Nucleic acid aptamers and bone regeneration-inducing materials comprising the nucleic acid aptamers

Abstract

To provide NA-AP having excellent binding ability to BMP, and reduction of the risk of heterotopic ossification in the bone regeneration treatment using the same.SOLUTION: Disclosed is a nucleic acid aptamer (NA-AP) that specifically binds to a bone morphogenetic protein (BMP) and comprises a base sequence selected from the group consisting of base sequences of specific sequences and base sequences having 80% of more identity to the specific base sequences, where the NA-AP is DNA or RNA, and when the NA-AP is DNA, each U in the nucleic acid sequences is substituted with T.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to NA-AP having binding ability to BMP, and a bone regeneration-inducing material containing said NA-AP. [Background technology]

[0002] BMPs are secreted signaling molecules belonging to the TGF-β superfamily. They were originally discovered as regulators of cartilage and bone formation, and at least 20 types of BMPs have been found to play roles in embryogenesis and the morphogenesis of tissues and organs.

[0003] Currently, two BMPs (BMP-2 and BMP-7 / OP-1) have been approved by the US Food and Drug Administration (FDA), and the clinical application of the former in particular has been progressing in the field of orthopedics. However, since BMPs have strong bone induction properties and cannot be retained locally when administered as an aqueous solution, problems have been reported in which bones form in undesired locations, known as "ectopic ossification."

[0004] In order to reduce the risk of such heterotopic ossification, a carrier for retaining BMP locally is required. Furthermore, in order to maximize the local concentration of BMP, it is desirable to be able to selectively capture BMP. In recent years, NA-AP has attracted attention as a means for selectively capturing such proteins (e.g., Patent Document 1). The Systematic Evolution of Ligands by EXponential enrichment (SELEX) method is often used as an effective means for searching for new aptamers that specifically bind to proteins. However, there have been no reports so far on the base sequence of NA-AP that specifically binds to BMP. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Patent No. 6914284 Summary of the Invention [Problem to be solved by the invention]

[0006] Therefore, the objective of the present invention is to provide NA-AP that has excellent binding ability to BMP, and to improve the therapeutic effect and reduce the risk of ectopic ossification by increasing the local concentration of BMP in bone regeneration therapy using it. [Means for solving the problem]

[0007] As a result of intensive research aimed at solving the above-mentioned problems, the inventors discovered NA-AP having specific binding ability to BMP, and a bone regeneration inducing material in which said NA-AP is supported in a hydrogel, thereby completing the present invention.

[0008] That is, in one aspect, the present invention provides <1> An NA-AP characterized by specifically binding to BMP, the NA-AP having any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4, and base sequences having 80% or more homology to each of these base sequences, the NA-AP being DNA or RNA, and when the NA-AP is DNA, the NA-AP is a sequence in which U in the nucleic acid sequence is replaced with T; <2> The above-mentioned nucleic acid sequence has any one of the nucleic acid sequences selected from the group consisting of nucleic acid sequences having 90% or more homology with the nucleic acid sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4. <1> NA-AP described in; <3> The above-mentioned nucleic acid has any one of the nucleic acid sequences selected from the group consisting of nucleic acid sequences having 95% or more homology with the nucleic acid sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4. <1> NA-AP described in; <4> The NA-AP has a sequence represented by the following formula (I): 5'-X-AAAAAGUAAUGUAGGAGUUCACUUU-Y-3' (I) (wherein X and Y are each one or more nucleotides selected from C, G, U, or A). <1> NA-AP described in; <5> The above, wherein the BMP is BMP-2. <1> NA-AP as described; <6> The above, wherein the BMP-2 is human BMP-2. <5> NA-AP described in <7> The above compound has at its 5'-end or 3'-end one or more functional groups selected from the group consisting of a sulfhydryl group, an amino group, a hydroxy group, a carboxyl group, an imidazole group, an alkynyl group, an aldehyde group, an azide group, a maleimide group, an N-hydroxysuccinimidyl (NHS) group, a pentafluorophenyl ester group, a pyridyl sulfide group, an α-halo ester group, an α-halo amide group, a hydrazide group, an isocyanate group, an aryl azide group, a diazirine group, and a sulfosuccinimidyl group. <1> NA-AP listed in This provides:

[0009] In another aspect, the present invention relates to a bone regeneration-inducing material and composition comprising the above-mentioned NA-AP, specifically, <8> the above <1> ~ <7> A bone regeneration inducing material comprising the NA-AP according to any one of the above items. <9> The above, comprising an insoluble carrier on which the NA-AP is immobilized. <8> 2. The bone regeneration guide material according to claim 1 ; <10> The insoluble carrier is a hydrogel. <9> 2. The bone regeneration guide material according to claim 1 ; <11> The hydrogel contains polyethylene glycol (PEG) as a network component. <10> 2. The bone regeneration guide material according to claim 1 ; <12> the above <1> ~ <7> A composition comprising the NA-AP according to any one of the above and a hydrogel; and <13> The hydrogel contains polyethylene glycol (PEG) as a network component. <12> The composition described in This provides: Effect of the Invention

[0010] The NA-AP of the present invention has excellent binding ability to BMP, and can reduce the risk of ectopic ossification in bone regeneration treatment. Furthermore, by carrying the NA-AP in a specific hydrogel, the retention of BMP in the affected area can be improved. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 shows a sensorgram obtained when BMP2 was injected into a chip on which NA-AP was immobilized. [Diagram 2] FIG. 2 shows a sensorgram obtained when BMP2 was injected into a chip on which NA-AP was immobilized, and then BMPR was injected. [Diagram 3] FIG. 3 shows the results of evaluation of the ability of NA-AP to inhibit Smad phosphorylation using the Western blotting (WB) method. [Figure 4] FIG. 4 shows a sensorgram obtained when BMP2 was injected into a chip on which NA-AP was immobilized. [Diagram 5] FIG. 5 shows sensorgrams obtained when different concentrations of BMP2 were injected onto a chip on which SEQ ID NO:3-4 was immobilized (Kd=0.404 nM). [Figure 6] FIG. 6 shows the C 1s and F 1s spectra of the substrate on which SEQ ID NO:3-4 or poly dT was immobilized. [Figure 7] Figure 7 shows the results of evaluating the BMP2 capture ability of NA-AP immobilized materials using Enzyme-Linked Immuno-Sorbent Assay (ELISA). [Figure 8] FIG. 8 shows the amounts of MHC produced and ALP produced during culture of mouse myoblasts (C2C12). [Figure 9] FIG. 9 shows CT images of the mouse front paws after each sample was implanted. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Hereinafter, embodiments of the present invention will be described. The scope of the present invention is not limited to these descriptions, and other than the following examples, the present invention can be appropriately modified and implemented without departing from the spirit of the present invention.

[0013] 1. Nucleic acid aptamers of the present invention The NA-AP of the present invention is characterized by being capable of specifically binding to BMP, and has any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 2, 3, and 4, and base sequences having 80% or more homology with these base sequences. When the NA-AP is DNA, the U in these base sequences is replaced with T.

[0014] <Sequence number 1> 5'- GGGAGACAAGAAUAAACGCUCAAUGGAAGGACUGAAACGCACCACGUGUGCCCAGAGAGUAAG UUCGACAGGAGGCUCACAACAGGC -3' <Sequence number 2> 5'- GGGAGACAAGAAUAAACGCUCAAGCCCCUACACGCCGUAGCUUGGUGCUGUUCUACGGGGAGC UUCGACAGGAGGCUCACAACAGGC -3' <Sequence number 3> 5'- GGGAGACAAGAAUAAACGCUCAAUGCCGGCACAUCCGUCGAAAAAGUAAUGUAGGAGUUCACU UUCGACAGGAGGCUCACAACAGGC -3' <Sequence number 3-1> 5'- GGCUGUUGUGAGCCUCCUGUCGAAAGUGAACUCCUACAUUACUUUUUCGACGGAUGUGCCGGCAUUGACC -3' <Sequence number 3-2> 5'- GGCUGUCGAAAGUGAACUCCUACAUUACUUUUUCGACGCC -3' <Sequence number 3-3> 5'- AGUGAACUCCUACAUUACUUUGGACGGAUGUGCCC -3' <Sequence number 3-4> 5'- GGCAAAAAGUAAUGUAGGAGUUCACUUUGCC -3'

[0015] Here, in silico analysis has predicted that the BMP binding site of the NA-AP of the present invention is different from the binding site with the BMP receptor (BMPR). Therefore, NA-AP does not inhibit the function of BMP, and thus effectively exerts bone regeneration ability.

[0016] In this specification, the term "aptamer" refers to a nucleic acid molecule that can specifically bind to small molecules such as amino acids, polymers such as proteins, and viruses and cells, and in the present invention refers to a functional molecule that can directly bind to BMP. The aptamer can be obtained by the SELEX method. In the present invention, single-stranded or double-stranded nucleic acid molecules, such as RNA, modified RNA, single-stranded DNA, or double-stranded DNA, can be used as the nucleic acid molecule. In the present invention, preferred nucleic acid molecules are RNA and its modified RNA. Each nucleic acid may contain bases modified with fluorine or methyl groups, or may contain modifications such as thiophosphorylation of the phosphate moiety, as necessary.

[0017] In a preferred embodiment, the NA-AP of the present invention has any one of the base sequences selected from the group consisting of base sequences having a homology of 90% or more, more preferably 95% or more, even more preferably 97% or more, and particularly preferably 99% or more to the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 2, 3, and 4, respectively.

[0018] In a further preferred embodiment, the NA-AP of the present invention can have a sequence as shown in formula (I) below. 5'-X-AAAAAGUAAUGUAGGAGUUCACUUU-Y-3' (I)

[0019] Here, X and Y are each one or more nucleotides selected from C, G, U, or A; preferably, X and Y are combined to form one or more stem structures or G-quadruplexes. In this specification, the term "stem structure" refers to a double helix structure formed by complementary base pairs, and the term "G-quadruplex" refers to a higher-order structure that can be adopted by a guanine-rich nucleic acid, in which four guanine bases form a planar structure and are stacked together to form a quadruplex structure.

[0020] The NA-APs of the present invention can be labeled at any position of the nucleic acid molecule, for example at one or both ends or at other positions, or a functional group or molecule can be attached to any position of the nucleic acid molecule, for binding to a carrier, for subjecting to biochemical tests, or for modifying their biochemical and / or biophysical properties.

[0021] The NA-AP of the present invention is preferably modified at the 5'-end and / or 3'-end. For example, the NA-AP of the present invention may have at the 5'-end or 3'-end one or more functional groups selected from the group consisting of sulfhydryl group, amino group, hydroxy group, carboxyl group, imidazole group, alkynyl group, aldehyde group, azide group, maleimide group, N-hydroxysuccinimidyl (NHS) group, pentafluorophenyl ester group, pyridyl sulfide group, α-halo ester group, α-halo amide group, hydrazide group, isocyanate group, aryl azide group, diazirine group, and sulfosuccinimidyl group.

[0022] Other examples of the label include fluorescent substances such as fluorescein, rhodamine, and derivatives thereof; 32 P, 35Examples of functional compounds include isotopes such as S. Examples of functional compounds include tag molecules such as biotin and maltose. Biotin has the property of specifically binding to avidin and streptavidin, and can be used to measure binding activity in the presence of an appropriate substrate by binding an enzyme such as alkaline phosphatase or horseradish peroxidase to such avidin.

[0023] The NA-AP of the present invention can be DNA or RNA, but is preferably an RNA aptamer. When the NA-AP is DNA, it is a sequence in which U in the base sequence shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4 is replaced with T.

[0024] The BMP to which the NA-AP of the present invention specifically binds is preferably BMP-2, more preferably human BMP-2.

[0025] The NA-AP of the present invention can be obtained, for example, by the SELEX method. The SELEX method is known as a method for selecting only the nucleic acid that binds to the target molecule with high affinity by repeating the cycle of selecting and amplifying the nucleic acid that binds to the target molecule from a nucleic acid library containing random sequences, for example, 5 to 20 times (Tuerk, C. and Gold, L., Science, Vol. 249, pp. 505-510, 1990).

[0026] 2. Bone regeneration-inducing material and composition of the present invention In another aspect, the present invention provides a bone regeneration inductive material comprising NA-AP.

[0027] Preferably, the bone regeneration-inducing material of the present invention includes an insoluble carrier on which NA-AP is immobilized. Such carriers are not particularly limited as long as they are carriers commonly used in the art for protein purification, etc., and include, for example, cellulose-based carriers including Sepharose, Sephadex, and Biogel, agarose-based carriers, and hydrogels formed by synthetic polymers.

[0028] Preferably, the insoluble carrier is a hydrogel formed from a hydrophilic polymer. Such a hydrogel may contain a hydrophilic polymer having a polyalkylene glycol or a polyvinyl skeleton as a network component. The polyalkylene glycol is typically polyethylene glycol (PEG). Examples of the polymer having a polyvinyl skeleton include polyalkyl methacrylate such as polymethyl methacrylate, polyacrylate, polyvinyl alcohol, poly N-alkylacrylamide, and polyacrylamide.

[0029] Representative examples of hydrophilic polymers having polyethylene glycol (PEG) as the main chain include PEGs having multiple branches, and PEGs having two, three, four or eight branches are particularly preferred. In particular, gels consisting of a 4-branched PEG backbone are generally known as Tetra-PEG gels, in which a meshwork network is constructed by an AB-type cross-end coupling reaction between two types of 4-branched polymers each having an electrophilic functional group such as an active ester structure and a nucleophilic functional group such as an amino group at the end (Matsunaga et al., Macromolecules, Vol. 42, No. 4, pp. 1344-1351, 2009). Tetra-PEG gels can be easily prepared in situ by simple two-liquid mixing of each polymer solution, and the gelation time can be controlled by adjusting the pH and ionic strength during gel preparation. Since this gel is mainly composed of PEG, it is also excellent in biocompatibility.

[0030] The polymer forming the PEG hydrogel was 1x10 3 ~1x10 5 range, preferably 5x10 3 ~8x10 4 in the range of 1x10 4 ~2x10 4 The weight average molecular weight (Mw) ranges from 0.1 to 1.0.

[0031] Preferably, the polymer forming the PEG hydrogel is a combination of a polymer having one or more nucleophilic functional groups at the side chain or end and a polymer having one or more electrophilic functional groups at the side chain or end. For example, it is preferable that one polymer has one or more nucleophilic functional groups at the side chain or end, and the other polymer has one or more electrophilic functional groups at the side chain or end. The gel is formed by crosslinking such nucleophilic functional groups and electrophilic functional groups. Here, the total number of nucleophilic functional groups and electrophilic functional groups is preferably 5 or more. It is more preferable that these functional groups are present at the end.

[0032] Examples of the nucleophilic functional group include a thiol group (-SH) and an amino group, and those skilled in the art can use any known nucleophilic functional group as appropriate. Preferably, the nucleophilic functional group is a -SH group. The nucleophilic functional groups may be the same or different, but are preferably the same. By using the same functional group, the reactivity with the electrophilic functional group that forms the crosslinked bond becomes uniform, and it becomes easier to obtain a gel having a uniform three-dimensional structure.

[0033] As the electrophilic functional group, a functional group that can be attacked by a nucleophilic functional group can be used. Examples of such functional groups include a maleimide group, an N-hydroxy-succinimidyl (NHS) group, a sulfosuccinimidyl group, a phthalimidyl group, an imidazoyl group, an acryloyl group, a nitrophenyl group, and -CO2PhNO2 (Ph represents an o-, m-, or p-phenylene group), and other known electrophilic functional groups can be appropriately used by those skilled in the art. Preferably, the electrophilic functional group is a maleimide group or an N-hydroxysuccinimidyl (NHS) group. Particularly preferably, it is a maleimide group. The electrophilic functional groups may be the same or different, but it is preferable that they are the same. By using the same functional group, the reactivity with the nucleophilic functional group that forms the crosslinked bond becomes uniform, and it becomes easier to obtain a gel having a uniform three-dimensional structure.

[0034] The method of crosslinking for hydrogel formation is not limited to the reaction between the nucleophilic functional group and the electrophilic functional group, and those skilled in the art may select other known chemically crosslinkable pairs.

[0035] In another aspect, the present invention can be defined as a composition comprising the above-mentioned NA-AP and a hydrogel, the hydrogel being formed from a polymer having a polyethylene glycol (PEG) backbone as described above. EXAMPLES

[0036] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0037] 1. Screening of BMP2-binding RNA aptamers using SELEX Using the SELEX method, we selected an RNA aptamer (hereafter referred to as NA-AP) that specifically binds to BMP2. The details are as follows. As a template DNA pool, a single-stranded DNA with the following sequence was used. The total length is 104 bases, and there are 40 bases of random sequence indicated by N between "GAA" and "TTG".

[0038] DNA Pool Random 40 (Gene Design) Sequence: 5' - GCC TGT TGT GAG CCT CCT GTC GAA (40N) TTG AGC GTT TAT TCT TGT CTC CCT ATA GTG AGT CGT ATT A- 3' Length: 104 bases (the central 40 bases are random sequences)

[0039] The base sequences at both ends of the random sequence are the primer sequences used in PCR and the promoter sequence of T7 RNA polymerase. To confer nuclease resistance to RNA, RNA was transcribed and synthesized using the DuraScribe T7 Transcription Kit (Air Brown), which can incorporate deoxynucleoside triphosphates (dNTPs) with 2'F modification on the ribose of pyrimidine residues. The transcription products were purified by polyacrylamide gel electrophoresis (PAGE) and used as an RNA pool.

[0040] The target BMP2 (Peprotech, product code AF-120-02) was immobilized on the surface of protein-immobilized N-hydroxysuccinimide (NHS) resin (GE Healthcare, product code #17-0906-01). The procedure was performed according to the attached instructions. 5 μL of NHS resin was taken and thoroughly washed with SELEX buffer (20 mM Tris-HCl pH 7.6, 145 mM NaCl, 5.4 mM KCl, 0.8 mM MgCl2, 1.8 mM CaCl2), after which 20 μL of RNA pool prepared at a concentration of 5 μM was added and mixed at room temperature for 60 minutes. The target-binding RNA and non-binding RNA were then separated by washing five times with SELEX buffer. Finally, the solution was replaced with 100 μL of Elution buffer (100 mM Tris-HCl pH 7.6, 6 mM EDTA, 7 M Urea), and then heated at 95 °C for 15 minutes to remove the RNA adsorbed to the NHS resin. The collected supernatant contained RNA with protein binding ability, which was converted back to DNA by reverse transcription reaction, amplified by PCR, and the DNA was purified. The next round of RNA pools was synthesized by retranscription using this DNA. This cycle was repeated for a total of 10 rounds.

[0041] 2. Sequencing Data Analysis The PCR product of the final round was cloned into a TOPO vector and sequence analysis was performed. The obtained sequence data was aligned using software (ClustalW). From the analysis results, enriched sequences were selected. The base sequences including the random sequence of NA-AP selected in this way are shown in SEQ ID NOs: 1 to 3 below. The 2' position of the ribose of each pyrimidine nucleotide is a fluorine atom.

[0042] <Sequence number 1> 5'- GGGAGACAAGAAUAAACGCUCAAUGGAAGGACUGAAACGCACCACGUUGGCCCAGAGAGUAAGUUCGACAGGAGGCUCACAACAGGC -3' <Sequence number 2> 5'- GGGAGACAAGAAUAAACGCUCAAGCCCCUACACGCCGUAGCUUGGUGCUGUUCUACGGGGAGCUUCGACAGGAGGCUCACAACAGGC -3' <Sequence number 3> 5'- GGGAGACAAGAAUAAACGCUCAAUGCCGGCACAUCCGUCGAAAAAGUAAUGUAGGAGUUCACUUUCGACAGGAGGCUCACAACAGGC -3'

[0043] 3. Binding Ability Assessment Using a surface plasmon resonance (SPR) sensor (Biacore 3000), the binding ability of NA-AP represented by SEQ ID NO: 1 to 3 to BMP2 was evaluated. First, a streptavidin (SA)-immobilized SA chip was used as the sensor chip. To this, 16-nucleotide polydeoxythymine (Poly dT) with biotin bound to the 5' end was bound. 16-nucleotide Poly A was added to the 3' end of the ligand nucleic acid. NA-AP was immobilized on the SA chip by the binding of the dT and A. Then, 100 nM BMP2 was injected, and a sensorgram was obtained (Figure 1). From this sensorgram, it was found that the obtained NA-AP bound to BMP2 more specifically than the negative control 40N.

[0044] Similarly, a surface plasmon resonance sensor (Biacore3000) was used to evaluate the binding ability of BMPR to the obtained complex of NA-AP and BMP2 (NA-AP / BMP2 complex). The sensor chip used was an SA chip with streptavidin immobilized thereon. To this, 16-nucleotide poly dT with biotin bound to the 5' end was bound. To the nucleic acid serving as the ligand, 16-nucleotide poly A was added to the 3' end. NA-AP was immobilized on the SA chip by the binding of the dT and A. BMP2 was injected to form an NA-AP / BMP2 complex, and BMPR was further injected to obtain a sensorgram. The complex-forming abilities of the three were compared and evaluated from the sensorgram. For SEQ ID NOs: 1 and 3, when BMPR was added to the NA-AP / BMP2 complex, the RU value increased, confirming the formation of a ternary complex of NA-AP / BMP2 / BMPR (Figure 2).

[0045] The ability of the obtained NA-AP to inhibit signal transduction against BMP2 was evaluated using the Western blotting (WB) method. Mouse myoblasts (C2C12) were cultured using a medium containing NA-AP and BMP2 protein. The ability of NA-AP to inhibit BMP2 signal transduction was evaluated using phosphorylation of Smad1 / 5 / 8 as an indicator. Phosphorylated forms of Smad1 / 5 / 8 were detected in 40N and SEQ ID NOs: 1 to 3 (Figure 3).

[0046] These results showed that all sequences have BMP2 binding ability, the strength of BMPR binding ability is in the order of sequence number 1 > sequence number 3 > sequence number 2, and the order of signal transduction inhibitory ability is sequence number 1 = sequence number 2 = sequence number 3.

[0047] 4. Shortening of NA-AP The sequence was shortened based on SEQ ID NO: 3. Secondary structure analysis was performed on the sequence using the programs Mfold and RNAfold to search for structural motifs important for BMP2 binding and to design a minimal functional sequence. The designed sequences are as follows. The 2' position of the ribose of each pyrimidine nucleotide is a fluorine atom.

[0048] <Sequence number 3-1> 5' - GGCUGUUGUGAGCCUCCUGUCGAAAGUGAACUCCUACAUUACUUUUUCGACGGAUGUGCCGGCAUUGACC - 3' <Sequence number 3-2> 5' - GGCUGUCGAAAGUGAACUCCUACAUUACUUUUUCGACGCC - 3' <Sequence number 3-3> 5' - AGUGAACUCCUACAUUACUUUGGACGGAUGUGCCC - 3' <Sequence number 3-4> 5' - GGCAAAAAGUAAUGUAGGAGUUCACUUUGCC - 3'

[0049] Functional evaluation of SEQ ID NO:3-1 to 3-4 was carried out in the same manner as for the other sequences. As a result, it was found that SEQ ID NO:3-4 has the ability to bind to BMP2 and does not inhibit the interaction with BMPR, and is a sequence having the intended function (FIGS. 4 and 5).

[0050] 5. In vitro evaluation of NA-AP immobilized materials SEQ ID NO: 3-4 modified with SH groups via poly dT (pdT) was synthesized (Gene Design). The aptamer was immobilized on a gold-coated glass plate. The material was evaluated using an X-ray photoelectron spectroscopy (XPS) ESCA3200 (Shimadzu Corporation) with fluorine as an index. A pdT-immobilized material was prepared as a negative control. As a result of the same XPS analysis, a phosphorus peak was detected on the pdT immobilized surface, and fluorine and phosphorus peaks were detected on the SEQ ID NO: 3-4 immobilized surface (Figure 6). It was confirmed that pdT and SEQ ID NO: 3-4 were present on the substrate, respectively.

[0051] Three types of glass plates, untreated, pdT-immobilized, and SEQ ID NO:3-4-immobilized, were immersed in human serum containing 1000 ng / mL BMP2 and reacted at 37°C for 30 minutes. After washing several times with PBS, surface-adsorbed proteins were recovered using a solution containing a surfactant. The BMP2 capture ability of each material was evaluated by enzyme-linked immunosorbent assay (ELISA), and it was found that the SEQ ID NO:3-4-immobilized material was able to capture and concentrate BMP2 (Figure 7).

[0052] C2C12 were cultured on each material prepared in the same manner, and the production of alkaline phosphatase (ALP; one of the bone differentiation markers that induces osteoblast differentiation of C2C12) and myosin heavy chain (MHC; one of the muscle maturation markers) by the captured BMP2 was used as an index to evaluate the ability of C2C12 to differentiate into osteoblasts. In the evaluation by ALP production, after the culture, the cell number was evaluated using a reducing colorimetric reagent and cell proliferation measurement reagent (Takara Bio, WST-1), and then the ALP activity was measured to calculate the ALP activity value per cell. On the other hand, in the evaluation by MHC production, the cells were fixed after the culture, stained with a fluorescently labeled anti-MHC antibody, and the fluorescence intensity measured by Keyence BZ-X710 was used as an index. As a result, a decrease in the amount of MHC production and an increase in the amount of ALP production were observed in the material immobilized with SEQ ID NO: 3-4 (Figure 8).

[0053] From the above results, it was confirmed that the SEQ ID NO:3-4 immobilized material captures the BMP2 molecule without inhibiting its physiological activity and further induces osteoblast differentiation of C2C12, demonstrating that the aptamer immobilized material exerts its intended function.

[0054] 6. In vivo evaluation of NA-AP immobilized materials For in vivo evaluation, a hydrogel with NA-AP immobilized was prepared. SEQ ID NO: 3-4 was used as NA-AP. In the following examples, the polymer concentration is expressed in g / L, and 1 g / L corresponds to 0.1% by weight.

[0055] Citrate-phosphate buffer (CPB) was prepared as a buffer for the polymer solution in each experiment. CPB can be prepared by a commonly reported method, but here, it was prepared to pH 3.0 according to the report by McIlvaine et al. (J. Biol. Chem. 49 (1): 183-186.). At this time, the molar concentration of the solute was set to 200 mM. Potassium sulfate (K2SO4) was added to the prepared CPB 200 mM to make it 450 mM, and this was used as the gelation solvent. As the raw polymers for the hydrogel, Tetra-PEG-SH (tetrathiol-polyethylene glycol) having -SH groups at the terminals and Tetra-PEG-MA (tetramaleimide-polyethylene glycol) having maleimide groups at the terminals were used. These raw polymers were commercially available from SINOPEG Co., Ltd. The weight average molecular weight (Mw) of both was 20,000.

[0056] Tetra-PEG-MA was dissolved in a gelling solvent to be 60 g / L, and NA-AP was dissolved in a gelling solvent to be 40 μM or 0 μM. These were named NA-AP(+)MA solution and NA-AP(-)MA solution, respectively. Next, Tetra-PEG-SH was dissolved in a gelling solvent to be 60 g / L. This was named SH solution. In an empty container, the NA-AP(+)MA solution or NA-AP(-)MA solution and the SH solution were mixed in the same volume, and the mixture was immediately filled into a glass capillary with an inner diameter of 640 μm and both ends were sealed with clay. The glass capillary was left to stand overnight in a thermostatic chamber at 25 ° C., and then the glass was removed to obtain a cylindrical gel containing NA-AP (NA-AP(+) gel) and a gel not containing the same aptamer (NA-AP(-) gel) with a diameter of 640 μm.

[0057] BMP2 (Peprotech, product code AF-120-02) was dissolved in Dulbecco's phosphate buffered saline (D-PBS, Sigma-Aldrich, product code D8662) to a concentration of 100 nM (dimer concentration) to prepare BMP2 solution. Each gel was immersed in BMP2 solution dispensed into separate containers at 4°C overnight, and the samples were named NA-AP(-) / BMP(+) and NA-AP(+) / BMP(+). Separately, as a comparative control, each gel was immersed in PBS not containing BMP2 overnight at 4°C, and the samples were named NA-AP(-) / BMP(-) and NA-AP(+) / BMP(-).

[0058] Radial defects were created in mice under anesthesia. CT observation confirmed that defects had been created only in the radius. Each sample was implanted into the defect, and the wound was closed. CT images of the same area were then taken up to 4 weeks later (Figure 9). In the NA-AP(-) group, no significant regeneration of the radius was observed, regardless of the presence or absence of BMP. On the other hand, in the NA-AP(+) / BMP(+) group, significant bone regeneration was observed around the gel implantation site. In the NA-AP(+) / BMP(-) group, slight bone regeneration was also observed proximally. The fact that each bone regeneration was observed slightly shifted from the gel implantation site is thought to be due to the gel moving away from the implantation site due to the movement of the mouse.

[0059] Thus, it was found that NA-AP, which has BMP2 binding ability, also functions as a bone regeneration inducing material in vivo.

Claims

1. A nucleic acid aptamer (NA-AP) characterized by specifically binding to bone morphogenetic protein (BMP), comprising any one of the base sequences selected from the group consisting of the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4, and base sequences having 80% or more homology to each of these base sequences, wherein the NA-AP is DNA or RNA, and when the NA-AP is DNA, the NA-AP is a sequence in which U in the nucleic acid sequence is replaced with T.

2. The NA-AP according to claim 1, which has any one of the base sequences selected from the group consisting of base sequences having 90% or more homology with the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4.

3. The NA-AP according to claim 1, which has any one of the base sequences selected from the group consisting of base sequences having 95% or more homology with the base sequences shown in SEQ ID NOs: 1 to 3, 3-1, 3-2, 3-3, and 3-4.

4. The NA-AP has a sequence represented by the following formula (I): 5'-X-AAAAAAGUAAUGUAGGAGUUCACUUU-Y-3' (I) (wherein X and Y are each one or more nucleotides selected from C, G, U, or A). having The NA-AP according to claim 1.

5. The NA-AP of claim 1, wherein the BMP is bone morphogenetic protein 2 (BMP-2).

6. The NA-AP according to claim 5, wherein the BMP-2 is human BMP-2.

7. The NA-AP according to claim 1, having at the 5'-end or 3'-end one or more functional groups selected from the group consisting of a sulfhydryl group, an amino group, a hydroxy group, a carboxyl group, an imidazole group, an alkynyl group, an aldehyde group, an azide group, a maleimide group, an N-hydroxysuccinimidyl (NHS) group, a pentafluorophenyl ester group, a pyridyl sulfide group, an α-halo ester group, an α-halo amide group, a hydrazide group, an isocyanate group, an aryl azide group, a diazirine group, and a sulfosuccinimidyl group.

8. A bone regeneration inducing material comprising the NA-AP according to any one of claims 1 to 7.

9. The bone regeneration inducing material according to claim 8, comprising an insoluble carrier to which the NA-AP is immobilized.

10. The bone regeneration-inducing material according to claim 9 , wherein the insoluble carrier is a hydrogel.

11. The bone regeneration inductive material according to claim 10 , wherein the hydrogel contains polyethylene glycol (PEG) as a network component.

12. A composition comprising the NA-AP according to any one of claims 1 to 7 and a hydrogel.

13. The composition of claim 12 , wherein the hydrogel comprises polyethylene glycol (PEG) as a network component.

Images