COMPOSITION TO BE USED TO SUPPRESS INHIBITION OF MEASUREMENT OF ApoE DUE TO LIPID AND USE THEREOF

A surfactant with a steroid skeleton addresses lipid interference in ApoE measurement, ensuring accurate ApoE quantification in samples with diverse lipid levels.

JP2025118433APending Publication Date: 2025-08-13FUJIREBIO CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2024013746
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-01-31
Publication Date
2025-08-13

AI Technical Summary

Technical Problem

Lipids in biological samples interfere with accurate measurement of ApoE protein levels, leading to significant variations in measurement results despite similar ApoE content.

Method used

A composition comprising a surfactant with a steroid skeleton is used to suppress lipid-mediated inhibition of ApoE measurement, enabling accurate measurement even in samples containing lipids.

Benefits of technology

The surfactant effectively suppresses lipid interference, allowing reliable measurement of ApoE protein levels in biological samples with varying lipid contents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025118433000001
    Figure 2025118433000001
  • Figure 2025118433000002
    Figure 2025118433000002
  • Figure 2025118433000003
    Figure 2025118433000003
Patent Text Reader

Abstract

To provide a composition that can suppress an action of lipid to suppress measurement of apolipoprotein E (ApoE).SOLUTION: A composition to be used to suppress inhibition of measurement of ApoE due to lipid of the present disclosure includes a surfactant having a steroid skeleton.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to compositions and uses for suppressing lipid-mediated inhibition of ApoE measurement. [Background technology]

[0002] Apolipoprotein E (ApoE) is a glycoprotein involved in the transport and metabolism of lipids such as cholesterol. The mature human ApoE protein is known to consist of 299 amino acids. The APOE gene has three distinct alleles (ε2, ε3, and ε4) that encode three distinct ApoE protein isoforms (ApoE2, ApoE3, and ApoE4). The three ApoE isoforms differ at amino acid residues 112 and 158. ApoE2 has a cysteine residue (Cys112 / Cys158), ApoE3 has a Cysteine residue (Cys112 / Arg158), and ApoE4 has a Arg112 / Arg158 residue (Arg112 / Arg158). These allelic combinations result in three homozygous forms (E2 / E2; E3 / E3; E4 / E4) and three heterozygous forms (E2 / E3; E3 / E4; E2 / E4).

[0003] It is known that APOE alleles are correlated with the risk of developing Alzheimer's disease (Patent Document 1). Carriers of two APOE4 alleles (homozygous E4 / E4) have a risk of developing Alzheimer's disease (AD) that is more than 10 times higher than non-carriers. Carriers of one APOE4 allele (heterozygous) also have a risk of developing AD that is several times higher than non-carriers. It is also known that APOE alleles affect the age at which AD develops. Therefore, determining whether or not a person has an APOE4 allele is important for predicting the risk of developing Alzheimer's disease.

[0004] Furthermore, the APOE4 allele has been reported to be a risk factor for amyloid-related imaging abnormalities (ARIA), a side effect, in patients receiving disease-modifying therapy (DMT) for AD (Non-Patent Document 1). Therefore, the importance of genotyping and phenotyping of the APOE gene is increasing.

[0005] Nucleic acid testing is the main method for detecting the APOE4 allele. Other known methods for detecting the APOE4 allele include measuring ApoE4 protein by immunoassay to determine the presence or absence of ApoE4, and measuring ApoE4 protein and ApoE protein separately by immunoassay to determine the homozygous E4 / E4 based on the ratio (Non-Patent Document 2). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 1994 / 009155 [Non-patent literature]

[0007] [Non-Patent Document 1] Cummings, J., Apostolova, L., Rabinovici, GD et al., “Lecanemab: Appropriate Use Recommendations.”, J. Prev. Alzheimers Dis., 2023, 10, pages 362-377 [Non-patent document 2] Yuri T, Degrieck R, Minczakiewicz D, Sato H, Kamada J, Nakazawa T, et al. “Estimation of the allelic status of apolipoprotein E4 isoforms with fully automated LUMIPULSE(R) assays.” Explor Neurosci. 2023;2: pages238-244 Summary of the Invention [Problem to be solved by the invention]

[0008] Therefore, the present inventors measured ApoE protein in blood samples and found that even if the ApoE content is the same, the measurement results of ApoE protein vary greatly depending on the individual from whom they are derived, i.e., measurement interference occurs. Furthermore, the present inventors found that the measurement interference (measurement interference) is caused by lipids.

[0009] Therefore, an object of the present disclosure is to provide a composition for use in suppressing lipid-mediated inhibition of ApoE protein measurement. [Means for solving the problem]

[0010] To achieve the above object, the composition of the present disclosure for use in suppressing the inhibition of ApoE protein measurement by lipids comprises a surfactant having a steroid skeleton.

[0011] The kit for use in measuring ApoE of the present disclosure comprises a surfactant having a steroid skeleton, It also includes an ApoE measurement reagent.

[0012] The method for measuring ApoE of the present disclosure includes a measurement step of contacting a subject sample with an ApoE measurement reagent in the presence of a surfactant having a steroid skeleton, and measuring ApoE in the sample. [Effects of the Invention]

[0013] According to the present disclosure, the inhibitory effect of lipids on ApoE measurement can be suppressed. DETAILED DESCRIPTION OF THE INVENTION

[0014] <Definition> As used herein, "apolipoprotein E" (ApoE) refers to a protein that belongs to the family of lipid-binding proteins called apolipoproteins and mediates lipid transport between tissues. ApoE is a mature ApoE consisting of 299 amino acids, which is generated by cleavage of the N-terminal signal peptide of a precursor protein consisting of 317 amino acids. The ApoE gene is known to have three major alleles / isoforms: the Apo-ε2 gene (APOE2), the Apo-ε3 gene (APOE3), and the Apo-ε4 gene (APOE4). The alleles of the ApoE gene are defined by two polymorphisms, rs429358 and rs7412. In the APOE2 gene, the codon encoding the 112th amino acid in the APOE gene is a Cys-encoding codon (TGC), and the codon encoding the 158th amino acid is a Cys-encoding codon (TGC). In the APOE3 gene, the codon encoding the 112th amino acid in the APOE gene is a codon encoding Cys (TGC), and the codon encoding the 158th amino acid is a codon encoding Arg (CGC). In the APOE4 gene, the codon encoding the 112th amino acid in the APOE gene is a codon encoding Arg (CGC), and the codon encoding the 158th amino acid is a codon encoding Arg (CGC). The nucleotide sequence encoding the precursor protein of human APOE3 corresponds to the nucleotide sequence from 70 to 1023 of GenBank accession number NM_000041.4. Specific examples of human ApoE2 to 4 genes include genes consisting of the nucleotide sequences shown below. In the nucleotide sequences of SEQ ID NOs: 1 to 3 below, the underlined nucleotides are, from the front, the codon encoding the 112th amino acid and the codon encoding the 158th amino acid of mature ApoE.

[0015] ·APOE2 gene 5'-ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGGCCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAG GTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGAGGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCGGCTGGGCGCGGACATGGAGGACGTG TGC GGCCGCCTGGTGCAGTACCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCCCTCCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG TGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAAACAGGGCCGCGTGCGGGCCCACTGTGGGCTCCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCGGACCCGCGACCGCCTGG ACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCTCCAAGAGCTTGGTTCGAGCCCCTGGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCAGCGACAATCACTGA-3'

[0016] ·APOE3 gene 5'-ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGGCCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAG GTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGAGGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCGGCTGGGCGCGGACATGGAGGACGTG TGCGGCCGCCTGGTGCAGTACCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCCCTCCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG CGC CTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAAACAGGGCCGCGTGCGGGCCCACTGTGGGCTCCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCGGACCCGCGACCGCCTGG ACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCTCCAAGAGCTTGGTTCGAGCCCCTGGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCAGCGACAATCACTGA-3'

[0017] ·APOE4 gene 5'-ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTG CGC GGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAG CGC CTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA-3'

[0018] As used herein, the term "subject" refers to an animal or a cell, tissue, or organ derived from an animal, and particularly includes humans. The term "animal" refers to both humans and non-human animals. Examples of non-human animals include mammals such as mice, rats, hamsters, rabbits, goats, cows, horses, dogs, cats, pigs, monkeys, dolphins, and sea lions.

[0019] As used herein, the term "sample" refers to a substance that contains or may contain ApoE. Examples of the sample include biological samples such as biological samples or specimens. Examples of the biological sample include samples containing body fluids, cells, tissues, organs, etc., and specific examples include feces, whole blood, serum, plasma, cerebrospinal fluid, puncture fluid, bile, etc. The biological sample is preferably a blood sample such as whole blood, serum, or plasma. The sample may be liquid or solid. When the sample is solid, in the present disclosure, it is preferable to prepare a liquid sample by mixing the solid sample with a liquid. Examples of the liquid include water; physiological saline; buffers such as Hank's buffer solution, Good's buffer solution (HEPES buffer, Tricine buffer, etc.), Tris buffer, phosphate buffer, and glycine buffer.

[0020] As used herein, the term "kit" generally refers to a unit in which the components to be provided (e.g., test reagents, diagnostic reagents, test reagents, labels, substrates, instructions, etc.) are provided separately in two or more compartments. The kit can be suitably used to provide a composition that is not provided in a mixed state, but is preferably mixed immediately before use, for reasons of stability, etc. The kit preferably includes, for example, instructions or instructions on how to use the components to be provided (e.g., test reagents, diagnostic reagents, test reagents, etc.), or instructions or instructions describing the processing of the components. As used herein, when the kit is used as a reagent kit, the kit may also include instructions, etc., describing how to use the test reagent, diagnostic reagent, etc.

[0021] As used herein, "instructions" or "instructions" refer to written instructions to a physician or other user on how to use the present disclosure. The instructions include, for example, instructions on how to use the inhibition method or measurement method, composition, or kit of the present disclosure. The instructions may be prepared in accordance with a format specified by a regulatory agency of the country in which the present disclosure is implemented (e.g., the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, the European Medicines Agency (EMA) in Europe, etc.), and may clearly state that they have been approved by the regulatory agency. The instructions may be a so-called package insert, and are usually provided in paper form, but are not limited thereto, and may also be provided in the form of, for example, electronic media (e.g., a homepage provided on the Internet, email).

[0022] As used herein, the term "gene" refers to a factor that determines a genetic trait, and may refer to a "polynucleotide," an "oligonucleotide," and a "nucleic acid."

[0023] As used herein, the terms "protein," "peptide," or "polypeptide" refer to a polymer composed of unmodified (naturally occurring), modified, and / or artificial amino acids. The polypeptide is, for example, a peptide having a length of 10 amino acids or more.

[0024] As used herein, "nucleic acid," "polynucleotide," or "oligonucleotide" refers to a polymer of deoxyribonucleotides (DNA), ribonucleotides (RNA), and / or modified nucleotides. The nucleic acid may be a single-stranded or double-stranded nucleic acid molecule. The polynucleotide may be composed of naturally occurring nucleotides, modified or artificial nucleotides, or both.

[0025] As used herein, the term "label" refers to a label used to distinguish a molecule or substance of interest from other molecules or substances. Examples of the label include fluorescent labels such as fluorescent dyes or fluorescent substances (e.g., fluorescein, fluorescein isothiocyanate, rhodamine), chemiluminescent labels such as luciferin and aequorin, luminescent substances such as acridinium derivatives, enzyme labels such as horseradish peroxidase, alkaline phosphatase, β-galactosidase (β-gal), glucose oxidase, and luciferase, and the like. 3 H, 14 C. 32 P, 35 S, 125 Radioisotope (RI) labels such as I;

[0026] As used herein, a "binding molecule" refers to a molecule capable of binding to a predetermined molecule. Examples of the binding molecule include nucleic acid molecules, proteins, and sugar chains capable of binding to the predetermined molecule. Specific examples of the binding molecule include aptamers, antibodies, receptors, and ligands capable of binding to the predetermined molecule. The binding molecule may be, for example, a known binding molecule capable of binding to the predetermined molecule, or a newly prepared binding molecule prepared by SELEX, phage display, or the like. The "antibody" refers to a protein containing one or more polypeptides substantially or partially encoded by immunoglobulin genes or fragments of immunoglobulin genes. Examples of the antibody include polyclonal antibodies and monoclonal antibodies. Examples of the antibody isotype include IgG (e.g., IgG1, IgG2, IgG3, IgG4, etc.), IgM, IgA (e.g., IgA1, IgA2, etc.), IgE, IgD, IgY, etc. The antibody may be derived from animals such as mammals (e.g., mouse, rat, hamster, rabbit, goat, cow, horse, camel, and alpaca); birds (e.g., chicken and ostrich); and cartilaginous fish (e.g., shark). The antibody may be, for example, a camelid-derived heavy chain antibody (VHH antibody), a cartilaginous fish-derived immunoglobulin new antigen receptor (IgNAR), an antibody fragment (e.g., Fab, Fab', F(ab')2, single-domain antibody (nanobody), etc.), or a recombinant antibody (e.g., scFv, disulfide-linked Fv (dsFv), diabody, minibody, etc.). The antibody may be an antibody-like molecule (e.g., affibody, anticalin, DARPins, monobody, etc.) produced by molecular biology techniques (e.g., phage display) and / or by protein engineering techniques using existing protein motifs.

[0027] Sequence information for the proteins described herein or the nucleic acids (e.g., DNA or RNA) encoding them is available from Protein Data Bank, UniProt, GenBank, etc. RNA nucleic acid sequences can also be obtained from the corresponding DNA base sequences using appropriate sequence conversion software, etc.

[0028] The present disclosure will be specifically described below using examples. Unless otherwise specified, each disclosure may incorporate the explanations of other disclosures.

[0029] <Composition for use in suppressing lipid-induced inhibition of ApoE measurement> In one aspect, the present disclosure provides a composition capable of suppressing lipid-induced inhibition of apolipoprotein E (ApoE) measurement. The composition (hereinafter also referred to as "composition") for use in suppressing lipid-induced inhibition of apolipoprotein E (ApoE) measurement of the present disclosure comprises a surfactant having a steroid skeleton.

[0030] The present inventors have found that when measuring ApoE in blood samples, even if the ApoE content is the same, the ApoE measurement results vary greatly depending on the blood source. As a result of extensive research, the present inventors have discovered that an increase in the lipid content in a sample inhibits ApoE measurement. Furthermore, they have discovered that the use of a surfactant with a steroid skeleton, among other surfactants, can suppress the lipid-mediated inhibition of ApoE measurement, thereby establishing the present disclosure. The composition of the present disclosure can suppress the lipid-mediated inhibition of ApoE measurement, thereby enabling ApoE measurement even when the sample contains lipids such as cholesterol and neutral lipids. Therefore, the composition of the present disclosure can suitably measure ApoE, for example, in biological samples containing lipids.

[0031] In the present disclosure, examples of the lipid include cholesterol, neutral fats, chylomicrons, and very low-density lipoproteins (VLDL). The lipid is, for example, a lipid contained in chyle. The composition of the present disclosure can be suitably used for samples having a lipid content of 780 FTU (Formazin Turbidity Unit), particularly 1580 FTU or more.

[0032] In the present disclosure, the ApoE to be measured may be any one ApoE, two or more ApoE, or all ApoE (total ApoE). Furthermore, the measurement target is preferably a combination of total ApoE and one or more ApoE, since it allows evaluation of, for example, ApoE alleles and their genotypes. Specifically, when evaluating the genotype of ApoE4, the measurement target is, for example, a combination of total ApoE and ApoE4.

[0033] The surfactant having a steroid skeleton is a compound having a steroid skeleton as an independent ring structure, i.e., a steroid skeleton not condensed with another ring, or a salt thereof. The configuration at the 5-position of the surfactant having a steroid skeleton may be either α or β. The surfactant having a steroid skeleton may have a steroid skeleton without a hydroxyl group at the 7-position, or may have a steroid skeleton with a hydroxyl group at the 7-position.

[0034] Examples of surfactants having a steroid skeleton include compounds having a steroid skeleton as a hydrophobic moiety and a hydrophilic moiety, or salts thereof. Examples of the hydrophilic moiety include anionic moieties such as sulfonate (-SO3-), carboxylate (-COO-), and phosphonate (-POO2-), cationic moieties such as quaternary ammonium and quaternary phosphonium, which may be substituted with one to four hydrocarbon groups, and nonionic hydrophilic moieties such as multiple ethers, as well as groups such as hydrocarbon groups containing these moieties. Therefore, surfactants having a steroid skeleton can be anionic surfactants, cationic surfactants, amphoteric surfactants, or nonionic surfactants, depending on the type of hydrophilic moiety. Examples of the hydrocarbon group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl (lauryl), tetradecyl (myristyl), hexadecyl (cetyl), heptadecyl, octadecyl (stearyl), cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, phenyl, and naphthalenyl. The hydrocarbon group is preferably a hydrocarbon group having 1 to 10 carbon atoms, and more preferably an alkyl group having 1 to 6 carbon atoms.

[0035] In addition to the hydrophilic portion, the steroid skeleton may have 1 to 6, preferably 1, 2, 3, or 4, substituents. The substituents are not particularly limited as long as they do not significantly impair the properties (e.g., hydrophobicity) of the steroid skeleton, and examples thereof include a hydrocarbon group having 1 to 10 carbon atoms; a hydroxyl group; a hydroxyl group substituted with a hydrocarbon group having 1 to 10 carbon atoms such as an alkyloxy group; a hydrocarbon group-carbonyl-oxy group having 1 to 10 carbon atoms such as an alkyl-carbonyl-oxy group; an oxo group; a formyl group; a hydrocarbon group-oxy-carbonyl group having 1 to 10 carbon atoms such as an alkyloxy-carbonyl group; a halogen atom such as a fluorine atom, chlorine atom, bromine atom, or iodine atom; and a cyano group.

[0036] The surfactant having a steroid skeleton is preferably a bile acid, a derivative thereof, or a salt thereof. Examples of the bile acid include deoxycholic acid, chenodeoxycholic acid, ursodeoxycholic acid, hyodeoxycholic acid, cholic acid, glycocholic acid, taurocholic acid, hyocholic acid, 5α-cypurinol, lithocholic acid, taurodeoxycholic acid, and taurocholic acid. Examples of the bile acid derivative include CHAPS (3-[(3-Cholamidopropyl) dimethylammonio] propanesulfonate), BIGCHAP (N,N-Bis(3-D-gluconamidopropyl) cholamide), deoxy-BIGCHAP (N,N-Bis(3-D-gluconamidopropyl) deoxycholamide), and CHAPSO (3-[(3-Cholamidopropyl) dimethylammonio]-2-hydroxy-1-propanesulfonate).

[0037] The salt is an arbitrary salt, and examples thereof include inorganic salts, organic salts, inner salts, etc. The inorganic salts include, for example, metal salts, halide salts, acid addition salts, ammonium salts, etc. The metal salts include, for example, alkali metal salts such as lithium salts, sodium salts, potassium salts; alkaline earth metal salts such as magnesium salts, calcium salts; etc. The halogen in the halide salt includes, for example, fluorine, bromine, chlorine, iodine, etc. The acid addition salts which are inorganic salts include salts with inorganic acids such as hydrochloride, nitrate, sulfate, phosphate, carbonate, bicarbonate, perchlorate, etc. The organic salts include, for example, ammonium salts; aliphatic amine salts such as trimethylamine salt, triethylamine salt, dicyclohexylamine salt, ethanolamine salt, diethanolamine salt, triethanolamine salt; aralkylamine salts such as N,N-dibenzylethylenediamine; heterocyclic aromatic amine salts such as pyridine salt, picoline salt, quinoline salt, isoquinoline salt; salts with organic bases such as these; salts with organic acids such as oxalate, acetate, propionate, succinate, glycolate, lactate, maleate, fumarate, tartrate, malate, citrate, etc.

[0038] The composition of the present disclosure may contain a surfactant having one type of steroid skeleton or may contain surfactants having a plurality of types of steroid skeletons.

[0039] The form of the composition of the present disclosure may be a solid form such as powder or granule, or may be a liquid form such as slurry (suspension), jelly, solution, etc.

[0040] The composition of the present disclosure can be suitably used as a test reagent, a test reagent or a research reagent for measuring ApoE in a sample containing or capable of containing lipids, for example. Further, according to the composition of the present disclosure, the suppression method of the present disclosure described later can be suitably carried out.

[0041] <Kit for measuring ApoE> In another aspect, the present disclosure provides a kit for use in measuring ApoE in which the inhibitory effect of lipids on ApoE measurement is suppressed. The kit for use in measuring ApoE of the present disclosure (hereinafter also referred to as "kit") includes a surfactant having a steroid skeleton and a reagent for measuring apolipoprotein E (ApoE). The kit of the present disclosure can suppress the inhibitory effect of lipids on ApoE measurement. Therefore, the kit of the present disclosure can suitably measure ApoE in a sample, even if the sample contains the lipid, for example.

[0042] The ApoE measurement reagent is a reagent capable of specifically detecting or measuring ApoE, and includes, for example, a first binding molecule for ApoE. The first binding molecule preferably specifically binds to ApoE. The first binding molecule is preferably an antibody against ApoE or an antigen-binding fragment thereof. The ApoE to be measured may be one type or multiple types. When the ApoE to be measured is multiple types, the first binding molecule may include a first binding molecule that specifically binds to a region common to each ApoE, or may include multiple first binding molecules that specifically bind to each ApoE. The ApoE antibody may be, for example, an antibody against ApoE2, an antibody against ApoE3, an antibody against ApoE4, or a combination of these antibodies, or may be an antibody that binds to all of ApoE2, ApoE3, and ApoE4 (anti-Pan-ApoE antibody). These ApoE antibodies can be produced by appropriately adapting and improving conventionally known methods. When the antibody against ApoE is, for example, a monoclonal antibody, it can be produced by a method for producing a monoclonal antibody using a hybridoma (Kohler & Milstein, Nature, 256:495, 1975). In addition, the antibody against ApoE is commercially available, and a commercially available antibody can also be used.

[0043] The first molecule for ApoE may be supported on a carrier. That is, the ApoE measurement reagent may contain a carrier supporting a first binding molecule for ApoE. The carrier may be, for example, particles such as magnetic particles or beads; membranes such as nitrocellulose membranes; substrates such as glass, plastic, or metal; or plates such as multi-well plates. Because of their excellent operability, the carrier is preferably a particle. The antibody may be provided in a form impregnated in a medium such as filter paper. The first binding molecule for ApoE may be configured to be supported on a carrier during ApoE measurement. That is, in the kit of the present disclosure, the ApoE measurement reagent may be configured so that the first binding molecule for ApoE is supported on the carrier by being present in a separate state and coexisting during measurement. In this case, the kit of the present disclosure may comprise, for example, binding a first component of a pair of affinity substances to a first binding molecule for ApoE, binding a second component of the pair of affinity substances to the carrier, and supporting the first binding molecule for ApoE on the carrier via affinity binding between the first and second components. The pair of affinity substances comprises the first and second components, and the first and second components are a combination of substances that exhibit specific binding ability to each other, and may also be referred to as, for example, a tag and a binding partner.

[0044] The method for immobilizing the first binding molecule on the carrier can be a conventionally known method or a method based thereon, depending on the type of first binding molecule. The first binding molecule may be immobilized directly or indirectly on the surface of the carrier. For example, the direct immobilization method may involve attaching an active group to the carrier, and then using the resulting carrier or a carrier having an active group, and then binding the first binding molecule to the carrier via a covalent bond formed by reaction between the active group and the first binding molecule. For example, the indirect immobilization method may involve using a pair of affinity substances. Examples of the pair of affinity substances include a combination of biotin and avidin or streptavidin, a combination of nickel and a His tag, or a combination of an epitope tag, such as a flag™ tag, HA tag, T7 tag, V5 peptide tag, and / or Myc tag, and an antibody against the tag. The first binding molecule may also be supported on the carrier by ionic bonding with the carrier or by adsorption to the carrier. When the first molecule against ApoE is indirectly supported on a carrier, for example, the antibody against ApoE and the carrier may be contained in the same container or in separate containers.

[0045] The ApoE measurement reagent may contain, for example, a second binding molecule for ApoE or a complex of ApoE and the first binding molecule. In this case, it is preferable that the first binding molecule and the second binding molecule bind to different sites on ApoE, i.e., that the two binding molecules can simultaneously bind to ApoE. When there are multiple types of ApoE to be measured, the second binding molecule may contain a second binding molecule that specifically binds to a region common to each ApoE, or may contain multiple second binding molecules that specifically bind to each ApoE.

[0046] The first binding molecule and / or the second binding molecule may have a label. In this case, ApoE can be detected via the first binding molecule and / or the second binding molecule by detecting the label. When the ApoE measurement reagent contains the first binding molecule and the second binding molecule, it is preferable that one of the first binding molecule and the second binding molecule is supported on the carrier, and the other has a label. It is more preferable that the first binding molecule is supported on the carrier, and the second binding molecule has a label. The method for introducing a label into the first binding molecule and / or the second binding molecule can be carried out by appropriately adopting a conventionally known method or a method similar thereto, depending on the type of the first binding molecule and the second binding molecule. The label may be directly or indirectly bound. Examples of the method for binding the label include the same methods as those exemplified as the method for immobilizing the first binding molecule on the carrier.

[0047] When the first binding molecule and / or the second binding molecule has a label, the kit of the present disclosure may have a substrate capable of reacting with the label. In this case, the label is, for example, the enzyme label described above, and the substrate is a substance capable of reacting with the enzyme label. The substrate may be solid or liquid. When the substrate is liquid, it can also be called a substrate liquid.

[0048] The first binding molecule and / or the second binding molecule included in the kit of the present disclosure may be in the form of a solution (liquid or gel) dissolved or dispersed in a buffer solution or the like, or may be in a solid form such as powder or granules, for example, obtained by freeze-drying the liquid dissolved in the buffer solution. Examples of the buffer solution include Tris buffers such as Tris-HCl buffer, Tris-EDTA (TE) buffer, TAE buffer, TBE buffer, and Tris-buffered saline; phosphate buffers such as phosphate-buffered saline; carbonate buffers such as carbonate-sodium bicarbonate buffer; and Good's buffers such as MES, ADA, PIPES, TAPS, CAPS, ACES, cholamine hydrochloride, BES, TES, HEPES, acetamidoglycine, tricine, glycineamide, and bicine. The pH of the solution is, for example, 4.0 to 9.5, preferably 5 to 9 or 5.5 to 8.5, and more preferably 6 to 8. The pH can be adjusted using, for example, the buffer solution, an acidic substance such as hydrochloric acid, or an alkaline substance such as sodium hydroxide. The solution may further contain a water-soluble polymer such as bovine serum albumin (BSA), a chelating agent such as EDTA, a sugar such as sucrose, or a preservative such as sodium azide.

[0049] The kit of the present disclosure may further include an ApoE standard. The ApoE standard is an aqueous solution containing ApoE at one or more predetermined concentrations, or an ApoE powder (e.g., a lyophilized product). The ApoE standard is useful, for example, as a control. Furthermore, by using the ApoE standard, for example, in the ApoE measurement method described below, a calibration curve corresponding to the ApoE concentration can be prepared, and the ApoE concentration in a sample can be analyzed.

[0050] The kit of the present disclosure may include, for example, a diluent for diluting a sample (specimen diluent), a diluent for diluting a first binding molecule (first binding molecule diluent), a diluent for diluting a second binding molecule (second binding molecule diluent), a washing solution for washing the complex formed by the reaction between the sample and the ApoE measurement reagent, a pretreatment solution (treatment solution), etc.

[0051] The diluent contains, for example, the buffer solution, and the washing solution contains, for example, the buffer solution and a nonionic surfactant.

[0052] In the kit of the present disclosure, the surfactant containing a steroid skeleton may be contained separately from the ApoE measurement reagent or may be contained mixed with part or all of the ApoE measurement reagent. Since the surfactant containing a steroid skeleton can suppress the inhibition of ApoE measurement by lipids, it is preferable that it coexist with the sample when the ApoE measurement reagent is contacted with the ApoE measurement reagent. Therefore, the surfactant containing a steroid skeleton is preferably contained in a reagent used when the sample is contacted with the ApoE measurement reagent or prior to the contact. Therefore, in the kit of the present disclosure, the surfactant containing a steroid skeleton may be contained in, for example, the solution in which the first binding molecule is dissolved or dispersed, the specimen dilution solution, the first binding molecule dilution solution, the solution in which the second binding molecule is dissolved or dispersed, and / or the second binding molecule dilution solution, depending on the order of use of the kit of the present disclosure. Specifically, when the kit of the present disclosure includes the first binding molecule, a specimen dilution solution, and optionally the second binding molecule as the ApoE measurement reagent, and the sample is diluted with the specimen dilution solution and the resulting dilution solution is brought into contact with the first binding molecule, the first binding molecule is preferably contained in a dissolved or dispersed solution, the specimen dilution solution, and / or the first binding molecule dilution solution. This allows the sample and the surfactant having a steroid skeleton to coexist, thereby effectively suppressing the measurement inhibitory effect of the lipid.

[0053] In the kit of the present disclosure, each reagent or component may be in a solid form such as powder or granules, or in a liquid form such as a slurry (suspension), jelly, or solution.

[0054] In the kit of the present disclosure, for example, each component may be contained separately, or some or all of the components may be contained in a mixed or unmixed state. In the kit of the present disclosure, when all the reagents are contained in a single container in a mixed or unmixed state, the kit of the present disclosure can also be referred to as, for example, a reagent for use in measuring ApoE.

[0055] The kit of the present disclosure may further include, for example, containers for storing the components of the kit. In this case, the kit of the present disclosure may be provided in a form in which each component is contained in a different container (e.g., a tube, a plate, etc.). The kit of the present disclosure may also be provided in the form of a device. In this case, some or all of the components may be provided in a form contained in the device. When some of the components are provided in a form contained in the device, the remaining components of the kit may be provided in a form not contained in the device, for example, in a form contained in a different container. In this case, the components not contained in the device may be used by being injected into the device during ApoE measurement. Examples of the device structure include: 1) a device having a first area for mixing a sample with a specimen dilution solution to prepare a mixed solution, and a second area for contacting the prepared mixed solution with a surfactant having a steroid skeleton and an ApoE measurement reagent to detect ApoE; 2) a device having an area for mixing a sample with a surfactant having a steroid skeleton and an ApoE measurement reagent to detect ApoE; and 3) a device having a flow path that allows mixing of the sample with the components (e.g., reaction solution, dilution solution, etc.), and an area for detecting ApoE.

[0056] Kits of the present disclosure may include, for example, instructions or instructions.

[0057] The kit of the present disclosure can be suitably used as, for example, a test kit, a test kit, or a research kit for detecting ApoE in a lipid-containing sample, and the kit of the present disclosure can be suitably used to carry out the ApoE measurement method of the present disclosure described below.

[0058] <Method for suppressing lipid-mediated inhibition of ApoE measurement> In another aspect, the present disclosure discloses a method capable of suppressing the inhibitory effect of lipids on ApoE measurement. The method for suppressing the inhibition of apolipoprotein E (ApoE) measurement by lipids (hereinafter also referred to as the "suppression method") of the present disclosure includes a coexistence step of causing a target sample to coexist with a surfactant having a steroid skeleton. The suppression method of the present disclosure can suppress the inhibitory effect of lipids on ApoE measurement. Therefore, the suppression method of the present disclosure can suitably measure ApoE in a sample containing the lipids, for example.

[0059] The inhibition method of the present disclosure can also be described as, for example, a method for pretreating a sample for use in measuring ApoE, a method for preparing (producing) a lipid-containing sample that allows ApoE measurement, or a method for preparing (producing) a lipid-containing sample with improved ApoE measurement efficiency.

[0060] The suppression method of the present disclosure includes a coexistence step of coexisting a target sample with a surfactant having a steroid skeleton. The coexistence can be achieved by contacting or mixing (hereinafter collectively referred to as "contact") the target sample with the surfactant having a steroid skeleton. The coexistence is preferably achieved in a liquid system (coexistence system or mixed system) containing water, physiological saline, the buffer solution, or the like. The order of the contacting is not particularly limited and can be any order.

[0061] In the coexistence step, the concentration of the surfactant having a steroid skeleton in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.01 to 2.5 (w / v)%, more preferably 0.015 to 2 (w / v)%, because this can further suppress the inhibition of ApoE measurement by the lipid. The concentration of the surfactant can also be referred to as, for example, the concentration in the liquid system.

[0062] When the surfactant having a steroid skeleton is CHAPS, the concentration of CHAPS in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.01 to 3 (w / v)%, and is preferably 0.23 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipid, and more preferably 0.24 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE4 and total ApoE measurement by the lipid.

[0063] When the surfactant having a steroid skeleton is deoxycholic acid, the concentration of deoxycholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.019 to 0.29 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids, and is more preferably 0.019 to 0.23 (w / v)% or 0.038 to 0.23 (w / v)% because this can further suppress the inhibition of ApoE4 and total ApoE measurement by the lipids.

[0064] When the surfactant having a steroid skeleton is cholic acid, the concentration of cholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.028 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids, and is more preferably 0.029 to 1.9 (w / v)% or 0.095 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids.

[0065] When the surfactant having a steroid skeleton is glycocholic acid, the concentration of glycocholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.028 to 0.29 (w / v)% or 0.047 to 0.29 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids, and more preferably 0.029 to 0.19 (w / v)% or 0.095 to 0.19 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids.

[0066] When the surfactant having a steroid skeleton is taurocholic acid, the concentration of taurocholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.01 to 3 (w / v)%, and is preferably 0.023 to 0.29 (w / v)% or 0.047 to 0.29 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids, and more preferably 0.029 to 0.19 (w / v)% or 0.048 to 0.19 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids.

[0067] In the coexistence step, the coexistence conditions (e.g., temperature, time, pH) may be within a range in which the surfactant having a steroid skeleton can suppress lipid-mediated inhibition of ApoE measurement. Specific examples of the temperature during coexistence include 4 to 42°C, or 18 to 40°C. The coexistence time is, for example, 1 minute to 12 hours, 3 minutes to 120 minutes, or 5 to 60 minutes. The pH during coexistence is, for example, 4 to 9.5, preferably 5 to 9 or 5.5 to 8.5, and more preferably 6 to 8.

[0068] The surfactant having a steroid skeleton may be contained in, for example, the diluent. In this case, in the coexistence step, for example, the sample is diluted with the diluent to allow the sample and the surfactant having a steroid skeleton to coexist. In the dilution, the volume of the diluent used to dilute the sample can be appropriately determined depending on the volume of the sample and the intended use of the sample (e.g., qualitative measurement, quantitative measurement, etc.), and can be set to, for example, a volume larger than the volume of the sample. As a specific example, the volume of the diluent used to dilute the sample is, for example, 1 to 25 times, preferably 2 to 20 times, and more preferably 4 to 10 times the volume of the sample (standard (1)).

[0069] The suppression of ApoE measurement inhibition can be interpreted as, for example, promoting the reaction between ApoE and the reagent. The suppression of ApoE measurement inhibition can be evaluated, for example, using a high-lipid-containing blood sample containing chyle and a control sample without chyle, according to Example 1 described below. Specifically, in the evaluation, for example, first, a control blood sample containing or not containing the test substance is prepared so that the concentration in the liquid system is 0.2 (w / v)%, and a high-lipid-containing blood sample containing or not containing the test substance is prepared so that the concentration in the liquid system is 0.2 (w / v), and a measured ApoE value (concentration) is obtained for each sample. Next, the ratio (C) of the measured ApoE value of the high-lipid-containing blood sample to the measured ApoE value of the control blood sample without the test substance (100%) and the ratio (T) of the measured ApoE value of the high-lipid-containing blood sample with the test substance added to the measured ApoE value of the control blood sample with the test substance added to the measured ApoE value (100%) are calculated. When the T is greater than C, for example, when the difference between the T and C (TC) is 2.5% or more, 5% or more, 10% or more, 15% or more, 20% or more, or 25% or more, the test substance can be evaluated as being able to suppress the inhibition of ApoE measurement. Furthermore, when evaluating the suppression of ApoE measurement inhibition in the measurement method described below, the evaluation may be performed in the presence of a measurement reagent described below. In this case, the evaluation may be performed, for example, by obtaining ApoE measurement values (concentrations) for a control blood sample with or without the addition of a test substance so that the concentration in the reaction solution is 0.2 (w / v)% in the measurement method described below, and for a high-lipid-containing blood sample with or without the addition of a test substance so that the concentration in the reaction solution is 0.2 (w / v). Next, the ratio (C) of the ApoE measurement value of the high-lipid-containing blood sample under the non-addition condition to the ApoE measurement value of the control blood sample under the non-addition condition (100%) and the ratio (T) of the ApoE measurement value of the high-lipid-containing blood sample under the addition condition to the ApoE measurement value of the control blood sample under the addition condition (100%) may be calculated. The obtained ratios (C) and (T) can then be evaluated, for example, based on the evaluation criteria described above.

[0070] <Method for Measuring ApoE> In another aspect, the present disclosure provides a method for measuring ApoE in which the inhibitory effect of lipids on the measurement of ApoE is suppressed. The method for measuring ApoE of the present disclosure (hereinafter, also referred to as "measurement method") includes a measurement step of bringing a sample of a subject into contact with a measurement reagent for ApoE in the presence of a surfactant having a steroid skeleton, and measuring ApoE in the sample. In the measurement method of the present disclosure, by bringing ApoE into contact with a measurement reagent for ApoE in the presence of the surfactant having a steroid skeleton and measuring the ApoE, the inhibitory effect of lipids on the measurement of ApoE can be suppressed. Therefore, according to the measurement method of the present disclosure, for example, even for a sample containing the lipid, ApoE in the sample can be suitably measured.

[0071] In the measurement step, the sample is brought into contact with a measurement reagent for ApoE in the presence of a surfactant having a steroid skeleton, and ApoE in the sample is measured. In the measurement step, for example, by measuring the presence or absence of ApoE detected by the measurement reagent for ApoE, the presence or absence of ApoE in the sample can be qualitatively measured. Also, in the measurement step, for example, by measuring the amount of ApoE detected by the measurement reagent for ApoE, the amount of ApoE in the sample can be quantitatively measured. Further, in the measurement step, the ApoE to be measured may be one, a plurality, or all (total ApoE) as described above.

[0072] In the measurement step, the ApoE measurement can be performed using an ApoE-binding molecule. In this case, the ApoE measurement may be performed by an immunological technique. Examples of the immunological technique include direct competitive ELISA, indirect competitive ELISA, sandwich ELISA, direct competitive immunoassay, indirect competitive immunoassay, sandwich immunoassay, immunochromatography, spin immunoassay, and latex agglutination. When the ApoE measurement reagent contains a label, examples of the immunological technique include fluorescent immunoassay (FIA), enzyme immunoassay (EIA), chemiluminescent immunoassay, chemiluminescent enzyme immunoassay, and radioimmunoassay (RIA), depending on the type of label.

[0073] As examples of the measurement step, a measurement example in which ApoE is measured using the first binding molecule and a measurement example in which ApoE is measured using the first binding molecule and the second binding molecule will be described.

[0074] When ApoE is measured using the first binding molecule, the measurement step includes a first complex formation step of contacting a sample with a first binding molecule for ApoE in the presence of a surfactant having a steroid skeleton to form a first complex between ApoE in the sample and the first binding molecule, and a complex measurement step of measuring ApoE in the sample by measuring the first complex.

[0075] In the complex formation step, the contact can be carried out, for example, by mixing the subject sample with the first binding molecule for ApoE. The contact is preferably carried out in a liquid system containing water, physiological saline, the buffer solution, or the like.

[0076] In the complex formation step, the concentration of the surfactant having a steroid skeleton in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.01 to 2.5 (w / v)%, more preferably 0.015 to 2 (w / v)%, because this can further suppress inhibition of ApoE measurement by the lipid. The surfactant concentration can also be referred to as the concentration in the liquid system (reaction solution) containing the sample and the first binding molecule for ApoE, for example.

[0077] When the surfactant having a steroid skeleton is CHAPS, the concentration of CHAPS in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.01 to 3 (w / v)%, and is preferably 0.23 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipid, and more preferably 0.24 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE4 and total ApoE measurement by the lipid.

[0078] When the surfactant having a steroid skeleton is deoxycholic acid, the concentration of deoxycholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.019 to 0.29 (w / v)% or 0.038 to 0.29 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids, and more preferably 0.019 to 0.23 (w / v)% or 0.038 to 0.23 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids.

[0079] When the surfactant having a steroid skeleton is cholic acid, the concentration of cholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.028 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids, and is more preferably 0.029 to 1.9 (w / v)% or 0.095 to 1.9 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids.

[0080] When the surfactant having a steroid skeleton is glycocholic acid, the concentration of glycocholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.010 to 3 (w / v)%, and is preferably 0.028 to 0.29 (w / v)% or 0.047 to 0.29 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids, and more preferably 0.029 to 0.19 (w / v)% or 0.095 to 0.19 (w / v)% in order to further suppress the inhibition of ApoE measurement by the lipids.

[0081] When the surfactant having a steroid skeleton is taurocholic acid, the concentration of taurocholic acid in the liquid system is, for example, 0.001 to 10 (w / v)%, 0.005 to 5 (w / v)%, or 0.01 to 3 (w / v)%, and is preferably 0.023 to 0.29 (w / v)% or 0.047 to 0.29 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids, and more preferably 0.029 to 0.19 (w / v)% or 0.048 to 0.19 (w / v)% because this can further suppress the inhibition of ApoE measurement by the lipids.

[0082] In the complex formation step, the contact conditions (e.g., temperature, time, pH) between the sample and the first binding molecule are not particularly limited, as long as the steroid-based surfactant can suppress lipid-mediated inhibition of ApoE measurement and the first complex can be formed. Specific examples of the contact temperature include 4 to 42°C or 18 to 40°C. The contact time is, for example, 1 minute to 12 hours, 3 minutes to 120 minutes, or 5 to 60 minutes. The pH during complex formation is, for example, 4 to 9.5, preferably 5 to 9 or 5.5 to 8.5, and more preferably 6 to 8.

[0083] In the measurement step or the complex formation step, the surfactant having a steroid skeleton is required to be present when the sample is contacted with the ApoE assay reagent (e.g., the first binding molecule and / or the second binding molecule), and the order of contact is not particularly limited. In the measurement step or the complex formation step, for example, after contacting the surfactant having a steroid skeleton with the sample, they may be further contacted with the ApoE assay reagent (e.g., a solution containing the first binding molecule and / or the second binding molecule); after contacting the surfactant having a steroid skeleton with the ApoE assay reagent (e.g., a solution containing the first binding molecule and / or the second binding molecule), they may be contacted with the sample; or the surfactant having a steroid skeleton, the sample, and the ApoE assay reagent (e.g., a solution containing the first binding molecule and / or the second binding molecule) may be contacted simultaneously. Furthermore, in the measurement step or the complex formation step, the sample may be diluted with a specimen dilution solution containing a surfactant containing the steroid skeleton, thereby allowing the sample to coexist with the surfactant having the steroid skeleton, and then the diluted sample may be brought into contact with the ApoE measurement reagent (e.g., a solution containing the first binding molecule and / or the second binding molecule).

[0084] In the dilution, the volume of the diluent used to dilute the sample can be appropriately determined depending on the volume of the sample and the purpose of use of the sample (e.g., qualitative measurement, quantitative measurement, etc.), and can be set to, for example, a volume larger than the volume of the sample. Specific examples of the volume of the diluent used to dilute the sample are, for example, 1 to 25 times, preferably 2 to 20 times, and more preferably 4 to 10 times the volume of the sample (1).

[0085] The complex measurement step is, for example, a step of measuring a first complex between ApoE and the first binding molecule in the sample, i.e., a step of measuring the binding between ApoE and the first binding molecule. In the complex measurement step, by detecting the presence or absence of binding between the two, for example, the presence or absence of ApoE in the sample can be analyzed (qualitatively), and by detecting the degree of binding between the two (amount of binding), for example, the amount of ApoE in the sample can be analyzed (quantitatively).

[0086] The method for measuring the binding between ApoE and the first binding molecule is not particularly limited, and for example, a conventionally known method for measuring binding between substances can be used, specifically, SPR, fluorescence polarization, etc. Furthermore, when the first binding molecule has a label, the binding between ApoE and the first binding molecule may be measured by directly or indirectly detecting the label in the first complex in the complex measurement step. The method for detecting the label can be determined appropriately depending on, for example, the type of label.

[0087] Furthermore, when measuring ApoE using the first binding molecule and the second binding molecule, the measurement step includes a first complex formation step of contacting the sample with a first binding molecule for ApoE in the presence of a surfactant containing the steroid skeleton to form a first complex between ApoE in the sample and the first binding molecule, a second complex formation step of contacting the first complex with a second binding molecule for ApoE to form a second complex between the first complex and the second binding molecule, and a complex measurement step of measuring ApoE in the sample by measuring the second complex. In this case, it is preferable that the first binding molecule is supported on the carrier before, during, or after the formation of the first complex. When the first binding molecule is supported on the carrier after the formation of the first complex, the measurement method includes, for example, supporting the first binding molecule on the carrier in the second complex formation step described below. When the first binding molecule is immobilized on the carrier during or after the formation of the first complex, the first binding molecule is indirectly immobilized on the carrier, for example, by adding the above-mentioned pair of affinity substances to the first binding substance and the carrier.

[0088] The first complex formation step can be carried out in the same manner as the complex formation step. In the measurement step, it is preferable to separate the first complex after the first complex formation step, since this can improve the measurement accuracy of the ApoE. Optionally, it is more preferable to further wash the separated first complex with the washing solution. The separation of the first complex can be carried out, for example, by solid-liquid separation. When the first binding molecule is supported on a carrier, the separation of the first complex can be carried out, for example, by separating a solid fraction containing the carrier from a liquid fraction. When the first binding molecule is supported on magnetic particles, the separation of the first complex can be carried out by generating a magnetic field using a magnet or the like to separate a solid fraction containing the magnetic particles from a liquid fraction.

[0089] Next, in the second complex formation step, the first complex is contacted with the second binding molecule to form the second complex. The contact between the first complex and the second binding molecule is preferably carried out in a liquid system containing, for example, water, physiological saline, or the buffer solution.

[0090] In the second complex formation step, the conditions for contacting the first complex with the second binding molecule are not particularly limited as long as the conditions allow the formation of the second complex. Specific examples of the temperature for the contact include 4 to 42°C, or 18 to 40°C. The time for the contact is, for example, 1 minute to 12 hours, 3 minutes to 120 minutes, or 5 minutes to 60 minutes.

[0091] In the measurement step, after the second complex formation step, it is preferable to separate the second complex because this can improve the accuracy of the ApoE measurement, and it is more preferable to optionally further wash the separated second complex with the washing solution. The separation of the second complex can be performed, for example, in the same manner as the separation of the first complex.

[0092] The complex measurement step is, for example, a step of measuring a second complex between the first complex and the second binding molecule, i.e., a step of measuring the binding between the first complex and the second binding molecule. In the complex measurement step, the presence or absence of ApoE in the sample can be analyzed (qualitatively determined) by detecting the presence or absence of binding between the two, and the amount of ApoE in the sample can be analyzed (quantitatively determined) by detecting the degree of binding between the two (amount of binding). The method for measuring the binding between the first complex and the second binding molecule can be performed, for example, in the same manner as the method for measuring the binding between ApoE and the first binding molecule. When the second binding molecule has a label, the complex measurement step may measure the binding between the first complex and the second binding molecule by directly or indirectly detecting the label in the second complex. The method for detecting the label can be determined appropriately depending on, for example, the type of label.

[0093] In the complex measurement step, for example, a second complex between the first complex and the second binding molecule may be separated, the separated second complex is washed with the washing solution, and then the label is released from the second complex and detected, thereby measuring the binding between the first complex and the second binding molecule.

[0094] In the measurement method of the present disclosure, the first complex formation step and the second complex formation step may be carried out simultaneously. When the first and second complex formation steps are carried out simultaneously, they can be carried out in the same manner as the complex formation step.

[0095] In this way, the ApoE can be measured by the measurement method of the present disclosure.

[0096] The measurement method of the present disclosure may, for example, optionally analyze the amount of ApoE in the measurement step.In this case, in the measurement step, for example, the correlation between the amount of ApoE present and the measured value obtained by measuring ApoE can be calculated in advance, and the amount of ApoE in the sample can be analyzed from the measured value based on the correlation.Therefore, the measurement method of the present disclosure can also be called, for example, an analysis method.

[0097] Furthermore, the measurement method of the present disclosure may optionally analyze the ApoE genotype in the measurement step, for example. The analysis of the ApoE genotype can be performed, for example, according to the analysis method described in Non-Patent Document 2. Specifically, the measurement method of the present disclosure measures the amount of total ApoE and the amount of ApoE of the genotype to be analyzed (e.g., ApoE2, ApoE3, ApoE4, etc.). Then, the measurement method of the present disclosure can evaluate, for example, whether the ApoE of the genotype to be analyzed is homozygous, heterozygous, or absent, based on the proportion of ApoE of the genotype to be analyzed in the total ApoE.

[0098] According to the measurement method of the present disclosure, ApoE can be suitably measured, for example, in a sample containing the lipid, such as a biological sample such as a blood sample, etc. Therefore, the measurement method of the present disclosure can be suitably used, for example, as a method for detecting or testing ApoE in the biological sample.

[0099] <Test Method> In another aspect, the present disclosure provides a method for assessing the risk of or testing the possibility of amyloid-related imaging abnormalities occurring when a subject is administered an Alzheimer's disease-modifying drug, such as an anti-amyloid beta antibody. The testing method of the present disclosure is a method for testing the possibility of amyloid-related imaging abnormalities occurring when a subject is administered an Alzheimer's disease-modifying drug, and includes a measurement step of contacting a sample from the subject with an ApoE measurement reagent in the presence of a surfactant having a steroid skeleton and measuring ApoE in the sample. The testing method of the present disclosure can assess the risk of ARIA occurring in the subject (the subject) when the AD disease-modifying drug is administered, or test the possibility of ARIA occurring.

[0100] In the test method of the present disclosure, the description of the measurement step in the measurement method of the present disclosure can be used for the measurement step.

[0101] The AD disease modifying drugs include, for example, anti-amyloid β antibodies, and specific examples include lecanemab (Rekenvi (registered trademark)), donanemab, aducanumab, and the like.

[0102] The test method of the present disclosure may include, for example, an evaluation step of evaluating the possibility of ARIA occurring based on the analysis result of the ApoE genotype obtained in the measurement step. Specifically, in the evaluation step, for example, if the subject's ApoE genotype is ApoE4 heterozygous or homozygous, the subject can be evaluated as having a high possibility of ARIA occurring when the AD disease-modifying drug is administered. On the other hand, in the evaluation step, for example, if the subject's ApoE genotype does not have ApoE4, the subject can be evaluated as having a low possibility of ARIA occurring when the AD disease-modifying drug is administered.

[0103] The test method of the present disclosure may, for example, include an administration step of administering the AD disease-modifying drug based on the evaluation result of the evaluation step. Specifically, in the administration step, for example, the AD disease-modifying drug is administered to a subject who is unlikely to develop ARIA. When the test method of the present disclosure includes the administration step, the test method of the present disclosure can also be referred to as, for example, a companion diagnostic method for Alheimer's disease, a test and treatment method for Alheimer's disease, or a diagnostic and treatment method.

[0104] The testing method of the present disclosure may, for example, determine, based on the results of the evaluation step, whether to administer the AD disease-modifying drug, whether to increase or decrease the dosage of the AD disease-modifying drug relative to a baseline dosage of the AD disease-modifying drug, and / or a follow-up protocol for the subject after administration of the AD disease-modifying drug.

[0105] <Use> The present disclosure relates to the use of a composition of the present disclosure for use in suppressing lipid-induced inhibition of apolipoprotein E (ApoE) measurement, and to the use of a kit of the present disclosure for use in measuring ApoE in which lipid-induced inhibition of ApoE measurement has been suppressed. [Example]

[0106] The present disclosure will be described in detail below using examples, but the present disclosure is not limited to the embodiments described in the examples. Unless otherwise specified, commercially available reagents and kits were used according to the attached protocols. In the following description, "mol / l" may also be abbreviated as "M."

[0107] [Example 1] Using blood samples, we confirmed that the measured values of ApoE4 and Pan-ApoE decrease in the presence of lipids, i.e., that measurement is inhibited, and that the inhibition of measurement by lipids can be suppressed by adding CHAPS.

[0108] For each blood sample described below, preparation of a solid-phase particle solution, measurement of ApoE4, and measurement of Pan-ApoE were carried out according to the following procedures.

[0109] (1) Preparation of solid-phase particle solution Magnetic particles with immobilized mouse anti-ApoE4 antibodies that specifically bind to ApoE4 were suspended in a particle diluent (50 mM Tris buffer, 1 mM EDTA2Na, 0.1% NaN3, 2.0% BSA, pH 7.2) to obtain a solution of immobilized anti-ApoE4 antibodies. The magnetic particles with immobilized mouse anti-ApoE4 antibodies were prepared using a reagent included in Lumipulse® G ApoE4 Immunoreaction Cartridges (manufactured by Fujirebio Europe NV).

[0110] Similarly, a solution of particles containing immobilized anti-Pan-ApoE antibodies was prepared using mouse anti-Pan-ApoE antibodies. The anti-Pan-ApoE antibodies bind not only to ApoE4 but also to other alleles, ApoE2 and ApoE3. The magnetic particles containing the immobilized mouse anti-Pan-ApoE antibodies were prepared using reagents included in Lumipulse® G Pan-ApoE Immunoreaction Cartridges (Fujirebio Europe NV).

[0111] (2) ApoE4 measurement method 20 μL of sample was diluted with 180 μL of specimen diluent. 10 μL of the resulting sample diluent was dispensed into a reaction vessel containing 150 μL of anti-ApoE4 antibody solid-phase particle solution. The resulting reaction solution (solution B) was stirred and then incubated at 37°C for 10 minutes. After the incubation, a magnetic field was used to separate the bead fraction from the liquid fraction (B / F), and the bead fraction was recovered and washed with a washing solution. Next, 150 μL of an enzyme-labeled antibody solution containing alkaline phosphatase (ALP)-labeled anti-ApoE monoclonal antibody was dispensed into the reaction vessel, stirred, and then incubated at 37°C for 10 minutes. After the incubation, a magnetic field was used to separate the B / F fraction and wash the solution. Next, 200 μL of Lumipulse® substrate solution (Fujirebio) containing the chemiluminescent substrate 3-(2'-spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane disodium salt (AMPPD) was dispensed into the reaction vessel, stirred, and then incubated at 37°C for 5 minutes. After the incubation, the luminescence intensity of the resulting reaction solution was measured using a luminometer. The measurement was performed using a fully automated chemiluminescent enzyme immunoassay system (Lumipulse G1200 (Fujirebio)). The enzyme-labeled antibody solution used was the reagent contained in Lumipulse G ApoE4 Immunoreaction Cartridges. The sample diluent, washing solution, and substrate solution were prepared using Lumipulse reagent (Fujirebio) according to the manual attached to the Lumipulse G ApoE4 Immunoreaction Cartridges.

[0112] Furthermore, Lumipulse G ApoE4 Calibrators (Fujirebio Europe NV) were used to measure ApoE4 levels in each blood sample according to the attached protocol, and a calibration curve was created. The ApoE4 levels in each blood sample were calculated from the counts of each blood sample based on the calibration curve.

[0113] (3) Method for measuring Pan-ApoE 20 μL of sample was diluted with 180 μL of specimen diluent. 10 μL of the resulting sample diluent was dispensed into a reaction vessel containing 200 μL of anti-Pan-ApoE antibody solid-phase particle solution. The resulting reaction solution (solution C) was stirred and then incubated at 37°C for 10 minutes. After the incubation, the B / F separation and washing were performed using a magnetic field. Next, 150 μL of an enzyme-labeled antibody solution containing an ALP-labeled anti-ApoE monoclonal antibody was dispensed into the reaction vessel, stirred, and then incubated at 37°C for 10 minutes. After the incubation, the B / F separation and washing were performed using a magnetic field. Next, 200 μL of Lumipulse (registered trademark) substrate solution (manufactured by Fujirebio Inc.) containing the chemiluminescent substrate AMPPD was dispensed into the reaction vessel, stirred, and then incubated at 37°C for 5 minutes. After the incubation, the luminescence intensity of the resulting reaction solution was measured using a luminometer. The measurement was performed using a fully automated chemiluminescent enzyme immunoassay system. The enzyme-labeled antibody solution used was a reagent included in Lumipulse G Pan-ApoE Immunoreaction Cartridges. The sample diluent, washing solution, and substrate solution were Lumipulse Reagent (Fujirebio Inc.) according to the manual attached to the Lumipulse G Pan-ApoE Immunoreaction Cartridges.

[0114] Furthermore, Lumipulse G Pan-ApoE Calibrators (Fujirebio Europe NV) were used to measure the blood samples according to the attached protocol, and a calibration curve was created. The Pan-ApoE measurement value for each blood sample was calculated from the count value of each blood sample based on the calibration curve.

[0115] (4) Study of lipid-induced measurement inhibition and additives that can suppress measurement inhibition The present inventors have found that when some blood samples are measured using the above-mentioned measurement method, the measured values of ApoE4 and Pan-ApoE are sometimes low. After investigating the cause of this, the present inventors came up with the idea that the measured values may be lowered in blood samples containing high concentrations of lipids such as triglycerides. Therefore, in this example, they investigated whether the addition of lipids causes a decrease in the measured values of ApoE4 and Pan-ApoE, and investigated additives that can inhibit the decrease in the measured values.

[0116] High-lipid blood samples were prepared by adding 20 μl of chyle from Interference Check A Plus (Sysmex Corporation) to 180 μl of blood samples (EDTA-2K plasma) 1–3 containing ApoE4 and Pan-ApoE. Control blood samples were prepared by adding the blank sample from Interference Check A Plus in the same manner. Using each blood sample and sample dilution, ApoE4 and Pan-ApoE measurements were obtained according to the procedures for preparing the immobilized particle solution, measuring ApoE4, and measuring Pan-ApoE. Surfactants such as Tween 20, Tergitol 15-S-30, CHAPS, hexadecyltrimethylammonium chloride (C16TAC), or sodium dodecyl sulfate (SDS) were used as additives. These surfactants were added to the antibody-immobilized particle solution (Solution A) at a concentration of 1.0 w / v%. The additive control was measured in the same manner, except that the antibody-immobilized particle solution without the surfactant was used. Then, to detect the presence or absence of measurement inhibition from the obtained measurements, the ratio of the measurement value (L) of the high lipid sample to the measurement value (C) of the control (L / C × 100 (%)) was calculated. Furthermore, the coefficient of variation (CV) was calculated from the L / C of each sample to evaluate the variability in the inhibitory effect of lipids on measurement inhibition. The measurement results for ApoE4 and Pan-ApoE are shown in Table 1 and Table 2, respectively.

[0117] [Table 1]

[0118] [Table 2]

[0119] As shown in Table 1, without the addition of surfactants, lipids inhibited the measurement, resulting in a 22-45% decrease in ApoE4 measurement values. In contrast, the addition of CHAPS to the sample diluent suppressed the lipid-induced inhibition, resulting in an increase in ApoE4 measurement values, which recovered to the same level (within ±6%) as the control sample before the addition of lipids. On the other hand, the addition of other nonionic surfactants (Tween 20, Tergitol 15-S-30) or cationic surfactant (C16TAC) to the sample diluent reduced the measurement values, indicating that the degree of lipid inhibition was less than that of CHAPS. Furthermore, the addition of an anionic surfactant to the sample diluent resulted in extremely large CVs and large fluctuations in the measurement values, making it difficult to use the assay in an ApoE4 assay.

[0120] As shown in Table 2, Pan-ApoE was also inhibited by lipids in the absence of surfactants, resulting in a 22-56% decrease in Pan-ApoE measurement values. In contrast, the addition of CHAPS to the sample diluent suppressed lipid inhibition, resulting in increased measurement values, recovering to the same level (within ±8%) as the control sample values before lipid addition. On the other hand, the addition of other nonionic surfactants (Tween 20, Tergitol 15-S-30) or cationic surfactant (C16TAC) to the sample diluent resulted in significant sample recovery (34-123%), indicating that lipid inhibition could not be consistently suppressed. Furthermore, the addition of anionic surfactants to the sample diluent resulted in extremely large CVs and significant fluctuations in measurement values, making them difficult to use in Pan-ApoE assays.

[0121] From the above, it was found that the presence of lipids such as neutral lipids inhibits the measurement of ApoE4 and Pan-ApoE, and that the addition of CHAPS can suppress the inhibition of measurement by lipids.

[0122] [Example 2] Using blood samples, it was confirmed that the addition of a surfactant with a steroid skeleton could suppress the lipid-mediated inhibition of ApoE4 and Pan-ApoE measurements.

[0123] CHAPS is a surfactant with a steroid skeleton, and surfactants with a similar skeleton include bile acid surfactants such as cholic acid, deoxycholic acid, glycocholic acid, and taurodeoxycholic acid. Therefore, the ApoE4 measurement method of Example 1(2) and the Pan-ApoE measurement method of Example 1(3) were used to investigate whether lipid-mediated measurement inhibition could be suppressed, in the same manner as in Example 1, except that the bile acid surfactants were used. Each blood sample was prepared in the same manner as in Example 1. The ApoE4 measurement results are shown in Tables 3 to 7 below, and the Pan-ApoE measurement results are shown in Tables 8 to 12 below.

[0124] [Table 3]

[0125] [Table 4]

[0126] As shown in Tables 3 and 4, it was found that deoxycholic acid at any concentration (antibody-immobilized particle solution: 0.020-0.25%, reaction solution: 0.019-0.23%) was able to suppress lipid-induced interference in ApoE4 measurement compared to when no surfactant was added. Furthermore, deoxycholic acid had a sufficiently low CV at any concentration, indicating that it was able to suppress ApoE measurement inhibition regardless of the sample.

[0127] [Table 5]

[0128] [Table 6]

[0129] As shown in Tables 5 and 6, it was found that lipid-induced interference in ApoE4 measurement could be suppressed at any concentration (antibody-immobilized particle solution: 0.030-0.20%, reaction solution: 0.028-0.19%) of cholic acid, glycocholic acid, or taurocholic acid compared to the absence of surfactant. In particular, it was found that lipid-induced interference in ApoE4 measurement could be further suppressed at concentrations of 0.030-0.20%, 0.050-0.20%, and 0.050-0.20% for cholic acid, glycocholic acid, and taurocholic acid in the antibody-immobilized particle solution, respectively, or at concentrations of 0.028-0.19%, 0.047-0.19%, and 0.047-0.19% in the reaction solution. Furthermore, it was found that cholic acid, glycocholic acid, and taurocholic acid had sufficiently low CVs under all concentration conditions, and were able to suppress inhibition of ApoE measurement regardless of the sample.

[0130] [Table 7]

[0131] As shown in Table 7, it was found that cholic acid or CHAPS at any concentration (antibody-immobilized particle solution: 0.25-2.0%, reaction solution: 0.23-1.9%) could suppress lipid-induced interference in ApoE4 measurement compared to when no surfactant was added. Furthermore, cholic acid and CHAPS had sufficiently low CVs at any concentration, demonstrating that they could suppress ApoE measurement inhibition regardless of the sample.

[0132] [Table 8]

[0133] [Table 9]

[0134] As shown in Tables 8 and 9, it was found that lipid-induced interference in Pan-ApoE measurement was suppressed at all concentrations of deoxycholic acid (antibody-immobilized particle solution: 0.020-0.30%, reaction solution: 0.019-0.29%) compared to when no surfactant was added. In particular, lipid-induced interference in Pan-ApoE measurement was further suppressed at concentrations of 0.040-0.30% in the antibody-immobilized particle solution, i.e., 0.038-0.29% in the reaction solution. Furthermore, the CV of deoxycholic acid was sufficiently low at all concentrations, demonstrating its ability to suppress ApoE measurement inhibition regardless of the sample.

[0135] [Table 10]

[0136] [Table 11]

[0137] As shown in Tables 10 and 11, lipid-induced interference in Pan-ApoE measurement was found to be suppressed at any concentration (antibody-immobilized particle solution: 0.030-0.20%, reaction solution: 0.029-0.19%) of cholic acid, glycocholic acid, or taurocholic acid compared to the absence of surfactant. In particular, lipid-induced interference in Pan-ApoE measurement was found to be further suppressed at concentrations of 0.10-0.20%, 0.10-0.20%, and 0.050-0.20% for cholic acid, glycocholic acid, and taurocholic acid in the antibody-immobilized particle solution, respectively, i.e., at concentrations of 0.095-0.19%, 0.095-0.19%, and 0.048-0.19% in the reaction solution, respectively. Furthermore, it was found that cholic acid, glycocholic acid, and taurocholic acid had sufficiently low CVs under all concentration conditions, and were able to suppress inhibition of ApoE measurement regardless of the sample.

[0138] [Table 12]

[0139] As shown in Table 12, it was found that cholic acid and CHAPS at any concentration (antibody-immobilized particle solution: 0.25 to 2.0%, reaction solution: 0.24 to 1.9%) were able to suppress lipid interference in Pan-ApoE measurement compared to when no surfactant was added. Furthermore, cholic acid and CHAPS had sufficiently low CVs at any concentration, demonstrating that they were able to suppress ApoE measurement inhibition regardless of the sample.

[0140] From the above, it has been found that the use of surfactants having a steroid skeleton other than CHAPS can also suppress the measurement inhibition caused by lipids in the measurement of ApoE in general, including ApoE4.In addition, surfactants having a steroid skeleton can act favorably on lipids bound to ApoE due to the affinity between the steroid skeleton and lipids, and can dissociate the lipids from ApoE, so it is presumed that they exhibit superior ability to suppress the measurement inhibition of ApoE compared with other surfactants.However, this presumption does not limit the present disclosure in any way.

[0141] [Example 3] Using blood samples, we confirmed that the addition of multiple surfactants with a steroid skeleton could suppress lipid-mediated inhibition of ApoE4 and Pan-ApoE measurements.

[0142] Except for using a combination of bile acid surfactants such as cholic acid, deoxycholic acid, glycocholic acid, and taurodeoxycholic acid, the ability to suppress measurement inhibition by lipids was investigated using the ApoE4 measurement method of Example 1(2) and the Pan-ApoE measurement method of Example 1(3) in the same manner as in Example 1. The ApoE4 measurement results are shown in Tables 13 and 14 below, and the Pan-ApoE measurement results are shown in Tables 15 and 16 below.

[0143] [Table 13]

[0144] [Table 14]

[0145] As shown in Tables 13 and 14, any combination of deoxycholic acid with cholic acid, glycocholic acid, or taurocholic acid was found to be able to suppress lipid interference in ApoE4 measurement compared to when no surfactant was added. Furthermore, all surfactant combinations had sufficiently low CVs under all concentration conditions, demonstrating that they were able to suppress ApoE measurement inhibition regardless of the sample.

[0146] [Table 15]

[0147] [Table 16]

[0148] As shown in Tables 15 and 16, it was found that the combination of deoxycholic acid and cholic acid, deoxycholic acid and glycocholic acid, or deoxycholic acid and taurocholic acid suppressed measurement inhibition by lipids. Furthermore, all surfactant combinations had sufficiently low CVs under all concentration conditions, indicating that they could suppress ApoE measurement inhibition regardless of the sample.

[0149] From the above, it was found that by using surfactants with a steroid skeleton, such as CHAPS and bile acid surfactants, alone or in combination, it is possible to effectively suppress inhibition of Pan-ApoE and ApoE4 measurement even in hyperlipidemic blood samples (e.g., blood samples from patients with hyperlipidemia) with high levels of triglycerides and cholesterol.

[0150] Although the present disclosure has been described above with reference to the embodiments and examples, the present disclosure is not limited to the above-described embodiments and examples. Various modifications that can be understood by a person skilled in the art can be made to the configuration and details of the present disclosure within the scope of the present disclosure.

[0151] <Additional Notes> Some or all of the above embodiments and examples can be described as follows in the following supplementary notes, but are not limited thereto. <Composition for inhibiting the inhibition of ApoE measurement by lipids> (Supplementary Note 1) A composition for inhibiting the inhibition of apolipoprotein E (ApoE) measurement by lipids, comprising a surfactant having a steroid skeleton. (Supplementary Note 2) The composition according to Supplementary Note 1, wherein the surfactant is a bile acid or its derivative or their salt. (Supplementary Note 3) The composition according to Supplementary Note 1 or 2, wherein the surfactant has a steroid skeleton without a hydroxyl group at the 7-position. (Supplementary Note 4) The composition according to any one of Supplementary Notes 1 to 3, wherein the surfactant is cholic acid, deoxycholic acid, glycochenodeoxycholic acid, or taurodeoxycholic acid, or their salts. (Supplementary Note 5) The composition according to any one of Supplementary Notes 1 to 4, wherein the ApoE is ApoE4 and / or total ApoE. <Kit for use in the measurement of ApoE> (Supplementary Note 6) A kit for use in the measurement of ApoE, comprising a surfactant having a steroid skeleton and a measurement reagent for apolipoprotein E (ApoE). (Supplementary Note 7) The kit according to Supplementary Note 6, wherein the surfactant is a bile acid or its derivative or their salt. (Supplementary Note 8) The kit according to Supplementary Note 6 or 7, wherein the surfactant has a steroid skeleton without a hydroxyl group at the 7-position. (Supplementary Note 9) The kit according to Supplementary Note 7, wherein the surfactant is cholic acid, deoxycholic acid, glycochenodeoxycholic acid, or taurodeoxycholic acid, or their salts. (Supplementary Note 10) The kit according to any one of Appendices 6 to 9, wherein the ApoE measurement reagent comprises a first binding molecule for ApoE. (Appendix 11) A kit according to any one of Appendices 6 to 10, wherein the ApoE measurement reagent comprises a carrier carrying a first binding molecule for ApoE. (Appendix 12) 12. The kit of claim 11, wherein the carrier is a magnetic particle. (Appendix 13) 13. The kit according to any one of claims 10 to 12, wherein the ApoE measurement reagent has a label and contains a second binding molecule for ApoE. (Appendix 14) the label is an enzyme, 14. The kit of claim 13, comprising a substrate for the enzyme. (Appendix 15) A kit according to any one of claims 6 to 14, wherein the ApoE is ApoE4 and / or total ApoE. <Method for suppressing lipid-induced inhibition of ApoE measurement> (Appendix 16) A method for suppressing lipid-mediated inhibition of apolipoprotein E (ApoE) measurement, comprising a coexistence step of causing a target sample to coexist with a surfactant having a steroid skeleton. (Appendix 17) 17. The suppression method according to claim 16, wherein the coexistence step involves contacting the sample with a solution containing the surfactant. (Appendix 18) 18. The method for suppressing according to claim 16 or 17, wherein the surfactant is a bile acid or a derivative thereof, or a salt thereof. (Appendix 19) 19. The method for suppressing a steroid compound according to any one of claims 16 to 18, wherein the surfactant has a steroid skeleton that does not have a hydroxyl group at the 7-position. (Appendix 20) 19. The method of suppression described in Appendix 18, wherein the surfactant is cholic acid, deoxycholic acid, glycocholic acid, or taurodeoxycholic acid, or a salt thereof. (Appendix 21) The ApoE is the suppression method according to any one of Appendices 16 to 20, which is ApoE4 and / or total ApoE. (Appendix 22) The sample is the suppression method according to any one of Appendices 16 to 21, which includes a biological sample. (Appendix 23) The biological sample is the suppression method according to Appendix 22, which is a blood sample. <Method for Measuring ApoE> (Appendix 24) A method for measuring ApoE, including a measurement step of contacting a sample of a subject with a measurement reagent for ApoE in the presence of a surfactant having a steroid skeleton to measure ApoE in the sample. (Appendix 25) The measurement step is In the presence of a surfactant having a steroid skeleton, a first complex formation step of contacting the sample with a first binding molecule for ApoE to form a first complex of ApoE in the sample and the first binding molecule, and A complex measurement step of measuring ApoE in the sample by measuring the first complex, which is the measurement method according to Appendix 24. (Appendix 26) The measurement step is In the presence of a surfactant having a steroid skeleton, a first complex formation step of contacting the sample with a first binding molecule for ApoE to form a first complex of ApoE in the sample and the first binding molecule, and A second complex formation step of contacting the first complex with a second binding molecule for ApoE to form a second complex of the first complex and the second binding molecule, and A complex measurement step of measuring ApoE in the sample by measuring the second complex, which is the measurement method according to Appendix 24. (Appendix 27) The first binding molecule is supported on a carrier, which is the measurement method according to Appendix 26. (Appendix 28) The second complex has a label, In the complex measurement step, the ApoE in the sample is measured by measuring the label in the second complex, according to the measurement method described in Supplementary Note 26 or 27. (Supplementary Note 29) The measurement method according to any one of Supplementary Notes 24 to 28, including a coexistence step of bringing the sample into contact with a solution containing the surfactant prior to the measurement step. (Supplementary Note 30) The measurement method according to any one of Supplementary Notes 24 to 29, wherein the surfactant is a bile acid, its derivative, or a salt thereof. (Supplementary Note 31) The measurement method according to any one of Supplementary Notes 24 to 30, wherein the surfactant has a steroid skeleton without a hydroxyl group at the 7-position. (Supplementary Note 32) The measurement method according to Supplementary Note 30, wherein the surfactant is cholic acid, deoxycholic acid, glycocholic acid, or taurodeoxycholic acid, or a salt thereof. (Supplementary Note 33) The measurement method according to any one of Supplementary Notes 24 to 32, wherein the ApoE is ApoE4 and / or total ApoE. (Supplementary Note 34) The measurement method according to any one of Supplementary Notes 24 to 33, wherein the sample includes a biological sample. (Supplementary Note 35) The measurement method according to Supplementary Note 34, wherein the biological sample is a blood sample. <Test method for the possibility of ARIA> (Supplementary Note 36) A method for testing the possibility of amyloid-related imaging abnormalities when administering a disease-modifying drug for Alzheimer's disease (AD) to a subject, including a measurement step of measuring ApoE in the sample by bringing the sample of the subject into contact with a measurement reagent for ApoE in the presence of a surfactant having a steroid skeleton. (Supplementary Note 37) The test method according to Supplementary Note 36, including an evaluation step of evaluating the possibility of occurrence of the ARIA based on the analysis result of the genotype of the ApoE obtained in the measurement step. (Supplementary Note 38) The test method according to claim 37, further comprising an administration step of administering the AD disease modifying drug based on the evaluation result of the evaluation step. (Appendix 39) 39. The test method according to any one of Appendices 36 to 38, wherein the Alzheimer's disease modifying drug is an anti-amyloid beta antibody. (Appendix 40) The measuring step a first complex formation step of contacting the sample with a first binding molecule for ApoE in the presence of the surfactant having a steroid skeleton to form a first complex between ApoE in the sample and the first binding molecule; A test method according to any one of Appendices 36 to 39, comprising a complex measurement step of measuring ApoE in the sample by measuring the first complex. (Appendix 41) The measuring step a first complex formation step of contacting the sample with a first binding molecule for ApoE in the presence of a surfactant having a steroid skeleton to form a first complex between ApoE in the sample and the first binding molecule; a second complex formation step of contacting the first complex with a second binding molecule for ApoE to form a second complex between the first complex and the second binding molecule; A test method according to any one of Appendices 36 to 39, comprising a complex measurement step of measuring ApoE in the sample by measuring the second complex. (Appendix 42) 42. The test method of claim 41, wherein the first binding molecule is supported on a carrier. (Appendix 43) the second complex comprises a label; 43. The test method according to claim 41 or 42, wherein in the complex measurement step, ApoE in the sample is measured by measuring the label in the second complex. (Appendix 44) 44. The test method according to any one of Appendices 36 to 43, further comprising, prior to the measurement step, a coexistence step of contacting the sample with a solution containing the surfactant. (Appendix 45) 45. The test method according to any one of appendices 36 to 44, wherein the surfactant is a bile acid or a derivative thereof or a salt thereof. (Appendix 46) 46. The test method according to any one of Appendices 36 to 45, wherein the surfactant has a steroid skeleton that does not have a hydroxyl group at the 7-position. (Appendix 47) 46. The test method of claim 45, wherein the surfactant is cholic acid, deoxycholic acid, glycocholic acid, or taurodeoxycholic acid, or a salt thereof. (Appendix 48) 48. The test method according to any one of claims 36 to 47, wherein the ApoE is ApoE4 and / or total ApoE. (Appendix 49) 49. The test method of any one of claims 36 to 48, wherein the sample comprises a biological sample. (Appendix 50) 50. The test method of claim 49, wherein the biological sample is a blood sample. <Use> (Appendix 51) Use of a composition described in any one of Appendices 1 to 5 for suppressing lipid-mediated inhibition of apolipoprotein E (ApoE) measurement. (Appendix 52) Use of the kit according to any one of Appendices 6 to 15 for measuring ApoE in which the inhibitory effect of lipids on ApoE measurement has been suppressed. [Industrial Applicability]

[0152] As described above, according to the present disclosure, the inhibitory effect of lipids on ApoE measurement can be suppressed, and therefore the present disclosure is extremely useful, for example, in the field of testing.

Claims

1. A composition for use in suppressing lipid-induced inhibition of apolipoprotein E (ApoE) measurement, comprising a surfactant having a steroid skeleton.

2. The composition of claim 1 , wherein the surfactant is a bile acid or a derivative thereof or a salt thereof.

3. 3. The composition of claim 2, wherein the surfactant is cholic acid, deoxycholic acid, glycocholic acid, or taurodeoxycholic acid, or a salt thereof.

4. The composition of claim 1 or 2, wherein the ApoE is ApoE4 and / or whole ApoE.

5. a surfactant having a steroid skeleton; A kit for use in measuring apolipoprotein E (ApoE), comprising: a measuring reagent for ApoE.

6. A method for measuring ApoE, comprising a measuring step of contacting a subject sample with an ApoE measuring reagent in the presence of a surfactant having a steroid skeleton, and measuring ApoE in the sample.

7. The measuring step a first complex formation step of contacting the sample with a first binding molecule for ApoE in the presence of a surfactant having a steroid skeleton to form a first complex between ApoE in the sample and the first binding molecule; a second complex formation step of contacting the first complex with a second binding molecule for ApoE to form a second complex between the first complex and the second binding molecule; The method according to claim 6 , further comprising a complex measuring step of measuring ApoE in the sample by measuring the second complex.

8. The measurement method according to claim 7 , wherein the first binding molecule is supported on a carrier.

9. The method according to claim 6 or 7, wherein the surfactant is a bile acid or a derivative thereof, or a salt thereof.

10. The method according to claim 9, wherein the surfactant is cholic acid, deoxycholic acid, glycocholic acid, taurodeoxycholic acid, or a salt thereof.

11. The method according to claim 6 or 7, wherein the ApoE is ApoE4 and / or total ApoE.

12. The measurement method according to claim 6 or 7, wherein the sample includes a biological sample.

13. The measurement method according to claim 12 , wherein the biological sample is a blood sample.

Citation Information

Patent Citations

  • Methods of detecting alzheimer's disease

    WO1994009155A1