Method and kit for determining filaggrin genotype

Abstract

To achieve a method for rapidly obtaining sufficient PCR products to perform long-read sequencing of an FLG exon 3 region.SOLUTION: A method for performing long-read sequencing of an exon 3 region of a filaggrin gene according to the present disclosure includes a step of amplifying a nucleic acid sequence of the exon 3 region of the filaggrin gene by a PCR method using a primer set and a DNA polymerase. The primer set includes at least one pair of primers including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a method and kit for long-read sequencing of the exon3 region of the filaggrin gene.

Background Art

[0002] Filaggrin (FLG) is present in the Epidermal Differentiation Complex (EDC) on chromosome 1q21 (Non-Patent Document 1). FLG is composed of three exons, and there are about 10 - 12 repetitive sequences of about 972 bp with more than 90% homology in the third exon (Non-Patent Documents 2 - 3, Figure 1). In a previous study that determined the nucleotide sequence of FLG by shotgun method in Japanese patients with atopic dermatitis (AD), the number of repetitive sequences was reported to be 11 - 13 (Non-Patent Document 4). There are many loss-of-function mutations in the Exon3 region that inhibit translation due to nonsense mutations or frameshift mutations, etc., and it is known to be race-specific (Non-Patent Document 5).

[0003] This repetitive sequence of FLG forms profilaggrin which is a precursor (Non-Patent Document 6), and becomes the main component of keratohyalin granules present in the granular layer of the epidermis (Non-Patent Document 7). Insoluble profilaggrin undergoes dephosphorylation and is decomposed into multiple filaggrin monomers (Non-Patent Document 3). When filaggrin is completely decomposed, it becomes a natural moisturizing factor (NMF; Natural Moisturizing Factor) and can retain the moisture in the outermost layer of the stratum corneum (Non-Patent Document 1). From the above, FLG plays an important role in the epidermal barrier function. Loss-of-function mutations of FLG affect the decrease in the expression level of FLG. Since the skin barrier function is reduced, external substances such as antigens are likely to invade (Non-Patent Document 7), and it is involved in the activation of the immune response, thus affecting the onset of various allergic diseases such as atopic dermatitis.

[0004] Regarding human FLG, Gan et al. showed by Southern blot that there are 10 - 12 differences among individuals in the exon3 region (Non-Patent Document 3), and Sasaki et al. showed that there are 11 - 13 repeat structures of about 972 bp each (Non-Patent Document 4). Because the homology of each of these repeat structures is high, it is not easy to complicate the FLG gene structure and identify FLG gene mutations.

[0005] So far, various studies have been conducted on FLG mutations. In studies before the use of next generation sequence (NGS), for a small number of samples, direct sequencing such as the Sanger method was used to determine the nucleotide sequence, and methods such as TaqMan Genotyping assay were used to determine the genotype of major mutations within the population (Non-Patent Document 8).

[0006] Amplification of the FLG exon3 region was required for sequencing, but due to the complexity of the structure caused by the repeat sequence, it was difficult to amplify the whole, and PCR was performed by dividing exon3 into multiple regions to amplify the target region. Although a Long-range PCR method covering the entire FLG exon3 region was developed by Smith et al. in 2006, it has been reported that it was not possible to completely determine the entire nucleotide sequence of the region (Non-Patent Document 9). In 2007, a method for completely determining the nucleotide sequence of the exon3 region by the Sanger method was reported by Sandilands et al. (Non-Patent Document 10), but in the exon3 region, design of multiple primers and corresponding PCR were required, and a lot of labor was required for genotyping. Subsequently, in 2012, a method of performing Long-range PCR by dividing the exon3 region into two parts was reported by Brown et al. (Non-Patent Document 2).

[0007] For genotyping methods, the methods vary for each FLG mutation. For example, for the R501X mutation, which is a frequent mutation in the European population, the TaqMan Genotyping assay is used, and for 2282del4 or 3702delG, it is performed by sizing fluorescently labeled PCR products (Non-Patent Document 10). Kono et al. designed primers and fluorescent probes that can be used in real-time PCR methods based on the principle of FRET, such as TaqMan-PCR, in order to rapidly and simply detect and screen 10 types of FLG mutations reported in Japanese people (Non-Patent Document 11), and have since obtained a patent for the primers and probes they developed (Patent Document 1).

[0008] The method of performing genotyping after direct sequencing as described above is very laborious. Furthermore, when there are multiple consecutive repeat sequences with a repeat size of about 972 bp per one and a repeat sequence homology of about 99% (for example, repeat 8), direct sequencing by the Sanger method has limitations in its detection.

[0009] In 2017, Romero et al. reported that they determined the FLG repeat sequences of cynomolgus monkeys (Macaca fascicularis), orangutans (Pongo abelii), gorillas (Gorilla gorilla), chimpanzees (Pan troglodytes), and humans (Homo sapiens) using PacBio RSII and the short-read sequencing of illumina MiSeq with PrimeSTAR (registered trademark) GXL DNA Polymerase (Non-Patent Document 12). In 2018, Wong et al. developed a sequencing method using illumina's MiSeq, making it possible to analyze many samples at once (Non-Patent Document 13).

[0010] In 2023, Mareso et al. reported an analytical method that used PrimeSTAR to prepare a library and then used PacBio long-read sequencing (Non-Patent Document 14). This method performs Long-range PCR in two steps. In the first step, a universal sequence is added to the 5' side of region-specific primers for amplification, and in the second step, PCR is carried out to add barcodes. For protocol optimization, the number of cycles in the first step is 25, while the number of cycles in the second step is 7.

Prior Art Documents

Patent Documents

[0011]

Patent Document 1

Non-Patent Documents

[0012]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

[0013] Regarding the techniques disclosed in Non-Patent Documents 2 and 12, there are concerns in that, as shown in FIGS. 4(a) and (b), many non-specific bands are detected.

[0014] The technique disclosed in Non-Patent Document 13 is useful for detecting gene mutations, but is not suitable for detecting large structural variations such as copy number variants (CNVs). Also, in the FLG exon3 region containing a complex structure of repeat sequences, it cannot be denied that errors may occur during mapping in sequence determination by short-read sequencing.

[0015] So far, no method has been reported for obtaining sufficient PCR products for long-read sequencing of the FLG exon3 region in a short time.

[0016] One aspect of the present invention aims to realize a method for obtaining sufficient PCR products for long-read sequencing of the FLG exon3 region in a short time.

Means for Solving the Problem

[0017] In order to solve the above problems, the present inventors have found that by performing the PCR method under specific reaction conditions, a PCR product capable of long-read sequencing of the FLG exon3 region can be obtained in a short time. Then, a long-read sequencing method for the FLG exon3 region was established, leading to the completion of the present invention.

[0018] The method according to one aspect of the present invention includes a step of amplifying a nucleic acid sequence of the exon3 region (FLG exon3 region) of the filaggrin gene by a PCR method using a primer set and a DNA polymerase. The primer set includes at least one primer pair including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence. The first barcode sequence and the second barcode sequence are different from each other. The first universal sequence is a nucleotide sequence represented by SEQ ID NO: 1, a nucleotide sequence including a deletion, substitution, addition, or insertion of 1 or 2 bases in the nucleotide sequence represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more sequence identity with the nucleotide sequence represented by SEQ ID NO: 1. The second universal sequence is a nucleotide sequence represented by SEQ ID NO: 2, a nucleotide sequence including a deletion, substitution, addition, or insertion of 1 or 2 bases in the nucleotide sequence represented by SEQ ID NO: 2, or a nucleotide sequence having 80% or more sequence identity with the nucleotide sequence represented by SEQ ID NO: 1. This is a method for long-read sequencing of the FLG exon3 region.

[0019] Further, the kit according to one aspect of the present invention includes a primer set including at least two primer pairs including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer consisting of a second universal sequence and a second barcode sequence. The first barcode array and the second barcode array are different from each other. The first universal array is an array represented by SEQ ID NO: 1, a nucleotide sequence including a deletion, substitution, addition, or insertion of one or two bases in the array represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more sequence identity with the array represented by SEQ ID NO: 1. The second universal array is an array represented by SEQ ID NO: 2, a nucleotide sequence including a deletion, substitution, addition, or insertion of one or two bases in the array represented by SEQ ID NO: 2, or a nucleotide sequence having 80% or more sequence identity with the array represented by SEQ ID NO: 1, and is a kit for long-read sequencing of the FLG exon3 region.

Advantages of the Invention

[0020] According to one aspect of the present invention, a method for obtaining a sufficient amount of PCR product for long-read sequencing of the FLG exon3 region in a short time can be provided.

Brief Description of the Drawings

[0021]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Modes for Carrying Out the Invention

[0022] 〔Definitions of Terms and the Like〕 As used herein, "long-read sequencing" refers to sequencing (determining the sequence) of a nucleic acid sequence of 10 kb or more.

[0023] As used herein, the "barcode sequence" refers to an artificial nucleic acid sequence for identifying a sample.

[0024] As used herein, "polynucleotide" can also be interchangeably referred to as "nucleic acid" or "nucleic acid molecule", and is intended to be a polymer of nucleotides. Also, "base sequence" can also be interchangeably referred to as "nucleic acid sequence" or "nucleotide sequence". Unless otherwise specified, polynucleotides can exist in the form of RNA or DNA. The form of RNA is, for example, mRNA. The form of DNA is, for example, cDNA or genomic DNA. DNA can be double-stranded or single-stranded.

[0025] As used herein, "protein" can also be interchangeably referred to as "polypeptide".

[0026] As used herein, "A and / or B" is a concept that includes both A and B and A or B, and can also be interchangeably referred to as "at least one of A and B". Also, as used herein, "~" means a range of more than or equal to and less than or equal to the numerical values at both ends thereof.

[0027] [Method for long-read sequencing] The method for long-read sequencing according to one aspect of the present invention is a method for long-read sequencing of the exon3 region of the filaggrin (FLG) gene (hereinafter, may be referred to as the "FLG exon3 region"). Hereinafter, the method may be referred to as the "present long-read sequencing method".

[0028] (Filaggrin gene) The filaggrin (FLG) gene is a gene present in the epidermal differentiation complex on chromosome 1q21. The mRNA sequence of the wild-type filaggrin gene is shown in SEQ ID NO: 3 (NCBI Reference Sequence: NM_002016). The amino acid sequence of the wild-type filaggrin protein is shown in SEQ ID NO: 4 (NCBI Reference Sequence: NP_002007).

[0029] A schematic diagram of the FLG gene is shown in Figure 1. The FLG gene is composed of three exons (from the 5'-end side, Exon1, Exon2, Exon3). Exon1 is a unique sequence in the 5'-untranslated region. At the 5'-ends of Exon2 and Exon3, there are unique sequences encoding the N-terminal domain of profilaggrin. In Exon3, there are 10 - 12 or 11 - 13 repetitive sequences of about 972 bp, each encoding a filaggrin peptide. After 10 - 13 repetitive sequences, a short unique sequence and a 3'-untranslated region follow.

[0030] This long-read sequencing method includes a step of amplifying the nucleic acid sequence of the exon3 region of the filaggrin gene by a PCR method using a primer set and a DNA polymerase.

[0031] The nucleic acid sequence of the exon3 region of the filaggrin gene can be prepared from a biological sample collected from a subject using a known extraction method and / or an extraction method. Examples of biological samples include blood (e.g., whole blood, plasma, or serum, etc.), saliva, cerebrospinal fluid, urine, skin, nails, hair, etc.

[0032] Examples of subjects include mammals such as humans or non-human animals. Non-human animals include domestic animals such as cows, horses, pigs, and sheep; pet animals or experimental animals such as dogs, cats, rats, mice, hamsters, monkeys, and rabbits. Preferably, humans are included.

[0033] Also, as an example of a subject, it may be a subject suspected of having a disease involving filaggrin (e.g., an allergic disease such as atopic dermatitis). Also, a certain age group, for example, in the case of humans, neonates, infants, children, adults (e.g., those 20 years old or older, 30 years old or older, 40 years old or older, 50 years old or older, 60 years old or older, 70 years old or older, or 80 years old or older) may be subjects regardless of the presence or absence of a disease involving filaggrin.

[0034] (Primer set) The above primer set includes at least one primer pair, which includes a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence. The above primer pair is a primer pair that can amplify the entire length of the exon3 region of the filaggrin gene.

[0035] The first universal sequence is the sequence represented by SEQ ID NO: 1 (ggaatttcggcaaatcctgaaggtaa), a nucleotide sequence containing a deletion, substitution, addition, or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more (preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) sequence identity with the sequence represented by SEQ ID NO: 1.

[0036] Examples of the second universal sequence include the sequence represented by SEQ ID NO: 2 (ccttccaggtcaggaggacacttctt), a nucleotide sequence containing a deletion, substitution, addition, or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 2, or a nucleotide sequence having 90% or more (preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) sequence identity with the sequence represented by SEQ ID NO: 2.

[0037] The above first barcode sequence and the above second barcode sequence are different from each other. The first barcode sequence and the second barcode sequence can each be obtained or designed from a known database or the like. The length of the barcode sequence may be 15 to 25 bases.

[0038] The above forward primer may be a forward primer consisting of a first universal sequence and a first barcode sequence. The above reverse primer may be a reverse primer consisting of a second universal sequence and a second barcode sequence.

[0039] The primer pair(s) included in the above primer set is / are at least one kind, and may be multiple kinds (for example, at least 2 kinds, at least 5 kinds, at least 10 kinds, at least 15 kinds, at least 20 kinds) of primer pairs.

[0040] When there are at least 2 kinds of primer pairs included in the above primer set, each forward primer commonly includes a first universal sequence, while the first barcode sequences are different from each other among the forward primers. The first barcode sequence is added to the 5'-end side of the sequence represented by SEQ ID NO: 1.

[0041] When there are at least 2 kinds of primer pairs included in the above primer set, each reverse primer commonly includes a second universal sequence, while the second barcode sequences are different from each other among the reverse primers. The second barcode sequence is added to the 5'-end side of the sequence represented by SEQ ID NO: 2.

[0042] As an example of the above primer set, a primer set including at least one kind of primer pair among the following 24 kinds of primer pairs can be mentioned: A primer pair including a forward primer consisting of the sequence represented by SEQ ID NO: 5 and a reverse primer consisting of the sequence represented by SEQ ID NO: 29; A primer pair including a forward primer consisting of the sequence represented by SEQ ID NO: 6 and a reverse primer consisting of the sequence represented by SEQ ID NO: 30; A primer pair including a forward primer consisting of the sequence represented by SEQ ID NO: 7 and a reverse primer consisting of the sequence represented by SEQ ID NO: 31; A primer pair including a forward primer consisting of the sequence represented by SEQ ID NO: 8 and a reverse primer consisting of the sequence represented by SEQ ID NO: 32; A primer pair including a forward primer consisting of the sequence represented by SEQ ID NO: 9 and a reverse primer consisting of the sequence represented by SEQ ID NO: 33; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 10 and a reverse primer consisting of the sequence represented by SEQ ID NO: 34; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 11 and a reverse primer consisting of the sequence represented by SEQ ID NO: 35; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 12 and a reverse primer consisting of the sequence represented by SEQ ID NO: 36; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 13 and a reverse primer consisting of the sequence represented by SEQ ID NO: 37; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 14 and a reverse primer consisting of the sequence represented by SEQ ID NO: 38; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 15 and a reverse primer consisting of the sequence represented by SEQ ID NO: 39; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 16 and a reverse primer consisting of the sequence represented by SEQ ID NO: 40; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 17 and a reverse primer consisting of the sequence represented by SEQ ID NO: 41; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 18 and a reverse primer consisting of the sequence represented by SEQ ID NO: 42; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 19 and a reverse primer consisting of the sequence represented by SEQ ID NO: 43; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 20 and a reverse primer consisting of the sequence represented by SEQ ID NO: 44; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 21 and a reverse primer consisting of the sequence represented by SEQ ID NO: 45; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 22 and a reverse primer consisting of the sequence represented by SEQ ID NO: 46; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 23 and a reverse primer consisting of the sequence represented by SEQ ID NO: 47; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 24 and a reverse primer consisting of the sequence represented by SEQ ID NO: 48; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 25 and a reverse primer consisting of the sequence represented by SEQ ID NO: 49; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 26 and a reverse primer consisting of the sequence represented by SEQ ID NO: 50; A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 27 and a reverse primer consisting of the sequence represented by SEQ ID NO: 51; and, A primer pair comprising a forward primer consisting of the sequence represented by SEQ ID NO: 28 and a reverse primer consisting of the sequence represented by SEQ ID NO: 52.

[0043] In that a PCR product enabling long-read sequencing from multiple specimens can be obtained by one-step PCR (i.e., single PCR cycle conditions), the primer set preferably includes at least 2, 5, 10, 15, 20 primer pairs among the above 24 primer pairs, and more preferably includes all 24 primer pairs. With the above 24 primer pairs, 576 (24×24) combinations are possible.

[0044] The nucleic acid sequence used as a primer can be prepared, for example, by synthesis using a commercially available DNA synthesizer.

[0045] (DNA polymerase) As the DNA polymerase used in the above PCR method, known DNA polymerases can be used. In terms of obtaining a PCR product capable of long-read sequencing in a shorter time, it is preferable that the DNA polymerase is a DNA polymerase derived from Thermococcus kodakaraensis. The DNA polymerase derived from Thermococcus kodakaraensis includes variants of the DNA polymerase (for example, a DNA polymerase with suppressed 3'→5' exonuclease activity). Examples of commercially available products containing the DNA polymerase derived from Thermococcus kodakaraensis include KOD (manufactured by Toyobo), KOD ONE (registered trademark) PCR Master Mix (manufactured by Toyobo), etc.

[0046] The PCR method can be carried out by a known method. For example, a mixture obtained by mixing each PCR reaction reagent can be subjected to a commercially available PCR apparatus, and amplification of the target sequence can be carried out by a predetermined reaction cycle. Examples of PCR reaction reagents include DNA polymerase, primer set, template DNA (for example, DNA collected from a subject), nucleotides (adenine, guanine, thymine, and cytosine), etc.

[0047] The amounts of the template DNA and the primer can be appropriately adjusted according to the PCR apparatus and PCR conditions used.

[0048] (PCR method) The PCR method includes a denaturation step of dissociating double-stranded template DNA into single strands, an annealing step of binding each of the forward primer and the reverse primer constituting the primer pair to the single-stranded template DNA obtained in the denaturation step, and an extension step of synthesizing DNA complementary to the template DNA starting from each primer by DNA polymerase.

[0049] The denaturation temperature in the denaturation step may be 92°C to 100°C, preferably 95°C to 99°C. The denaturation time in the denaturation step may be 3 seconds to 20 seconds, preferably 5 seconds to 15 seconds.

[0050] The annealing temperature in the annealing process may be 60°C to 80°C, preferably 65°C to 75°C. The annealing time in the annealing process may be 10 seconds to 60 seconds, preferably 20 seconds to 50 seconds.

[0051] The elongation temperature in the elongation process may be 60°C to 80°C, preferably 65°C to 75°C. The elongation time in the elongation process may be 2 minutes to 15 minutes, preferably 3 minutes to 10 minutes.

[0052] The annealing process and the elongation process may be carried out under the same temperature conditions.

[0053] Taking the operation combining the denaturation process, the annealing process and the elongation process as one cycle, multiple cycles may be carried out until a sufficient amount of PCR product is obtained for performing a long-read sequence. For example, the number of such cycles may be 20 to 50 times.

[0054] The above PCR method may be carried out by combining different PCR cycles, but in terms of operability and efficiency, it is preferably carried out with one type of PCR cycle (that is, carried out in one step).

[0055] In terms of operability and efficiency, in the long-read sequence method, it is preferable to amplify each individual's DNA by singleplex PCR and then pool them.

[0056] (Long-read sequence) By subjecting the amplification product obtained by the above PCR method to a commercially available long-read sequencing device, long-read sequencing can be carried out. Before subjecting it to the long-read sequencing device, concentration adjustment such as purification or concentration of the amplification product may be carried out.

[0057] Examples of commercially available long-read sequencing devices include Sequel manufactured by Pacific Bioscience (PacBio), products of Oxford Nanopore Technology (Nanopore), and the like.

[0058] PacBio's long-read sequencing device is based on Single-Molecule real-time (SMRT) sequencing technology. First, hairpin adapters (SMRTbell adapters) are ligated to both ends of double-stranded DNA, and the circular single-stranded DNA is used as a template. Then, a single template DNA binds to a DNA polymerase molecule in a small hole called a Zero-Mode Waveguide (ZMW), and the incorporation of bases is detected in real time. At the same time, the template DNA is repeatedly circulated and read, enabling highly accurate sequencing.

[0059] Nanopore's long-read sequencing device passes single-stranded DNA through the pore of the α-hemolysin (αHL) protein (nanopore protein) of Staphylococcus aureus. By recording the characteristic disturbances of the ionic current generated when each base passes through, the base sequence is determined.

[0060] 〔Method for Detecting Mutations in the FLG exon3 Region〕 A method for detecting mutations in the FLG exon3 region (hereinafter, may be referred to as "this mutation detection method") including the step of performing long-read sequencing on the FLG exon3 region using this long-read sequencing method is also included in one aspect of the present invention.

[0061] In this specification, "detecting mutations in the FLG exon3 region" means detecting or measuring whether mutations exist in the exon3 region of FLG.

[0062] Mutations in the FLG exon3 region include single nucleotide mutations, Indel mutations, copy number variations, etc. A single nucleotide variant (SNV) indicates a mutation caused by the substitution of a single base. An Indel mutation (short insertion / deletion) indicates a mutation caused by the insertion or deletion of 1 to dozens of bases. A copy number variant (CNV) indicates a situation where the copy number of a specific segment of DNA differs between the genomes of different individuals.

[0063] Mutations in the FLG exon3 region may be loss-of-function mutations or missense mutations involving amino acid substitutions. Examples of loss-of-function mutations include nonsense mutations and frameshift mutations.

[0064] By this mutation detection method, the risk of developing a disease involving filaggrin can be predicted. Also, for a subject predicted to have a high risk of developing a disease involving filaggrin by this mutation detection method, corresponding measures can be taken according to the risk.

[0065] A method for collecting data for evaluating the risk of a disease involving filaggrin, which includes a step of detecting mutations in the FLG exon3 region using the above mutation detection method, is also included in one aspect of the present invention. The collection of data can be carried out by methods known in the art.

[0066] 〔Kit for long-read sequencing of the FLG exon3 region〕 A kit for long-read sequencing of the FLG exon3 region, which includes the above primer set, is also included in one aspect of the present invention.

[0067] The kit may contain a DNA polymerase derived from Thermococcus kodakarensis. The kit may also contain an instruction manual describing procedures for long-read sequencing, etc. The instruction manual may be written or printed on paper or other media, or may be attached to an electronic medium such as a magnetic tape, a readable disk such as a computer, or a CD-ROM, etc.

[0068] Details and preferred embodiments of the primer set included in the kit are as shown in the column of [Method for Long-Read Sequencing].

[0069] The kit can also be used as a kit for detecting mutations in the FLG exon3 region. The kit can also be used as a kit for detecting the risk of developing diseases involving filaggrin.

[0070] [Summary] The method according to Aspect 1 of the present invention includes a step of amplifying a nucleic acid sequence in the FLG exon3 region by a PCR method using a primer set and a DNA polymerase, wherein the primer set includes a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence, at least one primer pair, the first barcode sequence and the second barcode sequence are different from each other, the first universal sequence is a sequence represented by SEQ ID NO: 1, a nucleotide sequence including a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more sequence identity with the sequence represented by SEQ ID NO: 1, and the second universal sequence is a sequence represented by SEQ ID NO: 2, a nucleotide sequence including a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 2, or a nucleotide sequence having 80% or more sequence identity with the sequence represented by SEQ ID NO: 1, and it is a method for long-read sequencing of the FLG exon3 region.

[0071] In the method according to Embodiment 2 of the present invention, in Embodiment 1 of the present invention, the DNA polymerase may be a DNA polymerase derived from Thermococcus kodakarensis.

[0072] In the method according to Embodiment 3 of the present invention, in Embodiment 1 or 2 of the present invention, the PCR method may be carried out with one type of PCR cycle.

[0073] In the method according to Embodiment 4 of the present invention, in any one of Embodiments 1 to 3 of the present invention, the at least one primer pair may be any of a total of 576 combinations of primer pairs obtained by combining 24 Forward Primers and 24 Reverse Primers.

[0074] The method according to Embodiment 5 of the present invention is a method for detecting mutations in the FLG exon3 region, including the step of long-read sequencing of the exon3 region of the filaggrin gene using any of the methods according to Embodiments 1 to 4 of the present invention.

[0075] In the method according to Embodiment 6 of the present invention, in Embodiment 5 of the present invention, the mutation may be at least one mutation selected from the group consisting of single nucleotide mutations, Indel mutations, and copy number mutations.

[0076] The kit according to aspect 7 of the present invention includes a primer set including at least one primer pair including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence, wherein the first barcode sequence and the second barcode sequence are different from each other, the first universal sequence is a sequence represented by SEQ ID NO: 1, a nucleotide sequence including a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more sequence identity with the sequence represented by SEQ ID NO: 1, and the second universal sequence is a sequence represented by SEQ ID NO: 2, a nucleotide sequence including a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 2, or a nucleotide sequence having 80% or more sequence identity with the sequence represented by SEQ ID NO: 1. It is a kit for long-read sequencing of the FLG exon3 region.

[0077] The kit according to aspect 8 of the present invention may further include a DNA polymerase derived from Thermococcus kodakarensis in aspect 7 of the present invention.

[0078] The kit according to aspect 9 of the present invention may be any of 576 combinations of primer pairs obtained by combining 24 Forward Primers and 24 Reverse Primers in aspect 7 or 8 of the present invention.

[0079] Examples are shown below to explain the embodiments of the present invention in more detail. Of course, the present invention is not limited to the following examples of the present invention, and it goes without saying that various aspects are possible in terms of details. Furthermore, the present invention is not limited to the above-described embodiments, and various modifications are possible within the scope shown in the claims. Embodiments obtained by appropriately combining the disclosed technical means are also included in the technical scope of the present invention. Also, all of the documents described in this specification are incorporated by reference.

Example

[0080] 〔Method〕

[0081] [Experimental Method] (1. Adjustment of DNA Concentration) Each DNA extracted from human sample blood and saliva was adjusted to 10 ng / μL. Elution Buffer CBD-O2 (KURABO INDUSTRIES LTD.) was used for dilution.

[0082] (2. PCR Method) Using the primers shown in Table 1 and patient sample DNA, PCR amplification of the FLG exon3 region was performed. The PCR method was The Applied Biosystems TM SimpliAmp TMPerformed using a Thermal Cycler (Thermo Fisher SCIENTIFIC). Each of the Forward Primer sequences with SEQ ID NOs: 5 to 28 in Table 1 forms a primer pair with the Reverse Primer sequences with SEQ ID NOs: 29 to 52. For example, the Forward Primer sequence with SEQ ID NO: 5 used the Reverse Primer sequence with SEQ ID NO: 29 as a primer pair. The Forward reaction plate with SEQ ID NO: 1 used a 96 Well Semi-Skirted PCR Plate (4titude). The DNA polymerase used was KOD One® PCR Master Mix (TOYOBO). The composition of the PCR reaction reagents and the details of the reaction cycles are shown below. Regarding the barcode sequences, the barcode sequences described in PacBio-PCR-Barcodes-24×24-Set-2018.xls were used and added to the 5' end of the FLG-specific primers with reference to the library preparation protocol of the DNA Technologies & Expression Analysis Core Laboratory at the UC DAVIS genome center (https: / / dnatech.genomecenter.ucdavis.edu / faqs / how-to-prepare-samples-for-multiplexed-amplicon-sequencing-on-the-pacbio-sequel / ).

[0083]

Table 1

[0084] In Table 1, the lower-case English letters are the Universal Sequences of PacBio, and the upper-case English letters are the barcode sequences assigned to each primer. The barcode sequences used the known barcode information described in PacBio-PCR-Barcodes-24×24-Set-2018.xls.

[0085] The composition of the PCR reaction reagents is shown in Table 2 below.

[0086]

Table 2

[0087] The reaction cycle of PCR is shown below. The reactions in (2) and (3) were carried out for 30 cycles. (1) 94°C for 2 minutes (2) 98°C for 10 seconds (3) 72°C for 4 minutes and 40 seconds (4) 25°C Hold

[0088] (3. Purification) After the reaction by the PCR method, the PCR products were purified using AMPure XP SPRI Reagent (Beckman Coulter). The PCR products were transferred to the reaction plate and AMPure XP was added. Vortexing was performed at room temperature for 15 seconds, followed by centrifugation for 10 seconds and then standing for 5 minutes. Then the reaction plate was transferred onto a magnet plate for 96-well deep wells and further allowed to stand for 2 minutes. The DNA was washed twice with 80% ethanol by aspiration or decantation. After eluting the DNA with Buffer EB Elution buffer (QIAGEN), vortexing was performed at room temperature for 1 minute, followed by centrifugation for 10 seconds and then standing for 2 minutes. Then the plate was transferred onto the magnet plate and further allowed to stand for 2 minutes to separate the beads from the solution. Finally, the supernatant was transferred to a 96 Well Semi-Skirted PCR Plate (4titude). The composition of the purification reagents is shown in Table 3 below.

[0089]

Table 3

[0090] (4. Concentration measurement) After purification, the concentration was measured using the Qubit dsDNA Broad Range Assay Kit (Invitrogen Life Technologies) with a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific). The composition of the Qubit reagent for each prepared tube is shown in Table 4 below. Note that BR Buffer and Reagent were mixed at a ratio of 199:1. Standards #1 and #2 were prepared by mixing them in separate tubes.

[0091]

Table 4

[0092] Also, the concentration was confirmed again using a NanoDrop Lite Plus spectrophotometer (Thermo Fisher Scientific), and the nucleic acid to protein ratio was measured.

[0093] (5. Electrophoresis) To confirm the amplification of DNA by PCR, electrophoresis was performed using a 1% agarose gel. 5 μl of GelRed Nucleic Acid Gel Stain (Biotium, Hayward, CA) was used as the fluorescent dye. The loading buffer was Gel Loading Dye, Purpule (New England BioLabs Japan), diluted 2-fold with distilled water. 3 μl of the loading buffer was mixed with 3 μl of the PCR product, and a total of 6 μl of the mixture was applied to the gel. Electrophoresis was carried out at 100 V for 20 minutes. The electrophoresis image was taken using an electrophoresis gel imaging device FASIII (TOYOBO).

[0094] (6. Analysis by PacBio long-read sequencing) PCR products with concentrations ranging from 2.82 to 25.5 ng / μL were pooled and used for library preparation. The library was prepared using the SMRTbell Express Template Prep Kit (Macrogen Japan). Subsequently, long-read sequencing was performed using PacBio Sequel or Sequel II from PacBio.

[0095] [Analysis] (1. Obtaining read length and determining copy number) The read size was obtained from the fastq files of each sample separated by barcodes, and fastq files were created for each sequence size. The copy number of each sample was determined from the sorted sequence sizes. In this study, the reference sequences with 11 repeats were named NG_016190_A1, those with 12 repeats were named NG_016190_A2, and those with 13 repeats were named NG_016190_A3.

[0096] (2. Sequence alignment) Alignment was performed using pbmm2 (https: / / github.com / PacificBiosciences / pbmm2) with the reference files for each sequence size.

[0097] (3. Assigning Read Group by Picard) Read Group was assigned to the bam file generated in (2. Sequence alignment) using Picard (http: / / broadinstitute.github.io / picard / ).

[0098] (4. Haplotype call by GATK) Haplotype calling was performed on the bam file generated by (3. Assignment of Read Group by Picard) using GATK's HaplotypeCaller. GATK refers to Ryan Poplin, V.R.-R., Mark A. DePristo, Tim J. Fennell, Mauricio O. Carneiro, Geraldine A. Van der Auwera, David E. Kling, Laura D. Gauthier, Ami Levy-Moonshine, David Roazen, Khalid Shakir, Joel Thibault, Sheila Chandran, Chris Whelan, Monkol Lek, Stacey Gabriel, Mark J Daly, Ben Neale, Daniel G. MacArthur, Eric Banks, Scaling accurate genetic variant discovery to tens of thousands of samples. bioRxiv, 2018.

[0099] (5. Combine Variations by GATK) For the vcf file generated by (4. Haplotype Call by GATK), the integration of variants and samples was performed using GATK.

[0100] (6. GenotypeGVCFs by GATK) GenotypeGVCFs was performed on the vcf file generated by (5. Combine Variations by GATK) using GATK.

[0101] (7. Filtering of Variants by GATK) For the vcf file generated by (6. GenotypeGVCFs by GATK), filtering of variants was performed using GATK.

[0102] (8. Variant QC by bcftools) Variant filtering was performed on the vcf file generated in (7. Variant filtering by GATK) using bcftools (Danecek, P. and S.A. McCarthy, BCFtools / csq: haplotype-aware variant consequences. Bioinformatics, 2017. 33(13): p. 2037-2039.).

[0103] (9. Phasing for homozygotes) Phasing was performed on the vcf file generated in (8. Variant QC by bcftools) using whatshap. Refer to Marcel Martin, V.O.P.P., Shilpa Garg, Sarah O Fischer, View ORCID ProfileNadia Pisanti, View ORCID ProfileGunnar W Klau, Alexander Schoenhuth, View ORCID ProfileTobias Marschall, WhatsHap: fast and accurate read-based phasing. bioRxiv, 2016.

[0104] After phasing the homozygotes, they were merged with the heterozygotes using the bcftools merge command. Variant annotation was performed on the generated vcf file using the bcftools csq command. Then, variants annotated with stop codon or frameshift were selected using the generated vcf file.

[0105] [Results]

[0106] (1. Detection of novel CNV polymorphisms and FLG mutations) Four CNV polymorphisms were detected by analyzing human DNA samples and named A1, A2, A3, and A4, respectively (Figure 3).

[0107] The CNVs reported so far are shown in Figure 2. Figure 2 only shows a schematic diagram of the structure of FLG exon3. (a) to (d) in Figure 2 show the CNVs reported in Non-Patent Document 10, and (e) to (h) show the CNVs reported in Non-Patent Document 4.

[0108] In Figures 2 to 3, from the left end in order are shown the S100 domain (circle), B domain, unique sequence, partial filaggrin sequence, filaggrin repeat sequence (diamond), partial filaggrin sequence, unique sequence, and C-terminal domain.

[0109] In Figure 3, A1-1 has a known structure and is the same as the sequence registered in the human genome reference GRCh38. Sequences with extremely high homology (99%) were assigned the same number based on A1-1 using blast2, and sequences with 91 - 96% homology are shown with different numbers.

[0110] In addition, the detected FLG loss-of-function mutations were compared with the sequence information reported in previous studies (I. Nemoto-Hasebe, M.A., T. Nomura, A. Sandilands, W.H.I. McLean, H. Shimizu, FLG mutation p.Lys4021X in the C-terminal imperfect filaggrin repeat in Japanese patients with atopic eczema. British Journal of Dermatology, 2009. 161(6): p. 1387-1390; Toshifumi Nomura 1, M.A., Aileen Sandilands 2, Ikue Nemoto-Hasebe 1, Kaori Sakai 1, Akari Nagasaki 1, Mitsuhito Ota 3, Hiroo Hata 1, Alan T. Evans 4, Colin N.A. Palmer 5, Hiroshi Shimizu 1, W.H. Irwin McLean Specific Filaggrin Mutations Cause Ichthyosis Vulgaris and Are Significantly Associated with Atopic Dermatitis in Japan. Journal of Investigative Dermatology, 2008. 128(6): p. 1436-1441.; Nomura, T., et al., Unique mutations in the filaggrin gene in Japanese patients with ichthyosis vulgaris and atopic dermatitis. J Allergy Clin Immunol, 2007. 119(2): p. 434-40., and Non-Patent Document 4). As a result, it was confirmed that the known loss-of-function mutations specific to Japanese people, 3321delA, Q1701X, Q1790X, S2554X, S2889X, S3296X, and K4022X, were present in each allele.On the other hand, S1695X, which is also a mutation detected in the Japanese population (Nomura, T., et al., Prevalent and rare mutations in the gene encoding filaggrin in Japanese patients with ichthyosis vulgaris and atopic dermatitis. J Invest Dermatol, 2009. 129(5): p. 1302-5.), was not detected in this study. Furthermore, a novel loss-of-function mutation, W2563X, was detected. For example, Q1790X means a substitution of the 1790th glutamine in the human filaggrin protein with a stop codon (nonsense mutation). 3221delA indicates a deletion of the 3221st adenine in the human filaggrin gene.

[0111] (3. FLG Repeat Number in Human Samples) Regarding the genotypes of the repeat numbers of 234 individuals for whom repeat number data could be obtained through preliminary examinations, the homozygous carriers of 13 repeats were the most numerous, followed by the heterozygotes of 11 and 13 repeats, the heterozygotes of 12 and 13 repeats, the heterozygotes of 11 and 12 repeats, the homozygotes of 11 and 11 repeats, the homozygotes of 12 and 12 repeats, and the heterozygotes of 11 and 14 repeats in that order. Also, regarding the alleles of the repeat numbers, the allele frequency of 13 repeats was the highest, followed by the 11-repeat allele, the 12-repeat allele, and the 14-repeat allele in that order.

[0112] [Discussion] [Establishment of the Long-Read Sequencing Method for FLG exon3] In this example, a long-read sequencing method for the FLG exon3 region was established, and novel CNVs and loss-of-function mutations were detected. The results of comparing the method of this example with the prior art method are shown in FIG. 4.

[0113] In FIGS. 4(a) to (c), TriDye TM 2log DNA Ladder (New England Biolabs Japan) was used as a marker.

[0114] Figure 4(a) shows the results of experiments conducted using the primers reported in Non-Patent Document 2. Based on the disclosure of Non-Patent Document 2, long-range PCR was performed by splitting the exon3 region into two parts. In PCR1, a single band was expected to be obtained around 8.0 kb, and in PCR2, around 4.0 - 6.0 kb. However, non-specific bands appeared, and the target PCR product could not be obtained (Figure 4(a)).

[0115] Figure 4(b) shows the results of experiments conducted on the method reported in Non-Patent Document 12. Based on the disclosure of Non-Patent Document 12, the long-PCR method was performed. As shown in Figure 4(b), many non-specific bands appeared.

[0116] To solve these problems, as a result of intensive studies by the present inventors, it was confirmed that the FLG exon3 region can be amplified with a single band and the target region can be amplified in one run by the primers and PCR conditions shown in the [Method] column (Figure 4(c)). Also, the time required for PCR was short, and the concentration was 10 - 18 ng / μl, making it possible to obtain sufficient PCR products for sequencing.

[0117] In the examination of loss-of-function mutations, a novel nonsense mutation W2563X and six known mutations, 3321delA, Q1701X, Q1790X, S2554X, S2889X, S3296X, and K4022X, were detected. Six of the known mutations other than Q1790X have been reported by Hirota et al. to have a significant association with pediatric allergy patients (Hirota, T., et al., Association study of childhood food allergy with genome-wide association studies-discovered loci of atopic dermatitis and eosinophilic esophagitis. J Allergy Clin Immunol, 2017. 140(6): p. 1713-1716.). On the other hand, S1695X, which was detected from a patient with ichthyosis vulgaris complicated by atopic dermatitis in Japanese patients, was not detected. Considering that this mutation is extremely rare, it is thought that it was not detected in the patient population of this example (Hamada, T., et al., De novo occurrence of the filaggrin mutation p.R501X with prevalent mutation c.3321delA in a Japanese family with ichthyosis vulgaris complicated by atopic dermatitis. J Invest Dermatol, 2008. 128(5): p. 1323-5.; Nomura, T., et al., Prevalent and rare mutations in the gene encoding filaggrin in Japanese patients with ichthyosis vulgaris and atopic dermatitis. J Invest Dermatol, 2009. 129(5): p. 1302-5.).

[0118] In the human samples of this example, loss-of-function mutations detected in white patients including European or European-American populations were not detected, and it was confirmed that they were race-specific (Brown, S.J., et al., Loss-of-function variants in the filaggrin gene are a significant risk factor for peanut allergy. J Allergy Clin Immunol, 2011. 127(3): p. 661-7.; Venkataraman, D., et al., Filaggrin loss-of-function mutations are associated with food allergy in childhood and adolescence. J Allergy Clin Immunol, 2014. 134(4): p. 876-882 e4.).

[0119] Regarding the Japanese samples in this example, SNP genotyping was performed using the Illumina Asian Screening Array. The Asian Screening Array contains probes for detecting 3321delA, Q1701X, Q1790X, S2554X, S2889X, S3296X, and K4022X other than S2889X, and it has been confirmed that the results by the long-read sequencing performed according to the present invention are 100% consistent with the results by Illumina array typing.

[0120] Regarding the allele frequencies of the repeat numbers, the allele frequency of the 13-repeat was the highest, followed by those of the 11-repeat allele, 12-repeat allele, and 14-repeat allele. Among the common alleles, the one with the lowest allele frequency was the 12-repeat. Sasaki et al. determined the sequences of Japanese AD patients by the shotgun method and reported that the genotype 11 / 13 was the highest and the frequency of the 11-repeat allele was the highest (Non-Patent Document 4). This discrepancy is attributed to factors such as the fact that Sasaki et al. obtained the repeat numbers for 24 individuals while 234 individuals' repeat numbers were obtained in this example, and the sample sizes and analysis methods were different. On the other hand, the low-frequency repeat number was common at 12 times.

[0121] The repeat structure of FLG varies depending on which sequence is used as the basic repeat sequence. In accordance with the repeat structure reported in Non-Patent Document 10, Fig. 5 shows the repeat structures of A1, A2, A3, and A4.

Industrial Applicability

[0122] The present invention can be used in the medical field, and in particular, can be used for the diagnosis of diseases involving filaggrin such as atopic dermatitis.

Claims

1. A method for long-read sequencing of the exon3 region of the filaggrin gene, comprising the step of amplifying the nucleic acid sequence of the exon3 region of the filaggrin gene by a PCR method using a primer set and a DNA polymerase, wherein the primer set includes at least one primer pair including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence, wherein the first barcode sequence and the second barcode sequence are different from each other, wherein the first universal sequence is a sequence represented by SEQ ID NO: 1, a nucleotide sequence containing a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 1, or a nucleotide sequence having at least 80% sequence identity with the sequence represented by SEQ ID NO: 1, and wherein the second universal sequence is a sequence represented by SEQ ID NO: 2, a nucleotide sequence containing a deletion, substitution, addition or insertion of 1 or 2 bases in the sequence represented by SEQ ID NO: 2, or a nucleotide sequence having at least 80% sequence identity with the sequence represented by SEQ ID NO:

1.

2. The method according to claim 1, wherein the DNA polymerase is a DNA polymerase derived from Thermococcus kodakarensis.

3. The method according to claim 1, wherein the PCR method is carried out with one type of PCR cycle.

4. The method according to claim 1, wherein the at least one primer pair is any one of 576 combinations of primer pairs obtained by combining 24 Forward Primers and 24 Reverse Primers.

5. A method for detecting a mutation in the exon3 region of the filaggrin gene, comprising the step of long-read sequencing of the exon3 region of the filaggrin gene using the method according to any one of claims 1 to 4.

6. The method according to claim 5, wherein the mutation is at least one mutation selected from the group consisting of a single nucleotide mutation, an Indel mutation and a copy number mutation.

7. A primer set including at least one primer pair including a forward primer containing a first universal sequence and a first barcode sequence, and a reverse primer containing a second universal sequence and a second barcode sequence, wherein the first barcode sequence and the second barcode sequence are different from each other, The first universal array is an array represented by SEQ ID NO: 1, a nucleotide sequence containing a deletion, substitution, addition, or insertion of 1 or 2 bases in the array represented by SEQ ID NO: 1, or a nucleotide sequence having 80% or more sequence identity with the array represented by SEQ ID NO:

1. The second universal array is an array represented by SEQ ID NO: 2, a nucleotide sequence containing a deletion, substitution, addition, or insertion of 1 or 2 bases in the array represented by SEQ ID NO: 2, or a nucleotide sequence having 80% or more sequence identity with the array represented by SEQ ID NO:

1. A kit for long-read sequencing of the exon 3 region of the filaggrin gene.

8. The kit according to claim 7, further comprising a DNA polymerase derived from Thermococcus kodakarensis.

9. The kit according to claim 7, wherein the at least one primer pair is any one of a total of 576 combinations of primer pairs obtained by combining 24 Forward Primers and 24 Reverse Primers.

Images