Method for genome editing of plant

By introducing a CRISPR/Cas system into plant meristems via particle bombardment and treating at 37°C, the method enhances genome editing efficiency, facilitating the production of genome-edited plants.

JP2025145825APending Publication Date: 2025-10-03NAT AGRI & FOOD RES ORG
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2024046273
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-22
Publication Date
2025-10-03

AI Technical Summary

Technical Problem

Existing genome editing methods for plants have varying efficiency depending on crop species and target genes, necessitating improvements for more effective genome editing.

Method used

Introduce a CRISPR/Cas system into the shoot apex of a plant meristem using particle bombardment and treat the meristem at a high temperature of 37°C for 16 to 24 hours to enhance genome editing efficiency.

Benefits of technology

Significantly improves genome editing efficiency in plants, allowing for the efficient production of genome-edited plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025145825000005
    Figure 2025145825000005
  • Figure 2025145825000006
    Figure 2025145825000006
  • Figure 2025145825000007
    Figure 2025145825000007
Patent Text Reader

Abstract

To provide a method for genome editing of a plant with improved genome editing efficiency.SOLUTION: A method for genome editing of a plant, comprising: (1) introducing a CRISPR / Cas system into a meristematic tissue of a bud having shoot-forming ability of the plant by a particle bombardment method; and (2) culturing the meristematic tissue having the CRISPR / Cas system introduced in step (1) under a high temperature condition.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a genome editing method for plants, and more specifically to a genome editing method for introducing a CRISPR / Cas system into a meristem of a bud that has the ability to form a shoot, such as a shoot apex, by particle bombardment. [Background technology]

[0002] Genome editing technology is advancing worldwide, accelerating the development of genome-edited crops. In this context, the present inventors have developed a crop genome editing technology called the "implant particle bombardment (iPB) method" (Patent Document 1). The iPB method is a genome editing technique that directly introduces a genome editing enzyme into the meristem, such as the shoot apex, of a plant. In principle, it does not require cultivation and can be applied to a variety of crops. However, genome editing efficiency varies depending on the crop species and the target gene. Therefore, further improvements in this efficiency are desired. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Japanese Patent Application Laid-Open No. 2017-205104 [Non-patent literature]

[0004] [Non-Patent Document 1] Soumen Nandy et al., Plant Direct., 2019 May 29;3(5):e00145 [Non-patent document 2] Wayne Xu et al., ACS Agricultural Science & Technology, April 18, 2022, Volume 2, Issue 2, Pages 222-231 [Non-patent document 3] Matthew J Milner et al., Front Plant Sci., 2020 Nov 26, 11:583374 [Non-patent document 4] Jonas Blomme et al., BMC Plant Biol., 2022 March 24, 22(1):142 [Non-patent document 5] Greta Bigelyte et al., Nature Communications, October 26, 2021, 12(1):6191 [Non-patent document 6] Mitsuko Kishi-Kaboshi et al., Plant Biotechnology, 2023, Vol. 40, No. 3, pp. 237-245 [Non-Patent Document 7] Yingxiao Zhang et al., Front Genome Ed., 2022 Jan 31, 4:780238 Summary of the Invention [Problem to be solved by the invention]

[0005] The present invention has been made in consideration of the problems associated with the prior art, and aims to provide a plant genome editing method with higher genome editing efficiency. [Means for solving the problem]

[0006] As a result of extensive research to achieve the above-mentioned objective, the inventors discovered that genome editing efficiency can be significantly improved by directly introducing a complex of gRNA and Cas9 protein (RNP) into cells at the shoot apex of a plant using the iPB method, and then treating the shoot apex at a high temperature of 37°C, thereby completing the present invention.

[0007] That is, the present invention provides the following aspects.

[0008] [1] A method for genome editing of a plant, comprising the following steps (1) and (2): (1) A step of introducing a CRISPR / Cas system into a shoot meristem of a plant by particle bombardment; (2) A process of culturing the meristem into which the CRISPR / Cas system was introduced in step (1) at high temperature.

[0009] [2] The method according to [1], wherein the high temperature is 30 to 45°C.

[0010] [3] The method according to [1], wherein the high temperature is 37°C.

[0011] [4] The method according to any one of [1] to [3], wherein the incubation time at high temperature in step (2) is 1 to 30 hours.

[0012] [5] The method according to any one of [1] to [3], wherein the incubation time at high temperature in step (2) is 16 to 24 hours.

[0013] [6] The method according to any one of [1] to [5], further comprising the step of culturing the meristem at high temperature before step (1).

[0014] [7] The method according to any one of [1] to [6], wherein the Cas protein constituting the CRISPR / Cas system is a Cas9 protein or a Cas12 protein.

[0015] [8] The method according to any one of [1] to [7], wherein the meristem is a shoot apex.

[0016] [9] The method according to [8], wherein in step (1), the CRISPR / Cas system is introduced into L2 cells or shoot apical stem cells of the shoot apex.

[0017]

[10] A method for producing a genome-edited plant, comprising: The method according to any one of [1] to [9], further comprising the step of growing the meristem cultured at high temperature to obtain a plant body.

[0018] There have been reports that genome editing efficiency was improved by treating plant protoplasts, etc., after the introduction of the CRISPR / Cas system at high temperature (Non-Patent Documents 1 to 7). However, the present inventors were the first to demonstrate that genome editing efficiency was improved by treating the meristem of a shoot, into which the system was introduced by particle bombardment, at high temperature. [Effects of the Invention]

[0019] According to the present invention, it is possible to more efficiently edit the genome of a plant, and also to efficiently produce a genome-edited plant. [Brief explanation of the drawings]

[0020] [Figure 1] This is an electrophoresis photograph showing the results of analyzing genome editing in the SD1 gene in the resulting plant body, which was introduced with the CRISPR / Cas9 system targeting the gene using the CAPS method (restriction enzyme: SalI). [Figure 2] This is an electrophoresis photograph showing the results of analyzing genome editing in the AHG1 gene in the resulting plant body, which was introduced with the CRISPR / Cas9 system targeting the AHG1 gene using the iPB method, using the CAPS method (restriction enzyme: MboI). [Figure 3] This graph shows the genome editing efficiency in plants obtained by introducing a CRISPR / Cas9 system targeting the SD1 gene using the iPB method. The genome editing efficiency represents the ratio of the number of genome-edited individuals obtained by growing the same shoot apices to the number of seed shoot apices treated using the iPB method. The number of tests and the number of analyzed samples for each condition are as follows: Condition "1": 5 tests, 150 analyzed samples; Condition "2": 4 tests, 140 analyzed samples; Condition "3": 4 tests, 139 analyzed samples; and Condition "4": 4 tests, 136 analyzed samples. The genome editing efficiency in the figure is shown as the average value ± standard deviation. [Figure 4]This graph shows the genome editing efficiency in plants obtained by introducing the CRISPR / Cas9 system targeting the AHG1 gene using the iPB method. The genome editing efficiency is the same as in Figure 3. The number of tests and the number of analyzed samples for each condition are as follows: 18 tests and 600 samples under the condition "22°C"; 15 tests and 537 samples under the condition "37°C." DETAILED DESCRIPTION OF THE INVENTION

[0021] The present invention relates to a method for genome editing of plants, which comprises the following steps (1) and (2), and is particularly characterized by step (2), as shown in the examples below. (1) A step of introducing a CRISPR / Cas system into a shoot meristem of a plant by particle bombardment; (2) A process of culturing the meristem into which the CRISPR / Cas system was introduced in step (1) at high temperature.

[0022] <Plant> The genome editing method of the present invention can be widely applied to seed-bearing plants, rhizome-bearing plants, and plants that can be cultivated by shoot apex. Therefore, the target plants of the present invention are seed plants, including angiosperms and gymnosperms. Angiosperms include monocotyledonous and dicotyledonous plants.

[0023] "Monocotyledonous plants" may be of any type, but examples include grasses, lilies, Musaceae, Bromeliaceae, and orchids. "Gramineous plants" include rice, wheat, barley, corn, oats, turfgrass, sorghum, rye, foxtail millet, and sugarcane. "Liliaceous plants" include leeks and asparagus. "Musaceae plants" include bananas. "Bromeliaceae plants" include pineapples. "Orchidaceae plants" include orchids.

[0024] Examples of "dicotyledonous plants" include Brassicaceae, Leguminosae, Solanaceae, Cucurbitaceae, Convolvulaceae, Rosaceae, Moraceae, Malvaceae, Asteraceae, Amaranthaceae, and Polygonaceae. Examples of "Brassicaceae plants" include Arabidopsis thaliana, Chinese cabbage, rapeseed, cabbage, cauliflower, and Japanese radish. Examples of "Legumes" include soybean, adzuki bean, kidney bean, pea, cowpea, and alfalfa. Examples of "Solanaceae plants" include tomato, eggplant, potato, tobacco, and chili pepper. Examples of "Cucurbitaceae plants" include Japanese cantaloupe, cucumber, melon, and watermelon. Examples of "Convolvulaceae plants" include morning glory, sweet potato (sweet potato), and bindweed. Examples of "Rosaceae plants" include rose, strawberry, and apple. "Mulberry family plants" include mulberry, fig, rubber tree, etc. "Mallow family plants" include cotton, kenaf, etc. "Asteraceae family plants" include lettuce, etc. "Amaranthaceae family plants" include sugar beet, etc. "Polygonaceae family plants" include buckwheat, etc.

[0025] "Gymnosperms" include pine, cedar, ginkgo, cycad and the like.

[0026] <Bud meristem with shoot formation ability> In the present invention, "shoot formation ability" refers to the ability to elongate and develop leaves and stems. Examples of bud meristems with such ability include the shoot apex. The term "shoot apex" refers to the growing point at the tip of the stem (shoot apical meristem), as well as tissue consisting of the growing point and several leaf primordia arising from the growing point. In the present invention, only the hemispherical (dome-shaped) growing point from which the leaf primordia have been removed may be used as the shoot apex. Alternatively, a shoot apex containing the growing point and leaf primordia, or plant tissue containing the shoot apex, may also be used. Using only the growing point from which the leaf primordia have been removed, virus-free tissue can be obtained. Furthermore, in this specification, "germlineage" refers to a collective term for germ cells, from primordial germ cells, which are the source of germ cells, to the final products, egg cells and sperm cells. The "L2 layer" refers to the second outer cell layer of the shoot apical meristem, where undifferentiated cells (also called germline cells) that will differentiate into germ cells in the future reside. In the present invention, shoot apical stem cells that transition to the germline or cells present in the L2 layer (L2 cells) can be suitable targets for introducing the CRISPR / Cas system.

[0027] In the present invention, the material from which the shoot apex is obtained may be a seed, a rhizome, or a terminal bud.

[0028] In the present invention, "seeds" include natural seeds obtained by cultivating (or culturing) plants under natural or near-natural conditions. "Natural seeds" are not limited to seeds obtained in outdoor fields, but also include seeds obtained by greenhouse cultivation and seeds obtained from tissue cultures such as in vitro seedlings. Seeds obtained by tissue culture (direct reprogramming, etc.) can also be used as seeds of the present invention, as long as shoot tips can be obtained from them. Furthermore, in the present invention, artificial seeds are also included. Examples of such "artificial seeds" include those in which regenerable plant parts (cultures such as adventitious buds and somatic embryos) are encapsulated in an artificial membrane. Artificial seeds from which transformable shoot tips can be obtained are particularly useful in the present invention. Furthermore, in the present invention, shoot tips can be obtained from seed embryos, which may be immature or mature, but are preferably mature. In other words, mature seeds are more preferably used in the present invention. "Fully ripe seeds" means seeds that have completed the ripening process after pollination and are fully ripe as seeds. In the present invention, fully ripe seeds whose root length is 1 mm or less are more preferred.

[0029] In the present invention, "rhizome" is a general term for underground stems, including tubers that are lumpy and have many buds, corms that are spherical and have large terminal buds, and bulbs that are shortened stems with enlarged scale leaves and have a spherical shape. In the present invention, shoot tips can be obtained from the young shoots of such rhizomes. In addition, in the present invention, "terminal bud" refers to the bud at the tip of a stem. Furthermore, in the present invention, meristems capable of shoot formation can be obtained not only from the above-mentioned seeds, rhizomes, and terminal buds, but also from axillary buds (lateral buds), adventitious buds, etc.

[0030] In the present invention, the method for obtaining a meristem capable of shoot formation from such material (bud) is not particularly limited. For example, first, fully mature plant seeds are imbibed with water. If necessary, vernalization treatment may be performed before imbibition. Imbibition is performed by soaking the seeds in water and incubating them. The imbibition temperature is preferably 15 to 25°C for wheat, barley, or rice, and 25 to 35°C for corn or soybean. During this process, the water may be exchanged one or more times. For wheat, the imbibition period is preferably until the radicle begins to elongate or until new leaf primordia are formed. The imbibition time, depending on the seed dormancy state, is less than 16 hours after imbibition, preferably 12 hours. This imbibition process softens the seeds, making it easier to expose the shoot apex. Next, the shoot apex of the embryo in the seeds imbibed with water is exposed. In the case of wheat, barley, rice, or corn, the shoot apex is exposed by removing the coleoptiles and leaf primordia. In the case of soybean, the shoot apex is exposed by removing the seed coat and cotyledons. In the case of potato, which is a plant with an underground stem, the shoot apex is exposed by sprouting from the seed potato and removing the leaf primordia from the excised shoot. In the case of apple, the shoot apex is exposed by removing the leaf primordia from the seed embryo or the excised apical or lateral bud. Any means for exposing the shoot apex can be used as long as it can remove the coleoptiles and leaf primordia or the seed coat and cotyledons under a stereomicroscope. Examples of such means include a drilling tool such as a needle with a diameter of approximately 0.2 mm, tweezers, a pipette, a syringe, and a cutting tool such as a scalpel or cutter. Next, the endosperm and excess scutellum are removed using a cutting tool such as a scalpel, and the embryo and scutellum containing the exposed shoot apex are placed on an agar medium or on top of it, with the shoot apex facing upward. To obtain virus-free shoot tips, the scalpel may be replaced with a new sterile scalpel at the final stage of cutting the shoot tips, which will result in virus-free plants.

[0031] <CRISPR / Casシステム> In the present invention, the particle bombardment method is used to introduce the CRISPR / Cas system into the meristem of a plant's bud that has the ability to form shoots, and genome editing is introduced into the cells of the meristem (note that the meristem of a bud that has the ability to form shoots will also be referred to simply as the "meristem" hereinafter).

[0032] "Genome editing," part of a technology known as New Breeding Techniques (NBT), uses site-specific nucleases to cleave specific genes (target genes) in the genome and modify them. More specifically, it includes disrupting a gene by cleaving the target gene and introducing mutations using a CRISPR / Cas system or similar, or inserting or replacing a DNA fragment site-specifically. Furthermore, genome editing efficiently inserts or replaces a site-specific DNA fragment by linking fragments homologous to the sequences on both sides of the cleavage sequence to both sides of the DNA fragment to be introduced at that site. Note that in the case of gene disruption, since only the targeted gene can be disrupted without leaving any trace of genetic recombination, some countries do not classify the plant as a genetically modified plant.

[0033] The CRISPR / Cas system uses a Cas protein, a nuclease (RGN; RNA-guided nuclease), and a guide RNA. By introducing this system into cells, the guide RNA binds to the target site, and the Cas protein is guided to the binding site, allowing it to cleave DNA.

[0034] (Cas protein) In the present invention, the "Cas protein" refers to a CRISPER (clustered regularly interspaced short palindromic repeat, CRISPER)-associated enzyme (nuclease), which may be a class 1 CRISPER-associated enzyme (e.g., type I such as Cas3, type IV, or type III such as Cas10) or a class 2 CRISPER-associated enzyme (e.g., type II such as Cas9, type V such as Cas12 (Cas12a (Cpf1), Cas12b (C2c1), Cas12e (CasX), and Cas12f1), and Cas14, or type VI such as Cas13), but is preferably a class 2 CRISPER-associated enzyme, more preferably a type II CRISPER-associated enzyme or a type V CRISPER-associated enzyme, even more preferably Cas9 or Cas12, and particularly preferably Cas9. Furthermore, examples of "Cas9 proteins" include Streptococcus pyogenes (S. pyogenes) Cas9, Streptococcus pneumoniae (S. pneumoniae) Cas9, and S. thermophilus Cas9.

[0035] Typical amino acid and nucleotide sequences of Cas proteins are registered in public databases, such as GenBank (http: / / www.ncbi.nlm.nih.gov), and can be used in the present invention. For example, typical amino acid and nucleotide sequences of the Cas9 protein derived from Streptococcus pyogenes are listed in NCBI Reference Sequences NP_269215 and NC_002737, respectively.

[0036] Furthermore, the Cas9 protein of the present invention is not limited to proteins consisting of the aforementioned typical amino acid sequences, but may also be a homolog, ortholog, mutant, or partial peptide thereof, as long as it has the activity of forming a complex with a guide RNA and cleaving a target DNA. Examples of "homolog" and "ortholog" include proteins consisting of an amino acid sequence that shares 85% or more, preferably 90% or more, and more preferably 95% or more (e.g., 96% or more, 97% or more, 98% or more, or 99% or more) identity with the amino acid sequence of the target Cas protein (e.g., the amino acid sequence described in NP_269215). Sequence identity can be evaluated using a numerical value calculated using BLAST or similar tools (e.g., default or initial setting parameters). Examples of "mutants" include proteins with endonuclease activity that have an amino acid sequence in which one or more amino acids have been substituted, deleted, added, or inserted relative to the amino acid sequence of a native Cas9 protein (e.g., the amino acid sequence described in NP_269215). Here, "multiple" refers to, for example, 2 to 150, preferably 2 to 100, and more preferably 2 to 50 (e.g., 2 to 30, 2 to 10, 2 to 5, 2 to 3, or 2). Examples of mutants include Cas proteins whose PAM recognition specificity has been altered by introducing mutations into specific amino acid residues. Techniques for altering the PAM recognition specificity of Cas proteins are known (Benjamin, P. et al., Nature 523, 481-485 (2015); Hirano, S. et al., Molecular Cell 61, 886-894 (2016)). Alternatively, the D10A mutant of Cas9, known to function as a nickase (a DNA cleavage enzyme that nicks only one DNA strand), may also be used.

[0037] A nuclear localization signal may be added to the Cas protein of the present invention. This promotes its localization to the nucleus within the cell, resulting in efficient genome editing within the nucleus. Furthermore, adding an organelle localization signal also enables efficient genome editing within organelles (intracellular organelles such as chloroplasts and mitochondria).

[0038] Those skilled in the art can express the Cas proteins of the present invention as recombinant proteins by inserting DNA encoding the Cas proteins into an appropriate vector and introducing the vector into host cells such as E. coli, animal cells, insect cells, or plant cells, or into a cell-free protein synthesis system (e.g., reticulocyte extract or wheat germ extract). Furthermore, recombinant proteins expressed in host cells can be purified by known peptide purification methods. Alternatively, the Cas proteins of the present invention can be prepared by chemical synthesis using a commercially available polypeptide synthesizer based on their amino acid sequences.

[0039] (guide RNA) The Cas protein forms a complex with the guide RNA, which guides it to the target region of the target gene, where it cleaves the target site in the target region using its endonuclease activity, resulting in genome editing. The "guide RNA" of the present invention is an RNA that contains a nucleotide sequence that interacts with the Cas protein (hereinafter also referred to as the "Cas-interacting sequence") and a nucleotide sequence complementary to the nucleotide sequence in the target region (hereinafter also referred to as the "targeting sequence").

[0040] The guide RNA of the CRISPR-Cas system of the present invention may be a single guide RNA (sgRNA) comprising a crRNA and a tracrRNA, or a two-molecule guide RNA consisting of a crRNA fragment and a tracrRNA fragment.

[0041] The targeting sequence in the crRNA is typically a nucleotide sequence consisting of 12 to 50 nucleotides, preferably 17 to 30 nucleotides, and more preferably 17 to 25 nucleotides, and is selected to target a region adjacent to the PAM (proto-spacer adjacent motif) sequence. The crRNA also contains a nucleotide sequence on the 3' side that can interact (hybridize) with the tracrRNA. Meanwhile, the tracrRNA contains a nucleotide sequence on the 5' side that can interact (hybridize) with a nucleotide sequence in the crRNA. The double-stranded RNA formed by the interaction of these nucleotide sequences interacts with the Cas protein.

[0042] The "target gene" in which genome editing is induced by the guide RNA is not particularly limited and may be any gene (DNA encoding any protein, etc.), such as a sugar metabolism-related gene, a lipid metabolism-related gene, a gene related to the production of useful substances (medicines, enzymes, pigments, aroma compounds, etc.), a gene related to plant growth regulation (promotion / inhibition), a flowering regulation-related gene, a gene related to disease and pest resistance (resistance to insect feeding, resistance to nematodes, mold (fungi), and bacterial diseases, resistance to viruses (diseases), etc.), a gene related to environmental stress (low temperature, high temperature, dryness, salt, light damage, ultraviolet light), a transporter-related gene, a gene related to flour milling characteristics, bread-making characteristics, or noodle-making characteristics, or a recombinase-related gene. Furthermore, the number of target genes or target regions targeted by genome editing in the present invention is typically one, but may be multiple. That is, in the present invention, multiple types of guide RNAs may be introduced into a meristem.

[0043] Those skilled in the art can prepare guide RNAs of the present invention by chemical synthesis using a commercially available polynucleotide synthesizer based on the nucleotide sequence, or by using an in vitro transcription system (e.g., a transcription system using phage RNA polymerase (T7 / T3 / SP6)).

[0044] In the present invention, the CRISPR / Cas system is preferably introduced into the meristem in the form of a complex (RNP) of a Cas protein and a guide RNA, as shown in the Examples below. However, the Cas protein may be introduced into the meristem in its protein form, or in the form of nucleotides (DNA, RNA) encoding the Cas protein, and the protein may be expressed in the cells. The guide RNA may also be introduced into the meristem in its RNA form, or in the form of DNA encoding the guide RNA, and the RNA may be expressed in the cells. In such cases, the Cas protein and guide RNA form a complex in the cells of the meristem into which they have been introduced, resulting in genome editing.

[0045] A more specific form of the nucleotides encoding the Cas protein and the DNA encoding the guide RNA is usually an expression vector encoding the Cas protein and / or the guide RNA. When an expression vector is used, it contains one or more regulatory elements operably linked to the target DNA to be expressed (DNA encoding the Cas protein and / or the guide RNA). Here, "operably linked" means that the target DNA is linked to the regulatory element in an expressible manner. Examples of "regulatory elements" include promoters, enhancers, insulators, and terminators.

[0046] A "promoter" does not have to be derived from a plant, as long as it functions in a plant or plant cells and is constitutively expressed or capable of inducing expression in specific plant tissues or at specific developmental stages. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2-35S omega promoter, the nopaline synthase gene promoter (Pnos), the maize ubiquitin promoter, the rice actin promoter, the tobacco PR protein promoter, the ADH promoter, and the RuBisco promoter. Translation efficiency can be increased by using a sequence that enhances translation activity, such as the tobacco mosaic virus omega sequence. Protein translation from multiple coding regions can also be achieved by inserting an internal ribosome entry site (IRES) as a translation initiation region 3' downstream of the promoter and 5' upstream of the translation initiation codon. Furthermore, pol III promoters such as the U6 promoter are suitable for expressing DNA encoding short RNAs such as guide RNAs. In addition, by using organelle-specific promoters (promoters that are expressed only in each organelle), efficient genome editing within each organelle is also possible.

[0047] A "terminator" may be any sequence that can terminate transcription of a gene transcribed by the promoter and has a polyA addition signal, and examples include the nopaline synthase (NOS) gene terminator, the octopine synthase (OCS) gene terminator, and the CaMV35S terminator.

[0048] The expression vector of the present invention may also contain other sequences. Examples of such other sequences include "marker genes" for confirming whether or not the vector has been introduced into plant cells. Examples include fluorescent protein genes, luciferase genes, chromogenic enzyme genes, drug resistance genes, plant hormone biosynthesis genes, replication promoter genes, and cell death suppressor genes. Specific examples of fluorescent protein genes include red fluorescent protein genes such as the DsRed gene and the RFP gene, the GFP (green fluorescent protein) gene, the YFP (yellow fluorescent protein) gene, and the aequorin gene. Specific examples of luciferase genes include the luciferase gene. Specific examples of chromogenic enzyme genes include the β-glucuronidase (GUS) gene, the β-galactosidase gene, the alkaline phosphatase gene, and the SEAP gene. Specific examples of drug resistance genes include the kanamycin resistance (NPTII) gene, the hygromycin resistance (HPT) gene, the tetracycline resistance gene, the ampicillin resistance gene, the spectinomycin resistance gene, the chloramphenicol resistance gene, the neomycin resistance gene, the methotrexate resistance gene (dihydrofolate reductase gene), and herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS)), and sulfonylurea resistance gene (mutant ALS gene (acetobutyrate synthase gene)). Specific examples of plant hormone biosynthesis genes include the ipt gene, the iaaM gene, the iaaH gene, and the rol (ro1A, rolB, rolC) genes. Specific examples of genes that promote somatic embryo formation include the WSU gene, the BBM gene, the AGL15 gene, and the Lec1 gene. Specific examples of replication promoter genes include the APS gene and the ct-ars1 gene. Specific examples of cell death-suppressing genes include the ACCd gene, the Bax-I gene, the NaGH gene, etc. However, according to the present invention, it is possible to produce a genome-edited plant without introducing such a marker gene.

[0049] The expression vector of the present invention is not particularly limited as long as it can express the sequence placed in it in plant cells into which it is introduced. For example, it can take the form of various vectors such as pAL series (pAL51, pAL156, etc.), pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), and tobacco mosaic virus (TMV). However, it is preferable that the expression vector be one that can stably express the encoded Cas protein and / or guide RNA without being integrated into the host genome.

[0050] In the present invention, when such an expression vector is used to introduce a Cas protein and / or a guide RNA into a meristem, the expression vector encoding the Cas protein and the expression vector encoding the guide RNA may be separate and independent, or may be a single expression vector (for example, they may take the form of an all-in-one vector).

[0051] Those skilled in the art can prepare expression vectors of the present invention using known techniques. For example, purified target DNA can be digested with appropriate restriction enzymes and ligated into a multicloning site of a suitable backbone vector. Alternatively, target DNA can be inserted into an intermediate vector by double crossover recombination. Expression vectors of the present invention can also be prepared using techniques such as the LR method, in-fusion cloning, and TA cloning. Furthermore, the nucleotide sequences placed in the expression vectors of the present invention may be optimized to use codons appropriate for the plant cells into which they are introduced, in order to efficiently express their translation products in those cells.

[0052] <Particle bombardment method> The "particle bombardment method" according to the present invention is also called the particle gun method, gene gun method, microparticle gun method, microparticle injection method, or particle delivery method, and refers to a method in which microparticles (microcarriers) coated with the CRISPR / Cas system (hereinafter also simply referred to as "the system") are injected at high speed and introduced into cells of the meristem of a bud that has the ability to form a shoot of a target plant.

[0053] The material of the "microparticles" coated by the system is not particularly limited, and for example, microparticles (metal microparticles) made of metals such as gold, tungsten, or magnetic particles (triiron tetroxide, etc.) are used. Among these, gold particles are preferred. The particle size (diameter) of such microparticles is not particularly limited, but is, for example, 0.3 μm or more and 1.5 μm or less, with the lower limit of the particle size being more preferably 0.4 μm or more, even more preferably 0.5 μm or more, and particularly preferably 0.6 μm. The upper limit of the particle size is more preferably 1.4 μm or less, even more preferably 1.3 μm or less, even more preferably 1.2 μm or less, particularly preferably 1.1 μm or less, and most preferably 1.0 μm or less.

[0054] Microparticles coated with the system are typically prepared by washing and sterilizing microparticles, adding the microparticles and the system while stirring to coat the microparticles with the system, and then washing with ethanol or phosphate-buffered saline (PBS, etc.). During stirring, adding a positively charged substance (e.g., polyamines such as spermidine) to dissolve the three-dimensional structure of the expression vector, or a substance (e.g., a salt such as calcium chloride) that promotes adhesion of the introduced substance to the microparticles or precipitation of the microparticles can enhance coating efficiency.

[0055] The microparticles coated with the system are applied as uniformly as possible to a macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench. When using protein-coated microparticles as the system, a hydrophilic macrocarrier film is preferably used. The "hydrophilic macrocarrier film" may be formed by attaching a hydrophilic film to the macrocarrier film or by applying a hydrophilic coating. Methods for hydrophilizing the film include those using surfactants, photocatalysts, and hydrophilic polymers. Examples of hydrophilic polymers used in the above methods include polymers of hydrophilic monomers such as polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethaneammonium.

[0056] The macrocarrier film and the plate with the meristem placed on it are then placed in a particle gun device, and high-pressure gas is fired from the gas acceleration tube toward the macrocarrier film. The macrocarrier film is stopped by a stopping plate, but the particles pass through the stopping plate and penetrate into the meristem placed below the stopping plate, introducing the system.

[0057] The "gas" emitted at high pressure is preferably an inert gas, such as helium gas. The gas pressure is preferably 1,100 to 1,600 psi, more preferably 1,200 to 1,500 psi. The optimal gas pressure can be determined appropriately through transient expression experiments, etc., depending on the type of system, the distance to the target meristem, etc.

[0058] The distance between the stopping plate and the target meristem depends on the particle size of the microparticles, but is preferably 9 cm or less, more preferably 8 cm or less, even more preferably 7 cm or less, and particularly preferably 6 cm or less, and the lower limit of the distance is preferably 2 cm or more, more preferably 3 cm or more, and even more preferably 4 cm or more. The optimal value of the target distance can be determined appropriately by transient expression experiments, etc., depending on the type of microparticle, particle size, gas pressure, etc.

[0059] In the present invention, the number of times that microparticles are bombarded into the meristem is preferably 2 or more, more preferably 3 or more, and even more preferably 4 or more. The upper limit of the number of times that microparticles are bombarded into the meristem is preferably 20 or less, more preferably 15 or less, and even more preferably 10 or less. The optimal number of bombardments can be determined appropriately by transient expression experiments, etc.

[0060] <High-temperature treatment> As shown in the examples below, the present invention makes it possible to improve genome editing efficiency by culturing the meristem of a bud with shoot formation ability that has been subjected to the above-mentioned particle bombardment method at high temperatures.

[0061] In the present invention, "high temperature" refers to a temperature higher than the normal meristem culture temperature (22-25°C). This temperature can be adjusted appropriately depending on the type of plant or its meristem, the type of target gene, and other factors. For example, it can be 30-45°C, preferably 32-42°C, more preferably 34-40°C, even more preferably 36-38°C, and particularly preferably 37°C. In the present invention, "culture" at high temperature includes not only culture involving proliferation of meristem cells and / or meristem growth, but also culture for maintaining the properties or survival of meristems (maintenance culture). Such culture can be performed, for example, by placing meristems in a plant tissue culture medium. The "plant tissue culture medium" is not particularly limited as long as it can culture the target plant tissue. Examples include Murashige-Skoog (MS) medium, Gamborg B5 medium, Chew (N6) medium, and modified versions of these basal media. The medium may be a liquid medium or a solid medium (a medium solidified with agar, gellan gum, gellan lite, or the like). The time for culturing at high temperature is not particularly limited as long as it is possible to improve genome editing efficiency, but is, for example, 1 to 30 hours, preferably 6 to 28 hours, more preferably 12 to 26 hours, and even more preferably 16 to 24 hours.

[0062] In the present invention, such high-temperature culture may be carried out at least after particle bombardment, but may also be carried out before particle bombardment. In this case, the high-temperature culture conditions (temperature, culture time, medium, etc.) may be the same before and after particle bombardment, or may be appropriately different.

[0063] <Method for producing genome-edited plants> In the present invention, a genome-edited plant (plant body) can be produced by growing a meristem into which the CRISPR / Cas system has been introduced by the above-mentioned method.

[0064] The "growth" method is not particularly limited as long as it can produce a plant, and a person skilled in the art can appropriately adopt a known method depending on the type of plant or meristem of interest. For example, as described above, the meristem cultured at high temperature can be cultured on a solid medium for several weeks (e.g., 2 weeks to 1 month) and then transplanted into soil to grow into a plant.

[0065] Genome-edited plants can also be obtained by growing them in a medium without the application of selective pressure from drugs (e.g., antibiotics). However, if a drug resistance gene is used as the marker gene, cells of the meristem into which the CRISPR / Cas system has been introduced can be selectively cultured by culturing them in a medium containing a drug corresponding to the gene. When performing selection using drugs, as described above, the marker gene can be carried in an expression vector encoding a Cas protein and / or guide RNA, and the marker gene can be introduced into cells of the meristem simultaneously with the CRISPR / Cas system. Alternatively, drug selection can be performed by separately preparing an expression vector encoding a marker gene, mixing it with an expression vector encoding a Cas protein and / or guide RNA, the Cas protein and / or guide RNA, and introducing the mixture into cells of the meristem. Note that sulfonylurea herbicides (e.g., chlorosulfuron) are known as selective drugs suitable for culturing meristems.

[0066] Furthermore, when nucleotides such as expression vectors are introduced, they may be incorporated into the genome of cells in the meristem. Furthermore, genome editing can also result in nonspecific mutations due to off-target effects. Such mutations introduced into genomic DNA other than the target gene can be removed by self-pollination or backcrossing to obtain progeny.

[0067] Furthermore, those skilled in the art can select plants in which the target gene has been genome-edited using known techniques. Examples of such known methods include DNA sequencing (next-generation sequencing, etc.), PCR (RT-PCR), CAPS, microarray analysis, Southern blotting, and Northern blotting. Using such nucleotide detection methods, it is possible to determine whether a mutation has been introduced by genome editing by comparing the sequence or length of the target gene or its transcription product before and after the mutation, enabling the selection of plants in which the target gene has been genome-edited based on this determination. In addition to such nucleotide detection methods, selection can also be performed by comparing the presence or size of a protein expressed from the target gene before and after the mutation. Examples of such protein detection methods include immunostaining of plant sections, ELISA, RIA, dot immunoblotting assay, and Western blotting. Furthermore, genome editing efficiency can be calculated, for example, from the number of meristems subjected to the method of the present invention and the number of plants determined to have been genome-edited by the method. In the present invention, "high genome editing efficiency" means, for example, that the genome editing efficiency is higher than that when the meristem is cultured at a normal culture temperature (22 to 25°C) after the introduction of the CRISPR / Cas system.

[0068] The above-described techniques can be used to produce plants in which the target gene has been genome-edited. The current generation (E0 generation) initially grown from meristems such as the shoot apex will be in a chimeric state, consisting of a mixture of genome-edited and wild-type cells. However, this chimeric state can be resolved by selecting with the aforementioned drugs, obtaining progeny through backcrossing, or by branch mutation. The resulting plants will stably express the traits of the genome-edited gene, or suppress the expression of the target gene, and will be inherited (transmitted) normally to progeny. In other words, once a plant consisting solely of genome-edited somatic cells (an individual in which the chimeric state has been resolved) is obtained, it is possible to obtain progeny from the plant through sexual or asexual reproduction. Furthermore, it is also possible to obtain propagation materials (e.g., seeds, fruits, cuttings, stumps, callus, protoplasts, etc.) from the plant, its progeny, or clones, and then mass-produce the plant from these materials.

[0069] Furthermore, the method of the present invention described above corresponds to an in planta genome editing method. The in planta genome editing method is generally a genome editing method that does not involve tissue culture manipulation, and is a method in which cells at the meristem site are genome-edited while the plant is still growing. The method of the present invention may also be embodied in a manner that includes only a tissue culture step of obtaining a plant body through the cultivation of meristems of buds capable of shoot formation, but does not include other tissue culture steps.

[0070] Furthermore, as described above, in the present invention, even if genome editing is performed using an expression vector, it is not necessarily necessary to integrate it into the genome to obtain a stable transformant. Genome editing can be performed by transiently expressing a Cas protein and / or a guide RNA. Genome editing can also be performed by introducing a Cas protein and a guide RNA into a cell. Therefore, genome-edited plants produced by the method of the present invention may not be genetically modified. [Example]

[0071] The present invention will be described in more detail below based on examples, but the present invention is not limited to the following examples.

[0072] (Wheat iPB method) 1. Preparation of Ripe Seeds Mature seeds of the wheat cultivar Yukihomare were immersed in bleach and shaken at room temperature for 15 minutes. They were then rinsed three times with tap water and three times with RO water. They were then placed on a Kimtowel towel in a plastic dish moistened with sterilized water. They were then incubated overnight at 22°C to allow for water absorption.

[0073] 2. Exposure of the seed embryo shoot apex The seed coat of the imbibed seeds was removed under a stereomicroscope, and the coleoptile, first leaf, and second leaf were removed using a Nanopass needle to expose the shoot apical meristem. The embryos were then excised from the endosperm and placed (36 per test condition) on a plastic dish containing MS maltose medium (MS inorganic salts, MS vitamins, 30 g / L maltose, 7 g / L gellan gum, pH 5.8) and incubated for 24 hours at 22°C or 37°C.

[0074] 3. Target Gene and gRNA The target genes for genome editing were the SD1 (semidwarf 1) gene and the AHG1 (ABA-hypersensitive germination 1) gene. The target sequences in these genes are as follows: Target sequence within the wheat SD1 gene: GGGCTGGAGGTCCTCGTCGA (SEQ ID NO: 1) Target sequence within the wheat AHG1 gene: GGACGAGATGGCGCGGATCA (SEQ ID NO: 2).

[0075] 4. Coating of RNP onto Gold Particles To 50 μg of a solution of Streptococcus pyogenes Cas9 protein, 50 μg of single-stranded RNA (IDT, product name: Alt-R CRISPR-Cas9 sgRNA) containing the target sequence and the tracrRNA sequence was added, followed by incubation at 37°C for 5 minutes to form a complex (RNP) between the Cas9 protein and the RNA. To the mixture, 2 μL of Cutsmart buffer (NEB) and 0.8 μL of RNase inhibitor (Takara Bio) were added, and then sterilized Milli-Q water was added to bring the volume to 20 μL. After allowing to stand at room temperature for 10 minutes, 1 / 4 the volume of Transit LT1 (Mirus Bio) was added and mixed. Next, gold particles (InBio Gold, product name: Spherical Gold Particles, particle size 0.6 μm) were added to a concentration of 40 mg / mL, mixed, and then allowed to stand on ice for 10 minutes. The suspension was then spun down (6000 rpm for 5 seconds), the supernatant was removed, and 26 μL of sterilized Milli-Q water was added. The gold particle suspension was then stirred in an ultrasonic cleaner, and 6 μL of the suspension was applied evenly to a 1 cm square hydrophilic film (3M) attached to the center of a macrocarrier, with a diameter of approximately 1 cm, and used in the particle bombardment method described below (enough for four macrocarriers).

[0076] 5. Particle bombardment RNP-coated gold particles were introduced into the shoot apex by particle bombardment under the following conditions. Equipment: PDS-1000 / He (Bio-Rad) Driving pressure: 1300 psi Hitting distance: approx. 6cm Number of shots: 4 After the infusion, the plants were incubated in the dark at 22°C or 7°C for 24 hours. They were then transferred to fresh MS maltose medium and cultured at 22°C under continuous light for two weeks. They were then transferred to potting soil and grown at 22°C under long-day conditions (16 hours light / 8 hours dark) until the fifth leaf emerged (approximately 20 days).

[0077] 6. Genomic DNA Extraction The fifth leaf (3 mm in diameter) was added to 100 μL of DNA extraction buffer (0.1 M Tris-HCl (pH 9.5), 1 M KCl, 10 mM EDTA) and subjected to crushing treatment (2000 rpm for 10 seconds) using a Multi-Bead Shocker (Yasui Kikai). Next, 10 μL of the sample was taken and incubated at 95°C for 10 minutes, after which it was diluted with 40 μL of sterile Milli-Q.

[0078] 7. Mutation Detection (PCR) To amplify the region containing the target sequence in the SD1 gene, PCR was performed using the following primer set. The PCR composition is shown in Table 1. 230429SD1target2 F:CGGACAGCAGCTCCATCATG (SEQ ID NO: 3) 230429SD1target2 R:GGTGTCGCCGATGTTGATGA (SEQ ID NO: 4)

[0079] [Table 1]

[0080] PCR targeting the SD1 gene was carried out by repeating 30 cycles of amplification reaction at 94°C for 2 minutes, followed by 98°C for 10 seconds, 60°C for 30 seconds, and 68°C for 8 seconds.

[0081] To amplify the region containing the target sequence in the AHG1 gene, PCR was performed using the following primer set. The PCR composition is shown in Table 2. 211007AHG1Ex3Univ-F: GACCGGCCGGACGAGATGGC (SEQ ID NO: 5) 211007AHG1Ex3Univ-R:TACCTAGCGCTCGGGACATGGC (SEQ ID NO: 6).

[0082] [Table 2]

[0083] PCR targeting the AHG1 gene was carried out by repeating 30 cycles of amplification reaction at 94°C for 2 minutes, followed by 98°C for 10 seconds, 67°C for 20 seconds, and 68°C for 3 seconds.

[0084] (CAPS processing) The PCR amplification products prepared above were subjected to restriction enzyme treatment under the following conditions, and then electrophoresis was carried out using a microchip electrophoresis apparatus MultiNA (Shimadzu Corporation).

[0085] [Table 3]

[0086] [Table 4]

[0087] During the CAPS treatment, wild-type PCR amplification products are cleaved, but mutated PCR amplification products are not digested by the restriction enzyme. Therefore, if undigested PCR amplification products were observed, it was determined that mutations had been introduced (Figures 1 and 2). The genome editing efficiency was calculated by using the number of treated seed shoot apices as the denominator and the number of individuals determined to have the mutation as the numerator.

[0088] As a result, as is clear from the results shown in Figure 3, when the shoot apex after RNP introduction was treated at a high temperature of 37°C, genome editing efficiency was significantly improved. Furthermore, as shown in Figures 3 and 4, it was revealed that genome editing efficiency was also significantly improved when the shoot apex before and after RNP introduction was treated at a high temperature of 37°C. [Industrial Applicability]

[0089] As described above, the present invention enables more efficient genome editing of plants. Conventional techniques require sophisticated culture systems, such as protoplasts. This makes it difficult to apply the technique to many crops. Furthermore, because genome-edited plants are developed through genetic engineering, the technique is unsuitable for developing crops that are socially acceptable. On the other hand, the present invention enables more efficient genome editing without the need for culture and genetic engineering.

[0090] Therefore, the present invention is useful in, for example, crop breeding, production of useful substances, variety improvement, functional analysis of target genes, and the like.

Claims

1. A method for genome editing of a plant, comprising the following steps (1) and (2): (1) A step of introducing a CRISPR / Cas system into a meristem of a plant shoot capable of forming a shoot by particle bombardment; (2) A step of culturing the meristem into which the CRISPR / Cas system has been introduced in step (1) at high temperature.

2. 2. The method of claim 1, wherein the elevated temperature is 30 to 45°C.

3. The method according to claim 2, wherein the incubation time at high temperature in step (2) is 1 to 30 hours.

4. The method of claim 1 , further comprising the step of culturing the meristem at an elevated temperature prior to step (1).

5. The method according to claim 2, wherein the Cas protein constituting the CRISPR / Cas system is a Cas9 protein or a Cas12 protein.

6. The method according to any one of claims 1 to 5, wherein the meristem is a shoot apex.

7. A method for producing a genome-edited plant, the method comprising the steps of: culturing the meristem cultured at high temperature to obtain a plant body;

Citation Information

Patent Citations

  • Method for editing genome of plant

    JP2017205104A