4, respectively. .

[0495] As can be seen from FIG. 3, from 14 days after a single administration, Complex 4 showed a significant effect on LDL-c. In particular, on the 22nd day after administration, the LDL-c suppression rate by Complex 4 was 64%. The suppression rate of LDL-c by Complex 4 was consistently high from the second to the eleventh week after administration. The N-cell response rate was maintained at 50% or higher in the 127-day observation period. Serum LDL-c levels in HP were always lower than before treatment.

[0496] For complex 7, the LDL-c suppression rate was 36% on day 22 after a single dose. Between the second and fourth weeks after administration, the LDL-c suppression rate was maintained at about 30%. 1 During the long observation period of 1 week, serum LDL-c levels in NHPs administered Complex 7 were consistently higher than those in the control group. It was lower than before.

[0497] As can be seen from FIG. 4, from 14 days after a single administration, Complex 4 showed a significant increase in the activity against CHO. In particular, on the 22nd day after administration, the CHO inhibition rate by complex 4 was 38%; Between the second and eighth weeks after administration, the inhibition rate of CHO by Complex 4 was consistently 30% or higher. The serum CH in NHPs administered Complex 4 was maintained over a long observation period of 127 days. O2 levels were always lower than pretreatment.

[0498] For conjugate 7, the inhibition rate of CHO was 38% on the 22nd day after a single dose. From the second to eighth week, the inhibition rate of CHO was basically maintained at 30% or more. Over a long observation period of one week, serum CHO levels in NHPs administered Conjugate 7 were consistently higher than before administration. It was lower.

[0499] (2-4) Detection of blood routine and coagulation function before and after liver puncture Before and after liver puncture, venous blood was collected from animals administered Complex 4 or 5. A fully automated 5-part classification hematology analyzer (ADVIA 2120 / ADVIA 2120i, Germany) Mens) and a fully automated blood coagulation analyzer (CA-7000 / CS-2000i, Sysmex The blood routine and coagulation function were detected using a ELISA kit (Kuken Chemical Co., Ltd.). As can be seen from the results, After administration, the effect of each complex on blood routine and coagulation function was compared to before administration. There was no significant difference, demonstrating the high biological safety of the siRNA complex provided by the present disclosure. Ta.

[0500] (Experimental Example 3) Evaluation of toxicity of siRNA complex in rats / mice In this example, the clinical toxicity responses of rats or mice administered conjugates 1, 4, or 7, respectively, were examined. Observe the response, detect liver weight, blood routine, blood biochemistry, lipid and other indicators, and perform gross dissection. and histopathological examination, the siRNA complex of the present disclosure was confirmed to have the following properties in small animals: Toxicological responses were evaluated.

[0501] (3-1) Evaluation of toxicity in rats (3-1-1) Detection of toxicity in SD rats administered Complex 1 or 4 SPF-level SD rats (Beijing Weitong Lihua Experimental Animals) were used, aged 6-9 weeks and weighing 210-250 g. Purchased from Kyokuto Technology Co., Ltd., license number: SCXK(Kyoto) 2016-0011 or S CXK (Kyoto) 2016-0006, all males) were selected and divided into 3 groups of 5 mice per group based on body weight. Each mouse was subcutaneously injected with Complex 1, Complex 4 or 1×PBS (pH 7.4) control. The dose was calculated based on the body weight, and each complex was dissolved in 1×PBS (pH 7.4) at 60 mg / ml. The administration volume was 5 ml / kg and the dose was 300 mg / kg.

[0502] After a single subcutaneous administration, the following indicators were detected: (1) Routine observation: Routine observation was performed twice a day. (2) Body weight: on D1 before administration, on D3, D6, D10, D14 after administration, and on D15 (the day of dissection). The body weight of each animal was measured. (3) Food intake: Food intake was measured on D2-3, D6-7, and D12-13. (4) Hematology: On day 15 before dissection, 1.9 ml of blood was collected from the abdominal artery of the rats. 1.0 mL of blood sample was treated with EDTA-K2 to prevent coagulation, and whole blood was directly sampled. The following blood cytological indices (red blood cell count (RBC), white blood cell count (WBC), platelet count) were recorded: (PLT), hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume ( MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC ), reticulocyte count (RET), reticulocyte ratio (RET%), neutrophil (NEU) count and ratio, Lymphocyte (LYM) count and ratio, monocyte (MONO) count and ratio, eosinophil (EOS) count and The remaining 0.9 Prevent coagulation with sodium citrate for each mL blood sample and centrifuge at 15-25°C. The plasma was isolated by centrifugation at 1800 x g for 10 min, and the clotting time (prothrombin time (PT)) was measured. and activated partial thrombin time (APTT). (5) Blood biochemistry: On day 2 after administration, 0.6 ml of blood was collected from the jugular vein of the rats, and then dissected on day 15. Before the procedure, 3 ml of blood was drawn from the abdominal artery of the rats, and none of the blood samples prevented coagulation. The serum was isolated by centrifugation at 1,800 × g for 10 minutes at ℃ and alkaline phosphatase ( ALP), alanine aminotransferase (ALT), aspartate aminotransferase AST, creatine kinase (CK), lactate dehydrogenase (LDH), gamma -Glutamyltransferase (GGT), Urea, Creatinine (Cre a), sodium ion concentration (Na + ), potassium ion concentration (K + ), chloride ion (C l - ), blood glucose (GLU), total bilirubin (TBIL), total protein (TP), albumin The blood biochemistry indices of albumin (ALB) and albumin / globulin ratio (A / G) were detected. . (6) Gross dissection and histopathological examination: On D15, the animals were dissected and each organ was weighed. , and histopathological examination was performed.

[0503] (3-1-2) Detection of toxicity in SD rats administered complex 7 Complex 7 was used instead of Complex 4, and Complex 7 was diluted in 1× PBS (pH 7.4) The solution is 20mg / ml and 6mg / ml, the administration volume is 5ml / kg, and the administration amount is (3-1-1) and (3-1-2) were similar to each other, except that the doses were 100 mg / kg and 30 mg / kg, respectively. The same method was used to detect toxicity in SD rats administered complex 7. For clinical studies, blood samples were taken before dissection on D8 and D15 after administration, respectively.

[0504] As can be seen from the results, none of the complexes showed any significant toxicity in rats. .

[0505] (3-2) Evaluation of toxicity in mice Five- to six-week-old SPF-level ICR mice (purchased from Beijing Sibyl Biotechnology Co., Ltd.) ) were selected, half female and half male, with 10 animals in each group, and The compound 4 or the complex 7 was subcutaneously injected once a week for two consecutive weeks for a total of three times. The complexes were administered on D1, D8, and D15, respectively. The dosage was calculated based on the body weight, and each complex was administered in 1×PB The solution was diluted to 30 mg / ml in 100 mM NaCl (pH 7.4), and the administration volume was 10 ml / kg. The dose was 300 mg / kg.

[0506] After three doses, the following indicators were detected: (1) Routine observation: Routine observation was performed once a day. (2) Body weight: Body weight was measured on D1, D8, and D15 before administration and on the day of dissection, D16. (3) Food intake: Measured once a week. (4) Blood biochemistry: On the day of dissection, the eyeball was removed and 1 ml of blood was taken. First, the cells were cultured at 37°C for 60 minutes, and then centrifuged at 4°C and 3000 rpm for 15 minutes. Serum was obtained and subjected to blood biochemistry detection. The detection index was blood biochemistry in the detection of the above rat toxicity. It is the same as the indicator. (5) Gross dissection and histopathological examination: On D16, the animals were dissected and each organ was weighed. , and histopathological examination was performed.

[0507] As can be seen from the results, none of the complexes showed any significant toxicity in mice. .

[0508] The above results demonstrated that the complex of the present disclosure has high biological safety.

[0509] Although several embodiments of the present disclosure have been described in detail above, the present disclosure The present disclosure is not limited to the specific details, but is within the scope of the technical idea of ​​the present disclosure. A number of simple modifications can be made to the present disclosure, all of which are within the scope of the present disclosure. Belongs to the range.

[0510] In addition, it should be noted that each of the specific techniques described in the above embodiments Technical features may be combined in any suitable manner, provided there is no contradiction, and To avoid unnecessary duplication, this disclosure will not separately describe the various possible combination methods.

[0511] In addition, various different embodiments of the present disclosure may be combined in any combination, and the spirit of the present disclosure will be apparent to those skilled in the art. Unless otherwise stated, such combinations should also be considered as disclosed in this disclosure. be.

Claims

1. An siRNA conjugate having a structure as shown in formula (308): 【Chemistry 1】 During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. m1, m2, or m3 is independently an integer selected from 2 to 10; R １ ０ , R １１ , R １２ , R １３ , R １４ Or R １５ are each independently H; or C １ -C １０ Alkyl group, C １ -C １０ Halogenated alkyl group and C １ -C １０ Alcoki is selected from the group consisting of aryl groups, R ３ is a group having the structure shown in formula A59, 【Chemistry 2】 In the formula, E １ is OH, SH or BH ２ and Nu is an siRNA, the siRNA comprises a sense strand and an antisense strand, Each nucleotide of the iRNA is independently a modified or unmodified nucleotide, The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II are at least partially inverted. The nucleotide sequence I and the nucleotide sequence II form a double-stranded region complementary to each other. It is one selected from the sequences shown in i) to vi) below, i) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length; and preferably has no more than three nucleotide differences, and is shown in nucleotide sequence II and SEQ ID NO:

2. The nucleotide sequences to be compared are of equal length and have no more than three nucleotide differences; 5'-AAGCAAGCAGACAUUUAUZ １ -3' (SEQ ID NO:1), 5'-Z ２ AUAAAUGUCUGCUUGCUUGCUU-3' (SEQ ID NO: 2) However, Z １ is C, and Z ２ is G, and in said nucleotide sequence I, position Z １ To The corresponding nucleotide Z ３ and in said nucleotide sequence II, position Z ２ Corresponding to Nucleotide Z ４ and Z ４ The first nucleotide at the 5' end of the antisense strand It is a nucleotide, ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:6 is 3 or less. The nucleotide sequence shown in FIG. 2 is the same length and has no more than three nucleotide differences. 、 5'-UUUGUAGCAUUUUUAUUAZ ５ -3' (SEQ ID NO:61), 5'-Z ６ UAAUAAAAAAUGCUACAAA-3' (SEQ ID NO:62) However, Z ５ is A and Z ６ is U, and in said nucleotide sequence I, position Z ５ To The corresponding nucleotide Z ７ and in said nucleotide sequence II, position Z ６ Corresponding to Nucleotide Z ８ and Z ８ The first nucleotide at the 5' end of the antisense strand is It is a nucleotide, iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 122 is the same length and has no more than three nucleotide differences. and 5'-GCCUGGAGGUUUAUUCGGAZ ９ -3' (SEQ ID NO: 121), 5'-Z １０ UCCGAAUAAACUCCAGGC-3 '(SEQ ID NO: 122) However, Z ９ is A and Z １０ is U, and in said nucleotide sequence I, position Z ９ Nucleotide Z corresponding to １１ and in said nucleotide sequence II, position Z １０ To The corresponding nucleotide Z １２ and Z １２ is the 5' end of the antisense strand It is the first nucleotide, iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 have a length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 182 is identical in length and has no more than three nucleotide differences. can be, 5'-CUGUUUUGCUUUUGUAACZ １３ -3' (SEQ ID NO: 181), 5'-Z １４ GUUACAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z １３ is U and Z １４ is A, and in said nucleotide sequence I, position Z １３ Nucleotide Z corresponding to １５ and in said nucleotide sequence II, position Z １ ４ Nucleotide Z corresponding to １６ and Z １６ is the 5' end of the antisense strand It is the first nucleotide at the end v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:2 is 3 or less. The nucleotide sequence shown in 42 is identical in length and has no more than three nucleotide differences. the law of nature, 5'-GGUUUUGUAGCAUUUUAZ １７ -3' (SEQ ID NO: 241), 5'-Z １８ UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z １７ is U and Z １８ is A, and in said nucleotide sequence I, position Z １７ Nucleotide Z corresponding to １９ and in said nucleotide sequence II, position Z １ ８ Nucleotide Z corresponding to ２０ and Z ２０ is the 5' end of the antisense strand It is the first nucleotide at the end vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have a length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 302 is the same length and has no more than three nucleotide differences. can be, 5'-GUGACUUUUUAAAAAAAZ ２１ -3' (SEQ ID NO: 301), 5'-Z ２２ UUUAUUUUAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z ２１ is A and Z ２２ is U, and in said nucleotide sequence I, position Z ２１ Nucleotide Z corresponding to ２３ and in said nucleotide sequence II, position Z ２ ２ Nucleotide Z corresponding to ２４ and Z ２４ is the 5' end of the antisense strand It is the first nucleotide at the end R ２ is a straight chain alkylene group of 1 to 20 carbon atoms in length, Carbon atoms are C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenile group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １８ Heterosi Crylene group and C ５ -C １０ one or more selected from the group consisting of heteroarylene groups; Optionally substituted, R ２ is C １ -C １０ Alkyl group, C ６ -C １０ Aryl group, C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, -OC １ -C １０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-OH, -OC １ - C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １０ Alkyl Phenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halogenated alkyl groups, Halogen Substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alkyl-NH ２ , -N ( C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １０ Alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ alkylphenyl group), -NH( C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C(O)O( C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) (C １ -C １０ Alki group), -CONH(C １ -C １０ alkyl group), -CONH ２ , -NHC(O)(C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ Alkyl group ) C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group)C(O)(F phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ -C １０ Alkylphe Nyl group, -C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group , -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ Alkyl group ), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ alkyl group), -NHS O ２ (phenyl group) and -NHSO ２ (C １ -C １０ halogenated alkyl groups) may optionally have one or more substituents of any one of Each L １ are each independently a straight chain alkylene group of 1 to 70 carbon atoms in length, One or more of the carbon atoms may be C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenylene group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １８ Heterocyclylene group and C ５ -C １０ Selected from the group consisting of heteroarylene groups and L １ is C １ -C １０ Alkyl group, C ６ -C １０ a Aryl group, C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, -OC １ -C １０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl -OH, -OC １ -C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halo Fluorinated alkyl groups, halogen substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alki Ru - NH ２ , -N(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ Alkylphe Nyl group), -NH(C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C(O)O(C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) ( C １ -C １０ alkyl group), -CONH(C １ -C １０ alkyl group), -CONH ２ , - NHC(O)(C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ alkyl group)C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ Alki (phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ - C １０ Alkylphenyl group, —C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group, -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ alkyl group), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ Al kill group), -NHSO ２ (phenyl group) and -NHSO ２ (C １ -C １０ Al halide and optionally having one or more substituents selected from the group consisting of alkyl groups; 【change】 represents the site at which a group is covalently attached, M １ represents the targeting group, siRNA conjugate.

2. Each L １ are independently selected from the group consisting of (A1) to (A26) groups and any combination thereof; R, 【Chemistry 3】 wherein each j1 is independently an integer from 1 to 20, and each j2 is independently an integer from 1 to 20. the law of nature, Each R' is independently C １ -C １０ is an alkyl group, Each Ra is independently a group represented by formula (A27) to (A45) or any combination thereof. is selected from the group consisting of 【Chemistry 4】 Each Rb is independently C １ -C １０ is an alkyl group, Or, L １ is selected from A1, A4, A5, A6, A8, A10, A11, and A13 and a combination of one or more bonds, Or, L １ At least two selected from A1, A4, A8, A10 and A11 It is a combination of bonds, Or, L １ is a combination of at least two bonds selected from A1, A8, and A10; the law of nature, Or, L １ is 3 to 25 atoms in length, Or, L １ is 4 to 15 atoms in length, 【change】 The siRNA conjugate of claim 1 , wherein represents the site to which the group is covalently attached.

3. j1 is an integer from 2 to 10, j2 is an integer from 2 to 10, and R′ is C １ -C ４ Al R a is one of A27, A28, A29, A30 and A31; R b is C １ -C ５ is an alkyl group, Alternatively, j1 is an integer from 3 to 5, j2 is an integer from 3 to 5, and R' is a methyl group. Ra is one of a group represented by formula (A27) or a group represented by formula (A28). A28), where Rb is a methyl group, an ethyl group, an isopropyl group, or a butyl group. The siRNA conjugate of claim 2 , which is one of the groups.

4. n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1+n3=2 to 3. The siRNA complex according to any one of claims 1 to 3.

5. Each m1, m2 or m3 is independently an integer from 2 to 5, and / or m1=m The siRNA complex of any one of claims 1 to 4, wherein m2=m3.

6. Each of said targeting groups independently binds to an asialoglycoprotein receptor on the surface of mammalian hepatocytes. is a ligand having affinity for Alternatively, each said targeting group is independently an asialoglycoprotein or a sugar; Alternatively, each of the targeting groups is selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose D-galactose, L-galactose, α-D-mannofuranose, β-D-mannose Furanose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose Ranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranos α-D-fructofuranose, α-D-fructopyranose, α-D-galactose Pyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactopyranose Citrobranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine Galactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N- n-Butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O- [(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, Oxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formaldehyde Mido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamine No-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucose Leucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl 4-Thio-β-D-galactopyranose, ethyl 3,4 ,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptide Topiranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D- One independently selected from 4-thioribose, L-ribose, and L-4-thioribose can be, Alternatively, at least one or each of the targeting groups is galactose or N-acetylgalactose. The siRNA conjugate of any one of claims 1 to 5, wherein the siRNA conjugate is tosamine.

7. R １０ , R １１ , R １２ , R １３ , R １４ Or R １５ are independently H, a methyl group or an ethyl group. is a ethyl group, Or, R １０ , R １１ , R １２ , R １３ , R １４ Or R １５ are both H. The siRNA complex according to any one of claims 1 to 6.

8. R ２ The nitrogen-containing backbone is bonded to the N at the site and R ３ The site that is bonded to the P atom in the Rarely, Or, R ２ the site bonded to N on the nitrogen-containing backbone forms an amide bond with N; The R ３ The site bonded to the P atom in the Or, R ２ is selected from the group represented by formula (B5), (B6), (B5') or (B6'). Selected, 【Chemistry 5】 During the ceremony, 【change】 represents the site at which the group is covalently attached, q ２ The range of values ​​of may be an integer from 1 to 10. siRNA complex.

9. Equations (403), (404), (405), (406), (407), (408), (4 ０９）、（４１０）、（４１１）、（４１２）、（４１３）、（４１４）、（４１５）、 (416), (417), (418), (419), (420), (421) or (42 2) The siRNA complex according to any one of claims 1 to 8, having the structure shown in 【Chemistry 6】 【change】 【change】 【change】 【change】 【change】 【change】

10. The P atom in formula A59 is attached to the end of the sense strand or antisense strand of the siRNA. The end refers to the four nucleic acids preceding one end of the sense strand or the antisense strand. Refers to cleotide, Alternatively, the P atom in formula A59 is a cyclic alkyl group of the sense or antisense strand of the siRNA. or the P atom in formula A59 is bonded to the 3' end of the sense strand of the siRNA. is combined with Alternatively, the P atom in formula A59 is linked to the siRNA via a phosphodiester bond. Any one of claims 1 to 9, which is bound to the 2', 3' or 5' position of a nucleotide in Item 1. The siRNA complex according to item 1.

11. i) a nucleotide sequence between said nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1; and / or the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 have no more than one octide difference. and the nucleotide sequence differs by no more than one nucleotide from the nucleotide sequence or ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61; and / or said nucleotide sequence II and sequence 62 has no more than one nucleotide difference from the nucleotide sequence set forth in or iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

121. and / or said nucleotide sequence II has no more than one nucleotide difference between said nucleotide sequence II and said There is no more than one nucleotide difference between the nucleotide sequence set forth in SEQ ID NO:122 、 or iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

181. and / or has no more than one nucleotide difference with said nucleotide sequence II. has no more than one nucleotide difference from the nucleotide sequence shown in column 182; or v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241; and / or said nucleotide sequence II and sequence 242 has no more than one nucleotide difference from the nucleotide sequence set forth in or vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

301. and / or has no more than one nucleotide difference with said nucleotide sequence II. has no more than one nucleotide difference with the nucleotide sequence shown in column 302; The siRNA complex of claim 1.

12. i) a nucleic acid sequence between said nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2; The difference between the leotide and Z ４ Including the difference at the position of Z ４ is selected from A, U or C; or ii) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

62. The nucleotide difference between ８ Including the difference at the position of Z ８ Select from A, C or G And, or iii) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 The nucleotide difference between the sequence is Z １２ Including the difference at the position of Z １２ is A, C or G is selected from or iv) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

182. The nucleotide difference between the sequence is Z １６ Including the difference at the position of Z １６ Is U, C or G? Selected from or v) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

242. The nucleotide difference between ２０ Including the difference at the position of Z ２０ from U, C or G Selected, or vi) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

302. The nucleotide difference between the sequence is Z ２４ Including the difference at the position of Z ２４ Is A, C or G? The siRNA complex according to claim 1 or 11, wherein the siRNA complex is selected from the group consisting of:

13. Z ３ But, Z ４ or Z ７ But, Z ８ and complementary nuclease or Z １１ But, Z １２ or Z １ ５ But, Z １６ or Z １９ But, Z ２０ and complementary Nuk or Z ２３ But, Z ２４ and the nucleotide sequence complementary to said The siRNA complex described in

14. The nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially Reverse complementary or completely reverse complementary, and essentially reverse complementary means that the two nucleotide sequences are The term "substantially reverse complementary" refers to a sequence having three or fewer base mismatches between the two sequences. This refers to the presence of one or less base mismatch between two nucleotide sequences, and is considered to be completely reversed. Complementary means that there is no mismatch between the two nucleotide sequences. The siRNA complex according to any one of claims 1 to 4.

15. The sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence III. The length of nucleotide sequence III and nucleotide sequence IV is are each independently 1 to 4 nucleotides, and said nucleotide sequence III is a nucleotide nucleotide sequence I is linked to the 5' end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3' end of nucleotide sequence II. The nucleotide sequence III and the nucleotide sequence IV are equal in length. The term "substantially reverse complementary" refers to a combination of two This refers to the presence of one or fewer base mismatches between nucleotide sequences, making it completely reverse-complementary. means that there is no mismatch between the two nucleotide sequences. The siRNA complex according to any one of claims 1 to 4.

16. i) the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4, The nucleotide sequences III and IV are each one nucleotide in length, the base of III is C; or the nucleotide sequences III and IV are both 2 nucleotides, from the 5' end to the 3' end, The base sequence is CC, or the nucleotide sequences III and IV are both 3 nucleotides in length. nucleotide having the nucleotide sequence of nucleotide III from the 5' end to the 3' end. or the nucleotide sequences III and IV are each 4 nucleotides in length. nucleotide sequence III from the 5' end to the 3' end is ACCC, or ii) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:63; The nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:64, Nucleotide sequences III and IV are each one nucleotide in length, The base of nucleotide sequence III is U, or the nucleotide sequences III and IV are different in length. Each of the sequences is 2 nucleotides. From the 5' end to the 3' end, the sequence is The base sequence of I is GU, or the nucleotide sequences III and IV are both From the 5' end to the 3' end, the nucleotide sequence III is The base sequence is GGU, or the nucleotide sequences III and IV are both 4 nucleotides, from the 5' end to the 3' end, the base sequence is GGGU; or iii) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123; and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 124; The nucleotide sequences III and IV are each one nucleotide in length. The base of nucleotide sequence III is G, or the nucleotide sequences III and IV are The length of each is 2 nucleotides, and the nucleotide sequence from the 5' end to the 3' end is The base sequence of sequence III is AG, or the nucleotide sequences III and IV have a length Each of them is a trinucleotide, and from the 5' end to the 3' end, it is nucleotide sequence I The nucleotide sequence of II is UAG, or the nucleotide sequences III and IV are different in length. Each of the sequences is 4 nucleotides, and from the 5' end to the 3' end, the sequence is The base sequence of I is AUAG, or iv) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183; wherein the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184; The nucleotide sequences III and IV are each one nucleotide in length. the base of nucleotide sequence III is C; or the nucleotide sequences III and IV have a length Each of these is two nucleotides, and from the 5' end to the 3' end, the nucleotide sequence The nucleotide sequence of III is AC, or the nucleotide sequences III and IV are different in length. Each of the sequences is 3 nucleotides, and from the 5' end to the 3' end, the sequence is The nucleotide sequence of I is GAC, or the nucleotide sequences III and IV are of equal length. Each of these is a 4-nucleotide sequence, and from the 5' to the 3' end, the sequence is is AGAC; or v) said nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 243; The nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244, Nucleotide sequences III and IV are each one nucleotide in length, the base of nucleotide sequence III is G; or the nucleotide sequences III and IV have a length Each of them is two nucleotides, and from the 5' end to the 3' end, it is nucleotide sequence I The base sequence of II is UG, or the nucleotide sequences III and IV are of equal length. Each of these is a trinucleotide and, from the 5' end to the 3' end, has the nucleotide sequence III or the nucleotide sequence III and IV are both From the 5' end to the 3' end, the nucleotide sequence III is The base sequence is UCUG, or vi) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303; wherein the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 304; The nucleotide sequences III and IV are each one nucleotide in length. the base of nucleotide sequence III is G; or the nucleotide sequences III and IV have a length Each of these is two nucleotides, and from the 5' end to the 3' end, the nucleotide sequence The base sequence of III is UG, or the nucleotide sequences III and IV are different in length. Each of the sequences is 3 nucleotides, and from the 5' end to the 3' end, the sequence is The base sequence of I is AUG, or the nucleotide sequences III and IV are of equal length. Each of these is a 4-nucleotide sequence, and from the 5' to the 3' end, the sequence is The siRNA complex according to claim 15, wherein the base sequence is UAUG.

17. 17. The method of claim 16, wherein the nucleotide sequences III and IV are completely reverse complementary. siRNA complex.

18. The antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length The length of the antisense strand is 1 to 3 nucleotides, and the antisense strand is bound to the 3' end of the antisense strand. or said nucleotide sequence V is 2 in length. Alternatively, the nucleotide sequence V is a sequence of two consecutive thymine deoxyribonuclease (TDM) residues. a uracil ribonucleotide or two consecutive uracil ribonucleotides, or The nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA. The siRNA complex according to any one of claims 1 to 17.

19. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, The antisense strand comprises the nucleotide sequence shown in SEQ ID NO:6, or The sense strand of A comprises the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand is , comprising the nucleotide sequence shown in SEQ ID NO:8, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

65. and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:66; or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:67, the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:68, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

125. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

126. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

127. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

128. Contains the array of Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

185. wherein the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 186; or wherein the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 187; the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 188; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

245. wherein the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

246. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

247. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

248. Contains the array of Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

305. wherein the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

306. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

307. The antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

308. The siRNA conjugate of any one of claims 1 to 18, comprising the sequence:

20. The siRNA is siPCSKa1, siPCSKa2, siPCSKb1, siP CSKb2, siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd 2. siPCSKe1, siPCSKe2, siPCSKf1 or siPCSKf2 The siRNA according to any one of claims 11 to 19, having a nucleotide sequence Complex.

21. The sense strand or the antisense strand has at least one modified nucleotide. and / or at least one phosphate ester group is a phosphate having a modifying group. The siRNA conjugate of any one of claims 1 to 20, which is an ester group.

22. Each nucleotide in the sense strand and the antisense strand is independently fluoro-modified. nucleotide or a non-fluoro modified nucleotide, Alternatively, the fluoro-modified nucleotide is a nucleotide sequence of nucleotide sequence I I, from the 5' end to the 3' end, at least the 1st base of said nucleotide sequence I The 7th, 8th and 9th nucleotides are fluoro-modified nucleotides, and the 5' to 3' nucleotides are At least the 2nd, 6th, 14th and 16th nucleotides of said nucleotide sequence II are tide is a fluoro-modified nucleotide, Alternatively, from the 5' end to the 3' end, in the sense strand, The nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 of sequence I are fluoro-modified nucleotides. and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides. and in the antisense strand, the nucleotide sequence is Nucleotides at positions 2, 6, 14, and 16 or 2, 6, 8, 9, 14, and 16 of nucleotide sequence II and the nucleotides at the remaining positions in the antisense strand are fluoro-modified nucleotides. The siRNA conjugate of claim 21 , wherein the nucleotide is a non-fluoro-modified nucleotide.

23. Each non-fluoro modified nucleotide has a hydroxy group at the 2' position of the ribose group of the nucleotide. are independently selected from nucleotides or nucleotide analogs substituted with non-fluorine groups. This is one of the Alternatively, the hydroxy group at the 2' position of the ribose group of the nucleotide is replaced with a non-fluorine group. The nucleotide may be a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2' -amino modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxy nucleotides nucleotide analogs are selected from isonucleotides, LNAs, one selected from ENA, cET, UNA and GNA; Alternatively, each non-fluoro-modified nucleotide is a methoxy-modified nucleotide. The methoxy-modified nucleotide is a nucleotide in which the 2'-hydroxy group of the ribose group is replaced with methoxy.

23. The siRNA conjugate of claim 21 or 22, wherein the nucleotide is a substituted nucleotide.

24. From the 5' end to the 3' end, the nucleotide sequence in the sense strand of the siRNA The nucleotides at positions 5, 7, 8 and 9 of column I are fluoro-modified nucleotides; The remaining nucleotides in the sense strand of the nucleic acid are methoxy-modified nucleotides, and the 5' end From the 3' end to the nucleotide sequence in the antisense strand of the siRNA The nucleotides at positions 2, 6, 8, 9, 14, and 16 of II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. Chid, Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I are fluoro-modified nucleotides. and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end to the 3' end, The nucleotides at positions 2, 6, 14, and 16 of peptide sequence II are fluoro-modified nucleotides. and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides. It is Chid. Alternatively, the nucleotide sequence of the sense strand of the siRNA from the 5' end to the 3' end may be The nucleotides at positions 7, 8 and 9 of nucleotide sequence I are fluoro-modified nucleotides; The nucleotides at the remaining positions of the sense strand of the iRNA are methoxy-modified nucleotides, nucleotides in the antisense strand of the siRNA from the 3' end to the 3' end The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoro-modified nucleotides. , the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides The siRNA complex according to any one of claims 21 to 23,

25. The siRNA is siPCSKa1-M1, siPCSKa2-M1, siPCSK a1-M2, siPCSKa2-M2, siPCSKa1-M3, siPCSKa2-M 3, siPCSKb1-M1, siPCSKb2-M1, siPCSKb1-M2, si PCSKb2-M2, siPCSKb1-M3, siPCSKb2-M3, siPCSK c1-M1, siPCSKc2-M1, siPCSKc1-M2, siPCSKc2-M 2, siPCSKc1-M3, siPCSKc2-M3, siPCSKd1-M1, si PCSKd2-M1, siPCSKd1-M2, siPCSKd2-M2, siPCSK d1-M3, siPCSKd2-M3, siPCSKe1-M1, siPCSKe2-M 1, siPCSKe1-M2, siPCSKe2-M2, siPCSKe1-M3, si PCSKe2-M3, siPCSKf1-M1, siPCSKf2-M1, siPCSK f1-M2, siPCSKf2-M2, siPCSKf1-M3 or siPCSKf2- The siRNA conjugate of any one of claims 1 to 24, which is any one of M1, M2, M3, M4, M5, M6, M7, M8, M9, M10, M11, M12, M13, M14, M15, M16, M17, M18, M19, M20, M21, M22, M23, M24, M25, M26, M27, M28, M

26. The phosphate ester group having the modifying group is a phosphate diester in the phosphate ester group. a thiophosphate group in which at least one oxygen atom of the bond is replaced with a sulfur atom; Alternatively, the phosphate ester group having the modifying group is a thiol having a structure represented by formula (1): The siRNA conjugate of claim 21 , which is a phosphate group. 【Chemistry 7】

27. In the siRNA, the thiophosphate group is Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, The first and second nucleotides from the 5' end of the antisense strand Between, The second and third nucleotides from the 5' end of the antisense strand Between, The first and second nucleotides from the 3' end of the antisense strand Between, and The second and third nucleotides from the 3' end of the antisense strand The s according to claim 26 is bonded to at least one selected from the group consisting of iRNA complexes.

28. The siRNA is siPCSKa1-M1S, siPCSKa2-M1S, siPC SKa1-M2S, siPCSKa2-M2S, siPCSKa1-M3S, siPCS Ka2-M3S, siPCSKb1-M1S, siPCSKb2-M1S, siPCSK b1-M2S, siPCSKb2-M2S, siPCSKb1-M3S, siPCSKb 2-M3S, siPCSKc1-M1S, siPCSKc2-M1S, siPCSKc1 -M2S, siPCSKc2-M2S, siPCSKc1-M3S, siPCSKc2- M3S, siPCSKd1-M1S, siPCSKd2-M1S, siPCSKd1-M 2S, siPCSKd2-M2S, siPCSKd1-M3S, siPCSKd2-M3 S, siPCSKe1-M1S, siPCSKe2-M1S, siPCSKe1-M2S , siPCSKe2-M2S, siPCSKe1-M3S, siPCSKe2-M3S, siPCSKf1-M1S, siPCSKf2-M1S, siPCSKf1-M2S, s iPCSKf2-M2S, siPCSKf1-M3S or siPCSKf2-M3S The siRNA complex according to any one of claims 1 to 27,

29. The 5'-terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide. or 5'-phosphate analog modified nucleotides, Alternatively, the 5'-phosphate nucleotide is a nucleotide having a structure shown in formula (2): The 5'-phosphate analog modified nucleotide is represented by any one of formulas (3) to (6). nucleotides selected from those having the structure shown in any one of 【Chemistry 8】 In the formula, R is selected from H, OH, a methoxy group, or fluorine, and Base represents a base. siR according to any one of claims 1 to 28, wherein the siR is selected from the group consisting of A, U, C, G and T. NA complex.

30. The siRNA is siPCSKa1-M1P1, siPCSKa1-M2P1, si PCSKa1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siPCSKa2-M3P1, siPCSKa1-M1SP1, siPCSKa1-M2 SP1, siPCSKa1-M3SP1, siPCSKa2-M1SP1, siPCSK a2-M2SP1, siPCSKa2-M3SP1, siPCSKb1-M1P1, si PCSKb1-M2P1, siPCSKb1-M3P1, siPCSKb2-M1P1, siPCSKb2-M2P1, siPCSKb2-M3P1, siPCSKb1-M1S P1, siPCSKb1-M2SP1, siPCSKb1-M3SP1, siPCSKb 2-M1SP1, siPCSKb2-M2SP1, siPCSKb2-M3SP1, si PCSKc1-M1P1, siPCSKc1-M2P1, siPCSKc1-M3P1, siPCSKc2-M1P1, siPCSKc2-M2P1, siPCSKc2-M3P 1, siPCSKc1-M1SP1, siPCSKc1-M2SP1, siPCSKc1 -M3SP1, siPCSKc2-M1SP1, siPCSKc2-M2SP1, siP CSKc2-M3SP1, siPCSKd1-M1P1, siPCSKd1-M2P1, siPCSKd1-M3P1, siPCSKd2-M1P1, siPCSKd2-M2P 1, siPCSKd2-M3P1, siPCSKd1-M1SP1, siPCSKd1- M2SP1, siPCSKd1-M3SP1, siPCSKd2-M1SP1, siPC SKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1-M1P1, siPCSKe1-M2P1, siPCSKe1-M3P1, siPCSKe2-M1P 1, siPCSKe2-M2P1, siPCSKe2-M3P1, siPCSKe1-M 1SP1, siPCSKe1-M2SP1, siPCSKe1-M3SP1, siPCS Ke2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1, siPCSKf1-M1P1, siPCSKf1-M2P1, siPCSKf1-M3P 1, siPCSKf2-M1P1, siPCSKf2-M2P1, siPCSKf2-M 3P1, siPCSKf1-M1SP1, siPCSKf1-M2SP1, siPCSK f1-M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1, or siPCSKf2-M3SP1 The siRNA conjugates described herein.

31. An siRNA comprising a sense strand and an antisense strand, Each nucleotide in the strand is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide. nucleotides, the sense strand comprising nucleotide sequence I, and the antisense strand comprising The nucleotide sequence I and the nucleotide sequence II are , forming a double-stranded region in at least a portion in a reverse complementary manner, and the fluoro-modified nucleotide is Located in nucleotide sequence I and nucleotide sequence II, from the 5' end to the 3' end In the sense strand, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence I are and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides. the antisense strand is a fluoro-modified nucleotide from the 5' end to the 3' end The nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluoro modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are non- is a fluoro-modified nucleotide, i) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length; and preferably has no more than three nucleotide differences, and is shown in nucleotide sequence II and SEQ ID NO:

2. The nucleotide sequences that are the same length and have no more than three nucleotide differences, In nucleotide sequence I, position Z １ Nucleotide Z corresponding to ３ The nucleoside is In sequence II, position Z ２ Nucleotide Z corresponding to ４ and Z ４ The above A the first nucleotide at the 5' end of the antisense strand, or ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:6 is 3 or less. The nucleotide sequence shown in FIG. 2 is the same length and has no more than three nucleotide differences. In said nucleotide sequence I, position Z ５ Nucleotide Z corresponding to ７ The above-mentioned In nucleotide sequence II, position Z ６ Nucleotide Z corresponding to ８ and Z ８ teeth, the first nucleotide at the 5' end of the antisense strand, or iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are The nucleotide sequence is the same in length and has no more than three nucleotide differences, and is identical to the nucleotide sequence II of SEQ ID NO: The nucleotide sequence shown in No. 122 is the same length and has no more than three nucleotide differences. and in said nucleotide sequence I, position Z ９ Nucleotide Z corresponding to １１ Includes In said nucleotide sequence II, position Z １０ Nucleotide Z corresponding to １２ Includes: Said Z １２ is the first nucleotide at the 5' end of the antisense strand, or iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 have a length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 182 is identical in length and has no more than three nucleotide differences. and in said nucleotide sequence I, position Z １３ Nucleotide Z corresponding to １５ Includes In said nucleotide sequence II, position Z １４ Nucleotide Z corresponding to １６ Includes: Said Z １６ is the first nucleotide at the 5' end of the antisense strand, or v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have a length and the nucleotide difference between said nucleotide sequence II and SEQ ID NO:2 is 3 or less. The nucleotide sequence shown in 42 is identical in length and has no more than three nucleotide differences. and in said nucleotide sequence I, position Z １７ Nucleotide Z corresponding to １９ Includes: In said nucleotide sequence II, position Z １８ Nucleotide Z corresponding to ２０ Contains, before Diary Z ２０ is the first nucleotide at the 5' end of the antisense strand, or vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have a length and the nucleotide sequence II and the sequence ID No. The nucleotide sequence shown in 302 is the same length and has no more than three nucleotide differences. and in said nucleotide sequence I, position Z ２１ Nucleotide Z corresponding to ２３ Includes In said nucleotide sequence II, position Z ２２ Nucleotide Z corresponding to ２４ Includes: Said Z ２４ is the first nucleotide at the 5' end of the antisense strand, A.

32. Each non-fluoro modified nucleotide has a hydroxy group at the 2' position of the ribose group of the nucleotide. are independently selected from nucleotides or nucleotide analogs substituted with non-fluorine groups. The siRNA of claim 31 , which is one of the above.

33. A nucleoside in which the 2'-hydroxyl group of the ribose group of a nucleotide is replaced with a non-fluorine group. 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-Alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino Modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxy nucleotides and the nucleotide analog is an isonucleotide, an LNA, an ENA , cET, UNA and GNA. iRNA.

34. Each non-fluoro modified nucleotide is a methoxy modified nucleotide, Toxo-modified nucleotides are nucleotides in which the 2'-hydroxy group of the ribose group is replaced with methoxy. The siRNA of any one of claims 31 to 33, which refers to a nucleotide.

35. i) a nucleotide sequence between said nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1; and / or the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 have no more than one octide difference. and the nucleotide sequence differs by no more than one nucleotide from the nucleotide sequence Alternatively, ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:61 and / or has no more than one nucleotide difference with said nucleotide sequence II. has no more than one nucleotide difference from the nucleotide sequence shown in column 62; or iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

121. and / or said nucleotide sequence II has no more than one nucleotide difference between said nucleotide sequence II and said There is no more than one nucleotide difference between the nucleotide sequence set forth in SEQ ID NO:122 、 or iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

181. and / or has no more than one nucleotide difference with said nucleotide sequence II. has no more than one nucleotide difference from the nucleotide sequence shown in column 182; or v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241; and / or said nucleotide sequence II and sequence 242 has no more than one nucleotide difference from the nucleotide sequence set forth in or vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:

301. and / or has no more than one nucleotide difference with said nucleotide sequence II. has no more than one nucleotide difference with the nucleotide sequence shown in column 302; The siRNA described in any one of claims 31 to 34.

36. i) a nucleic acid sequence between said nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2; The difference between the leotide and Z ４ Including the difference at the position of Z ４ is selected from A, U or C; or ii) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

62. The nucleotide difference between ８ Including the difference at the position of Z ８ Select from A, C or G And, or iii) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 The nucleotide difference between the sequence is Z １２ Including the difference at the position of Z １２ is A, C or G is selected from or iv) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

182. The nucleotide difference between the sequence is Z １６ Including the difference at the position of Z １６ Is U, C or G? Selected from or v) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

242. The nucleotide difference between ２０ Including the difference at the position of Z ２０ from U, C or G Selected, or vi) the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:

302. The nucleotide difference between the sequence is Z ２４ Including the difference at the position of Z ２４ Is A, C or G? The siRNA according to any one of claims 31 to 35, selected from the group consisting of:

37. Z ３ But, Z ４ or Z ７ But, Z ８ and complementary nuclease or Z １１ But, Z １２ or Z １ ５ But, Z １６ or Z １９ But, Z ２０ and complementary Nuk or Z ２３ But, Z ２４ and is a nucleotide complementary to The siRNA described in

38. The nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially Reverse complementary or completely reverse complementary, and essentially reverse complementary means that the two nucleotide sequences are The term "substantially reverse complementary" refers to a sequence having three or fewer base mismatches between the two sequences. This refers to the presence of one or less base mismatch between two nucleotide sequences, and is considered to be completely reversed. Complementary means that there is no mismatch between the two nucleotide sequences. The siRNA according to any one of claims 1 to 5.

39. The sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence III. The length of nucleotide sequence III and nucleotide sequence IV is are each independently 1 to 4 nucleotides, and said nucleotide sequence III is a nucleotide nucleotide sequence I is linked to the 5' end of nucleotide sequence I, and nucleotide sequence IV is linked to the 3' end of nucleotide sequence II. The nucleotide sequence III and the nucleotide sequence IV are equal in length. The term "substantially reverse complementary" refers to a combination of two This refers to the presence of one or fewer base mismatches between nucleotide sequences, making it completely reverse-complementary. means that there is no mismatch between the two nucleotide sequences. The siRNA according to any one of claims 1 to 4.

40. i) the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, Nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4, The nucleotide sequences III and IV are each one nucleotide in length, the base of III is C; or the nucleotide sequences III and IV are both 2 nucleotides, from the 5' end to the 3' end, The base sequence is CC, or the nucleotide sequences III and IV are both 3 nucleotides in length. nucleotide having the nucleotide sequence of nucleotide III from the 5' end to the 3' end. or the nucleotide sequences III and IV are each 4 nucleotides in length. nucleotide sequence III from the 5' end to the 3' end is ACCC, or ii) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:63; The nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:64, Nucleotide sequences III and IV are each one nucleotide in length, The base of nucleotide sequence III is U, or the nucleotide sequences III and IV are different in length. Each of the sequences is 2 nucleotides. From the 5' end to the 3' end, the sequence is The base sequence of I is GU, or the nucleotide sequences III and IV are both From the 5' end to the 3' end, the nucleotide sequence III is The base sequence is GGU, or the nucleotide sequences III and IV are both 4 nucleotides, from the 5' end to the 3' end, the base sequence is GGGU; or iii) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123; and said nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 124; The nucleotide sequences III and IV are each one nucleotide in length. The base of nucleotide sequence III is G, or the nucleotide sequences III and IV are The length of each is 2 nucleotides, and the nucleotide sequence from the 5' end to the 3' end is The base sequence of sequence III is AG, or the nucleotide sequences III and IV have a length Each of them is a trinucleotide, and from the 5' end to the 3' end, it is nucleotide sequence I The nucleotide sequence of II is UAG, or the nucleotide sequences III and IV are different in length. Each of the sequences is 4 nucleotides, and from the 5' end to the 3' end, the sequence is The base sequence of I is AUAG, or iv) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183; wherein the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184; The nucleotide sequences III and IV are each one nucleotide in length. the base of nucleotide sequence III is C; or the nucleotide sequences III and IV have a length Each of these is two nucleotides, and from the 5' end to the 3' end, the nucleotide sequence The nucleotide sequence of III is AC, or the nucleotide sequences III and IV are different in length. Each of the sequences is 3 nucleotides, and from the 5' end to the 3' end, the sequence is The nucleotide sequence of I is GAC, or the nucleotide sequences III and IV are of equal length. Each of these is a 4-nucleotide sequence, and from the 5' to the 3' end, the sequence is is AGAC; or v) said nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 243; The nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244, Nucleotide sequences III and IV are each one nucleotide in length, the base of nucleotide sequence III is G; or the nucleotide sequences III and IV have a length Each of them is two nucleotides, and from the 5' end to the 3' end, it is nucleotide sequence I The base sequence of II is UG, or the nucleotide sequences III and IV are of equal length. Each of these is a trinucleotide and, from the 5' end to the 3' end, has the nucleotide sequence III or the nucleotide sequence III and IV are both From the 5' end to the 3' end, the nucleotide sequence III is The base sequence is UCUG, or vi) said nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303; wherein the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 304; The nucleotide sequences III and IV are each one nucleotide in length. the base of nucleotide sequence III is G; or the nucleotide sequences III and IV have a length Each of these is two nucleotides, and from the 5' end to the 3' end, the nucleotide sequence The base sequence of III is UG, or the nucleotide sequences III and IV are different in length. Each of the sequences is 3 nucleotides, and from the 5' end to the 3' end, the sequence is The base sequence of I is AUG, or the nucleotide sequences III and IV are of equal length. Each of these is a 4-nucleotide sequence, and from the 5' to the 3' end, the sequence is The siRNA according to any one of claims 31 to 39, wherein the base sequence is UAUG.

41. The nucleotide sequences III and IV are completely reverse complementary to each other. RNA.

42. The antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length The length of the antisense strand is 1 to 3 nucleotides, and the antisense strand is bound to the 3' end of the antisense strand. or said nucleotide sequence V is 2 in length. Alternatively, the nucleotide sequence V is a sequence of two consecutive thymine deoxyribonuclease (TDM) residues. a uracil ribonucleotide or two consecutive uracil ribonucleotides, or The nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA.

42. The siRNA according to any one of claims 31 to 41.

43. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, The antisense strand comprises the nucleotide sequence shown in SEQ ID NO:6, or The sense strand of A comprises the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand is , comprising the nucleotide sequence shown in SEQ ID NO:8, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

65. and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:66; or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:67, the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:68, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

125. wherein the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

126. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

127. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

128. Contains the array of Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

185. wherein the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 186; or wherein the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 187; the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 188; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

245. wherein the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

246. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

247. The antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

248. Contains the array of Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

305. wherein the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

306. or the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

307. The antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

308. The siRNA of any one of claims 31 to 42, comprising the sequence:

44. siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2, siP CSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siPCSKe 1. Nucleotides shown in siPCSKe2, siPCSKf1 or siPCSKf2 The siRNA according to any one of claims 31 to 43, having a sequence.

45. siPCSKa1-M1, siPCSKa2-M1, siPCSKb1-M1, siP CSKb2-M1, siPCSKc1-M1, siPCSKc2-M1, siPCSKd 1-M1, siPCSKd2-M1, siPCSKe1-M1, siPCSKe2-M1 siPCSKf1-M1 or siPCSKf2-M1.

45. The siRNA according to any one of claims 1 to 44.

46. At least one phosphate group in the sense strand or the antisense strand is modified The siRNP of any one of claims 31 to 45, which is a phosphate ester group having a group. A.

47. The phosphate ester group having the modifying group is a phosphate diester in the phosphate ester group. a thiophosphate group in which at least one oxygen atom of the bond is replaced with a sulfur atom; Alternatively, the phosphate ester group having the modifying group is a thiol having a structure represented by formula (1): The siRNA of claim 46, which is a phosphate group. 【Chemistry 9】

48. The thiophosphate group is Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, The first and second nucleotides from the 5' end of the antisense strand Between, The second and third nucleotides from the 5' end of the antisense strand Between, The first and second nucleotides from the 3' end of the antisense strand Between, and The second and third nucleotides from the 3' end of the antisense strand The siRNA of claim 47, wherein the siRNA is linked to at least one of the group consisting of:

49. siPCSKa1-M1S, siPCSKa2-M1S, siPCSKb1-M1S, siPCSKb2-M1S, siPCSKc1-M1S, siPCSKc2-M1S, s iPCSKd1-M1S, siPCSKd2-M1S, siPCSKe1-M1S, si PCSKe2-M1S, siPCSKf1-M1S or siPCSKf2-M1S The siRNA according to any one of claims 31 to 48, which is one of the above.

50. The 5'-terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide. or 5'-phosphate analog modified nucleotides, Alternatively, the 5'-phosphate nucleotide is a nucleotide having a structure shown in formula (2): The 5'-phosphate analog modified nucleotide is represented by any one of formulas (3) to (6). nucleotides selected from those having the structure shown in any one of 【Chemistry 10】 In the formula, R is selected from H, OH, a methoxy group, or fluorine, and Base represents a base.

50. The si according to any one of claims 31 to 49, wherein the si is selected from the group consisting of A, U, C, G and T. RNA.

51. siPCSKa1-M1P1, siPCSKa2-M1P1, siPCSKa1-M1 SP1, siPCSKa2-M1SP1, siPCSKb1-M1P1, siPCSKb 2-M1P1, siPCSKb1-M1SP1, siPCSKb2-M1SP1, siP CSKc1-M1P1, siPCSKc2-M1P1, siPCSKc1-M1SP1, siPCSKc2-M1SP1, siPCSKd1-M1P1, siPCSKd2-M1 P1, siPCSKd1-M1SP1, siPCSKd2-M1SP1, siPCSKe 1-M1P1, siPCSKe2-M1P1, siPCSKe1-M1SP1, siPC SKe2-M1SP1, siPCSKf1-M1P1, siPCSKf2-M1P1, s either iPCSKf1-M1SP1 or siPCSKf2-M1SP1; The siRNA described in any one of claims 31 to 50.

52. siPCSKa1-M1SP, siPCSKb1-M1SP, siPCSKc1-M1 SP, siPCSKd1-M1SP, siPCSKe1-M1SP or siPCSKf1 - M1SP or any one of the siRNAs according to any one of claims 31 to 51. 。

53. A composition comprising the siRNA according to any one of claims 31 to 52 and a pharma- ceutically acceptable carrier. A pharmaceutical composition comprising:

54. siRNA according to any one of claims 31 to 52 and a compound complexed with said siRNA. The siRNA conjugate comprises a conjugated group.

55. siRNA complex according to any one of claims 1 to 30 and 54, or claims 31 to 52 The PCS of the siRNA according to any one of claims 1 to 53 and / or the pharmaceutical composition according to claim 53. For the preparation of a medicament for the treatment and / or prevention of a disease or physiological condition caused by abnormal expression of the K9 gene For use in.

56. A method for treating and / or preventing a disease or physiological condition caused by abnormal expression of the PCSK9 gene. siRNA complex according to any one of claims 1 to 30 and 54, claims 31 to 52 An effective amount of the siRNA according to any one of claims 53 and / or the pharmaceutical composition according to claim 53 is administered. administering to a subject suffering from the disease or physiological condition.

57. A method for suppressing expression of PCSK9 gene in liver cells, comprising the steps of: The siRNA complex according to any one of claims 31 to 52, contacting the hepatocytes with an effective amount of the iRNA and / or the pharmaceutical composition of claim 53; and

58. siRNA complex according to any one of claims 1 to 30 and 54, or claims 31 to 52 A kit comprising the siRNA according to any one of claims 53 and / or the pharmaceutical composition according to claim 53. to.

Images